## gff-version 2 ## source-version tandem repeats finder (TRF) 2.02 ## source-parameters 2 7 7 80 10 50 500 ## conversion-program trf2gff.pl 1.00 ## date Wed Jul 7 11:31:28 1999 ## DNA Adh Adh TRF tandem_repeat 1423 1474 68 . . Period_size 9; Copy Number 5.8; Match_percent 83; Indel_percent 0 Consensus_size 9; Consensus GGTGGTGTC Adh TRF tandem_repeat 10493 10542 84 . . Period_size 23; Copy Number 2.1; Match_percent 92; Indel_percent 3 Consensus_size 24; Consensus TTGGGTTAACATGGGTCAAACACT Adh TRF tandem_repeat 11266 11311 53 . . Period_size 14; Copy Number 3.4; Match_percent 75; Indel_percent 22 Consensus_size 14; Consensus TGCATTTCGCATTT Adh TRF tandem_repeat 28336 28360 50 . . Period_size 2; Copy Number 12.5; Match_percent 100; Indel_percent 0 Consensus_size 2; Consensus TA Adh TRF tandem_repeat 29335 29366 55 . . Period_size 15; Copy Number 2.1; Match_percent 94; Indel_percent 0 Consensus_size 15; Consensus GCTGTGGACGTGGGT Adh TRF tandem_repeat 54212 54236 50 . . Period_size 13; Copy Number 1.9; Match_percent 100; Indel_percent 0 Consensus_size 13; Consensus CAATTGCAATTTG Adh TRF tandem_repeat 66331 66365 61 . . Period_size 16; Copy Number 2.2; Match_percent 94; Indel_percent 0 Consensus_size 16; Consensus CTGAATGGCTGAATGG Adh TRF tandem_repeat 74562 74596 70 . . Period_size 3; Copy Number 11.7; Match_percent 100; Indel_percent 0 Consensus_size 3; Consensus AAT Adh TRF tandem_repeat 82238 82267 51 . . Period_size 6; Copy Number 4.8; Match_percent 95; Indel_percent 4 Consensus_size 6; Consensus TATGTA Adh TRF tandem_repeat 92979 93003 50 . . Period_size 1; Copy Number 25.0; Match_percent 100; Indel_percent 0 Consensus_size 1; Consensus T Adh TRF tandem_repeat 109140 109194 76 . . Period_size 5; Copy Number 10.8; Match_percent 86; Indel_percent 11 Consensus_size 5; Consensus TATAT Adh TRF tandem_repeat 131094 131166 56 . . Period_size 3; Copy Number 24.3; Match_percent 75; Indel_percent 0 Consensus_size 3; Consensus AGC Adh TRF tandem_repeat 135644 135675 55 . . Period_size 12; Copy Number 2.7; Match_percent 90; Indel_percent 0 Consensus_size 12; Consensus TTAAATTATGTA Adh TRF tandem_repeat 172331 172382 59 . . Period_size 18; Copy Number 2.8; Match_percent 76; Indel_percent 2 Consensus_size 18; Consensus CATTGCCACTGCCACTGA Adh TRF tandem_repeat 177054 177078 50 . . Period_size 10; Copy Number 2.5; Match_percent 100; Indel_percent 0 Consensus_size 10; Consensus CGGTTGTTGT Adh TRF tandem_repeat 178716 178746 53 . . Period_size 15; Copy Number 2.1; Match_percent 93; Indel_percent 0 Consensus_size 15; Consensus TTTCGTTCCATTTCG Adh TRF tandem_repeat 189135 189186 59 . . Period_size 19; Copy Number 2.6; Match_percent 81; Indel_percent 6 Consensus_size 19; Consensus AAAGGAGCGAAAGGAGCGA Adh TRF tandem_repeat 200058 200084 54 . . Period_size 3; Copy Number 9.0; Match_percent 100; Indel_percent 0 Consensus_size 3; Consensus ACA Adh TRF tandem_repeat 234430 234470 55 . . Period_size 6; Copy Number 6.8; Match_percent 91; Indel_percent 0 Consensus_size 6; Consensus ATTCAC Adh TRF tandem_repeat 236713 236751 71 . . Period_size 18; Copy Number 2.1; Match_percent 95; Indel_percent 4 Consensus_size 19; Consensus TGGCGCATGATGGGAATGA Adh TRF tandem_repeat 240427 240452 52 . . Period_size 12; Copy Number 2.2; Match_percent 100; Indel_percent 0 Consensus_size 12; Consensus TCGGTCCCGTAG Adh TRF tandem_repeat 254268 254303 54 . . Period_size 10; Copy Number 3.6; Match_percent 84; Indel_percent 0 Consensus_size 10; Consensus GAGTTGAGTT Adh TRF tandem_repeat 254268 254303 54 . . Period_size 15; Copy Number 2.4; Match_percent 90; Indel_percent 0 Consensus_size 15; Consensus GAGTTGAGCTCAGTT Adh TRF tandem_repeat 271285 271309 50 . . Period_size 3; Copy Number 8.3; Match_percent 100; Indel_percent 0 Consensus_size 3; Consensus CTG Adh TRF tandem_repeat 293134 293180 67 . . Period_size 2; Copy Number 23.5; Match_percent 86; Indel_percent 0 Consensus_size 2; Consensus TA Adh TRF tandem_repeat 354397 354431 61 . . Period_size 18; Copy Number 1.9; Match_percent 94; Indel_percent 0 Consensus_size 18; Consensus AGGGTTTGATTTAGGGAC Adh TRF tandem_repeat 354831 354922 94 . . Period_size 12; Copy Number 7.7; Match_percent 83; Indel_percent 0 Consensus_size 12; Consensus TGTTGCTGCTGC Adh TRF tandem_repeat 354837 354922 82 . . Period_size 3; Copy Number 28.7; Match_percent 80; Indel_percent 0 Consensus_size 3; Consensus TGC Adh TRF tandem_repeat 355065 355258 345 . . Period_size 99; Copy Number 2.0; Match_percent 94; Indel_percent 2 Consensus_size 99; Consensus ATTTATGCTCTTATGGCATATACACTGCACTCTATTTATGAGCTGATTTAATGCTATTAGAGCATTTATAAGGCACTTTTGTCAGGCACTTTTTATTTA Adh TRF tandem_repeat 367195 367226 55 . . Period_size 5; Copy Number 6.4; Match_percent 92; Indel_percent 0 Consensus_size 5; Consensus TTCAG Adh TRF tandem_repeat 368001 368026 52 . . Period_size 6; Copy Number 4.3; Match_percent 100; Indel_percent 0 Consensus_size 6; Consensus ATACAG Adh TRF tandem_repeat 368110 368168 82 . . Period_size 6; Copy Number 9.8; Match_percent 84; Indel_percent 0 Consensus_size 6; Consensus ACAGAT Adh TRF tandem_repeat 386164 386197 59 . . Period_size 7; Copy Number 4.9; Match_percent 96; Indel_percent 0 Consensus_size 7; Consensus AAATGCG Adh TRF tandem_repeat 407404 407442 62 . . Period_size 7; Copy Number 5.7; Match_percent 90; Indel_percent 6 Consensus_size 7; Consensus AATAATA Adh TRF tandem_repeat 407402 407451 66 . . Period_size 10; Copy Number 4.8; Match_percent 83; Indel_percent 16 Consensus_size 10; Consensus ATAATAATAA Adh TRF tandem_repeat 415973 416034 88 . . Period_size 24; Copy Number 2.6; Match_percent 89; Indel_percent 0 Consensus_size 24; Consensus GGCACTGGTTTGTCCACATAGTGG Adh TRF tandem_repeat 425533 425570 51 . . Period_size 12; Copy Number 3.1; Match_percent 88; Indel_percent 11 Consensus_size 12; Consensus ATATTATTATTA Adh TRF tandem_repeat 426019 426074 57 . . Period_size 2; Copy Number 30.0; Match_percent 75; Indel_percent 13 Consensus_size 2; Consensus AT Adh TRF tandem_repeat 426015 426074 93 . . Period_size 15; Copy Number 4.0; Match_percent 88; Indel_percent 0 Consensus_size 15; Consensus ATAAATATATAATAT Adh TRF tandem_repeat 426757 426809 61 . . Period_size 15; Copy Number 3.5; Match_percent 84; Indel_percent 2 Consensus_size 15; Consensus GGAGGAGCCGCCGTA Adh TRF tandem_repeat 426810 426853 70 . . Period_size 15; Copy Number 2.9; Match_percent 89; Indel_percent 0 Consensus_size 15; Consensus ATTCCGTGTCCGGAA Adh TRF tandem_repeat 439526 439577 68 . . Period_size 27; Copy Number 1.9; Match_percent 84; Indel_percent 0 Consensus_size 27; Consensus GCGGGACCACTGTGGCCAACGGCGATC Adh TRF tandem_repeat 446338 446371 52 . . Period_size 18; Copy Number 1.9; Match_percent 88; Indel_percent 5 Consensus_size 18; Consensus GCAGCACAATTACAGGCC Adh TRF tandem_repeat 476603 476632 51 . . Period_size 2; Copy Number 15.0; Match_percent 92; Indel_percent 0 Consensus_size 2; Consensus TA Adh TRF tandem_repeat 495027 495079 61 . . Period_size 3; Copy Number 17.7; Match_percent 84; Indel_percent 0 Consensus_size 3; Consensus CAG Adh TRF tandem_repeat 507896 507921 52 . . Period_size 4; Copy Number 6.5; Match_percent 100; Indel_percent 0 Consensus_size 4; Consensus TCCA Adh TRF tandem_repeat 515824 515862 60 . . Period_size 2; Copy Number 19.0; Match_percent 89; Indel_percent 5 Consensus_size 2; Consensus GT Adh TRF tandem_repeat 530227 530254 56 . . Period_size 7; Copy Number 4.0; Match_percent 100; Indel_percent 0 Consensus_size 7; Consensus GAGCATC Adh TRF tandem_repeat 531726 531752 54 . . Period_size 7; Copy Number 3.9; Match_percent 100; Indel_percent 0 Consensus_size 7; Consensus ACTGGAT Adh TRF tandem_repeat 542734 542764 62 . . Period_size 16; Copy Number 1.9; Match_percent 100; Indel_percent 0 Consensus_size 16; Consensus ATTCAATGGTGTTCTA Adh TRF tandem_repeat 543934 543964 53 . . Period_size 2; Copy Number 15.5; Match_percent 93; Indel_percent 0 Consensus_size 2; Consensus TG Adh TRF tandem_repeat 556247 556298 59 . . Period_size 3; Copy Number 17.3; Match_percent 79; Indel_percent 0 Consensus_size 3; Consensus AGC Adh TRF tandem_repeat 581128 581171 54 . . Period_size 6; Copy Number 7.2; Match_percent 82; Indel_percent 12 Consensus_size 6; Consensus CTGTAT Adh TRF tandem_repeat 591168 591192 50 . . Period_size 2; Copy Number 12.5; Match_percent 100; Indel_percent 0 Consensus_size 2; Consensus CA Adh TRF tandem_repeat 599702 599739 51 . . Period_size 12; Copy Number 3.2; Match_percent 81; Indel_percent 11 Consensus_size 12; Consensus TCCCAATCTCAG Adh TRF tandem_repeat 599717 599766 55 . . Period_size 12; Copy Number 4.2; Match_percent 81; Indel_percent 0 Consensus_size 12; Consensus CAATCCCAGTCA Adh TRF tandem_repeat 609695 609731 56 . . Period_size 2; Copy Number 18.5; Match_percent 88; Indel_percent 0 Consensus_size 2; Consensus CA Adh TRF tandem_repeat 627015 627040 52 . . Period_size 5; Copy Number 5.2; Match_percent 100; Indel_percent 0 Consensus_size 5; Consensus CCAAC Adh TRF tandem_repeat 630658 630694 51 . . Period_size 5; Copy Number 7.8; Match_percent 82; Indel_percent 11 Consensus_size 5; Consensus ATTAC Adh TRF tandem_repeat 633557 633599 50 . . Period_size 3; Copy Number 14.3; Match_percent 82; Indel_percent 0 Consensus_size 3; Consensus TGC Adh TRF tandem_repeat 649044 649070 54 . . Period_size 2; Copy Number 13.5; Match_percent 100; Indel_percent 0 Consensus_size 2; Consensus TG Adh TRF tandem_repeat 652588 652639 59 . . Period_size 9; Copy Number 5.8; Match_percent 83; Indel_percent 0 Consensus_size 9; Consensus CAGCAACAA Adh TRF tandem_repeat 652585 652637 79 . . Period_size 12; Copy Number 4.2; Match_percent 86; Indel_percent 13 Consensus_size 12; Consensus CAGCAGCAACAA Adh TRF tandem_repeat 654840 654881 84 . . Period_size 17; Copy Number 2.5; Match_percent 100; Indel_percent 0 Consensus_size 17; Consensus CATTCCATGCTCAAAAT Adh TRF tandem_repeat 655124 655173 66 . . Period_size 21; Copy Number 2.4; Match_percent 83; Indel_percent 6 Consensus_size 21; Consensus GTGGAGGTGGAAGCGGGAAGC Adh TRF tandem_repeat 655735 656675 1634 . . Period_size 225; Copy Number 4.2; Match_percent 95; Indel_percent 0 Consensus_size 225; Consensus GTTATTCCTTCTGTCGTTGTGGGTGCATTTGTGGTGGTCGGTATATTATCAGTGGTAGTAGGAGCAGGTGTGGTTGTTTTCAAGTCTTCAGCTGTTGTAGGAGATGCTGCAGTGGTCGTGATGTCCCTCGTAGTTGTGGAATCAGAGATGGATGTCGTAGTCGTCGTACTTACCAAACATATTGGTAAGTACGGAAAATCTTTACACTGAATTGAGTCCGTTGTA Adh TRF tandem_repeat 669576 669614 60 . . Period_size 3; Copy Number 13.0; Match_percent 88; Indel_percent 0 Consensus_size 3; Consensus GCA Adh TRF tandem_repeat 669816 669847 50 . . Period_size 12; Copy Number 2.6; Match_percent 85; Indel_percent 14 Consensus_size 13; Consensus GCTATTGCCTATT Adh TRF tandem_repeat 704056 704087 55 . . Period_size 5; Copy Number 6.4; Match_percent 92; Indel_percent 0 Consensus_size 5; Consensus TCCAC Adh TRF tandem_repeat 710193 710220 56 . . Period_size 3; Copy Number 9.3; Match_percent 100; Indel_percent 0 Consensus_size 3; Consensus TAT Adh TRF tandem_repeat 711816 711859 61 . . Period_size 6; Copy Number 7.3; Match_percent 84; Indel_percent 0 Consensus_size 6; Consensus TTGTCG Adh TRF tandem_repeat 720535 720575 55 . . Period_size 1; Copy Number 41.0; Match_percent 90; Indel_percent 0 Consensus_size 1; Consensus T Adh TRF tandem_repeat 735327 735355 51 . . Period_size 14; Copy Number 2.0; Match_percent 93; Indel_percent 6 Consensus_size 15; Consensus CGATCGGACGATGGA Adh TRF tandem_repeat 745219 745251 50 . . Period_size 16; Copy Number 2.1; Match_percent 88; Indel_percent 11 Consensus_size 16; Consensus TTTGTAATATTAATAT Adh TRF tandem_repeat 758073 758098 52 . . Period_size 1; Copy Number 26.0; Match_percent 100; Indel_percent 0 Consensus_size 1; Consensus T Adh TRF tandem_repeat 766754 766782 51 . . Period_size 14; Copy Number 2.0; Match_percent 93; Indel_percent 6 Consensus_size 15; Consensus CTTAATTAATGAGCT Adh TRF tandem_repeat 767649 767684 54 . . Period_size 8; Copy Number 4.5; Match_percent 89; Indel_percent 0 Consensus_size 8; Consensus GGATGGTT Adh TRF tandem_repeat 772182 772212 62 . . Period_size 6; Copy Number 5.2; Match_percent 100; Indel_percent 0 Consensus_size 6; Consensus TCGGGA Adh TRF tandem_repeat 773325 773349 50 . . Period_size 6; Copy Number 4.2; Match_percent 100; Indel_percent 0 Consensus_size 6; Consensus AAAGGC Adh TRF tandem_repeat 828833 828882 55 . . Period_size 2; Copy Number 25.0; Match_percent 79; Indel_percent 0 Consensus_size 2; Consensus AC Adh TRF tandem_repeat 833863 833890 56 . . Period_size 13; Copy Number 2.2; Match_percent 100; Indel_percent 0 Consensus_size 13; Consensus ATTCAAATTGAAA Adh TRF tandem_repeat 836531 836555 50 . . Period_size 12; Copy Number 2.1; Match_percent 100; Indel_percent 0 Consensus_size 12; Consensus GCGATCCGGATG Adh TRF tandem_repeat 858058 858090 57 . . Period_size 12; Copy Number 2.7; Match_percent 95; Indel_percent 4 Consensus_size 12; Consensus TTTTTTTTTAAC Adh TRF tandem_repeat 870704 870846 214 . . Period_size 9; Copy Number 15.9; Match_percent 89; Indel_percent 0 Consensus_size 9; Consensus TGTCCGTAA Adh TRF tandem_repeat 875703 875746 79 . . Period_size 18; Copy Number 2.4; Match_percent 96; Indel_percent 0 Consensus_size 18; Consensus TGGTATTGCCAATGGTAT Adh TRF tandem_repeat 877842 877877 63 . . Period_size 6; Copy Number 6.0; Match_percent 93; Indel_percent 0 Consensus_size 6; Consensus TGCAGT Adh TRF tandem_repeat 879111 879147 65 . . Period_size 2; Copy Number 18.5; Match_percent 94; Indel_percent 0 Consensus_size 2; Consensus CT Adh TRF tandem_repeat 883243 883272 51 . . Period_size 7; Copy Number 4.3; Match_percent 91; Indel_percent 0 Consensus_size 7; Consensus GCGGAGG Adh TRF tandem_repeat 883468 883497 60 . . Period_size 12; Copy Number 2.5; Match_percent 100; Indel_percent 0 Consensus_size 12; Consensus TGTGTGCGAGTG Adh TRF tandem_repeat 892148 892187 62 . . Period_size 6; Copy Number 6.7; Match_percent 88; Indel_percent 0 Consensus_size 6; Consensus TTGCTG Adh TRF tandem_repeat 899819 899845 54 . . Period_size 5; Copy Number 5.4; Match_percent 100; Indel_percent 0 Consensus_size 5; Consensus CCAAA Adh TRF tandem_repeat 936152 936184 57 . . Period_size 4; Copy Number 8.2; Match_percent 93; Indel_percent 0 Consensus_size 4; Consensus TATG Adh TRF tandem_repeat 949082 949115 59 . . Period_size 4; Copy Number 8.5; Match_percent 93; Indel_percent 0 Consensus_size 4; Consensus TGGA Adh TRF tandem_repeat 959936 959960 50 . . Period_size 1; Copy Number 25.0; Match_percent 100; Indel_percent 0 Consensus_size 1; Consensus T Adh TRF tandem_repeat 972869 972904 56 . . Period_size 14; Copy Number 2.5; Match_percent 86; Indel_percent 4 Consensus_size 15; Consensus GACCAGTGACCGGTG Adh TRF tandem_repeat 976963 976987 50 . . Period_size 10; Copy Number 2.5; Match_percent 100; Indel_percent 0 Consensus_size 10; Consensus GATGCGATGA Adh TRF tandem_repeat 993381 993447 61 . . Period_size 6; Copy Number 11.7; Match_percent 74; Indel_percent 15 Consensus_size 6; Consensus AGCAAA Adh TRF tandem_repeat 993387 993447 97 . . Period_size 17; Copy Number 3.6; Match_percent 91; Indel_percent 4 Consensus_size 17; Consensus AGCAAAAGCAACAGAAA Adh TRF tandem_repeat 1004719 1004761 50 . . Period_size 9; Copy Number 4.8; Match_percent 82; Indel_percent 0 Consensus_size 9; Consensus CAGCAACAA Adh TRF tandem_repeat 1004895 1004943 62 . . Period_size 3; Copy Number 16.3; Match_percent 82; Indel_percent 0 Consensus_size 3; Consensus CAG Adh TRF tandem_repeat 1008095 1008119 50 . . Period_size 13; Copy Number 1.9; Match_percent 100; Indel_percent 0 Consensus_size 13; Consensus GAGTAGTAGGTCC Adh TRF tandem_repeat 1016065 1016097 57 . . Period_size 15; Copy Number 2.3; Match_percent 94; Indel_percent 5 Consensus_size 14; Consensus AAAAATTGTAAGTA Adh TRF tandem_repeat 1021305 1021365 70 . . Period_size 8; Copy Number 7.6; Match_percent 81; Indel_percent 7 Consensus_size 8; Consensus ACTGAGTG Adh TRF tandem_repeat 1021305 1021365 86 . . Period_size 16; Copy Number 3.8; Match_percent 88; Indel_percent 0 Consensus_size 16; Consensus ACTGAATGACTGAGTG Adh TRF tandem_repeat 1021305 1021365 52 . . Period_size 4; Copy Number 15.2; Match_percent 76; Indel_percent 6 Consensus_size 4; Consensus ACTG Adh TRF tandem_repeat 1022268 1022312 63 . . Period_size 20; Copy Number 2.2; Match_percent 88; Indel_percent 0 Consensus_size 20; Consensus TGACTAACCCACCAACTGAC Adh TRF tandem_repeat 1036671 1036700 51 . . Period_size 7; Copy Number 4.3; Match_percent 91; Indel_percent 0 Consensus_size 7; Consensus TCCTGGC Adh TRF tandem_repeat 1054682 1054708 54 . . Period_size 5; Copy Number 5.4; Match_percent 100; Indel_percent 0 Consensus_size 5; Consensus GAACT Adh TRF tandem_repeat 1064007 1064032 52 . . Period_size 8; Copy Number 3.2; Match_percent 100; Indel_percent 0 Consensus_size 8; Consensus CCATATCG Adh TRF tandem_repeat 1064744 1064778 52 . . Period_size 12; Copy Number 2.9; Match_percent 82; Indel_percent 0 Consensus_size 12; Consensus CAATCAGTCAGT Adh TRF tandem_repeat 1070139 1070168 51 . . Period_size 9; Copy Number 3.2; Match_percent 95; Indel_percent 4 Consensus_size 9; Consensus TTTTTATTC Adh TRF tandem_repeat 1070495 1070528 50 . . Period_size 5; Copy Number 6.8; Match_percent 86; Indel_percent 0 Consensus_size 5; Consensus CGAGT Adh TRF tandem_repeat 1072955 1072985 53 . . Period_size 16; Copy Number 1.9; Match_percent 93; Indel_percent 0 Consensus_size 16; Consensus GGTGGTTCAGTGGTTT Adh TRF tandem_repeat 1079614 1079643 60 . . Period_size 4; Copy Number 7.5; Match_percent 100; Indel_percent 0 Consensus_size 4; Consensus ATGA Adh TRF tandem_repeat 1081006 1081059 72 . . Period_size 12; Copy Number 4.5; Match_percent 85; Indel_percent 0 Consensus_size 12; Consensus CGCGGATGTGTG Adh TRF tandem_repeat 1081006 1081059 90 . . Period_size 24; Copy Number 2.2; Match_percent 93; Indel_percent 0 Consensus_size 24; Consensus CGCGGATGTGTGCGCGGATGGGAG Adh TRF tandem_repeat 1095224 1095260 51 . . Period_size 5; Copy Number 7.6; Match_percent 85; Indel_percent 14 Consensus_size 5; Consensus GTTGT Adh TRF tandem_repeat 1099411 1099459 71 . . Period_size 7; Copy Number 7.0; Match_percent 85; Indel_percent 0 Consensus_size 7; Consensus TGAGGAC Adh TRF tandem_repeat 1099407 1099459 106 . . Period_size 14; Copy Number 3.8; Match_percent 100; Indel_percent 0 Consensus_size 14; Consensus GGATTGAGGACTGA Adh TRF tandem_repeat 1105993 1106033 64 . . Period_size 18; Copy Number 2.3; Match_percent 91; Indel_percent 0 Consensus_size 18; Consensus ATCTGCATCTCTATCTGT Adh TRF tandem_repeat 1106229 1106260 55 . . Period_size 7; Copy Number 4.6; Match_percent 92; Indel_percent 0 Consensus_size 7; Consensus TGCAAGT Adh TRF tandem_repeat 1109743 1109769 54 . . Period_size 6; Copy Number 4.5; Match_percent 100; Indel_percent 0 Consensus_size 6; Consensus ATACTA Adh TRF tandem_repeat 1112646 1112683 76 . . Period_size 1; Copy Number 38.0; Match_percent 100; Indel_percent 0 Consensus_size 1; Consensus T Adh TRF tandem_repeat 1121317 1121349 57 . . Period_size 4; Copy Number 8.2; Match_percent 93; Indel_percent 0 Consensus_size 4; Consensus GACA Adh TRF tandem_repeat 1126403 1126433 53 . . Period_size 16; Copy Number 1.9; Match_percent 93; Indel_percent 0 Consensus_size 16; Consensus GAGACTGCGAGACTGA Adh TRF tandem_repeat 1143879 1143913 61 . . Period_size 18; Copy Number 1.9; Match_percent 94; Indel_percent 0 Consensus_size 18; Consensus AGGGTTTGATTTAGGGAC Adh TRF tandem_repeat 1144313 1144404 94 . . Period_size 12; Copy Number 7.7; Match_percent 83; Indel_percent 0 Consensus_size 12; Consensus TGTTGCTGCTGC Adh TRF tandem_repeat 1144319 1144404 82 . . Period_size 3; Copy Number 28.7; Match_percent 80; Indel_percent 0 Consensus_size 3; Consensus TGC Adh TRF tandem_repeat 1144550 1144743 345 . . Period_size 99; Copy Number 2.0; Match_percent 94; Indel_percent 2 Consensus_size 99; Consensus ATTTATGCTCTTATGGCATATACACTGCACTCTATTTATGAGCTGATTTAATGCTATTAGAGCATTTATAAGGCACTTTTGTCAGGCACTTTTTATTTA Adh TRF tandem_repeat 1172531 1172585 94 . . Period_size 2; Copy Number 27.5; Match_percent 92; Indel_percent 7 Consensus_size 2; Consensus TA Adh TRF tandem_repeat 1178536 1178560 50 . . Period_size 1; Copy Number 25.0; Match_percent 100; Indel_percent 0 Consensus_size 1; Consensus T Adh TRF tandem_repeat 1183224 1183262 53 . . Period_size 17; Copy Number 2.3; Match_percent 82; Indel_percent 8 Consensus_size 17; Consensus ATATGTATTTATACTTC Adh TRF tandem_repeat 1187932 1187970 62 . . Period_size 16; Copy Number 2.5; Match_percent 91; Indel_percent 4 Consensus_size 16; Consensus ATTCTAATAAAAACCC Adh TRF tandem_repeat 1193722 1193759 67 . . Period_size 12; Copy Number 3.2; Match_percent 96; Indel_percent 0 Consensus_size 12; Consensus TTTGGTTTGGTT Adh TRF tandem_repeat 1206620 1206742 129 . . Period_size 48; Copy Number 2.6; Match_percent 78; Indel_percent 0 Consensus_size 48; Consensus GATTCGGTGGATTCGGAGGATTCGGAGAACAACAACAGCAGCAAGAAA Adh TRF tandem_repeat 1231161 1231192 55 . . Period_size 12; Copy Number 2.7; Match_percent 95; Indel_percent 0 Consensus_size 12; Consensus CCGAATCCACCT Adh TRF tandem_repeat 1231173 1231327 175 . . Period_size 45; Copy Number 3.2; Match_percent 74; Indel_percent 15 Consensus_size 45; Consensus CCGAATCCACCTCCAAATCCTCCTTGCTGCTGCTGCTGCTGATCA Adh TRF tandem_repeat 1231139 1231291 249 . . Period_size 57; Copy Number 2.7; Match_percent 92; Indel_percent 3 Consensus_size 57; Consensus TTGCTGCTGCTGCTGCTGATCACCGAATCCACCTCCGAATCCACCGCCAAATCCTCC Adh TRF tandem_repeat 1233125 1233272 197 . . Period_size 30; Copy Number 4.8; Match_percent 86; Indel_percent 4 Consensus_size 30; Consensus CAGCAAGGATTCGGACAAGGTGGACACGGC Adh TRF tandem_repeat 1233493 1233531 55 . . Period_size 5; Copy Number 8.2; Match_percent 83; Indel_percent 11 Consensus_size 5; Consensus TATTA Adh TRF tandem_repeat 1233498 1233537 55 . . Period_size 8; Copy Number 5.1; Match_percent 84; Indel_percent 6 Consensus_size 8; Consensus TATTATAT Adh TRF tandem_repeat 1241220 1241251 64 . . Period_size 14; Copy Number 2.3; Match_percent 100; Indel_percent 0 Consensus_size 14; Consensus TAAAGAATCTCACA Adh TRF tandem_repeat 1249520 1249553 50 . . Period_size 15; Copy Number 2.3; Match_percent 89; Indel_percent 0 Consensus_size 15; Consensus AGAAGAAGTGCTTTA Adh TRF tandem_repeat 1278306 1278348 50 . . Period_size 8; Copy Number 5.1; Match_percent 83; Indel_percent 10 Consensus_size 8; Consensus TATATGTA Adh TRF tandem_repeat 1281321 1281346 52 . . Period_size 13; Copy Number 2.0; Match_percent 100; Indel_percent 0 Consensus_size 13; Consensus AAATTGTTTTATA Adh TRF tandem_repeat 1295917 1296081 118 . . Period_size 36; Copy Number 4.6; Match_percent 70; Indel_percent 10 Consensus_size 35; Consensus TTCCTTACTATCATTCGGGAATTGTATTTGTCGCA Adh TRF tandem_repeat 1295883 1296153 476 . . Period_size 108; Copy Number 2.5; Match_percent 95; Indel_percent 1 Consensus_size 108; Consensus TTTTCCTACTGTCATTCGGAAAATTTTTATTTTCACTTTCCTTACTATCTTTCAGGAATTGTATGTTGTCGCATTCCTTACTCTCATTCGGGAACTCTGTTTGTATTA Adh TRF tandem_repeat 1298339 1298401 99 . . Period_size 26; Copy Number 2.3; Match_percent 91; Indel_percent 5 Consensus_size 26; Consensus ATTTCACAAGAATGTGAAAAAAAGCT Adh TRF tandem_repeat 1301351 1301383 66 . . Period_size 17; Copy Number 1.9; Match_percent 100; Indel_percent 0 Consensus_size 17; Consensus ACAGAAGGTGAAGATCA Adh TRF tandem_repeat 1308935 1308967 57 . . Period_size 11; Copy Number 3.0; Match_percent 95; Indel_percent 0 Consensus_size 11; Consensus TGGGTCGATGG Adh TRF tandem_repeat 1369864 1369893 51 . . Period_size 13; Copy Number 2.3; Match_percent 94; Indel_percent 0 Consensus_size 13; Consensus AAATATTAATTCG Adh TRF tandem_repeat 1370382 1370413 64 . . Period_size 12; Copy Number 2.7; Match_percent 100; Indel_percent 0 Consensus_size 12; Consensus CAGCAGCACAAG Adh TRF tandem_repeat 1383109 1383133 50 . . Period_size 2; Copy Number 12.5; Match_percent 100; Indel_percent 0 Consensus_size 2; Consensus CA Adh TRF tandem_repeat 1388183 1388207 50 . . Period_size 1; Copy Number 25.0; Match_percent 100; Indel_percent 0 Consensus_size 1; Consensus T Adh TRF tandem_repeat 1389000 1389024 50 . . Period_size 13; Copy Number 1.9; Match_percent 100; Indel_percent 0 Consensus_size 13; Consensus TAGAAAACAAAGA Adh TRF tandem_repeat 1397579 1397609 55 . . Period_size 15; Copy Number 2.0; Match_percent 93; Indel_percent 6 Consensus_size 16; Consensus AAAATATTTTAGCTAC Adh TRF tandem_repeat 1398631 1398664 50 . . Period_size 6; Copy Number 5.7; Match_percent 85; Indel_percent 0 Consensus_size 6; Consensus CCCATG Adh TRF tandem_repeat 1416062 1416119 82 . . Period_size 18; Copy Number 3.2; Match_percent 87; Indel_percent 7 Consensus_size 18; Consensus ATTCCTCCACAACCAGCT Adh TRF tandem_repeat 1452268 1452296 51 . . Period_size 12; Copy Number 2.3; Match_percent 94; Indel_percent 5 Consensus_size 13; Consensus TGCCAGGACAACG Adh TRF tandem_repeat 1453157 1453187 53 . . Period_size 2; Copy Number 15.5; Match_percent 93; Indel_percent 0 Consensus_size 2; Consensus TA Adh TRF tandem_repeat 1459631 1459666 54 . . Period_size 14; Copy Number 2.6; Match_percent 90; Indel_percent 0 Consensus_size 14; Consensus TTGTATCTCGACAT Adh TRF tandem_repeat 1463470 1463495 52 . . Period_size 5; Copy Number 5.2; Match_percent 100; Indel_percent 0 Consensus_size 5; Consensus TTCAG Adh TRF tandem_repeat 1473545 1473601 60 . . Period_size 5; Copy Number 11.4; Match_percent 84; Indel_percent 0 Consensus_size 5; Consensus GGATT Adh TRF tandem_repeat 1474088 1474113 52 . . Period_size 2; Copy Number 13.0; Match_percent 100; Indel_percent 0 Consensus_size 2; Consensus TA Adh TRF tandem_repeat 1474112 1474339 420 . . Period_size 113; Copy Number 2.0; Match_percent 96; Indel_percent 0 Consensus_size 113; Consensus TAAGTTAAGAACCCTCTTCTTGCGATCTTCGTCAGGACTCACCAGCGCTCGGCTCTCGTGTTTTCGGGCCCCGTCAGCAGGCGACTCGGGGCCTGTCTAGGAACATGTTCGTG Adh TRF tandem_repeat 1480217 1480252 72 . . Period_size 1; Copy Number 36.0; Match_percent 100; Indel_percent 0 Consensus_size 1; Consensus A Adh TRF tandem_repeat 1480262 1480316 56 . . Period_size 12; Copy Number 4.6; Match_percent 82; Indel_percent 13 Consensus_size 11; Consensus AAATACAAAAA Adh TRF tandem_repeat 1481117 1481342 416 . . Period_size 113; Copy Number 2.0; Match_percent 96; Indel_percent 0 Consensus_size 113; Consensus AGTTAAGAACCCTCTTCTTGCGATCTTCGTCAGGACTCACCAGCGCTCGGCTCTCGTGTTTTCGGGCCCCGTCAGCAGGCGACTCGGGGCCTGTCTAGGAACATGTTCGTGTA Adh TRF tandem_repeat 1486616 1486669 81 . . Period_size 26; Copy Number 2.1; Match_percent 89; Indel_percent 0 Consensus_size 26; Consensus TTTTATTTATATTGCTACAGAGAAAC Adh TRF tandem_repeat 1497094 1497133 71 . . Period_size 19; Copy Number 2.1; Match_percent 95; Indel_percent 0 Consensus_size 19; Consensus ACACTTAAAAAAATACTAA Adh TRF tandem_repeat 1497979 1498010 55 . . Period_size 15; Copy Number 2.1; Match_percent 94; Indel_percent 0 Consensus_size 15; Consensus AGGCACGCGAGGAGC Adh TRF tandem_repeat 1503315 1503343 58 . . Period_size 2; Copy Number 14.5; Match_percent 100; Indel_percent 0 Consensus_size 2; Consensus TC Adh TRF tandem_repeat 1510588 1510627 62 . . Period_size 6; Copy Number 6.7; Match_percent 97; Indel_percent 0 Consensus_size 6; Consensus TATTTG Adh TRF tandem_repeat 1517574 1517605 50 . . Period_size 12; Copy Number 2.6; Match_percent 85; Indel_percent 14 Consensus_size 13; Consensus AATAAAGATGTAA Adh TRF tandem_repeat 1524577 1524613 60 . . Period_size 18; Copy Number 1.9; Match_percent 89; Indel_percent 10 Consensus_size 20; Consensus ACAAATTCGTTTCTTAAAAT Adh TRF tandem_repeat 1558385 1558499 167 . . Period_size 21; Copy Number 5.5; Match_percent 91; Indel_percent 0 Consensus_size 21; Consensus CTTCCGCGGTGGAGAAGGCGG Adh TRF tandem_repeat 1561993 1562077 170 . . Period_size 39; Copy Number 2.2; Match_percent 100; Indel_percent 0 Consensus_size 39; Consensus TGAACGTCGTGGAAGACTAGATCGGGAGGAACGCGGCGG Adh TRF tandem_repeat 1584639 1584707 111 . . Period_size 21; Copy Number 3.3; Match_percent 93; Indel_percent 0 Consensus_size 21; Consensus AAGGAGGAGAAGGAGCGTGCT Adh TRF tandem_repeat 1588215 1588257 59 . . Period_size 3; Copy Number 14.3; Match_percent 85; Indel_percent 0 Consensus_size 3; Consensus GAT Adh TRF tandem_repeat 1604333 1604409 73 . . Period_size 6; Copy Number 12.8; Match_percent 76; Indel_percent 0 Consensus_size 6; Consensus GGGACA Adh TRF tandem_repeat 1604321 1604396 91 . . Period_size 24; Copy Number 3.2; Match_percent 83; Indel_percent 5 Consensus_size 24; Consensus GGGAACGAGACCGGGACAGAGACA Adh TRF tandem_repeat 1604335 1604405 88 . . Period_size 18; Copy Number 3.9; Match_percent 79; Indel_percent 0 Consensus_size 18; Consensus GACCGGGACAGGGACAGA Adh TRF tandem_repeat 1604329 1604409 99 . . Period_size 12; Copy Number 6.8; Match_percent 85; Indel_percent 0 Consensus_size 12; Consensus GACCGGGACAGA Adh TRF tandem_repeat 1614603 1614643 59 . . Period_size 5; Copy Number 8.6; Match_percent 84; Indel_percent 10 Consensus_size 5; Consensus CTGTT Adh TRF tandem_repeat 1614598 1614643 58 . . Period_size 15; Copy Number 3.3; Match_percent 82; Indel_percent 8 Consensus_size 14; Consensus TCTGTCTGTTCTGT Adh TRF tandem_repeat 1617132 1617172 52 . . Period_size 13; Copy Number 3.1; Match_percent 80; Indel_percent 13 Consensus_size 14; Consensus CAACTGTGCAACAC Adh TRF tandem_repeat 1617125 1617193 79 . . Period_size 26; Copy Number 2.7; Match_percent 82; Indel_percent 6 Consensus_size 26; Consensus GCAACAGCAACGTGCAACACCAATGG Adh TRF tandem_repeat 1644249 1644287 51 . . Period_size 7; Copy Number 5.6; Match_percent 84; Indel_percent 0 Consensus_size 7; Consensus GACGCAG Adh TRF tandem_repeat 1683100 1683129 51 . . Period_size 16; Copy Number 1.9; Match_percent 93; Indel_percent 6 Consensus_size 15; Consensus GACGAGGGCACCGAA Adh TRF tandem_repeat 1686677 1687141 930 . . Period_size 231; Copy Number 2.0; Match_percent 100; Indel_percent 0 Consensus_size 231; Consensus TCGGAAAATTATTTTTCCCTCTGTCTGTAATAAAATAATTTTATATGATTACAAGAAATATAAATCCTATTGAAAACATTCGACTCAGGCTTGTATTTCAAAAGGAGCTTGGCCAAAATGGTTTGGCATGCCGGTAGAAATTGACAAGACAAATAATAAAAAAAAGAGAGTCGATTTCCTCGGCTATCTGATACCCTGTACTCAGCGTTAGAGTGGGTAAGATGCACAATC Adh TRF tandem_repeat 1698003 1698064 79 . . Period_size 4; Copy Number 15.5; Match_percent 82; Indel_percent 0 Consensus_size 4; Consensus ACCA Adh TRF tandem_repeat 1698192 1698227 54 . . Period_size 9; Copy Number 4.0; Match_percent 85; Indel_percent 0 Consensus_size 9; Consensus GCAGCACCA Adh TRF tandem_repeat 1705346 1705372 54 . . Period_size 14; Copy Number 1.9; Match_percent 100; Indel_percent 0 Consensus_size 14; Consensus CTCTGGACTTTGGA Adh TRF tandem_repeat 1709366 1709404 51 . . Period_size 6; Copy Number 6.5; Match_percent 87; Indel_percent 0 Consensus_size 6; Consensus ACTCCC Adh TRF tandem_repeat 1711879 1711912 59 . . Period_size 2; Copy Number 17.0; Match_percent 93; Indel_percent 0 Consensus_size 2; Consensus GT Adh TRF tandem_repeat 1715744 1715779 51 . . Period_size 13; Copy Number 2.8; Match_percent 84; Indel_percent 16 Consensus_size 14; Consensus TTGTATTGGCCCTG Adh TRF tandem_repeat 1723551 1723584 68 . . Period_size 17; Copy Number 2.0; Match_percent 100; Indel_percent 0 Consensus_size 17; Consensus ACTACTTTATATAAATT Adh TRF tandem_repeat 1728633 1728685 52 . . Period_size 3; Copy Number 17.0; Match_percent 76; Indel_percent 7 Consensus_size 3; Consensus GCA Adh TRF tandem_repeat 1732811 1732837 54 . . Period_size 9; Copy Number 3.0; Match_percent 100; Indel_percent 0 Consensus_size 9; Consensus CATCCTCCA Adh TRF tandem_repeat 1732930 1732961 55 . . Period_size 6; Copy Number 5.3; Match_percent 92; Indel_percent 0 Consensus_size 6; Consensus GCAACT Adh TRF tandem_repeat 1736761 1736791 53 . . Period_size 14; Copy Number 2.2; Match_percent 94; Indel_percent 0 Consensus_size 14; Consensus GTGCGTGGGTGGGC Adh TRF tandem_repeat 1739991 1740037 85 . . Period_size 22; Copy Number 2.1; Match_percent 96; Indel_percent 0 Consensus_size 22; Consensus AATAAACTAAAAATTAATATTT Adh TRF tandem_repeat 1740127 1740152 52 . . Period_size 10; Copy Number 2.6; Match_percent 100; Indel_percent 0 Consensus_size 10; Consensus CACTTTTTAC Adh TRF tandem_repeat 1744038 1744094 60 . . Period_size 7; Copy Number 8.1; Match_percent 88; Indel_percent 0 Consensus_size 7; Consensus AAAACCA Adh TRF tandem_repeat 1750886 1750922 67 . . Period_size 18; Copy Number 2.0; Match_percent 94; Indel_percent 5 Consensus_size 19; Consensus TTAAAACTAGTTCATTTCA Adh TRF tandem_repeat 1768692 1768743 61 . . Period_size 7; Copy Number 7.6; Match_percent 78; Indel_percent 4 Consensus_size 7; Consensus ACATTCA Adh TRF tandem_repeat 1768693 1768748 69 . . Period_size 14; Copy Number 4.1; Match_percent 83; Indel_percent 2 Consensus_size 14; Consensus CATTCAACATTCAG Adh TRF tandem_repeat 1773901 1773930 51 . . Period_size 6; Copy Number 5.0; Match_percent 95; Indel_percent 0 Consensus_size 6; Consensus CAACTG Adh TRF tandem_repeat 1783205 1783248 63 . . Period_size 6; Copy Number 7.3; Match_percent 85; Indel_percent 10 Consensus_size 6; Consensus CCCAGT Adh TRF tandem_repeat 1787299 1787326 56 . . Period_size 13; Copy Number 2.2; Match_percent 100; Indel_percent 0 Consensus_size 13; Consensus ATCTATATAATCT Adh TRF tandem_repeat 1787855 1787888 50 . . Period_size 12; Copy Number 2.8; Match_percent 90; Indel_percent 0 Consensus_size 12; Consensus CATTACCAACCG Adh TRF tandem_repeat 1819458 1819487 51 . . Period_size 6; Copy Number 5.0; Match_percent 91; Indel_percent 0 Consensus_size 6; Consensus GTCCAT Adh TRF tandem_repeat 1822078 1822107 60 . . Period_size 15; Copy Number 2.0; Match_percent 100; Indel_percent 0 Consensus_size 15; Consensus CAAAGTTTGCTTAAC Adh TRF tandem_repeat 1837031 1837072 68 . . Period_size 7; Copy Number 6.1; Match_percent 88; Indel_percent 5 Consensus_size 7; Consensus GGGTATG Adh TRF tandem_repeat 1837031 1837065 52 . . Period_size 13; Copy Number 2.6; Match_percent 90; Indel_percent 4 Consensus_size 13; Consensus GGGTATGGATATG Adh TRF tandem_repeat 1837034 1837073 80 . . Period_size 20; Copy Number 2.0; Match_percent 100; Indel_percent 0 Consensus_size 20; Consensus TATGGGGTATGGGGTATGGA Adh TRF tandem_repeat 1865544 1865596 65 . . Period_size 13; Copy Number 4.2; Match_percent 79; Indel_percent 13 Consensus_size 13; Consensus TTTGTATATTATA Adh TRF tandem_repeat 1870671 1870699 51 . . Period_size 12; Copy Number 2.3; Match_percent 94; Indel_percent 5 Consensus_size 13; Consensus TAAAAAGTTTGAT Adh TRF tandem_repeat 1872504 1872539 63 . . Period_size 14; Copy Number 2.6; Match_percent 95; Indel_percent 0 Consensus_size 14; Consensus TCCCAGTTCCAAGT Adh TRF tandem_repeat 1883440 1883476 65 . . Period_size 17; Copy Number 2.2; Match_percent 95; Indel_percent 0 Consensus_size 17; Consensus AATTTAATATATAATTT Adh TRF tandem_repeat 1885100 1885139 53 . . Period_size 9; Copy Number 4.4; Match_percent 80; Indel_percent 0 Consensus_size 9; Consensus CGTCGTCGC Adh TRF tandem_repeat 1900736 1900766 53 . . Period_size 6; Copy Number 5.2; Match_percent 92; Indel_percent 0 Consensus_size 6; Consensus AATTGC Adh TRF tandem_repeat 1911264 1911290 54 . . Period_size 12; Copy Number 2.2; Match_percent 100; Indel_percent 0 Consensus_size 12; Consensus AAAAATGCATTT Adh TRF tandem_repeat 1938674 1938710 65 . . Period_size 12; Copy Number 3.1; Match_percent 96; Indel_percent 0 Consensus_size 12; Consensus ATAATTATAACC Adh TRF tandem_repeat 1947505 1947547 50 . . Period_size 6; Copy Number 7.2; Match_percent 83; Indel_percent 0 Consensus_size 6; Consensus CATGTC Adh TRF tandem_repeat 1957527 1957584 55 . . Period_size 6; Copy Number 9.7; Match_percent 79; Indel_percent 5 Consensus_size 6; Consensus CCAAAG Adh TRF tandem_repeat 1957527 1957585 64 . . Period_size 11; Copy Number 5.0; Match_percent 80; Indel_percent 12 Consensus_size 11; Consensus CCAAAGCCAAG Adh TRF tandem_repeat 1977435 1977459 50 . . Period_size 13; Copy Number 1.9; Match_percent 100; Indel_percent 0 Consensus_size 13; Consensus GATCATTGCACCG Adh TRF tandem_repeat 2003999 2004062 119 . . Period_size 31; Copy Number 2.1; Match_percent 96; Indel_percent 0 Consensus_size 31; Consensus CCCGCCCACAGTGAGAAATGTGTACTAATTT Adh TRF tandem_repeat 2006358 2006387 51 . . Period_size 2; Copy Number 15.0; Match_percent 92; Indel_percent 0 Consensus_size 2; Consensus CA Adh TRF tandem_repeat 2023907 2023937 62 . . Period_size 15; Copy Number 2.1; Match_percent 100; Indel_percent 0 Consensus_size 15; Consensus TGGAGTATATATTCG Adh TRF tandem_repeat 2026009 2026033 50 . . Period_size 9; Copy Number 2.8; Match_percent 100; Indel_percent 0 Consensus_size 9; Consensus CACCGAACA Adh TRF tandem_repeat 2033746 2033775 51 . . Period_size 6; Copy Number 5.0; Match_percent 91; Indel_percent 0 Consensus_size 6; Consensus AGCTGG Adh TRF tandem_repeat 2126704 2126735 55 . . Period_size 15; Copy Number 2.2; Match_percent 94; Indel_percent 5 Consensus_size 14; Consensus CGCTCACAAAAGCA Adh TRF tandem_repeat 2146664 2146702 60 . . Period_size 20; Copy Number 1.9; Match_percent 89; Indel_percent 0 Consensus_size 20; Consensus GTGATGCGATGCGATGCAAT Adh TRF tandem_repeat 2147202 2147226 50 . . Period_size 13; Copy Number 1.9; Match_percent 100; Indel_percent 0 Consensus_size 13; Consensus GAATTATCAATGT Adh TRF tandem_repeat 2159937 2159963 54 . . Period_size 2; Copy Number 13.5; Match_percent 100; Indel_percent 0 Consensus_size 2; Consensus CA Adh TRF tandem_repeat 2189123 2189147 50 . . Period_size 13; Copy Number 1.9; Match_percent 100; Indel_percent 0 Consensus_size 13; Consensus AATTAATAGATTA Adh TRF tandem_repeat 2191532 2191557 52 . . Period_size 3; Copy Number 8.7; Match_percent 100; Indel_percent 0 Consensus_size 3; Consensus TGA Adh TRF tandem_repeat 2202160 2202194 54 . . Period_size 17; Copy Number 2.1; Match_percent 89; Indel_percent 5 Consensus_size 17; Consensus GTTTTAAGACTAGTATA Adh TRF tandem_repeat 2214721 2214877 104 . . Period_size 3; Copy Number 53.0; Match_percent 75; Indel_percent 5 Consensus_size 3; Consensus ATA Adh TRF tandem_repeat 2215406 2215454 89 . . Period_size 4; Copy Number 12.2; Match_percent 95; Indel_percent 0 Consensus_size 4; Consensus GATG Adh TRF tandem_repeat 2215825 2215876 77 . . Period_size 3; Copy Number 17.3; Match_percent 87; Indel_percent 0 Consensus_size 3; Consensus TAA Adh TRF tandem_repeat 2227068 2227112 72 . . Period_size 11; Copy Number 4.1; Match_percent 91; Indel_percent 0 Consensus_size 11; Consensus AAGGGGGTAGC Adh TRF tandem_repeat 2227058 2227112 76 . . Period_size 22; Copy Number 2.5; Match_percent 85; Indel_percent 8 Consensus_size 22; Consensus GAGGGTAGCAAGGGGGTAGCAA Adh TRF tandem_repeat 2249721 2249747 54 . . Period_size 14; Copy Number 1.9; Match_percent 100; Indel_percent 0 Consensus_size 14; Consensus TTATATATTAAAGC Adh TRF tandem_repeat 2259275 2259309 54 . . Period_size 17; Copy Number 2.0; Match_percent 88; Indel_percent 5 Consensus_size 18; Consensus TAAATTAAGCCTTGTAAT Adh TRF tandem_repeat 2293699 2293728 53 . . Period_size 13; Copy Number 2.4; Match_percent 94; Indel_percent 5 Consensus_size 13; Consensus ATAGATATGGTTT Adh TRF tandem_repeat 2359376 2359421 56 . . Period_size 11; Copy Number 4.0; Match_percent 81; Indel_percent 10 Consensus_size 11; Consensus TATATATTTTT Adh TRF tandem_repeat 2362340 2362365 52 . . Period_size 9; Copy Number 2.9; Match_percent 100; Indel_percent 0 Consensus_size 9; Consensus AGCAGCACA Adh TRF tandem_repeat 2366112 2366153 50 . . Period_size 6; Copy Number 7.0; Match_percent 78; Indel_percent 10 Consensus_size 6; Consensus TGTCCA Adh TRF tandem_repeat 2375469 2376668 2240 . . Period_size 228; Copy Number 5.3; Match_percent 97; Indel_percent 0 Consensus_size 228; Consensus ATTCCAAATGTAGGCCAAGGAAACAGAGGGAATAGATATGATCCAAATCCGGAAATCGGAGCAGTTCCAGTCGGAAATCCTATTCCGAATGAAGGCAATGCATTTGGCGGTCGTGGATATGATTTAAATGAAATCCAAAAACATAATCAAGGTGGAAGATACATTCCACATGTAGGTCATGGAAATGGTCCCAATGCACCTAAAGAACCTCTTAAAATCGGAGGAAAT Adh TRF tandem_repeat 2405834 2405892 63 . . Period_size 7; Copy Number 8.9; Match_percent 80; Indel_percent 15 Consensus_size 7; Consensus TATTATA Adh TRF tandem_repeat 2410580 2410607 56 . . Period_size 14; Copy Number 2.0; Match_percent 100; Indel_percent 0 Consensus_size 14; Consensus GCCAAAGCGAAAAA Adh TRF tandem_repeat 2424794 2424818 50 . . Period_size 13; Copy Number 1.9; Match_percent 100; Indel_percent 0 Consensus_size 13; Consensus ATAGTGGTTTGAG Adh TRF tandem_repeat 2429836 2429865 53 . . Period_size 14; Copy Number 2.1; Match_percent 93; Indel_percent 6 Consensus_size 15; Consensus TTAATTCAATAATAT Adh TRF tandem_repeat 2435866 2435908 50 . . Period_size 8; Copy Number 5.4; Match_percent 80; Indel_percent 0 Consensus_size 8; Consensus TGACTAGA Adh TRF tandem_repeat 2443547 2443579 57 . . Period_size 10; Copy Number 3.3; Match_percent 91; Indel_percent 0 Consensus_size 10; Consensus AGGATATGCC Adh TRF tandem_repeat 2444339 2444363 50 . . Period_size 2; Copy Number 12.5; Match_percent 100; Indel_percent 0 Consensus_size 2; Consensus GT Adh TRF tandem_repeat 2452513 2452567 58 . . Period_size 12; Copy Number 4.6; Match_percent 81; Indel_percent 4 Consensus_size 12; Consensus ATCCGCCACATG Adh TRF tandem_repeat 2454294 2454323 53 . . Period_size 13; Copy Number 2.2; Match_percent 94; Indel_percent 5 Consensus_size 14; Consensus TTTATAAAATTTTA Adh TRF tandem_repeat 2465248 2465283 54 . . Period_size 18; Copy Number 2.0; Match_percent 88; Indel_percent 0 Consensus_size 18; Consensus CCGCCATCATCATGATCG Adh TRF tandem_repeat 2476796 2476845 68 . . Period_size 13; Copy Number 3.7; Match_percent 84; Indel_percent 7 Consensus_size 14; Consensus ATTATATTTTACTT Adh TRF tandem_repeat 2499015 2499060 69 . . Period_size 19; Copy Number 2.3; Match_percent 88; Indel_percent 7 Consensus_size 21; Consensus AAGCAGTGGGAAGGGGAAACC Adh TRF tandem_repeat 2500796 2500828 57 . . Period_size 3; Copy Number 11.0; Match_percent 93; Indel_percent 0 Consensus_size 3; Consensus GGA Adh TRF tandem_repeat 2512602 2512646 54 . . Period_size 5; Copy Number 9.0; Match_percent 87; Indel_percent 0 Consensus_size 5; Consensus CTGAA Adh TRF tandem_repeat 2564818 2564865 60 . . Period_size 23; Copy Number 2.1; Match_percent 81; Indel_percent 11 Consensus_size 22; Consensus CAAAAACTAAAAGTTATTCAAG Adh TRF tandem_repeat 2566337 2566364 56 . . Period_size 13; Copy Number 2.2; Match_percent 100; Indel_percent 0 Consensus_size 13; Consensus ATGTGCGGTAAAT Adh TRF tandem_repeat 2570414 2570442 58 . . Period_size 2; Copy Number 14.5; Match_percent 100; Indel_percent 0 Consensus_size 2; Consensus AC Adh TRF tandem_repeat 2571737 2571768 55 . . Period_size 7; Copy Number 4.6; Match_percent 96; Indel_percent 0 Consensus_size 7; Consensus GGCGGTG Adh TRF tandem_repeat 2579771 2579797 54 . . Period_size 2; Copy Number 13.5; Match_percent 100; Indel_percent 0 Consensus_size 2; Consensus TA Adh TRF tandem_repeat 2590413 2590442 60 . . Period_size 14; Copy Number 2.1; Match_percent 100; Indel_percent 0 Consensus_size 14; Consensus TCGAAATAAAGCGA Adh TRF tandem_repeat 2593068 2593338 476 . . Period_size 108; Copy Number 2.5; Match_percent 95; Indel_percent 1 Consensus_size 108; Consensus TTCCTGAAAGATAGTAAGGAAAGTGAAAATAAAAATTTTCCGAATGACAGTAGGAAAATAATACAAACAGAATTCCCGAATGAGAGTAAGGAATGCGACAACATACAA Adh TRF tandem_repeat 2593140 2593304 118 . . Period_size 36; Copy Number 4.6; Match_percent 70; Indel_percent 10 Consensus_size 35; Consensus TTCCCGAATGAGAGTAAGGAATGCGACAAATACAA Adh TRF tandem_repeat 2597900 2597932 50 . . Period_size 5; Copy Number 6.8; Match_percent 93; Indel_percent 3 Consensus_size 5; Consensus TTCCG Adh TRF tandem_repeat 2641313 2641337 50 . . Period_size 13; Copy Number 1.9; Match_percent 100; Indel_percent 0 Consensus_size 13; Consensus TACTCTACTATAG Adh TRF tandem_repeat 2651478 2651506 58 . . Period_size 14; Copy Number 2.1; Match_percent 100; Indel_percent 0 Consensus_size 14; Consensus ACTTAATTTCTAGG Adh TRF tandem_repeat 2660130 2660183 51 . . Period_size 5; Copy Number 9.0; Match_percent 82; Indel_percent 13 Consensus_size 6; Consensus TTTTTG Adh TRF tandem_repeat 2666820 2666844 50 . . Period_size 7; Copy Number 3.6; Match_percent 100; Indel_percent 0 Consensus_size 7; Consensus AGTGGAA Adh TRF tandem_repeat 2674186 2674230 63 . . Period_size 13; Copy Number 3.5; Match_percent 84; Indel_percent 0 Consensus_size 13; Consensus GGGACATCTCGGC Adh TRF tandem_repeat 2688917 2688951 52 . . Period_size 12; Copy Number 2.9; Match_percent 91; Indel_percent 0 Consensus_size 12; Consensus CGTCTGTCCGTT Adh TRF tandem_repeat 2689255 2689289 52 . . Period_size 2; Copy Number 17.5; Match_percent 87; Indel_percent 0 Consensus_size 2; Consensus TA Adh TRF tandem_repeat 2703028 2703097 69 . . Period_size 10; Copy Number 7.5; Match_percent 73; Indel_percent 15 Consensus_size 10; Consensus AGATAGATAT Adh TRF tandem_repeat 2703033 2703105 55 . . Period_size 6; Copy Number 12.0; Match_percent 71; Indel_percent 23 Consensus_size 6; Consensus GATATA Adh TRF tandem_repeat 2713665 2713700 51 . . Period_size 5; Copy Number 7.8; Match_percent 87; Indel_percent 12 Consensus_size 5; Consensus TTTTG Adh TRF tandem_repeat 2725501 2725557 105 . . Period_size 2; Copy Number 28.5; Match_percent 96; Indel_percent 0 Consensus_size 2; Consensus TA Adh TRF tandem_repeat 2756438 2756487 57 . . Period_size 15; Copy Number 3.6; Match_percent 78; Indel_percent 7 Consensus_size 14; Consensus AATATTTTACAATA Adh TRF tandem_repeat 2788846 2789016 218 . . Period_size 24; Copy Number 7.1; Match_percent 86; Indel_percent 2 Consensus_size 24; Consensus TCCCGGACCTGGATATCCTCTGGG Adh TRF tandem_repeat 2808709 2808738 60 . . Period_size 14; Copy Number 2.1; Match_percent 100; Indel_percent 0 Consensus_size 14; Consensus TTAGTTGTAATTAG Adh TRF tandem_repeat 2813993 2814020 56 . . Period_size 13; Copy Number 2.2; Match_percent 100; Indel_percent 0 Consensus_size 13; Consensus TTTCTGCCAGCAA Adh TRF tandem_repeat 2856339 2856364 52 . . Period_size 5; Copy Number 5.2; Match_percent 100; Indel_percent 0 Consensus_size 5; Consensus GGTAT Adh TRF tandem_repeat 2881397 2881426 51 . . Period_size 12; Copy Number 2.5; Match_percent 94; Indel_percent 0 Consensus_size 12; Consensus TTGCAAATCAAG Adh TRF tandem_repeat 2885773 2885803 53 . . Period_size 15; Copy Number 2.1; Match_percent 93; Indel_percent 0 Consensus_size 15; Consensus ATTCAATAAAATTCA Adh TRF tandem_repeat 2887597 2887626 51 . . Period_size 2; Copy Number 15.0; Match_percent 92; Indel_percent 0 Consensus_size 2; Consensus AT Adh TRF tandem_repeat 2902098 2902146 89 . . Period_size 14; Copy Number 3.5; Match_percent 97; Indel_percent 0 Consensus_size 14; Consensus ACTTCTCTAAGCCA Adh TRF tandem_repeat 2904963 2904992 51 . . Period_size 15; Copy Number 2.0; Match_percent 93; Indel_percent 0 Consensus_size 15; Consensus GAGAACCTGAGAACT Adh TRF tandem_repeat 2905838 2905867 51 . . Period_size 10; Copy Number 3.0; Match_percent 95; Indel_percent 0 Consensus_size 10; Consensus CATATATATG Adh TRF tandem_repeat 2913004 2913039 54 . . Period_size 8; Copy Number 4.5; Match_percent 85; Indel_percent 0 Consensus_size 8; Consensus AACAGCCA Adh TRF tandem_repeat 2913083 2913122 62 . . Period_size 3; Copy Number 13.3; Match_percent 91; Indel_percent 0 Consensus_size 3; Consensus CAA # # complfy: 1. Calypso entries only Jul 5 (MR) # 2. group field cleaned 5 (MR) # Adh calypso tandemrepeat 1622 1636 . + 1 # 15 x A Adh calypso tandemrepeat 2551 2568 . + 0 # 3 x ACCAGA Adh calypso tandemrepeat 2551 2568 . + 0 # 3 x ACCAGA Adh calypso tandemrepeat 3603 3617 . + 2 # 3 x AACGC Adh calypso tandemrepeat 3603 3617 . + 2 # 3 x AACGC Adh calypso tandemrepeat 10170 10185 . + 2 # 4 x CCTG Adh calypso tandemrepeat 10170 10185 . + 2 # 4 x CCTG Adh calypso tandemrepeat 28336 28359 . + 0 # 12 x TA Adh calypso tandemrepeat 28336 28359 . + 0 # 12 x TA Adh calypso tandemrepeat 29566 29581 . + 0 # 4 x GTAT Adh calypso tandemrepeat 29566 29581 . + 0 # 4 x GTAT Adh calypso tandemrepeat 37867 37881 . + 0 # 3 x CTTGA Adh calypso tandemrepeat 37867 37881 . + 0 # 3 x CTTGA Adh calypso tandemrepeat 39133 39148 . + 0 # 16 x A Adh calypso tandemrepeat 39133 39148 . + 0 # 16 x A Adh calypso tandemrepeat 39991 40005 . + 0 # 15 x A Adh calypso tandemrepeat 39991 40005 . + 0 # 15 x A Adh calypso tandemrepeat 40748 40762 . + 1 # 5 x TGC Adh calypso tandemrepeat 40748 40762 . + 1 # 5 x TGC Adh calypso tandemrepeat 41083 41098 . + 0 # 4 x AATA Adh calypso tandemrepeat 41083 41098 . + 0 # 4 x AATA Adh calypso tandemrepeat 41804 41818 . + 1 # 5 x TTC Adh calypso tandemrepeat 41804 41818 . + 1 # 5 x TTC Adh calypso tandemrepeat 41852 41867 . + 1 # 8 x TG Adh calypso tandemrepeat 41852 41867 . + 1 # 8 x TG Adh calypso tandemrepeat 42651 42670 . + 2 # 10 x TC Adh calypso tandemrepeat 42651 42670 . + 2 # 10 x TC Adh calypso tandemrepeat 46851 46868 . + 2 # 9 x AT Adh calypso tandemrepeat 46851 46868 . + 2 # 9 x AT Adh calypso tandemrepeat 46851 46868 . + 2 # 9 x AT Adh calypso tandemrepeat 46851 46868 . + 2 # 9 x AT Adh calypso tandemrepeat 47082 47097 . + 2 # 16 x T Adh calypso tandemrepeat 47082 47097 . + 2 # 16 x T Adh calypso tandemrepeat 47082 47097 . + 2 # 16 x T Adh calypso tandemrepeat 47082 47097 . + 2 # 16 x T Adh calypso tandemrepeat 53890 53904 . + 0 # 3 x TTTTA Adh calypso tandemrepeat 53890 53904 . + 0 # 3 x TTTTA Adh calypso tandemrepeat 54248 54267 . + 1 # 20 x A Adh calypso tandemrepeat 54248 54267 . + 1 # 20 x A Adh calypso tandemrepeat 58947 58969 . + 2 # 23 x A Adh calypso tandemrepeat 58947 58969 . + 2 # 23 x A Adh calypso tandemrepeat 63281 63295 . + 1 # 3 x AACAG Adh calypso tandemrepeat 63281 63295 . + 1 # 3 x AACAG Adh calypso tandemrepeat 70833 70850 . + 2 # 3 x GATACA Adh calypso tandemrepeat 70833 70850 . + 2 # 3 x GATACA Adh calypso tandemrepeat 72090 72105 . + 2 # 4 x ATAC Adh calypso tandemrepeat 72090 72105 . + 2 # 4 x ATAC Adh calypso tandemrepeat 74562 74594 . + 2 # 11 x AAT Adh calypso tandemrepeat 74562 74594 . + 2 # 11 x AAT Adh calypso tandemrepeat 76467 76486 . + 2 # 4 x CGAAT Adh calypso tandemrepeat 76467 76486 . + 2 # 4 x CGAAT Adh calypso tandemrepeat 77989 78006 . + 0 # 9 x TG Adh calypso tandemrepeat 77989 78006 . + 0 # 9 x TG Adh calypso tandemrepeat 82238 82261 . + 1 # 4 x TATGTA Adh calypso tandemrepeat 82238 82261 . + 1 # 4 x TATGTA Adh calypso tandemrepeat 83275 83290 . + 0 # 4 x CAGA Adh calypso tandemrepeat 83275 83290 . + 0 # 4 x CAGA Adh calypso tandemrepeat 85957 85974 . + 0 # 6 x GCA Adh calypso tandemrepeat 85957 85974 . + 0 # 6 x GCA Adh calypso tandemrepeat 91308 91322 . + 2 # 5 x TCG Adh calypso tandemrepeat 91308 91322 . + 2 # 5 x TCG Adh calypso tandemrepeat 91308 91322 . + 2 # 5 x TCG Adh calypso tandemrepeat 91308 91322 . + 2 # 5 x TCG Adh calypso tandemrepeat 91725 91739 . + 2 # 3 x TGGTT Adh calypso tandemrepeat 91725 91739 . + 2 # 3 x TGGTT Adh calypso tandemrepeat 91725 91739 . + 2 # 3 x TGGTT Adh calypso tandemrepeat 91725 91739 . + 2 # 3 x TGGTT Adh calypso tandemrepeat 92979 93003 . + 2 # 25 x T Adh calypso tandemrepeat 92979 93003 . + 2 # 25 x T Adh calypso tandemrepeat 92979 93003 . + 2 # 25 x T Adh calypso tandemrepeat 92979 93003 . + 2 # 25 x T Adh calypso tandemrepeat 96698 96717 . + 1 # 10 x TG Adh calypso tandemrepeat 96698 96717 . + 1 # 10 x TG Adh calypso tandemrepeat 98583 98601 . + 2 # 19 x T Adh calypso tandemrepeat 98583 98601 . + 2 # 19 x T Adh calypso tandemrepeat 100384 100401 . + 0 # 18 x A Adh calypso tandemrepeat 100384 100401 . + 0 # 18 x A Adh calypso tandemrepeat 101289 101308 . + 2 # 20 x A Adh calypso tandemrepeat 101289 101308 . + 2 # 20 x A Adh calypso tandemrepeat 103257 103271 . + 2 # 3 x CTGGT Adh calypso tandemrepeat 103257 103271 . + 2 # 3 x CTGGT Adh calypso tandemrepeat 104183 104197 . + 1 # 5 x TCG Adh calypso tandemrepeat 104183 104197 . + 1 # 5 x TCG Adh calypso tandemrepeat 108993 109008 . + 2 # 16 x A Adh calypso tandemrepeat 108993 109008 . + 2 # 16 x A Adh calypso tandemrepeat 109140 109174 . + 2 # 7 x TATAT Adh calypso tandemrepeat 109140 109174 . + 2 # 7 x TATAT Adh calypso tandemrepeat 111964 111978 . + 0 # 5 x CAT Adh calypso tandemrepeat 111964 111978 . + 0 # 5 x CAT Adh calypso tandemrepeat 126718 126732 . + 0 # 3 x TGGAT Adh calypso tandemrepeat 126718 126732 . + 0 # 3 x TGGAT Adh calypso tandemrepeat 131119 131136 . + 0 # 6 x GCA Adh calypso tandemrepeat 131119 131136 . + 0 # 6 x GCA Adh calypso tandemrepeat 137480 137497 . + 1 # 18 x T Adh calypso tandemrepeat 137480 137497 . + 1 # 18 x T Adh calypso tandemrepeat 137480 137497 . + 1 # 18 x T Adh calypso tandemrepeat 137480 137497 . + 1 # 18 x T Adh calypso tandemrepeat 137594 137608 . + 1 # 5 x AAC Adh calypso tandemrepeat 137594 137608 . + 1 # 5 x AAC Adh calypso tandemrepeat 137594 137608 . + 1 # 5 x AAC Adh calypso tandemrepeat 137594 137608 . + 1 # 5 x AAC Adh calypso tandemrepeat 137931 137945 . + 2 # 3 x ATTGT Adh calypso tandemrepeat 137931 137945 . + 2 # 3 x ATTGT Adh calypso tandemrepeat 137931 137945 . + 2 # 3 x ATTGT Adh calypso tandemrepeat 137931 137945 . + 2 # 3 x ATTGT Adh calypso tandemrepeat 143823 143842 . + 2 # 10 x AC Adh calypso tandemrepeat 143823 143842 . + 2 # 10 x AC Adh calypso tandemrepeat 152870 152889 . + 1 # 10 x AC Adh calypso tandemrepeat 152870 152889 . + 1 # 10 x AC Adh calypso tandemrepeat 166341 166360 . + 2 # 5 x CAAA Adh calypso tandemrepeat 166341 166360 . + 2 # 5 x CAAA Adh calypso tandemrepeat 167926 167943 . + 0 # 9 x CA Adh calypso tandemrepeat 167926 167943 . + 0 # 9 x CA Adh calypso tandemrepeat 172510 172524 . + 0 # 5 x TGT Adh calypso tandemrepeat 172510 172524 . + 0 # 5 x TGT Adh calypso tandemrepeat 182041 182056 . + 0 # 4 x ACAA Adh calypso tandemrepeat 182041 182056 . + 0 # 4 x ACAA Adh calypso tandemrepeat 182041 182056 . + 0 # 4 x ACAA Adh calypso tandemrepeat 182041 182056 . + 0 # 4 x ACAA Adh calypso tandemrepeat 192791 192808 . + 1 # 3 x AATGGT Adh calypso tandemrepeat 192791 192808 . + 1 # 3 x AATGGT Adh calypso tandemrepeat 200058 200084 . + 2 # 9 x ACA Adh calypso tandemrepeat 200058 200084 . + 2 # 9 x ACA Adh calypso tandemrepeat 200215 200230 . + 0 # 16 x A Adh calypso tandemrepeat 200215 200230 . + 0 # 16 x A Adh calypso tandemrepeat 207660 207675 . + 2 # 4 x TCAA Adh calypso tandemrepeat 207660 207675 . + 2 # 4 x TCAA Adh calypso tandemrepeat 209347 209361 . + 0 # 15 x T Adh calypso tandemrepeat 209347 209361 . + 0 # 15 x T Adh calypso tandemrepeat 212843 212857 . + 1 # 5 x TTA Adh calypso tandemrepeat 212843 212857 . + 1 # 5 x TTA Adh calypso tandemrepeat 214781 214798 . + 1 # 3 x GGGCAT Adh calypso tandemrepeat 214781 214798 . + 1 # 3 x GGGCAT Adh calypso tandemrepeat 224959 224973 . + 0 # 3 x AATTA Adh calypso tandemrepeat 224959 224973 . + 0 # 3 x AATTA Adh calypso tandemrepeat 227156 227170 . + 1 # 5 x GCT Adh calypso tandemrepeat 227156 227170 . + 1 # 5 x GCT Adh calypso tandemrepeat 227156 227170 . + 1 # 5 x GCT Adh calypso tandemrepeat 227156 227170 . + 1 # 5 x GCT Adh calypso tandemrepeat 231257 231274 . + 1 # 3 x TCTTGG Adh calypso tandemrepeat 231257 231274 . + 1 # 3 x TCTTGG Adh calypso tandemrepeat 233834 233848 . + 1 # 5 x TAT Adh calypso tandemrepeat 233834 233848 . + 1 # 5 x TAT Adh calypso tandemrepeat 234017 234031 . + 1 # 3 x GGCGA Adh calypso tandemrepeat 234017 234031 . + 1 # 3 x GGCGA Adh calypso tandemrepeat 234438 234455 . + 2 # 3 x TCACAT Adh calypso tandemrepeat 234438 234455 . + 2 # 3 x TCACAT Adh calypso tandemrepeat 238711 238725 . + 0 # 5 x TGC Adh calypso tandemrepeat 238711 238725 . + 0 # 5 x TGC Adh calypso tandemrepeat 242300 242318 . + 1 # 19 x A Adh calypso tandemrepeat 242300 242318 . + 1 # 19 x A Adh calypso tandemrepeat 242376 242393 . + 2 # 9 x CA Adh calypso tandemrepeat 242376 242393 . + 2 # 9 x CA Adh calypso tandemrepeat 243709 243724 . + 0 # 16 x A Adh calypso tandemrepeat 243709 243724 . + 0 # 16 x A Adh calypso tandemrepeat 248282 248296 . + 1 # 5 x GAT Adh calypso tandemrepeat 248282 248296 . + 1 # 5 x GAT Adh calypso tandemrepeat 251018 251035 . + 1 # 3 x AGATAC Adh calypso tandemrepeat 251018 251035 . + 1 # 3 x AGATAC Adh calypso tandemrepeat 254583 254598 . + 2 # 8 x TA Adh calypso tandemrepeat 254583 254598 . + 2 # 8 x TA Adh calypso tandemrepeat 255611 255633 . + 1 # 23 x T Adh calypso tandemrepeat 255611 255633 . + 1 # 23 x T Adh calypso tandemrepeat 259848 259863 . + 2 # 4 x TATG Adh calypso tandemrepeat 259848 259863 . + 2 # 4 x TATG Adh calypso tandemrepeat 266340 266354 . + 2 # 3 x ATATA Adh calypso tandemrepeat 266340 266354 . + 2 # 3 x ATATA Adh calypso tandemrepeat 270098 270115 . + 1 # 9 x TG Adh calypso tandemrepeat 270098 270115 . + 1 # 9 x TG Adh calypso tandemrepeat 270098 270115 . + 1 # 9 x TG Adh calypso tandemrepeat 270098 270115 . + 1 # 9 x TG Adh calypso tandemrepeat 271285 271308 . + 0 # 8 x CTG Adh calypso tandemrepeat 271285 271308 . + 0 # 8 x CTG Adh calypso tandemrepeat 271285 271308 . + 0 # 8 x CTG Adh calypso tandemrepeat 271285 271308 . + 0 # 8 x CTG Adh calypso tandemrepeat 271412 271426 . + 1 # 3 x GCACA Adh calypso tandemrepeat 271412 271426 . + 1 # 3 x GCACA Adh calypso tandemrepeat 271412 271426 . + 1 # 3 x GCACA Adh calypso tandemrepeat 271412 271426 . + 1 # 3 x GCACA Adh calypso tandemrepeat 284448 284462 . + 2 # 15 x T Adh calypso tandemrepeat 284448 284462 . + 2 # 15 x T Adh calypso tandemrepeat 293149 293168 . + 0 # 10 x AT Adh calypso tandemrepeat 293149 293168 . + 0 # 10 x AT Adh calypso tandemrepeat 297736 297751 . + 0 # 4 x TTGT Adh calypso tandemrepeat 297736 297751 . + 0 # 4 x TTGT Adh calypso tandemrepeat 307350 307367 . + 2 # 3 x TATAAA Adh calypso tandemrepeat 307350 307367 . + 2 # 3 x TATAAA Adh calypso tandemrepeat 312806 312823 . + 1 # 6 x GCA Adh calypso tandemrepeat 312806 312823 . + 1 # 6 x GCA Adh calypso tandemrepeat 313243 313260 . + 0 # 9 x AT Adh calypso tandemrepeat 313243 313260 . + 0 # 9 x AT Adh calypso tandemrepeat 314920 314937 . + 0 # 3 x TTCGGA Adh calypso tandemrepeat 314920 314937 . + 0 # 3 x TTCGGA Adh calypso tandemrepeat 315342 315359 . + 2 # 6 x AAT Adh calypso tandemrepeat 315342 315359 . + 2 # 6 x AAT Adh calypso tandemrepeat 315342 315359 . + 2 # 6 x AAT Adh calypso tandemrepeat 315342 315359 . + 2 # 6 x AAT Adh calypso tandemrepeat 321786 321801 . + 2 # 16 x G Adh calypso tandemrepeat 321786 321801 . + 2 # 16 x G Adh calypso tandemrepeat 331264 331285 . + 0 # 11 x TG Adh calypso tandemrepeat 331264 331285 . + 0 # 11 x TG Adh calypso tandemrepeat 331475 331492 . + 1 # 3 x GGCAGC Adh calypso tandemrepeat 331475 331492 . + 1 # 3 x GGCAGC Adh calypso tandemrepeat 331997 332012 . + 1 # 16 x T Adh calypso tandemrepeat 331997 332012 . + 1 # 16 x T Adh calypso tandemrepeat 332637 332651 . + 2 # 5 x AAC Adh calypso tandemrepeat 332637 332651 . + 2 # 5 x AAC Adh calypso tandemrepeat 354987 355002 . + 2 # 16 x T Adh calypso tandemrepeat 354987 355002 . + 2 # 16 x T Adh calypso tandemrepeat 357348 357362 . + 2 # 3 x CACAC Adh calypso tandemrepeat 357348 357362 . + 2 # 3 x CACAC Adh calypso tandemrepeat 359448 359465 . + 2 # 3 x TCCTCA Adh calypso tandemrepeat 359448 359465 . + 2 # 3 x TCCTCA Adh calypso tandemrepeat 367195 367209 . + 0 # 3 x TTCAG Adh calypso tandemrepeat 367195 367209 . + 0 # 3 x TTCAG Adh calypso tandemrepeat 367673 367687 . + 1 # 3 x AATAT Adh calypso tandemrepeat 367673 367687 . + 1 # 3 x AATAT Adh calypso tandemrepeat 367803 367818 . + 2 # 16 x T Adh calypso tandemrepeat 367803 367818 . + 2 # 16 x T Adh calypso tandemrepeat 368001 368024 . + 2 # 4 x ATACAG Adh calypso tandemrepeat 368001 368024 . + 2 # 4 x ATACAG Adh calypso tandemrepeat 368715 368729 . + 2 # 3 x CTCCA Adh calypso tandemrepeat 368715 368729 . + 2 # 3 x CTCCA Adh calypso tandemrepeat 371089 371103 . + 0 # 5 x GCT Adh calypso tandemrepeat 371089 371103 . + 0 # 5 x GCT Adh calypso tandemrepeat 377546 377561 . + 1 # 4 x CTAT Adh calypso tandemrepeat 377546 377561 . + 1 # 4 x CTAT Adh calypso tandemrepeat 378071 378086 . + 1 # 4 x TATG Adh calypso tandemrepeat 378071 378086 . + 1 # 4 x TATG Adh calypso tandemrepeat 381769 381783 . + 0 # 5 x CCT Adh calypso tandemrepeat 381769 381783 . + 0 # 5 x CCT Adh calypso tandemrepeat 385735 385749 . + 0 # 5 x CAT Adh calypso tandemrepeat 385735 385749 . + 0 # 5 x CAT Adh calypso tandemrepeat 386121 386138 . + 2 # 3 x GCATTT Adh calypso tandemrepeat 386121 386138 . + 2 # 3 x GCATTT Adh calypso tandemrepeat 388289 388304 . + 1 # 8 x TG Adh calypso tandemrepeat 388289 388304 . + 1 # 8 x TG Adh calypso tandemrepeat 388376 388390 . + 1 # 3 x GGAGT Adh calypso tandemrepeat 388376 388390 . + 1 # 3 x GGAGT Adh calypso tandemrepeat 393337 393354 . + 0 # 3 x CAGTTT Adh calypso tandemrepeat 393337 393354 . + 0 # 3 x CAGTTT Adh calypso tandemrepeat 400273 400292 . + 0 # 20 x A Adh calypso tandemrepeat 400273 400292 . + 0 # 20 x A Adh calypso tandemrepeat 411848 411865 . + 1 # 3 x ATATAA Adh calypso tandemrepeat 411848 411865 . + 1 # 3 x ATATAA Adh calypso tandemrepeat 417518 417532 . + 1 # 5 x TGT Adh calypso tandemrepeat 417518 417532 . + 1 # 5 x TGT Adh calypso tandemrepeat 419180 419194 . + 1 # 3 x ACTCC Adh calypso tandemrepeat 419180 419194 . + 1 # 3 x ACTCC Adh calypso tandemrepeat 428234 428249 . + 1 # 8 x AT Adh calypso tandemrepeat 428234 428249 . + 1 # 8 x AT Adh calypso tandemrepeat 429724 429741 . + 0 # 3 x CAGTTG Adh calypso tandemrepeat 429724 429741 . + 0 # 3 x CAGTTG Adh calypso tandemrepeat 433158 433173 . + 2 # 16 x A Adh calypso tandemrepeat 433158 433173 . + 2 # 16 x A Adh calypso tandemrepeat 441893 441907 . + 1 # 15 x A Adh calypso tandemrepeat 441893 441907 . + 1 # 15 x A Adh calypso tandemrepeat 447518 447535 . + 1 # 3 x GTTGCA Adh calypso tandemrepeat 447518 447535 . + 1 # 3 x GTTGCA Adh calypso tandemrepeat 449494 449508 . + 0 # 15 x A Adh calypso tandemrepeat 449494 449508 . + 0 # 15 x A Adh calypso tandemrepeat 463991 464010 . + 1 # 4 x TATTT Adh calypso tandemrepeat 463991 464010 . + 1 # 4 x TATTT Adh calypso tandemrepeat 467074 467089 . + 0 # 4 x TATG Adh calypso tandemrepeat 467074 467089 . + 0 # 4 x TATG Adh calypso tandemrepeat 471909 471924 . + 2 # 16 x T Adh calypso tandemrepeat 471909 471924 . + 2 # 16 x T Adh calypso tandemrepeat 472925 472939 . + 1 # 5 x TAT Adh calypso tandemrepeat 472925 472939 . + 1 # 5 x TAT Adh calypso tandemrepeat 476610 476631 . + 2 # 11 x AT Adh calypso tandemrepeat 476610 476631 . + 2 # 11 x AT Adh calypso tandemrepeat 484358 484372 . + 1 # 15 x T Adh calypso tandemrepeat 484358 484372 . + 1 # 15 x T Adh calypso tandemrepeat 484595 484612 . + 1 # 9 x CA Adh calypso tandemrepeat 484595 484612 . + 1 # 9 x CA Adh calypso tandemrepeat 485890 485905 . + 0 # 4 x TTAT Adh calypso tandemrepeat 485890 485905 . + 0 # 4 x TTAT Adh calypso tandemrepeat 487040 487057 . + 1 # 6 x TGC Adh calypso tandemrepeat 487040 487057 . + 1 # 6 x TGC Adh calypso tandemrepeat 488023 488040 . + 0 # 9 x CA Adh calypso tandemrepeat 488023 488040 . + 0 # 9 x CA Adh calypso tandemrepeat 490320 490336 . + 2 # 17 x T Adh calypso tandemrepeat 490320 490336 . + 2 # 17 x T Adh calypso tandemrepeat 493299 493314 . + 2 # 16 x T Adh calypso tandemrepeat 493299 493314 . + 2 # 16 x T Adh calypso tandemrepeat 494589 494604 . + 2 # 8 x AC Adh calypso tandemrepeat 494589 494604 . + 2 # 8 x AC Adh calypso tandemrepeat 495032 495052 . + 1 # 7 x GCA Adh calypso tandemrepeat 495032 495052 . + 1 # 7 x GCA Adh calypso tandemrepeat 495032 495052 . + 1 # 7 x GCA Adh calypso tandemrepeat 495032 495052 . + 1 # 7 x GCA Adh calypso tandemrepeat 499214 499229 . + 1 # 4 x TAGT Adh calypso tandemrepeat 499214 499229 . + 1 # 4 x TAGT Adh calypso tandemrepeat 499214 499229 . + 1 # 4 x TAGT Adh calypso tandemrepeat 499214 499229 . + 1 # 4 x TAGT Adh calypso tandemrepeat 501325 501339 . + 0 # 15 x A Adh calypso tandemrepeat 501325 501339 . + 0 # 15 x A Adh calypso tandemrepeat 502593 502607 . + 2 # 3 x CAAAA Adh calypso tandemrepeat 502593 502607 . + 2 # 3 x CAAAA Adh calypso tandemrepeat 503810 503825 . + 1 # 16 x A Adh calypso tandemrepeat 503810 503825 . + 1 # 16 x A Adh calypso tandemrepeat 507896 507919 . + 1 # 6 x TCCA Adh calypso tandemrepeat 507896 507919 . + 1 # 6 x TCCA Adh calypso tandemrepeat 515838 515861 . + 2 # 12 x TG Adh calypso tandemrepeat 515838 515861 . + 2 # 12 x TG Adh calypso tandemrepeat 529704 529718 . + 2 # 3 x CATTT Adh calypso tandemrepeat 529704 529718 . + 2 # 3 x CATTT Adh calypso tandemrepeat 533284 533299 . + 0 # 4 x ATTT Adh calypso tandemrepeat 533284 533299 . + 0 # 4 x ATTT Adh calypso tandemrepeat 534250 534267 . + 0 # 9 x GT Adh calypso tandemrepeat 534250 534267 . + 0 # 9 x GT Adh calypso tandemrepeat 534551 534571 . + 1 # 7 x CAT Adh calypso tandemrepeat 534551 534571 . + 1 # 7 x CAT Adh calypso tandemrepeat 538105 538122 . + 0 # 9 x TG Adh calypso tandemrepeat 538105 538122 . + 0 # 9 x TG Adh calypso tandemrepeat 539677 539694 . + 0 # 3 x GATACA Adh calypso tandemrepeat 539677 539694 . + 0 # 3 x GATACA Adh calypso tandemrepeat 539709 539726 . + 2 # 9 x CA Adh calypso tandemrepeat 539709 539726 . + 2 # 9 x CA Adh calypso tandemrepeat 543940 543963 . + 0 # 12 x TG Adh calypso tandemrepeat 543940 543963 . + 0 # 12 x TG Adh calypso tandemrepeat 543940 543963 . + 0 # 12 x TG Adh calypso tandemrepeat 543940 543963 . + 0 # 12 x TG Adh calypso tandemrepeat 544062 544079 . + 2 # 3 x TGCCTT Adh calypso tandemrepeat 544062 544079 . + 2 # 3 x TGCCTT Adh calypso tandemrepeat 544062 544079 . + 2 # 3 x TGCCTT Adh calypso tandemrepeat 544062 544079 . + 2 # 3 x TGCCTT Adh calypso tandemrepeat 545026 545040 . + 0 # 5 x TGC Adh calypso tandemrepeat 545026 545040 . + 0 # 5 x TGC Adh calypso tandemrepeat 546049 546068 . + 0 # 4 x TTTTA Adh calypso tandemrepeat 546049 546068 . + 0 # 4 x TTTTA Adh calypso tandemrepeat 546183 546200 . + 2 # 9 x GT Adh calypso tandemrepeat 546183 546200 . + 2 # 9 x GT Adh calypso tandemrepeat 548133 548154 . + 2 # 11 x CA Adh calypso tandemrepeat 548133 548154 . + 2 # 11 x CA Adh calypso tandemrepeat 559442 559457 . + 1 # 8 x TG Adh calypso tandemrepeat 559442 559457 . + 1 # 8 x TG Adh calypso tandemrepeat 562060 562079 . + 0 # 10 x GT Adh calypso tandemrepeat 562060 562079 . + 0 # 10 x GT Adh calypso tandemrepeat 563160 563177 . + 2 # 9 x CA Adh calypso tandemrepeat 563160 563177 . + 2 # 9 x CA Adh calypso tandemrepeat 563387 563402 . + 1 # 4 x GGTT Adh calypso tandemrepeat 563387 563402 . + 1 # 4 x GGTT Adh calypso tandemrepeat 567593 567609 . + 1 # 17 x T Adh calypso tandemrepeat 567593 567609 . + 1 # 17 x T Adh calypso tandemrepeat 568971 568986 . + 2 # 8 x CA Adh calypso tandemrepeat 568971 568986 . + 2 # 8 x CA Adh calypso tandemrepeat 574093 574107 . + 0 # 5 x CTA Adh calypso tandemrepeat 574093 574107 . + 0 # 5 x CTA Adh calypso tandemrepeat 577165 577180 . + 0 # 8 x AT Adh calypso tandemrepeat 577165 577180 . + 0 # 8 x AT Adh calypso tandemrepeat 577385 577400 . + 1 # 4 x CCAA Adh calypso tandemrepeat 577385 577400 . + 1 # 4 x CCAA Adh calypso tandemrepeat 583460 583477 . + 1 # 9 x AT Adh calypso tandemrepeat 583460 583477 . + 1 # 9 x AT Adh calypso tandemrepeat 589692 589709 . + 2 # 6 x TGT Adh calypso tandemrepeat 589692 589709 . + 2 # 6 x TGT Adh calypso tandemrepeat 589692 589709 . + 2 # 6 x TGT Adh calypso tandemrepeat 589692 589709 . + 2 # 6 x TGT Adh calypso tandemrepeat 591168 591191 . + 2 # 12 x CA Adh calypso tandemrepeat 591168 591191 . + 2 # 12 x CA Adh calypso tandemrepeat 591549 591564 . + 2 # 8 x AC Adh calypso tandemrepeat 591549 591564 . + 2 # 8 x AC Adh calypso tandemrepeat 594324 594339 . + 2 # 8 x TG Adh calypso tandemrepeat 594324 594339 . + 2 # 8 x TG Adh calypso tandemrepeat 599735 599752 . + 1 # 3 x CAGTCA Adh calypso tandemrepeat 599735 599752 . + 1 # 3 x CAGTCA Adh calypso tandemrepeat 601674 601693 . + 2 # 10 x AT Adh calypso tandemrepeat 601674 601693 . + 2 # 10 x AT Adh calypso tandemrepeat 604540 604555 . + 0 # 8 x TA Adh calypso tandemrepeat 604540 604555 . + 0 # 8 x TA Adh calypso tandemrepeat 606257 606272 . + 1 # 8 x TG Adh calypso tandemrepeat 606257 606272 . + 1 # 8 x TG Adh calypso tandemrepeat 607358 607377 . + 1 # 10 x TG Adh calypso tandemrepeat 607358 607377 . + 1 # 10 x TG Adh calypso tandemrepeat 607856 607872 . + 1 # 17 x A Adh calypso tandemrepeat 607856 607872 . + 1 # 17 x A Adh calypso tandemrepeat 609272 609287 . + 1 # 8 x CA Adh calypso tandemrepeat 609272 609287 . + 1 # 8 x CA Adh calypso tandemrepeat 609701 609726 . + 1 # 13 x CA Adh calypso tandemrepeat 609701 609726 . + 1 # 13 x CA Adh calypso tandemrepeat 612948 612965 . + 2 # 9 x GT Adh calypso tandemrepeat 612948 612965 . + 2 # 9 x GT Adh calypso tandemrepeat 617773 617787 . + 0 # 15 x T Adh calypso tandemrepeat 617773 617787 . + 0 # 15 x T Adh calypso tandemrepeat 618402 618419 . + 2 # 9 x GT Adh calypso tandemrepeat 618402 618419 . + 2 # 9 x GT Adh calypso tandemrepeat 618655 618670 . + 0 # 16 x G Adh calypso tandemrepeat 618655 618670 . + 0 # 16 x G Adh calypso tandemrepeat 620005 620022 . + 0 # 9 x TG Adh calypso tandemrepeat 620005 620022 . + 0 # 9 x TG Adh calypso tandemrepeat 622152 622169 . + 2 # 3 x TTGTAG Adh calypso tandemrepeat 622152 622169 . + 2 # 3 x TTGTAG Adh calypso tandemrepeat 622509 622530 . + 2 # 11 x AC Adh calypso tandemrepeat 622509 622530 . + 2 # 11 x AC Adh calypso tandemrepeat 622870 622884 . + 0 # 15 x G Adh calypso tandemrepeat 622870 622884 . + 0 # 15 x G Adh calypso tandemrepeat 622975 622992 . + 0 # 6 x CTG Adh calypso tandemrepeat 622975 622992 . + 0 # 6 x CTG Adh calypso tandemrepeat 624332 624349 . + 1 # 9 x CA Adh calypso tandemrepeat 624332 624349 . + 1 # 9 x CA Adh calypso tandemrepeat 627015 627039 . + 2 # 5 x CCAAC Adh calypso tandemrepeat 627015 627039 . + 2 # 5 x CCAAC Adh calypso tandemrepeat 630667 630681 . + 0 # 3 x ATTAC Adh calypso tandemrepeat 630667 630681 . + 0 # 3 x ATTAC Adh calypso tandemrepeat 630667 630681 . + 0 # 3 x ATTAC Adh calypso tandemrepeat 630667 630681 . + 0 # 3 x ATTAC Adh calypso tandemrepeat 649044 649069 . + 2 # 13 x TG Adh calypso tandemrepeat 649044 649069 . + 2 # 13 x TG Adh calypso tandemrepeat 659049 659069 . + 2 # 7 x GTG Adh calypso tandemrepeat 659049 659069 . + 2 # 7 x GTG Adh calypso tandemrepeat 661041 661055 . + 2 # 5 x CTG Adh calypso tandemrepeat 661041 661055 . + 2 # 5 x CTG Adh calypso tandemrepeat 661129 661146 . + 0 # 6 x TGC Adh calypso tandemrepeat 661129 661146 . + 0 # 6 x TGC Adh calypso tandemrepeat 669576 669602 . + 2 # 9 x GCA Adh calypso tandemrepeat 669576 669602 . + 2 # 9 x GCA Adh calypso tandemrepeat 669827 669844 . + 1 # 3 x TGCTAT Adh calypso tandemrepeat 669827 669844 . + 1 # 3 x TGCTAT Adh calypso tandemrepeat 676949 676966 . + 1 # 3 x GATCAT Adh calypso tandemrepeat 676949 676966 . + 1 # 3 x GATCAT Adh calypso tandemrepeat 676949 676966 . + 1 # 3 x GATCAT Adh calypso tandemrepeat 676949 676966 . + 1 # 3 x GATCAT Adh calypso tandemrepeat 680908 680923 . + 0 # 4 x AAGT Adh calypso tandemrepeat 680908 680923 . + 0 # 4 x AAGT Adh calypso tandemrepeat 687118 687135 . + 0 # 9 x CA Adh calypso tandemrepeat 687118 687135 . + 0 # 9 x CA Adh calypso tandemrepeat 688329 688343 . + 2 # 15 x T Adh calypso tandemrepeat 688329 688343 . + 2 # 15 x T Adh calypso tandemrepeat 690828 690842 . + 2 # 5 x TGT Adh calypso tandemrepeat 690828 690842 . + 2 # 5 x TGT Adh calypso tandemrepeat 691711 691731 . + 0 # 7 x ATA Adh calypso tandemrepeat 691711 691731 . + 0 # 7 x ATA Adh calypso tandemrepeat 697796 697811 . + 1 # 8 x TG Adh calypso tandemrepeat 697796 697811 . + 1 # 8 x TG Adh calypso tandemrepeat 704064 704083 . + 2 # 4 x ACTCC Adh calypso tandemrepeat 704064 704083 . + 2 # 4 x ACTCC Adh calypso tandemrepeat 704275 704290 . + 0 # 4 x ATCT Adh calypso tandemrepeat 704275 704290 . + 0 # 4 x ATCT Adh calypso tandemrepeat 706091 706105 . + 1 # 15 x A Adh calypso tandemrepeat 706091 706105 . + 1 # 15 x A Adh calypso tandemrepeat 710193 710219 . + 2 # 9 x TAT Adh calypso tandemrepeat 710193 710219 . + 2 # 9 x TAT Adh calypso tandemrepeat 710810 710824 . + 1 # 15 x A Adh calypso tandemrepeat 710810 710824 . + 1 # 15 x A Adh calypso tandemrepeat 711842 711859 . + 1 # 3 x GTCGTT Adh calypso tandemrepeat 711842 711859 . + 1 # 3 x GTCGTT Adh calypso tandemrepeat 712971 712988 . + 2 # 9 x GT Adh calypso tandemrepeat 712971 712988 . + 2 # 9 x GT Adh calypso tandemrepeat 717661 717675 . + 0 # 3 x GCCAA Adh calypso tandemrepeat 717661 717675 . + 0 # 3 x GCCAA Adh calypso tandemrepeat 720535 720552 . + 0 # 18 x T Adh calypso tandemrepeat 720535 720552 . + 0 # 18 x T Adh calypso tandemrepeat 720535 720552 . + 0 # 18 x T Adh calypso tandemrepeat 733228 733245 . + 0 # 18 x A Adh calypso tandemrepeat 733228 733245 . + 0 # 18 x A Adh calypso tandemrepeat 735072 735091 . + 2 # 4 x TATTA Adh calypso tandemrepeat 735072 735091 . + 2 # 4 x TATTA Adh calypso tandemrepeat 738596 738611 . + 1 # 4 x ATAA Adh calypso tandemrepeat 738596 738611 . + 1 # 4 x ATAA Adh calypso tandemrepeat 740801 740815 . + 1 # 15 x T Adh calypso tandemrepeat 740801 740815 . + 1 # 15 x T Adh calypso tandemrepeat 741415 741429 . + 0 # 3 x GTAAA Adh calypso tandemrepeat 741415 741429 . + 0 # 3 x GTAAA Adh calypso tandemrepeat 743744 743761 . + 1 # 3 x AAAGCC Adh calypso tandemrepeat 743744 743761 . + 1 # 3 x AAAGCC Adh calypso tandemrepeat 758073 758098 . + 2 # 26 x T Adh calypso tandemrepeat 758073 758098 . + 2 # 26 x T Adh calypso tandemrepeat 759896 759913 . + 1 # 3 x ATACAG Adh calypso tandemrepeat 759896 759913 . + 1 # 3 x ATACAG Adh calypso tandemrepeat 765789 765803 . + 2 # 3 x TCCAT Adh calypso tandemrepeat 765789 765803 . + 2 # 3 x TCCAT Adh calypso tandemrepeat 765789 765803 . + 2 # 3 x TCCAT Adh calypso tandemrepeat 765789 765803 . + 2 # 3 x TCCAT Adh calypso tandemrepeat 767787 767802 . + 2 # 4 x TCTG Adh calypso tandemrepeat 767787 767802 . + 2 # 4 x TCTG Adh calypso tandemrepeat 767787 767802 . + 2 # 4 x TCTG Adh calypso tandemrepeat 767787 767802 . + 2 # 4 x TCTG Adh calypso tandemrepeat 767944 767958 . + 0 # 3 x GGTCT Adh calypso tandemrepeat 767944 767958 . + 0 # 3 x GGTCT Adh calypso tandemrepeat 767944 767958 . + 0 # 3 x GGTCT Adh calypso tandemrepeat 767944 767958 . + 0 # 3 x GGTCT Adh calypso tandemrepeat 772182 772211 . + 2 # 5 x TCGGGA Adh calypso tandemrepeat 772182 772211 . + 2 # 5 x TCGGGA Adh calypso tandemrepeat 773325 773348 . + 2 # 4 x AAAGGC Adh calypso tandemrepeat 773325 773348 . + 2 # 4 x AAAGGC Adh calypso tandemrepeat 781674 781688 . + 2 # 3 x AAATT Adh calypso tandemrepeat 781674 781688 . + 2 # 3 x AAATT Adh calypso tandemrepeat 784148 784162 . + 1 # 5 x AGC Adh calypso tandemrepeat 784148 784162 . + 1 # 5 x AGC Adh calypso tandemrepeat 784264 784278 . + 0 # 3 x CCAAG Adh calypso tandemrepeat 784264 784278 . + 0 # 3 x CCAAG Adh calypso tandemrepeat 784461 784475 . + 2 # 15 x A Adh calypso tandemrepeat 784461 784475 . + 2 # 15 x A Adh calypso tandemrepeat 796709 796728 . + 1 # 4 x TCGCA Adh calypso tandemrepeat 796709 796728 . + 1 # 4 x TCGCA Adh calypso tandemrepeat 797684 797701 . + 1 # 3 x CAAAGT Adh calypso tandemrepeat 797684 797701 . + 1 # 3 x CAAAGT Adh calypso tandemrepeat 802077 802091 . + 2 # 5 x CAG Adh calypso tandemrepeat 802077 802091 . + 2 # 5 x CAG Adh calypso tandemrepeat 802572 802589 . + 2 # 6 x CAG Adh calypso tandemrepeat 802572 802589 . + 2 # 6 x CAG Adh calypso tandemrepeat 808315 808329 . + 0 # 3 x TCGGA Adh calypso tandemrepeat 808315 808329 . + 0 # 3 x TCGGA Adh calypso tandemrepeat 821966 821980 . + 1 # 3 x AATAA Adh calypso tandemrepeat 821966 821980 . + 1 # 3 x AATAA Adh calypso tandemrepeat 828833 828848 . + 1 # 8 x AC Adh calypso tandemrepeat 828833 828848 . + 1 # 8 x AC Adh calypso tandemrepeat 829935 829954 . + 2 # 5 x AATA Adh calypso tandemrepeat 829935 829954 . + 2 # 5 x AATA Adh calypso tandemrepeat 832947 832961 . + 2 # 5 x CAG Adh calypso tandemrepeat 832947 832961 . + 2 # 5 x CAG Adh calypso tandemrepeat 850690 850704 . + 0 # 15 x T Adh calypso tandemrepeat 850690 850704 . + 0 # 15 x T Adh calypso tandemrepeat 851045 851059 . + 1 # 5 x TAA Adh calypso tandemrepeat 851045 851059 . + 1 # 5 x TAA Adh calypso tandemrepeat 852082 852096 . + 0 # 15 x A Adh calypso tandemrepeat 852082 852096 . + 0 # 15 x A Adh calypso tandemrepeat 877842 877859 . + 2 # 3 x TGCAGT Adh calypso tandemrepeat 877842 877859 . + 2 # 3 x TGCAGT Adh calypso tandemrepeat 879111 879140 . + 2 # 15 x CT Adh calypso tandemrepeat 879111 879140 . + 2 # 15 x CT Adh calypso tandemrepeat 881602 881616 . + 0 # 3 x GCATC Adh calypso tandemrepeat 881602 881616 . + 0 # 3 x GCATC Adh calypso tandemrepeat 881685 881699 . + 2 # 3 x ATCAA Adh calypso tandemrepeat 881685 881699 . + 2 # 3 x ATCAA Adh calypso tandemrepeat 886116 886133 . + 2 # 3 x GCCGCT Adh calypso tandemrepeat 886116 886133 . + 2 # 3 x GCCGCT Adh calypso tandemrepeat 886492 886509 . + 0 # 6 x TGC Adh calypso tandemrepeat 886492 886509 . + 0 # 6 x TGC Adh calypso tandemrepeat 889369 889385 . + 0 # 17 x A Adh calypso tandemrepeat 889369 889385 . + 0 # 17 x A Adh calypso tandemrepeat 889677 889691 . + 2 # 3 x TGATT Adh calypso tandemrepeat 889677 889691 . + 2 # 3 x TGATT Adh calypso tandemrepeat 890317 890334 . + 0 # 6 x TTG Adh calypso tandemrepeat 890317 890334 . + 0 # 6 x TTG Adh calypso tandemrepeat 892159 892182 . + 0 # 4 x GTTGCT Adh calypso tandemrepeat 892159 892182 . + 0 # 4 x GTTGCT Adh calypso tandemrepeat 892925 892940 . + 1 # 4 x ATCT Adh calypso tandemrepeat 892925 892940 . + 1 # 4 x ATCT Adh calypso tandemrepeat 893320 893334 . + 0 # 15 x A Adh calypso tandemrepeat 893320 893334 . + 0 # 15 x A Adh calypso tandemrepeat 899819 899843 . + 1 # 5 x CCAAA Adh calypso tandemrepeat 899819 899843 . + 1 # 5 x CCAAA Adh calypso tandemrepeat 900010 900029 . + 0 # 5 x GACT Adh calypso tandemrepeat 900010 900029 . + 0 # 5 x GACT Adh calypso tandemrepeat 900010 900029 . + 0 # 5 x GACT Adh calypso tandemrepeat 900010 900029 . + 0 # 5 x GACT Adh calypso tandemrepeat 901102 901119 . + 0 # 9 x GT Adh calypso tandemrepeat 901102 901119 . + 0 # 9 x GT Adh calypso tandemrepeat 901102 901119 . + 0 # 9 x GT Adh calypso tandemrepeat 901102 901119 . + 0 # 9 x GT Adh calypso tandemrepeat 910341 910355 . + 2 # 3 x TTAAT Adh calypso tandemrepeat 910341 910355 . + 2 # 3 x TTAAT Adh calypso tandemrepeat 914388 914402 . + 2 # 3 x AGTCG Adh calypso tandemrepeat 914388 914402 . + 2 # 3 x AGTCG Adh calypso tandemrepeat 919523 919537 . + 1 # 3 x ATCCC Adh calypso tandemrepeat 919523 919537 . + 1 # 3 x ATCCC Adh calypso tandemrepeat 920663 920680 . + 1 # 6 x CAG Adh calypso tandemrepeat 920663 920680 . + 1 # 6 x CAG Adh calypso tandemrepeat 926131 926151 . + 0 # 7 x GCA Adh calypso tandemrepeat 926131 926151 . + 0 # 7 x GCA Adh calypso tandemrepeat 930584 930607 . + 1 # 4 x CCCATT Adh calypso tandemrepeat 930584 930607 . + 1 # 4 x CCCATT Adh calypso tandemrepeat 931193 931207 . + 1 # 3 x AACGA Adh calypso tandemrepeat 931193 931207 . + 1 # 3 x AACGA Adh calypso tandemrepeat 936152 936179 . + 1 # 7 x TATG Adh calypso tandemrepeat 936152 936179 . + 1 # 7 x TATG Adh calypso tandemrepeat 948020 948034 . + 1 # 3 x TCAGC Adh calypso tandemrepeat 948020 948034 . + 1 # 3 x TCAGC Adh calypso tandemrepeat 948020 948034 . + 1 # 3 x TCAGC Adh calypso tandemrepeat 948020 948034 . + 1 # 3 x TCAGC Adh calypso tandemrepeat 949088 949115 . + 1 # 7 x GATG Adh calypso tandemrepeat 949088 949115 . + 1 # 7 x GATG Adh calypso tandemrepeat 949088 949115 . + 1 # 7 x GATG Adh calypso tandemrepeat 949088 949115 . + 1 # 7 x GATG Adh calypso tandemrepeat 950677 950696 . + 0 # 10 x TG Adh calypso tandemrepeat 950677 950696 . + 0 # 10 x TG Adh calypso tandemrepeat 951654 951668 . + 2 # 5 x TGT Adh calypso tandemrepeat 951654 951668 . + 2 # 5 x TGT Adh calypso tandemrepeat 954660 954675 . + 2 # 16 x A Adh calypso tandemrepeat 954660 954675 . + 2 # 16 x A Adh calypso tandemrepeat 955339 955353 . + 0 # 3 x TGAGC Adh calypso tandemrepeat 955339 955353 . + 0 # 3 x TGAGC Adh calypso tandemrepeat 959024 959038 . + 1 # 15 x T Adh calypso tandemrepeat 959024 959038 . + 1 # 15 x T Adh calypso tandemrepeat 959377 959393 . + 0 # 17 x T Adh calypso tandemrepeat 959377 959393 . + 0 # 17 x T Adh calypso tandemrepeat 959936 959960 . + 1 # 25 x T Adh calypso tandemrepeat 959936 959960 . + 1 # 25 x T Adh calypso tandemrepeat 960528 960542 . + 2 # 5 x TTA Adh calypso tandemrepeat 960528 960542 . + 2 # 5 x TTA Adh calypso tandemrepeat 966188 966207 . + 1 # 10 x CA Adh calypso tandemrepeat 966188 966207 . + 1 # 10 x CA Adh calypso tandemrepeat 968087 968106 . + 1 # 10 x GT Adh calypso tandemrepeat 968087 968106 . + 1 # 10 x GT Adh calypso tandemrepeat 970545 970559 . + 2 # 3 x ATTGG Adh calypso tandemrepeat 970545 970559 . + 2 # 3 x ATTGG Adh calypso tandemrepeat 971138 971155 . + 1 # 3 x CGATAA Adh calypso tandemrepeat 971138 971155 . + 1 # 3 x CGATAA Adh calypso tandemrepeat 985994 986008 . + 1 # 5 x GCA Adh calypso tandemrepeat 985994 986008 . + 1 # 5 x GCA Adh calypso tandemrepeat 996726 996740 . + 2 # 5 x GGC Adh calypso tandemrepeat 996726 996740 . + 2 # 5 x GGC Adh calypso tandemrepeat 1002557 1002571 . + 1 # 3 x AACTC Adh calypso tandemrepeat 1002557 1002571 . + 1 # 3 x AACTC Adh calypso tandemrepeat 1002591 1002605 . + 2 # 3 x GAACT Adh calypso tandemrepeat 1002591 1002605 . + 2 # 3 x GAACT Adh calypso tandemrepeat 1002776 1002793 . + 1 # 9 x AG Adh calypso tandemrepeat 1002776 1002793 . + 1 # 9 x AG Adh calypso tandemrepeat 1005219 1005233 . + 2 # 5 x CAG Adh calypso tandemrepeat 1005219 1005233 . + 2 # 5 x CAG Adh calypso tandemrepeat 1005416 1005432 . + 1 # 17 x T Adh calypso tandemrepeat 1005416 1005432 . + 1 # 17 x T Adh calypso tandemrepeat 1005865 1005880 . + 0 # 4 x CTGA Adh calypso tandemrepeat 1005865 1005880 . + 0 # 4 x CTGA Adh calypso tandemrepeat 1014404 1014418 . + 1 # 3 x CGTTA Adh calypso tandemrepeat 1014404 1014418 . + 1 # 3 x CGTTA Adh calypso tandemrepeat 1015976 1015992 . + 1 # 17 x T Adh calypso tandemrepeat 1015976 1015992 . + 1 # 17 x T Adh calypso tandemrepeat 1020695 1020709 . + 1 # 3 x ATAAT Adh calypso tandemrepeat 1020695 1020709 . + 1 # 3 x ATAAT Adh calypso tandemrepeat 1020710 1020724 . + 1 # 3 x ATATA Adh calypso tandemrepeat 1020710 1020724 . + 1 # 3 x ATATA Adh calypso tandemrepeat 1021501 1021515 . + 0 # 15 x T Adh calypso tandemrepeat 1021501 1021515 . + 0 # 15 x T Adh calypso tandemrepeat 1026809 1026826 . + 1 # 3 x ATTGCG Adh calypso tandemrepeat 1026809 1026826 . + 1 # 3 x ATTGCG Adh calypso tandemrepeat 1027847 1027863 . + 1 # 17 x A Adh calypso tandemrepeat 1027847 1027863 . + 1 # 17 x A Adh calypso tandemrepeat 1038688 1038702 . + 0 # 5 x CTA Adh calypso tandemrepeat 1038688 1038702 . + 0 # 5 x CTA Adh calypso tandemrepeat 1038688 1038702 . + 0 # 5 x CTA Adh calypso tandemrepeat 1038688 1038702 . + 0 # 5 x CTA Adh calypso tandemrepeat 1045156 1045173 . + 0 # 3 x GGTCCA Adh calypso tandemrepeat 1045156 1045173 . + 0 # 3 x GGTCCA Adh calypso tandemrepeat 1054544 1054558 . + 1 # 3 x GCATC Adh calypso tandemrepeat 1054544 1054558 . + 1 # 3 x GCATC Adh calypso tandemrepeat 1054682 1054706 . + 1 # 5 x GAACT Adh calypso tandemrepeat 1054682 1054706 . + 1 # 5 x GAACT Adh calypso tandemrepeat 1062793 1062807 . + 0 # 3 x GTTGG Adh calypso tandemrepeat 1062793 1062807 . + 0 # 3 x GTTGG Adh calypso tandemrepeat 1064755 1064770 . + 0 # 4 x TCAA Adh calypso tandemrepeat 1064755 1064770 . + 0 # 4 x TCAA Adh calypso tandemrepeat 1065563 1065580 . + 1 # 6 x GCA Adh calypso tandemrepeat 1065563 1065580 . + 1 # 6 x GCA Adh calypso tandemrepeat 1070495 1070514 . + 1 # 4 x CGAGT Adh calypso tandemrepeat 1070495 1070514 . + 1 # 4 x CGAGT Adh calypso tandemrepeat 1073168 1073182 . + 1 # 5 x CTT Adh calypso tandemrepeat 1073168 1073182 . + 1 # 5 x CTT Adh calypso tandemrepeat 1079614 1079641 . + 0 # 7 x ATGA Adh calypso tandemrepeat 1079614 1079641 . + 0 # 7 x ATGA Adh calypso tandemrepeat 1086467 1086481 . + 1 # 5 x CAG Adh calypso tandemrepeat 1086467 1086481 . + 1 # 5 x CAG Adh calypso tandemrepeat 1088991 1089005 . + 2 # 5 x TCC Adh calypso tandemrepeat 1088991 1089005 . + 2 # 5 x TCC Adh calypso tandemrepeat 1089936 1089956 . + 2 # 7 x CTG Adh calypso tandemrepeat 1089936 1089956 . + 2 # 7 x CTG Adh calypso tandemrepeat 1094143 1094157 . + 0 # 5 x CAT Adh calypso tandemrepeat 1094143 1094157 . + 0 # 5 x CAT Adh calypso tandemrepeat 1094519 1094533 . + 1 # 5 x TGT Adh calypso tandemrepeat 1094519 1094533 . + 1 # 5 x TGT Adh calypso tandemrepeat 1095234 1095248 . + 2 # 3 x GTTGT Adh calypso tandemrepeat 1095234 1095248 . + 2 # 3 x GTTGT Adh calypso tandemrepeat 1096242 1096257 . + 2 # 4 x TTTA Adh calypso tandemrepeat 1096242 1096257 . + 2 # 4 x TTTA Adh calypso tandemrepeat 1099313 1099328 . + 1 # 4 x TGGC Adh calypso tandemrepeat 1099313 1099328 . + 1 # 4 x TGGC Adh calypso tandemrepeat 1107046 1107063 . + 0 # 3 x GCCACC Adh calypso tandemrepeat 1107046 1107063 . + 0 # 3 x GCCACC Adh calypso tandemrepeat 1109743 1109766 . + 0 # 4 x ATACTA Adh calypso tandemrepeat 1109743 1109766 . + 0 # 4 x ATACTA Adh calypso tandemrepeat 1110994 1111008 . + 0 # 15 x A Adh calypso tandemrepeat 1110994 1111008 . + 0 # 15 x A Adh calypso tandemrepeat 1112646 1112683 . + 2 # 38 x T Adh calypso tandemrepeat 1112646 1112683 . + 2 # 38 x T Adh calypso tandemrepeat 1120256 1120275 . + 1 # 5 x ATGG Adh calypso tandemrepeat 1120256 1120275 . + 1 # 5 x ATGG Adh calypso tandemrepeat 1121325 1121348 . + 2 # 6 x GACA Adh calypso tandemrepeat 1121325 1121348 . + 2 # 6 x GACA Adh calypso tandemrepeat 1123531 1123545 . + 0 # 5 x TTA Adh calypso tandemrepeat 1123531 1123545 . + 0 # 5 x TTA Adh calypso tandemrepeat 1125075 1125095 . + 2 # 7 x GCA Adh calypso tandemrepeat 1125075 1125095 . + 2 # 7 x GCA Adh calypso tandemrepeat 1125075 1125095 . + 2 # 7 x GCA Adh calypso tandemrepeat 1125075 1125095 . + 2 # 7 x GCA Adh calypso tandemrepeat 1131750 1131767 . + 2 # 3 x AGTTGC Adh calypso tandemrepeat 1131750 1131767 . + 2 # 3 x AGTTGC Adh calypso tandemrepeat 1135457 1135472 . + 1 # 8 x AT Adh calypso tandemrepeat 1135457 1135472 . + 1 # 8 x AT Adh calypso tandemrepeat 1144469 1144487 . + 1 # 19 x T Adh calypso tandemrepeat 1144469 1144487 . + 1 # 19 x T Adh calypso tandemrepeat 1145749 1145763 . + 0 # 3 x CCGAT Adh calypso tandemrepeat 1145749 1145763 . + 0 # 3 x CCGAT Adh calypso tandemrepeat 1146320 1146335 . + 1 # 16 x A Adh calypso tandemrepeat 1146320 1146335 . + 1 # 16 x A Adh calypso tandemrepeat 1147126 1147143 . + 0 # 3 x TTATTT Adh calypso tandemrepeat 1147126 1147143 . + 0 # 3 x TTATTT Adh calypso tandemrepeat 1151879 1151897 . + 1 # 19 x A Adh calypso tandemrepeat 1151879 1151897 . + 1 # 19 x A Adh calypso tandemrepeat 1152128 1152145 . + 1 # 3 x ATGCTG Adh calypso tandemrepeat 1152128 1152145 . + 1 # 3 x ATGCTG Adh calypso tandemrepeat 1155339 1155357 . + 2 # 19 x A Adh calypso tandemrepeat 1155339 1155357 . + 2 # 19 x A Adh calypso tandemrepeat 1155686 1155703 . + 1 # 6 x GAT Adh calypso tandemrepeat 1155686 1155703 . + 1 # 6 x GAT Adh calypso tandemrepeat 1157057 1157074 . + 1 # 3 x GCAATT Adh calypso tandemrepeat 1157057 1157074 . + 1 # 3 x GCAATT Adh calypso tandemrepeat 1160948 1160964 . + 1 # 17 x T Adh calypso tandemrepeat 1160948 1160964 . + 1 # 17 x T Adh calypso tandemrepeat 1161184 1161198 . + 0 # 5 x TTG Adh calypso tandemrepeat 1161184 1161198 . + 0 # 5 x TTG Adh calypso tandemrepeat 1162208 1162222 . + 1 # 15 x A Adh calypso tandemrepeat 1162208 1162222 . + 1 # 15 x A Adh calypso tandemrepeat 1168371 1168390 . + 2 # 10 x AC Adh calypso tandemrepeat 1168371 1168390 . + 2 # 10 x AC Adh calypso tandemrepeat 1172531 1172568 . + 1 # 19 x TA Adh calypso tandemrepeat 1172531 1172568 . + 1 # 19 x TA Adh calypso tandemrepeat 1172531 1172568 . + 1 # 19 x TA Adh calypso tandemrepeat 1172531 1172568 . + 1 # 19 x TA Adh calypso tandemrepeat 1176269 1176286 . + 1 # 18 x A Adh calypso tandemrepeat 1176269 1176286 . + 1 # 18 x A Adh calypso tandemrepeat 1178536 1178560 . + 0 # 25 x T Adh calypso tandemrepeat 1178536 1178560 . + 0 # 25 x T Adh calypso tandemrepeat 1190348 1190365 . + 1 # 3 x TGTTGC Adh calypso tandemrepeat 1190348 1190365 . + 1 # 3 x TGTTGC Adh calypso tandemrepeat 1195025 1195039 . + 1 # 15 x T Adh calypso tandemrepeat 1195025 1195039 . + 1 # 15 x T Adh calypso tandemrepeat 1196579 1196596 . + 1 # 3 x GCAACA Adh calypso tandemrepeat 1196579 1196596 . + 1 # 3 x GCAACA Adh calypso tandemrepeat 1206749 1206766 . + 1 # 6 x AGC Adh calypso tandemrepeat 1206749 1206766 . + 1 # 6 x AGC Adh calypso tandemrepeat 1207025 1207039 . + 1 # 3 x ATTAA Adh calypso tandemrepeat 1207025 1207039 . + 1 # 3 x ATTAA Adh calypso tandemrepeat 1227377 1227391 . + 1 # 15 x A Adh calypso tandemrepeat 1227377 1227391 . + 1 # 15 x A Adh calypso tandemrepeat 1231197 1231211 . + 2 # 5 x TGC Adh calypso tandemrepeat 1231197 1231211 . + 2 # 5 x TGC Adh calypso tandemrepeat 1231296 1231310 . + 2 # 5 x TGC Adh calypso tandemrepeat 1231296 1231310 . + 2 # 5 x TGC Adh calypso tandemrepeat 1233493 1233507 . + 0 # 3 x TATTA Adh calypso tandemrepeat 1233493 1233507 . + 0 # 3 x TATTA Adh calypso tandemrepeat 1237958 1237977 . + 1 # 10 x TG Adh calypso tandemrepeat 1237958 1237977 . + 1 # 10 x TG Adh calypso tandemrepeat 1254492 1254506 . + 2 # 3 x ATTCA Adh calypso tandemrepeat 1254492 1254506 . + 2 # 3 x ATTCA Adh calypso tandemrepeat 1278334 1278349 . + 0 # 4 x TATG Adh calypso tandemrepeat 1278334 1278349 . + 0 # 4 x TATG Adh calypso tandemrepeat 1284489 1284503 . + 2 # 15 x T Adh calypso tandemrepeat 1284489 1284503 . + 2 # 15 x T Adh calypso tandemrepeat 1291267 1291284 . + 0 # 3 x CGAGGA Adh calypso tandemrepeat 1291267 1291284 . + 0 # 3 x CGAGGA Adh calypso tandemrepeat 1293629 1293644 . + 1 # 4 x AATA Adh calypso tandemrepeat 1293629 1293644 . + 1 # 4 x AATA Adh calypso tandemrepeat 1298498 1298513 . + 1 # 4 x AATA Adh calypso tandemrepeat 1298498 1298513 . + 1 # 4 x AATA Adh calypso tandemrepeat 1305659 1305674 . + 1 # 4 x TTCA Adh calypso tandemrepeat 1305659 1305674 . + 1 # 4 x TTCA Adh calypso tandemrepeat 1305659 1305674 . + 1 # 4 x TTCA Adh calypso tandemrepeat 1305659 1305674 . + 1 # 4 x TTCA Adh calypso tandemrepeat 1311852 1311868 . + 2 # 17 x T Adh calypso tandemrepeat 1311852 1311868 . + 2 # 17 x T Adh calypso tandemrepeat 1313762 1313777 . + 1 # 8 x GT Adh calypso tandemrepeat 1313762 1313777 . + 1 # 8 x GT Adh calypso tandemrepeat 1316848 1316865 . + 0 # 9 x AG Adh calypso tandemrepeat 1316848 1316865 . + 0 # 9 x AG Adh calypso tandemrepeat 1342013 1342030 . + 1 # 3 x TCTTGG Adh calypso tandemrepeat 1342013 1342030 . + 1 # 3 x TCTTGG Adh calypso tandemrepeat 1348479 1348494 . + 2 # 16 x G Adh calypso tandemrepeat 1348479 1348494 . + 2 # 16 x G Adh calypso tandemrepeat 1354064 1354078 . + 1 # 3 x TACTA Adh calypso tandemrepeat 1354064 1354078 . + 1 # 3 x TACTA Adh calypso tandemrepeat 1354064 1354078 . + 1 # 3 x TACTA Adh calypso tandemrepeat 1354064 1354078 . + 1 # 3 x TACTA Adh calypso tandemrepeat 1360180 1360197 . + 0 # 3 x CAGATA Adh calypso tandemrepeat 1360180 1360197 . + 0 # 3 x CAGATA Adh calypso tandemrepeat 1361643 1361657 . + 2 # 3 x TTATT Adh calypso tandemrepeat 1361643 1361657 . + 2 # 3 x TTATT Adh calypso tandemrepeat 1364975 1364992 . + 1 # 3 x TGCTGT Adh calypso tandemrepeat 1364975 1364992 . + 1 # 3 x TGCTGT Adh calypso tandemrepeat 1367583 1367606 . + 2 # 24 x T Adh calypso tandemrepeat 1367583 1367606 . + 2 # 24 x T Adh calypso tandemrepeat 1379673 1379696 . + 2 # 24 x T Adh calypso tandemrepeat 1379673 1379696 . + 2 # 24 x T Adh calypso tandemrepeat 1383109 1383132 . + 0 # 12 x CA Adh calypso tandemrepeat 1383109 1383132 . + 0 # 12 x CA Adh calypso tandemrepeat 1388183 1388207 . + 1 # 25 x T Adh calypso tandemrepeat 1388183 1388207 . + 1 # 25 x T Adh calypso tandemrepeat 1391263 1391278 . + 0 # 4 x CATA Adh calypso tandemrepeat 1391263 1391278 . + 0 # 4 x CATA Adh calypso tandemrepeat 1391416 1391431 . + 0 # 8 x CA Adh calypso tandemrepeat 1391416 1391431 . + 0 # 8 x CA Adh calypso tandemrepeat 1392437 1392456 . + 1 # 4 x TTTCG Adh calypso tandemrepeat 1392437 1392456 . + 1 # 4 x TTTCG Adh calypso tandemrepeat 1395819 1395837 . + 2 # 19 x C Adh calypso tandemrepeat 1395819 1395837 . + 2 # 19 x C Adh calypso tandemrepeat 1395819 1395837 . + 2 # 19 x C Adh calypso tandemrepeat 1395819 1395837 . + 2 # 19 x C Adh calypso tandemrepeat 1399035 1399051 . + 2 # 17 x T Adh calypso tandemrepeat 1399035 1399051 . + 2 # 17 x T Adh calypso tandemrepeat 1399035 1399051 . + 2 # 17 x T Adh calypso tandemrepeat 1399035 1399051 . + 2 # 17 x T Adh calypso tandemrepeat 1401995 1402009 . + 1 # 3 x GATTG Adh calypso tandemrepeat 1401995 1402009 . + 1 # 3 x GATTG Adh calypso tandemrepeat 1404251 1404268 . + 1 # 9 x GT Adh calypso tandemrepeat 1404251 1404268 . + 1 # 9 x GT Adh calypso tandemrepeat 1406009 1406029 . + 1 # 7 x AGC Adh calypso tandemrepeat 1406009 1406029 . + 1 # 7 x AGC Adh calypso tandemrepeat 1408221 1408235 . + 2 # 3 x ACAAG Adh calypso tandemrepeat 1408221 1408235 . + 2 # 3 x ACAAG Adh calypso tandemrepeat 1410789 1410806 . + 2 # 3 x GCAGTG Adh calypso tandemrepeat 1410789 1410806 . + 2 # 3 x GCAGTG Adh calypso tandemrepeat 1410848 1410865 . + 1 # 6 x TCA Adh calypso tandemrepeat 1410848 1410865 . + 1 # 6 x TCA Adh calypso tandemrepeat 1424247 1424264 . + 2 # 3 x GTTCTG Adh calypso tandemrepeat 1424247 1424264 . + 2 # 3 x GTTCTG Adh calypso tandemrepeat 1424790 1424804 . + 2 # 15 x C Adh calypso tandemrepeat 1424790 1424804 . + 2 # 15 x C Adh calypso tandemrepeat 1425005 1425020 . + 1 # 4 x TGGA Adh calypso tandemrepeat 1425005 1425020 . + 1 # 4 x TGGA Adh calypso tandemrepeat 1426058 1426079 . + 1 # 11 x TG Adh calypso tandemrepeat 1426058 1426079 . + 1 # 11 x TG Adh calypso tandemrepeat 1427823 1427838 . + 2 # 4 x GTAT Adh calypso tandemrepeat 1427823 1427838 . + 2 # 4 x GTAT Adh calypso tandemrepeat 1429907 1429921 . + 1 # 15 x T Adh calypso tandemrepeat 1429907 1429921 . + 1 # 15 x T Adh calypso tandemrepeat 1434683 1434698 . + 1 # 16 x T Adh calypso tandemrepeat 1434683 1434698 . + 1 # 16 x T Adh calypso tandemrepeat 1449707 1449722 . + 1 # 16 x T Adh calypso tandemrepeat 1449707 1449722 . + 1 # 16 x T Adh calypso tandemrepeat 1453167 1453186 . + 2 # 10 x TA Adh calypso tandemrepeat 1453167 1453186 . + 2 # 10 x TA Adh calypso tandemrepeat 1454595 1454609 . + 2 # 5 x ATA Adh calypso tandemrepeat 1454595 1454609 . + 2 # 5 x ATA Adh calypso tandemrepeat 1461482 1461497 . + 1 # 8 x AC Adh calypso tandemrepeat 1461482 1461497 . + 1 # 8 x AC Adh calypso tandemrepeat 1463470 1463494 . + 0 # 5 x TTCAG Adh calypso tandemrepeat 1463470 1463494 . + 0 # 5 x TTCAG Adh calypso tandemrepeat 1463496 1463510 . + 2 # 3 x CAATG Adh calypso tandemrepeat 1463496 1463510 . + 2 # 3 x CAATG Adh calypso tandemrepeat 1463860 1463874 . + 0 # 3 x TATTT Adh calypso tandemrepeat 1463860 1463874 . + 0 # 3 x TATTT Adh calypso tandemrepeat 1472445 1472460 . + 2 # 4 x AGTG Adh calypso tandemrepeat 1472445 1472460 . + 2 # 4 x AGTG Adh calypso tandemrepeat 1474088 1474113 . + 1 # 13 x TA Adh calypso tandemrepeat 1474088 1474113 . + 1 # 13 x TA Adh calypso tandemrepeat 1480217 1480252 . + 1 # 36 x A Adh calypso tandemrepeat 1480217 1480252 . + 1 # 36 x A Adh calypso tandemrepeat 1484215 1484229 . + 0 # 5 x TGC Adh calypso tandemrepeat 1484215 1484229 . + 0 # 5 x TGC Adh calypso tandemrepeat 1484928 1484942 . + 2 # 5 x AAT Adh calypso tandemrepeat 1484928 1484942 . + 2 # 5 x AAT Adh calypso tandemrepeat 1485335 1485356 . + 1 # 11 x TC Adh calypso tandemrepeat 1485335 1485356 . + 1 # 11 x TC Adh calypso tandemrepeat 1485335 1485356 . + 1 # 11 x TC Adh calypso tandemrepeat 1485335 1485356 . + 1 # 11 x TC Adh calypso tandemrepeat 1497539 1497554 . + 1 # 4 x GTTT Adh calypso tandemrepeat 1497539 1497554 . + 1 # 4 x GTTT Adh calypso tandemrepeat 1502345 1502360 . + 1 # 8 x AC Adh calypso tandemrepeat 1502345 1502360 . + 1 # 8 x AC Adh calypso tandemrepeat 1503315 1503342 . + 2 # 14 x TC Adh calypso tandemrepeat 1503315 1503342 . + 2 # 14 x TC Adh calypso tandemrepeat 1503409 1503424 . + 0 # 8 x GT Adh calypso tandemrepeat 1503409 1503424 . + 0 # 8 x GT Adh calypso tandemrepeat 1506742 1506759 . + 0 # 6 x AAC Adh calypso tandemrepeat 1506742 1506759 . + 0 # 6 x AAC Adh calypso tandemrepeat 1506997 1507014 . + 0 # 6 x AAC Adh calypso tandemrepeat 1506997 1507014 . + 0 # 6 x AAC Adh calypso tandemrepeat 1507601 1507615 . + 1 # 3 x AGTGA Adh calypso tandemrepeat 1507601 1507615 . + 1 # 3 x AGTGA Adh calypso tandemrepeat 1510453 1510476 . + 0 # 4 x TTTTGG Adh calypso tandemrepeat 1510453 1510476 . + 0 # 4 x TTTTGG Adh calypso tandemrepeat 1510600 1510623 . + 0 # 4 x TATTTG Adh calypso tandemrepeat 1510600 1510623 . + 0 # 4 x TATTTG Adh calypso tandemrepeat 1511544 1511561 . + 2 # 3 x GGCTGG Adh calypso tandemrepeat 1511544 1511561 . + 2 # 3 x GGCTGG Adh calypso tandemrepeat 1512918 1512937 . + 2 # 4 x TGGTC Adh calypso tandemrepeat 1512918 1512937 . + 2 # 4 x TGGTC Adh calypso tandemrepeat 1512943 1512962 . + 0 # 4 x AGTTC Adh calypso tandemrepeat 1512943 1512962 . + 0 # 4 x AGTTC Adh calypso tandemrepeat 1514284 1514299 . + 0 # 4 x GTAT Adh calypso tandemrepeat 1514284 1514299 . + 0 # 4 x GTAT Adh calypso tandemrepeat 1523467 1523482 . + 0 # 4 x TCAC Adh calypso tandemrepeat 1523467 1523482 . + 0 # 4 x TCAC Adh calypso tandemrepeat 1529451 1529465 . + 2 # 5 x CAA Adh calypso tandemrepeat 1529451 1529465 . + 2 # 5 x CAA Adh calypso tandemrepeat 1529795 1529809 . + 1 # 5 x CAG Adh calypso tandemrepeat 1529795 1529809 . + 1 # 5 x CAG Adh calypso tandemrepeat 1529810 1529827 . + 1 # 6 x CAA Adh calypso tandemrepeat 1529810 1529827 . + 1 # 6 x CAA Adh calypso tandemrepeat 1530718 1530733 . + 0 # 4 x TCTG Adh calypso tandemrepeat 1530718 1530733 . + 0 # 4 x TCTG Adh calypso tandemrepeat 1530718 1530733 . + 0 # 4 x TCTG Adh calypso tandemrepeat 1530718 1530733 . + 0 # 4 x TCTG Adh calypso tandemrepeat 1532513 1532528 . + 1 # 4 x ACAT Adh calypso tandemrepeat 1532513 1532528 . + 1 # 4 x ACAT Adh calypso tandemrepeat 1532513 1532528 . + 1 # 4 x ACAT Adh calypso tandemrepeat 1532513 1532528 . + 1 # 4 x ACAT Adh calypso tandemrepeat 1562132 1562146 . + 1 # 5 x AAT Adh calypso tandemrepeat 1562132 1562146 . + 1 # 5 x AAT Adh calypso tandemrepeat 1575182 1575199 . + 1 # 3 x GATTTG Adh calypso tandemrepeat 1575182 1575199 . + 1 # 3 x GATTTG Adh calypso tandemrepeat 1575182 1575199 . + 1 # 3 x GATTTG Adh calypso tandemrepeat 1575182 1575199 . + 1 # 3 x GATTTG Adh calypso tandemrepeat 1587202 1587216 . + 0 # 3 x TTTTC Adh calypso tandemrepeat 1587202 1587216 . + 0 # 3 x TTTTC Adh calypso tandemrepeat 1587379 1587396 . + 0 # 3 x CGTCAT Adh calypso tandemrepeat 1587379 1587396 . + 0 # 3 x CGTCAT Adh calypso tandemrepeat 1588087 1588102 . + 0 # 16 x A Adh calypso tandemrepeat 1588087 1588102 . + 0 # 16 x A Adh calypso tandemrepeat 1588215 1588229 . + 2 # 5 x GAT Adh calypso tandemrepeat 1588215 1588229 . + 2 # 5 x GAT Adh calypso tandemrepeat 1588231 1588245 . + 0 # 5 x ATG Adh calypso tandemrepeat 1588231 1588245 . + 0 # 5 x ATG Adh calypso tandemrepeat 1590481 1590498 . + 0 # 3 x AACTGC Adh calypso tandemrepeat 1590481 1590498 . + 0 # 3 x AACTGC Adh calypso tandemrepeat 1590793 1590809 . + 0 # 17 x T Adh calypso tandemrepeat 1590793 1590809 . + 0 # 17 x T Adh calypso tandemrepeat 1591791 1591808 . + 2 # 9 x AT Adh calypso tandemrepeat 1591791 1591808 . + 2 # 9 x AT Adh calypso tandemrepeat 1592540 1592554 . + 1 # 3 x ACTTA Adh calypso tandemrepeat 1592540 1592554 . + 1 # 3 x ACTTA Adh calypso tandemrepeat 1597043 1597060 . + 1 # 3 x GGAGAT Adh calypso tandemrepeat 1597043 1597060 . + 1 # 3 x GGAGAT Adh calypso tandemrepeat 1598225 1598239 . + 1 # 3 x CTTTA Adh calypso tandemrepeat 1598225 1598239 . + 1 # 3 x CTTTA Adh calypso tandemrepeat 1609960 1609980 . + 0 # 7 x ACG Adh calypso tandemrepeat 1609960 1609980 . + 0 # 7 x ACG Adh calypso tandemrepeat 1611748 1611763 . + 0 # 4 x GCTA Adh calypso tandemrepeat 1611748 1611763 . + 0 # 4 x GCTA Adh calypso tandemrepeat 1612282 1612299 . + 0 # 3 x TATATG Adh calypso tandemrepeat 1612282 1612299 . + 0 # 3 x TATATG Adh calypso tandemrepeat 1613364 1613381 . + 2 # 18 x A Adh calypso tandemrepeat 1613364 1613381 . + 2 # 18 x A Adh calypso tandemrepeat 1614603 1614627 . + 2 # 5 x CTGTT Adh calypso tandemrepeat 1614603 1614627 . + 2 # 5 x CTGTT Adh calypso tandemrepeat 1626935 1626952 . + 1 # 3 x GAATGA Adh calypso tandemrepeat 1626935 1626952 . + 1 # 3 x GAATGA Adh calypso tandemrepeat 1627854 1627869 . + 2 # 8 x TG Adh calypso tandemrepeat 1627854 1627869 . + 2 # 8 x TG Adh calypso tandemrepeat 1628087 1628104 . + 1 # 9 x GT Adh calypso tandemrepeat 1628087 1628104 . + 1 # 9 x GT Adh calypso tandemrepeat 1632832 1632847 . + 0 # 4 x ATTT Adh calypso tandemrepeat 1632832 1632847 . + 0 # 4 x ATTT Adh calypso tandemrepeat 1637135 1637150 . + 1 # 4 x AGAC Adh calypso tandemrepeat 1637135 1637150 . + 1 # 4 x AGAC Adh calypso tandemrepeat 1638662 1638679 . + 1 # 9 x CA Adh calypso tandemrepeat 1638662 1638679 . + 1 # 9 x CA Adh calypso tandemrepeat 1643978 1643993 . + 1 # 8 x GT Adh calypso tandemrepeat 1643978 1643993 . + 1 # 8 x GT Adh calypso tandemrepeat 1646755 1646772 . + 0 # 3 x GGTTCT Adh calypso tandemrepeat 1646755 1646772 . + 0 # 3 x GGTTCT Adh calypso tandemrepeat 1647252 1647266 . + 2 # 3 x ATATT Adh calypso tandemrepeat 1647252 1647266 . + 2 # 3 x ATATT Adh calypso tandemrepeat 1648409 1648424 . + 1 # 8 x TG Adh calypso tandemrepeat 1648409 1648424 . + 1 # 8 x TG Adh calypso tandemrepeat 1661973 1661993 . + 2 # 21 x A Adh calypso tandemrepeat 1661973 1661993 . + 2 # 21 x A Adh calypso tandemrepeat 1662717 1662731 . + 2 # 3 x TTTTG Adh calypso tandemrepeat 1662717 1662731 . + 2 # 3 x TTTTG Adh calypso tandemrepeat 1666164 1666181 . + 2 # 9 x TA Adh calypso tandemrepeat 1666164 1666181 . + 2 # 9 x TA Adh calypso tandemrepeat 1666164 1666181 . + 2 # 9 x TA Adh calypso tandemrepeat 1666164 1666181 . + 2 # 9 x TA Adh calypso tandemrepeat 1667283 1667297 . + 2 # 3 x AAAAT Adh calypso tandemrepeat 1667283 1667297 . + 2 # 3 x AAAAT Adh calypso tandemrepeat 1667283 1667297 . + 2 # 3 x AAAAT Adh calypso tandemrepeat 1667283 1667297 . + 2 # 3 x AAAAT Adh calypso tandemrepeat 1671293 1671310 . + 1 # 3 x TGCTCC Adh calypso tandemrepeat 1671293 1671310 . + 1 # 3 x TGCTCC Adh calypso tandemrepeat 1676142 1676159 . + 2 # 9 x TA Adh calypso tandemrepeat 1676142 1676159 . + 2 # 9 x TA Adh calypso tandemrepeat 1679001 1679016 . + 2 # 16 x T Adh calypso tandemrepeat 1679001 1679016 . + 2 # 16 x T Adh calypso tandemrepeat 1681584 1681598 . + 2 # 3 x CGAAT Adh calypso tandemrepeat 1681584 1681598 . + 2 # 3 x CGAAT Adh calypso tandemrepeat 1685275 1685294 . + 0 # 10 x GT Adh calypso tandemrepeat 1685275 1685294 . + 0 # 10 x GT Adh calypso tandemrepeat 1691044 1691058 . + 0 # 3 x TTCGT Adh calypso tandemrepeat 1691044 1691058 . + 0 # 3 x TTCGT Adh calypso tandemrepeat 1693348 1693362 . + 0 # 3 x AATAA Adh calypso tandemrepeat 1693348 1693362 . + 0 # 3 x AATAA Adh calypso tandemrepeat 1693841 1693860 . + 1 # 4 x TTATA Adh calypso tandemrepeat 1693841 1693860 . + 1 # 4 x TTATA Adh calypso tandemrepeat 1698019 1698038 . + 0 # 5 x ACCA Adh calypso tandemrepeat 1698019 1698038 . + 0 # 5 x ACCA Adh calypso tandemrepeat 1702142 1702156 . + 1 # 3 x ATGAG Adh calypso tandemrepeat 1702142 1702156 . + 1 # 3 x ATGAG Adh calypso tandemrepeat 1703828 1703843 . + 1 # 4 x TTTG Adh calypso tandemrepeat 1703828 1703843 . + 1 # 4 x TTTG Adh calypso tandemrepeat 1703927 1703948 . + 1 # 11 x CA Adh calypso tandemrepeat 1703927 1703948 . + 1 # 11 x CA Adh calypso tandemrepeat 1709366 1709383 . + 1 # 3 x ACTCCC Adh calypso tandemrepeat 1709366 1709383 . + 1 # 3 x ACTCCC Adh calypso tandemrepeat 1710698 1710717 . + 1 # 5 x TATG Adh calypso tandemrepeat 1710698 1710717 . + 1 # 5 x TATG Adh calypso tandemrepeat 1710698 1710717 . + 1 # 5 x TATG Adh calypso tandemrepeat 1710698 1710717 . + 1 # 5 x TATG Adh calypso tandemrepeat 1711879 1711900 . + 0 # 11 x GT Adh calypso tandemrepeat 1711879 1711900 . + 0 # 11 x GT Adh calypso tandemrepeat 1711879 1711900 . + 0 # 11 x GT Adh calypso tandemrepeat 1711879 1711900 . + 0 # 11 x GT Adh calypso tandemrepeat 1716209 1716223 . + 1 # 15 x A Adh calypso tandemrepeat 1716209 1716223 . + 1 # 15 x A Adh calypso tandemrepeat 1719118 1719132 . + 0 # 3 x TCTGG Adh calypso tandemrepeat 1719118 1719132 . + 0 # 3 x TCTGG Adh calypso tandemrepeat 1720833 1720847 . + 2 # 5 x GCA Adh calypso tandemrepeat 1720833 1720847 . + 2 # 5 x GCA Adh calypso tandemrepeat 1721342 1721361 . + 1 # 5 x ACCG Adh calypso tandemrepeat 1721342 1721361 . + 1 # 5 x ACCG Adh calypso tandemrepeat 1728633 1728653 . + 2 # 7 x GCA Adh calypso tandemrepeat 1728633 1728653 . + 2 # 7 x GCA Adh calypso tandemrepeat 1728651 1728668 . + 2 # 3 x GCAACA Adh calypso tandemrepeat 1728651 1728668 . + 2 # 3 x GCAACA Adh calypso tandemrepeat 1728691 1728708 . + 0 # 3 x AACAGA Adh calypso tandemrepeat 1728691 1728708 . + 0 # 3 x AACAGA Adh calypso tandemrepeat 1731915 1731930 . + 2 # 16 x T Adh calypso tandemrepeat 1731915 1731930 . + 2 # 16 x T Adh calypso tandemrepeat 1732055 1732070 . + 1 # 4 x TGGT Adh calypso tandemrepeat 1732055 1732070 . + 1 # 4 x TGGT Adh calypso tandemrepeat 1732939 1732956 . + 0 # 3 x ACTGCA Adh calypso tandemrepeat 1732939 1732956 . + 0 # 3 x ACTGCA Adh calypso tandemrepeat 1733238 1733257 . + 2 # 20 x G Adh calypso tandemrepeat 1733238 1733257 . + 2 # 20 x G Adh calypso tandemrepeat 1743287 1743301 . + 1 # 3 x GAAAA Adh calypso tandemrepeat 1743287 1743301 . + 1 # 3 x GAAAA Adh calypso tandemrepeat 1744323 1744346 . + 2 # 12 x CA Adh calypso tandemrepeat 1744323 1744346 . + 2 # 12 x CA Adh calypso tandemrepeat 1748374 1748393 . + 0 # 10 x AT Adh calypso tandemrepeat 1748374 1748393 . + 0 # 10 x AT Adh calypso tandemrepeat 1748763 1748780 . + 2 # 6 x GCT Adh calypso tandemrepeat 1748763 1748780 . + 2 # 6 x GCT Adh calypso tandemrepeat 1749219 1749233 . + 2 # 3 x TTTCA Adh calypso tandemrepeat 1749219 1749233 . + 2 # 3 x TTTCA Adh calypso tandemrepeat 1750669 1750684 . + 0 # 8 x AT Adh calypso tandemrepeat 1750669 1750684 . + 0 # 8 x AT Adh calypso tandemrepeat 1759771 1759785 . + 0 # 5 x CTC Adh calypso tandemrepeat 1759771 1759785 . + 0 # 5 x CTC Adh calypso tandemrepeat 1759771 1759785 . + 0 # 5 x CTC Adh calypso tandemrepeat 1759771 1759785 . + 0 # 5 x CTC Adh calypso tandemrepeat 1768537 1768551 . + 0 # 3 x ATTGA Adh calypso tandemrepeat 1768537 1768551 . + 0 # 3 x ATTGA Adh calypso tandemrepeat 1768850 1768864 . + 1 # 3 x GTCCC Adh calypso tandemrepeat 1768850 1768864 . + 1 # 3 x GTCCC Adh calypso tandemrepeat 1771355 1771369 . + 1 # 15 x A Adh calypso tandemrepeat 1771355 1771369 . + 1 # 15 x A Adh calypso tandemrepeat 1773901 1773924 . + 0 # 4 x CAACTG Adh calypso tandemrepeat 1773901 1773924 . + 0 # 4 x CAACTG Adh calypso tandemrepeat 1780460 1780477 . + 1 # 3 x CCTGCT Adh calypso tandemrepeat 1780460 1780477 . + 1 # 3 x CCTGCT Adh calypso tandemrepeat 1782835 1782850 . + 0 # 16 x A Adh calypso tandemrepeat 1782835 1782850 . + 0 # 16 x A Adh calypso tandemrepeat 1783221 1783244 . + 2 # 4 x GTCCCA Adh calypso tandemrepeat 1783221 1783244 . + 2 # 4 x GTCCCA Adh calypso tandemrepeat 1784347 1784361 . + 0 # 3 x ATCCC Adh calypso tandemrepeat 1784347 1784361 . + 0 # 3 x ATCCC Adh calypso tandemrepeat 1789748 1789765 . + 1 # 9 x AT Adh calypso tandemrepeat 1789748 1789765 . + 1 # 9 x AT Adh calypso tandemrepeat 1790342 1790359 . + 1 # 3 x CCCGAT Adh calypso tandemrepeat 1790342 1790359 . + 1 # 3 x CCCGAT Adh calypso tandemrepeat 1792295 1792309 . + 1 # 3 x GGATT Adh calypso tandemrepeat 1792295 1792309 . + 1 # 3 x GGATT Adh calypso tandemrepeat 1795954 1795969 . + 0 # 8 x AT Adh calypso tandemrepeat 1795954 1795969 . + 0 # 8 x AT Adh calypso tandemrepeat 1804501 1804521 . + 0 # 7 x GCA Adh calypso tandemrepeat 1804501 1804521 . + 0 # 7 x GCA Adh calypso tandemrepeat 1804501 1804521 . + 0 # 7 x GCA Adh calypso tandemrepeat 1804501 1804521 . + 0 # 7 x GCA Adh calypso tandemrepeat 1809576 1809591 . + 2 # 8 x AC Adh calypso tandemrepeat 1809576 1809591 . + 2 # 8 x AC Adh calypso tandemrepeat 1810147 1810161 . + 0 # 5 x CAT Adh calypso tandemrepeat 1810147 1810161 . + 0 # 5 x CAT Adh calypso tandemrepeat 1811857 1811871 . + 0 # 5 x GAT Adh calypso tandemrepeat 1811857 1811871 . + 0 # 5 x GAT Adh calypso tandemrepeat 1819458 1819475 . + 2 # 3 x GTCCAT Adh calypso tandemrepeat 1819458 1819475 . + 2 # 3 x GTCCAT Adh calypso tandemrepeat 1819551 1819565 . + 2 # 15 x T Adh calypso tandemrepeat 1819551 1819565 . + 2 # 15 x T Adh calypso tandemrepeat 1826722 1826741 . + 0 # 4 x GAAAC Adh calypso tandemrepeat 1826722 1826741 . + 0 # 4 x GAAAC Adh calypso tandemrepeat 1827715 1827729 . + 0 # 3 x TTATT Adh calypso tandemrepeat 1827715 1827729 . + 0 # 3 x TTATT Adh calypso tandemrepeat 1836335 1836352 . + 1 # 3 x GCCAAT Adh calypso tandemrepeat 1836335 1836352 . + 1 # 3 x GCCAAT Adh calypso tandemrepeat 1836793 1836810 . + 0 # 3 x TGGAGC Adh calypso tandemrepeat 1836793 1836810 . + 0 # 3 x TGGAGC Adh calypso tandemrepeat 1837499 1837513 . + 1 # 3 x ATTCG Adh calypso tandemrepeat 1837499 1837513 . + 1 # 3 x ATTCG Adh calypso tandemrepeat 1838248 1838265 . + 0 # 6 x TCA Adh calypso tandemrepeat 1838248 1838265 . + 0 # 6 x TCA Adh calypso tandemrepeat 1840936 1840956 . + 0 # 7 x GTA Adh calypso tandemrepeat 1840936 1840956 . + 0 # 7 x GTA Adh calypso tandemrepeat 1853377 1853391 . + 0 # 3 x TGAAG Adh calypso tandemrepeat 1853377 1853391 . + 0 # 3 x TGAAG Adh calypso tandemrepeat 1869690 1869707 . + 2 # 6 x ATC Adh calypso tandemrepeat 1869690 1869707 . + 2 # 6 x ATC Adh calypso tandemrepeat 1872408 1872425 . + 2 # 6 x TCA Adh calypso tandemrepeat 1872408 1872425 . + 2 # 6 x TCA Adh calypso tandemrepeat 1875472 1875489 . + 0 # 3 x GTCTCA Adh calypso tandemrepeat 1875472 1875489 . + 0 # 3 x GTCTCA Adh calypso tandemrepeat 1883451 1883465 . + 2 # 3 x TAATT Adh calypso tandemrepeat 1883451 1883465 . + 2 # 3 x TAATT Adh calypso tandemrepeat 1897863 1897877 . + 2 # 5 x ATG Adh calypso tandemrepeat 1897863 1897877 . + 2 # 5 x ATG Adh calypso tandemrepeat 1899801 1899818 . + 2 # 6 x GAT Adh calypso tandemrepeat 1899801 1899818 . + 2 # 6 x GAT Adh calypso tandemrepeat 1900746 1900763 . + 2 # 3 x GCAATT Adh calypso tandemrepeat 1900746 1900763 . + 2 # 3 x GCAATT Adh calypso tandemrepeat 1910604 1910619 . + 2 # 8 x TG Adh calypso tandemrepeat 1910604 1910619 . + 2 # 8 x TG Adh calypso tandemrepeat 1919272 1919295 . + 0 # 8 x GAG Adh calypso tandemrepeat 1919272 1919295 . + 0 # 8 x GAG Adh calypso tandemrepeat 1923052 1923068 . + 0 # 17 x A Adh calypso tandemrepeat 1923052 1923068 . + 0 # 17 x A Adh calypso tandemrepeat 1928694 1928708 . + 2 # 15 x T Adh calypso tandemrepeat 1928694 1928708 . + 2 # 15 x T Adh calypso tandemrepeat 1933624 1933638 . + 0 # 15 x T Adh calypso tandemrepeat 1933624 1933638 . + 0 # 15 x T Adh calypso tandemrepeat 1935928 1935945 . + 0 # 9 x CT Adh calypso tandemrepeat 1935928 1935945 . + 0 # 9 x CT Adh calypso tandemrepeat 1935928 1935945 . + 0 # 9 x CT Adh calypso tandemrepeat 1935928 1935945 . + 0 # 9 x CT Adh calypso tandemrepeat 1942940 1942957 . + 1 # 9 x CT Adh calypso tandemrepeat 1942940 1942957 . + 1 # 9 x CT Adh calypso tandemrepeat 1946191 1946208 . + 0 # 6 x TTA Adh calypso tandemrepeat 1946191 1946208 . + 0 # 6 x TTA Adh calypso tandemrepeat 1949060 1949077 . + 1 # 3 x AGACCC Adh calypso tandemrepeat 1949060 1949077 . + 1 # 3 x AGACCC Adh calypso tandemrepeat 1949721 1949738 . + 2 # 3 x GATACA Adh calypso tandemrepeat 1949721 1949738 . + 2 # 3 x GATACA Adh calypso tandemrepeat 1952050 1952064 . + 0 # 3 x GAGCT Adh calypso tandemrepeat 1952050 1952064 . + 0 # 3 x GAGCT Adh calypso tandemrepeat 1958417 1958431 . + 1 # 5 x CAA Adh calypso tandemrepeat 1958417 1958431 . + 1 # 5 x CAA Adh calypso tandemrepeat 1961718 1961733 . + 2 # 8 x TA Adh calypso tandemrepeat 1961718 1961733 . + 2 # 8 x TA Adh calypso tandemrepeat 1963456 1963470 . + 0 # 3 x ATGCG Adh calypso tandemrepeat 1963456 1963470 . + 0 # 3 x ATGCG Adh calypso tandemrepeat 1963928 1963951 . + 1 # 8 x TCC Adh calypso tandemrepeat 1963928 1963951 . + 1 # 8 x TCC Adh calypso tandemrepeat 1968103 1968120 . + 0 # 9 x CT Adh calypso tandemrepeat 1968103 1968120 . + 0 # 9 x CT Adh calypso tandemrepeat 1971709 1971723 . + 0 # 15 x A Adh calypso tandemrepeat 1971709 1971723 . + 0 # 15 x A Adh calypso tandemrepeat 1978481 1978498 . + 1 # 3 x AATGCA Adh calypso tandemrepeat 1978481 1978498 . + 1 # 3 x AATGCA Adh calypso tandemrepeat 2006358 2006381 . + 2 # 12 x CA Adh calypso tandemrepeat 2006358 2006381 . + 2 # 12 x CA Adh calypso tandemrepeat 2010735 2010749 . + 2 # 15 x A Adh calypso tandemrepeat 2010735 2010749 . + 2 # 15 x A Adh calypso tandemrepeat 2016529 2016545 . + 0 # 17 x A Adh calypso tandemrepeat 2016529 2016545 . + 0 # 17 x A Adh calypso tandemrepeat 2020365 2020384 . + 2 # 20 x T Adh calypso tandemrepeat 2020365 2020384 . + 2 # 20 x T Adh calypso tandemrepeat 2025530 2025544 . + 1 # 3 x CATTT Adh calypso tandemrepeat 2025530 2025544 . + 1 # 3 x CATTT Adh calypso tandemrepeat 2025530 2025544 . + 1 # 3 x CATTT Adh calypso tandemrepeat 2025530 2025544 . + 1 # 3 x CATTT Adh calypso tandemrepeat 2028920 2028937 . + 1 # 9 x AT Adh calypso tandemrepeat 2028920 2028937 . + 1 # 9 x AT Adh calypso tandemrepeat 2028920 2028937 . + 1 # 9 x AT Adh calypso tandemrepeat 2028920 2028937 . + 1 # 9 x AT Adh calypso tandemrepeat 2042609 2042624 . + 1 # 4 x AAAT Adh calypso tandemrepeat 2042609 2042624 . + 1 # 4 x AAAT Adh calypso tandemrepeat 2044384 2044398 . + 0 # 5 x GCA Adh calypso tandemrepeat 2044384 2044398 . + 0 # 5 x GCA Adh calypso tandemrepeat 2057669 2057683 . + 1 # 3 x CGTTT Adh calypso tandemrepeat 2057669 2057683 . + 1 # 3 x CGTTT Adh calypso tandemrepeat 2064384 2064398 . + 2 # 3 x ATATT Adh calypso tandemrepeat 2064384 2064398 . + 2 # 3 x ATATT Adh calypso tandemrepeat 2084139 2084153 . + 2 # 3 x GTATA Adh calypso tandemrepeat 2084139 2084153 . + 2 # 3 x GTATA Adh calypso tandemrepeat 2085093 2085110 . + 2 # 9 x TA Adh calypso tandemrepeat 2085093 2085110 . + 2 # 9 x TA Adh calypso tandemrepeat 2087717 2087731 . + 1 # 15 x T Adh calypso tandemrepeat 2087717 2087731 . + 1 # 15 x T Adh calypso tandemrepeat 2089161 2089175 . + 2 # 3 x CATTT Adh calypso tandemrepeat 2089161 2089175 . + 2 # 3 x CATTT Adh calypso tandemrepeat 2089530 2089547 . + 2 # 3 x CAACAT Adh calypso tandemrepeat 2089530 2089547 . + 2 # 3 x CAACAT Adh calypso tandemrepeat 2097990 2098011 . + 2 # 11 x TG Adh calypso tandemrepeat 2097990 2098011 . + 2 # 11 x TG Adh calypso tandemrepeat 2098669 2098686 . + 0 # 9 x TC Adh calypso tandemrepeat 2098669 2098686 . + 0 # 9 x TC Adh calypso tandemrepeat 2111586 2111601 . + 2 # 8 x CA Adh calypso tandemrepeat 2111586 2111601 . + 2 # 8 x CA Adh calypso tandemrepeat 2118089 2118103 . + 1 # 15 x T Adh calypso tandemrepeat 2118089 2118103 . + 1 # 15 x T Adh calypso tandemrepeat 2118089 2118103 . + 1 # 15 x T Adh calypso tandemrepeat 2123067 2123082 . + 2 # 4 x CTAT Adh calypso tandemrepeat 2123067 2123082 . + 2 # 4 x CTAT Adh calypso tandemrepeat 2128235 2128252 . + 1 # 6 x CAG Adh calypso tandemrepeat 2128235 2128252 . + 1 # 6 x CAG Adh calypso tandemrepeat 2141813 2141827 . + 1 # 3 x ATAAA Adh calypso tandemrepeat 2141813 2141827 . + 1 # 3 x ATAAA Adh calypso tandemrepeat 2144259 2144274 . + 2 # 16 x A Adh calypso tandemrepeat 2144259 2144274 . + 2 # 16 x A Adh calypso tandemrepeat 2144485 2144502 . + 0 # 3 x GTATGG Adh calypso tandemrepeat 2144485 2144502 . + 0 # 3 x GTATGG Adh calypso tandemrepeat 2144514 2144531 . + 2 # 3 x GGTCTG Adh calypso tandemrepeat 2144514 2144531 . + 2 # 3 x GGTCTG Adh calypso tandemrepeat 2146666 2146680 . + 0 # 3 x GATGC Adh calypso tandemrepeat 2146666 2146680 . + 0 # 3 x GATGC Adh calypso tandemrepeat 2146796 2146813 . + 1 # 3 x GCAGGG Adh calypso tandemrepeat 2146796 2146813 . + 1 # 3 x GCAGGG Adh calypso tandemrepeat 2154241 2154261 . + 0 # 7 x CAG Adh calypso tandemrepeat 2154241 2154261 . + 0 # 7 x CAG Adh calypso tandemrepeat 2159937 2159962 . + 2 # 13 x CA Adh calypso tandemrepeat 2159937 2159962 . + 2 # 13 x CA Adh calypso tandemrepeat 2160363 2160377 . + 2 # 3 x ATATT Adh calypso tandemrepeat 2160363 2160377 . + 2 # 3 x ATATT Adh calypso tandemrepeat 2160363 2160377 . + 2 # 3 x ATATT Adh calypso tandemrepeat 2160363 2160377 . + 2 # 3 x ATATT Adh calypso tandemrepeat 2162285 2162300 . + 1 # 4 x TCGC Adh calypso tandemrepeat 2162285 2162300 . + 1 # 4 x TCGC Adh calypso tandemrepeat 2162285 2162300 . + 1 # 4 x TCGC Adh calypso tandemrepeat 2162285 2162300 . + 1 # 4 x TCGC Adh calypso tandemrepeat 2163052 2163069 . + 0 # 9 x AC Adh calypso tandemrepeat 2163052 2163069 . + 0 # 9 x AC Adh calypso tandemrepeat 2163052 2163069 . + 0 # 9 x AC Adh calypso tandemrepeat 2163052 2163069 . + 0 # 9 x AC Adh calypso tandemrepeat 2168181 2168200 . + 2 # 10 x AT Adh calypso tandemrepeat 2168181 2168200 . + 2 # 10 x AT Adh calypso tandemrepeat 2168525 2168542 . + 1 # 3 x CTCGAA Adh calypso tandemrepeat 2168525 2168542 . + 1 # 3 x CTCGAA Adh calypso tandemrepeat 2168789 2168808 . + 1 # 5 x AAGA Adh calypso tandemrepeat 2168789 2168808 . + 1 # 5 x AAGA Adh calypso tandemrepeat 2168860 2168877 . + 0 # 3 x CCCCCT Adh calypso tandemrepeat 2168860 2168877 . + 0 # 3 x CCCCCT Adh calypso tandemrepeat 2169754 2169771 . + 0 # 9 x CA Adh calypso tandemrepeat 2169754 2169771 . + 0 # 9 x CA Adh calypso tandemrepeat 2170312 2170326 . + 0 # 3 x AAAAT Adh calypso tandemrepeat 2170312 2170326 . + 0 # 3 x AAAAT Adh calypso tandemrepeat 2170345 2170360 . + 0 # 8 x CA Adh calypso tandemrepeat 2170345 2170360 . + 0 # 8 x CA Adh calypso tandemrepeat 2170565 2170582 . + 1 # 3 x TGTGAG Adh calypso tandemrepeat 2170565 2170582 . + 1 # 3 x TGTGAG Adh calypso tandemrepeat 2180401 2180416 . + 0 # 8 x TA Adh calypso tandemrepeat 2180401 2180416 . + 0 # 8 x TA Adh calypso tandemrepeat 2183371 2183385 . + 0 # 5 x GTT Adh calypso tandemrepeat 2183371 2183385 . + 0 # 5 x GTT Adh calypso tandemrepeat 2185062 2185076 . + 2 # 15 x T Adh calypso tandemrepeat 2185062 2185076 . + 2 # 15 x T Adh calypso tandemrepeat 2185203 2185220 . + 2 # 3 x AATGAA Adh calypso tandemrepeat 2185203 2185220 . + 2 # 3 x AATGAA Adh calypso tandemrepeat 2190034 2190048 . + 0 # 15 x T Adh calypso tandemrepeat 2190034 2190048 . + 0 # 15 x T Adh calypso tandemrepeat 2190264 2190281 . + 2 # 3 x GGAAAT Adh calypso tandemrepeat 2190264 2190281 . + 2 # 3 x GGAAAT Adh calypso tandemrepeat 2191532 2191555 . + 1 # 8 x TGA Adh calypso tandemrepeat 2191532 2191555 . + 1 # 8 x TGA Adh calypso tandemrepeat 2192530 2192544 . + 0 # 3 x AAATT Adh calypso tandemrepeat 2192530 2192544 . + 0 # 3 x AAATT Adh calypso tandemrepeat 2198374 2198388 . + 0 # 5 x TCG Adh calypso tandemrepeat 2198374 2198388 . + 0 # 5 x TCG Adh calypso tandemrepeat 2214823 2214837 . + 0 # 5 x AAT Adh calypso tandemrepeat 2214823 2214837 . + 0 # 5 x AAT Adh calypso tandemrepeat 2214859 2214876 . + 0 # 6 x AAT Adh calypso tandemrepeat 2214859 2214876 . + 0 # 6 x AAT Adh calypso tandemrepeat 2215406 2215437 . + 1 # 8 x GATG Adh calypso tandemrepeat 2215406 2215437 . + 1 # 8 x GATG Adh calypso tandemrepeat 2215825 2215845 . + 0 # 7 x TAA Adh calypso tandemrepeat 2215825 2215845 . + 0 # 7 x TAA Adh calypso tandemrepeat 2215861 2215875 . + 0 # 5 x TAA Adh calypso tandemrepeat 2215861 2215875 . + 0 # 5 x TAA Adh calypso tandemrepeat 2230139 2230156 . + 1 # 9 x AC Adh calypso tandemrepeat 2230139 2230156 . + 1 # 9 x AC Adh calypso tandemrepeat 2230365 2230382 . + 2 # 9 x GT Adh calypso tandemrepeat 2230365 2230382 . + 2 # 9 x GT Adh calypso tandemrepeat 2231181 2231198 . + 2 # 6 x TCA Adh calypso tandemrepeat 2231181 2231198 . + 2 # 6 x TCA Adh calypso tandemrepeat 2232468 2232482 . + 2 # 3 x ACAAA Adh calypso tandemrepeat 2232468 2232482 . + 2 # 3 x ACAAA Adh calypso tandemrepeat 2234024 2234038 . + 1 # 15 x T Adh calypso tandemrepeat 2234024 2234038 . + 1 # 15 x T Adh calypso tandemrepeat 2242794 2242816 . + 2 # 23 x A Adh calypso tandemrepeat 2242794 2242816 . + 2 # 23 x A Adh calypso tandemrepeat 2248183 2248197 . + 0 # 5 x TGA Adh calypso tandemrepeat 2248183 2248197 . + 0 # 5 x TGA Adh calypso tandemrepeat 2259378 2259392 . + 2 # 5 x TTA Adh calypso tandemrepeat 2259378 2259392 . + 2 # 5 x TTA Adh calypso tandemrepeat 2267417 2267434 . + 1 # 9 x AT Adh calypso tandemrepeat 2267417 2267434 . + 1 # 9 x AT Adh calypso tandemrepeat 2277326 2277340 . + 1 # 5 x AGC Adh calypso tandemrepeat 2277326 2277340 . + 1 # 5 x AGC Adh calypso tandemrepeat 2279921 2279936 . + 1 # 4 x AATA Adh calypso tandemrepeat 2279921 2279936 . + 1 # 4 x AATA Adh calypso tandemrepeat 2280187 2280208 . + 0 # 22 x A Adh calypso tandemrepeat 2280187 2280208 . + 0 # 22 x A Adh calypso tandemrepeat 2298057 2298071 . + 2 # 15 x A Adh calypso tandemrepeat 2298057 2298071 . + 2 # 15 x A Adh calypso tandemrepeat 2298057 2298071 . + 2 # 15 x A Adh calypso tandemrepeat 2298057 2298071 . + 2 # 15 x A Adh calypso tandemrepeat 2301737 2301756 . + 1 # 10 x CA Adh calypso tandemrepeat 2301737 2301756 . + 1 # 10 x CA Adh calypso tandemrepeat 2302523 2302543 . + 1 # 7 x AGC Adh calypso tandemrepeat 2302523 2302543 . + 1 # 7 x AGC Adh calypso tandemrepeat 2321002 2321024 . + 0 # 23 x A Adh calypso tandemrepeat 2321002 2321024 . + 0 # 23 x A Adh calypso tandemrepeat 2324093 2324107 . + 1 # 15 x A Adh calypso tandemrepeat 2324093 2324107 . + 1 # 15 x A Adh calypso tandemrepeat 2348152 2348171 . + 0 # 4 x ATACC Adh calypso tandemrepeat 2348152 2348171 . + 0 # 4 x ATACC Adh calypso tandemrepeat 2348301 2348315 . + 2 # 15 x G Adh calypso tandemrepeat 2348301 2348315 . + 2 # 15 x G Adh calypso tandemrepeat 2356498 2356512 . + 0 # 3 x AACAG Adh calypso tandemrepeat 2356498 2356512 . + 0 # 3 x AACAG Adh calypso tandemrepeat 2363903 2363918 . + 1 # 8 x TA Adh calypso tandemrepeat 2363903 2363918 . + 1 # 8 x TA Adh calypso tandemrepeat 2365560 2365574 . + 2 # 15 x A Adh calypso tandemrepeat 2365560 2365574 . + 2 # 15 x A Adh calypso tandemrepeat 2373664 2373679 . + 0 # 4 x AATA Adh calypso tandemrepeat 2373664 2373679 . + 0 # 4 x AATA Adh calypso tandemrepeat 2379370 2379385 . + 0 # 16 x A Adh calypso tandemrepeat 2379370 2379385 . + 0 # 16 x A Adh calypso tandemrepeat 2382389 2382404 . + 1 # 8 x AC Adh calypso tandemrepeat 2382389 2382404 . + 1 # 8 x AC Adh calypso tandemrepeat 2400669 2400683 . + 2 # 5 x TGT Adh calypso tandemrepeat 2400669 2400683 . + 2 # 5 x TGT Adh calypso tandemrepeat 2401208 2401225 . + 1 # 9 x AT Adh calypso tandemrepeat 2401208 2401225 . + 1 # 9 x AT Adh calypso tandemrepeat 2401610 2401629 . + 1 # 4 x ATAAT Adh calypso tandemrepeat 2401610 2401629 . + 1 # 4 x ATAAT Adh calypso tandemrepeat 2405966 2405981 . + 1 # 8 x AT Adh calypso tandemrepeat 2405966 2405981 . + 1 # 8 x AT Adh calypso tandemrepeat 2414339 2414356 . + 1 # 6 x CAA Adh calypso tandemrepeat 2414339 2414356 . + 1 # 6 x CAA Adh calypso tandemrepeat 2418287 2418302 . + 1 # 4 x GTGC Adh calypso tandemrepeat 2418287 2418302 . + 1 # 4 x GTGC Adh calypso tandemrepeat 2421556 2421570 . + 0 # 5 x TGG Adh calypso tandemrepeat 2421556 2421570 . + 0 # 5 x TGG Adh calypso tandemrepeat 2421891 2421906 . + 2 # 4 x ATAC Adh calypso tandemrepeat 2421891 2421906 . + 2 # 4 x ATAC Adh calypso tandemrepeat 2425056 2425079 . + 2 # 6 x ACTG Adh calypso tandemrepeat 2425056 2425079 . + 2 # 6 x ACTG Adh calypso tandemrepeat 2425105 2425122 . + 0 # 9 x GT Adh calypso tandemrepeat 2425105 2425122 . + 0 # 9 x GT Adh calypso tandemrepeat 2427790 2427807 . + 0 # 9 x TA Adh calypso tandemrepeat 2427790 2427807 . + 0 # 9 x TA Adh calypso tandemrepeat 2435576 2435590 . + 1 # 15 x A Adh calypso tandemrepeat 2435576 2435590 . + 1 # 15 x A Adh calypso tandemrepeat 2439263 2439278 . + 1 # 8 x TG Adh calypso tandemrepeat 2439263 2439278 . + 1 # 8 x TG Adh calypso tandemrepeat 2439509 2439523 . + 1 # 3 x GTAAT Adh calypso tandemrepeat 2439509 2439523 . + 1 # 3 x GTAAT Adh calypso tandemrepeat 2441087 2441104 . + 1 # 3 x ACGCAC Adh calypso tandemrepeat 2441087 2441104 . + 1 # 3 x ACGCAC Adh calypso tandemrepeat 2444339 2444362 . + 1 # 12 x GT Adh calypso tandemrepeat 2444339 2444362 . + 1 # 12 x GT Adh calypso tandemrepeat 2455870 2455885 . + 0 # 16 x A Adh calypso tandemrepeat 2455870 2455885 . + 0 # 16 x A Adh calypso tandemrepeat 2456271 2456288 . + 2 # 3 x CATATA Adh calypso tandemrepeat 2456271 2456288 . + 2 # 3 x CATATA Adh calypso tandemrepeat 2467970 2467987 . + 1 # 3 x AATGCG Adh calypso tandemrepeat 2467970 2467987 . + 1 # 3 x AATGCG Adh calypso tandemrepeat 2475185 2475199 . + 1 # 3 x TAGAA Adh calypso tandemrepeat 2475185 2475199 . + 1 # 3 x TAGAA Adh calypso tandemrepeat 2475185 2475199 . + 1 # 3 x TAGAA Adh calypso tandemrepeat 2475185 2475199 . + 1 # 3 x TAGAA Adh calypso tandemrepeat 2481905 2481922 . + 1 # 3 x TGGATA Adh calypso tandemrepeat 2481905 2481922 . + 1 # 3 x TGGATA Adh calypso tandemrepeat 2483605 2483620 . + 0 # 4 x TACA Adh calypso tandemrepeat 2483605 2483620 . + 0 # 4 x TACA Adh calypso tandemrepeat 2488498 2488512 . + 0 # 5 x TGA Adh calypso tandemrepeat 2488498 2488512 . + 0 # 5 x TGA Adh calypso tandemrepeat 2493288 2493302 . + 2 # 5 x ATC Adh calypso tandemrepeat 2493288 2493302 . + 2 # 5 x ATC Adh calypso tandemrepeat 2499108 2499123 . + 2 # 8 x CT Adh calypso tandemrepeat 2499108 2499123 . + 2 # 8 x CT Adh calypso tandemrepeat 2500796 2500822 . + 1 # 9 x GGA Adh calypso tandemrepeat 2500796 2500822 . + 1 # 9 x GGA Adh calypso tandemrepeat 2503704 2503721 . + 2 # 9 x TG Adh calypso tandemrepeat 2503704 2503721 . + 2 # 9 x TG Adh calypso tandemrepeat 2504989 2505006 . + 0 # 3 x CATCCC Adh calypso tandemrepeat 2504989 2505006 . + 0 # 3 x CATCCC Adh calypso tandemrepeat 2512367 2512389 . + 1 # 23 x T Adh calypso tandemrepeat 2512367 2512389 . + 1 # 23 x T Adh calypso tandemrepeat 2512599 2512613 . + 2 # 3 x GACCT Adh calypso tandemrepeat 2512599 2512613 . + 2 # 3 x GACCT Adh calypso tandemrepeat 2512614 2512633 . + 2 # 4 x GAACT Adh calypso tandemrepeat 2512614 2512633 . + 2 # 4 x GAACT Adh calypso tandemrepeat 2515812 2515828 . + 2 # 17 x T Adh calypso tandemrepeat 2515812 2515828 . + 2 # 17 x T Adh calypso tandemrepeat 2518426 2518441 . + 0 # 8 x AC Adh calypso tandemrepeat 2518426 2518441 . + 0 # 8 x AC Adh calypso tandemrepeat 2528405 2528420 . + 1 # 8 x AC Adh calypso tandemrepeat 2528405 2528420 . + 1 # 8 x AC Adh calypso tandemrepeat 2542285 2542304 . + 0 # 5 x AACA Adh calypso tandemrepeat 2542285 2542304 . + 0 # 5 x AACA Adh calypso tandemrepeat 2561483 2561499 . + 1 # 17 x A Adh calypso tandemrepeat 2561483 2561499 . + 1 # 17 x A Adh calypso tandemrepeat 2562377 2562391 . + 1 # 3 x TGCAC Adh calypso tandemrepeat 2562377 2562391 . + 1 # 3 x TGCAC Adh calypso tandemrepeat 2562544 2562559 . + 0 # 8 x GA Adh calypso tandemrepeat 2562544 2562559 . + 0 # 8 x GA Adh calypso tandemrepeat 2562999 2563013 . + 2 # 3 x TTTGT Adh calypso tandemrepeat 2562999 2563013 . + 2 # 3 x TTTGT Adh calypso tandemrepeat 2564121 2564135 . + 2 # 3 x TTGAC Adh calypso tandemrepeat 2564121 2564135 . + 2 # 3 x TTGAC Adh calypso tandemrepeat 2570414 2570441 . + 1 # 14 x AC Adh calypso tandemrepeat 2570414 2570441 . + 1 # 14 x AC Adh calypso tandemrepeat 2579771 2579796 . + 1 # 13 x TA Adh calypso tandemrepeat 2579771 2579796 . + 1 # 13 x TA Adh calypso tandemrepeat 2581725 2581745 . + 2 # 21 x T Adh calypso tandemrepeat 2581725 2581745 . + 2 # 21 x T Adh calypso tandemrepeat 2582249 2582264 . + 1 # 8 x AC Adh calypso tandemrepeat 2582249 2582264 . + 1 # 8 x AC Adh calypso tandemrepeat 2590705 2590720 . + 0 # 4 x TATT Adh calypso tandemrepeat 2590705 2590720 . + 0 # 4 x TATT Adh calypso tandemrepeat 2595578 2595593 . + 1 # 4 x TATT Adh calypso tandemrepeat 2595578 2595593 . + 1 # 4 x TATT Adh calypso tandemrepeat 2596019 2596036 . + 1 # 3 x TCGTCC Adh calypso tandemrepeat 2596019 2596036 . + 1 # 3 x TCGTCC Adh calypso tandemrepeat 2597900 2597919 . + 1 # 4 x TTCCG Adh calypso tandemrepeat 2597900 2597919 . + 1 # 4 x TTCCG Adh calypso tandemrepeat 2613229 2613243 . + 0 # 3 x AAAAT Adh calypso tandemrepeat 2613229 2613243 . + 0 # 3 x AAAAT Adh calypso tandemrepeat 2613229 2613243 . + 0 # 3 x AAAAT Adh calypso tandemrepeat 2613229 2613243 . + 0 # 3 x AAAAT Adh calypso tandemrepeat 2627807 2627824 . + 1 # 9 x TA Adh calypso tandemrepeat 2627807 2627824 . + 1 # 9 x TA Adh calypso tandemrepeat 2637495 2637509 . + 2 # 3 x CTTTT Adh calypso tandemrepeat 2637495 2637509 . + 2 # 3 x CTTTT Adh calypso tandemrepeat 2640286 2640300 . + 0 # 5 x AGC Adh calypso tandemrepeat 2640286 2640300 . + 0 # 5 x AGC Adh calypso tandemrepeat 2648139 2648156 . + 2 # 18 x T Adh calypso tandemrepeat 2648139 2648156 . + 2 # 18 x T Adh calypso tandemrepeat 2653285 2653300 . + 0 # 8 x CA Adh calypso tandemrepeat 2653285 2653300 . + 0 # 8 x CA Adh calypso tandemrepeat 2658749 2658763 . + 1 # 3 x TTTCA Adh calypso tandemrepeat 2658749 2658763 . + 1 # 3 x TTTCA Adh calypso tandemrepeat 2658749 2658763 . + 1 # 3 x TTTCA Adh calypso tandemrepeat 2658749 2658763 . + 1 # 3 x TTTCA Adh calypso tandemrepeat 2660137 2660156 . + 0 # 20 x T Adh calypso tandemrepeat 2660137 2660156 . + 0 # 20 x T Adh calypso tandemrepeat 2660166 2660183 . + 2 # 3 x TTTTTG Adh calypso tandemrepeat 2660166 2660183 . + 2 # 3 x TTTTTG Adh calypso tandemrepeat 2662362 2662381 . + 2 # 5 x ATTT Adh calypso tandemrepeat 2662362 2662381 . + 2 # 5 x ATTT Adh calypso tandemrepeat 2664163 2664180 . + 0 # 3 x TGGTGA Adh calypso tandemrepeat 2664163 2664180 . + 0 # 3 x TGGTGA Adh calypso tandemrepeat 2664737 2664751 . + 1 # 15 x T Adh calypso tandemrepeat 2664737 2664751 . + 1 # 15 x T Adh calypso tandemrepeat 2665008 2665025 . + 2 # 9 x AC Adh calypso tandemrepeat 2665008 2665025 . + 2 # 9 x AC Adh calypso tandemrepeat 2666920 2666934 . + 0 # 3 x TGTGT Adh calypso tandemrepeat 2666920 2666934 . + 0 # 3 x TGTGT Adh calypso tandemrepeat 2667144 2667163 . + 2 # 4 x TTTCG Adh calypso tandemrepeat 2667144 2667163 . + 2 # 4 x TTTCG Adh calypso tandemrepeat 2671441 2671459 . + 0 # 19 x A Adh calypso tandemrepeat 2671441 2671459 . + 0 # 19 x A Adh calypso tandemrepeat 2674620 2674640 . + 2 # 7 x TGA Adh calypso tandemrepeat 2674620 2674640 . + 2 # 7 x TGA Adh calypso tandemrepeat 2680817 2680834 . + 1 # 9 x CA Adh calypso tandemrepeat 2680817 2680834 . + 1 # 9 x CA Adh calypso tandemrepeat 2681867 2681882 . + 1 # 4 x TTTA Adh calypso tandemrepeat 2681867 2681882 . + 1 # 4 x TTTA Adh calypso tandemrepeat 2683317 2683334 . + 2 # 9 x AT Adh calypso tandemrepeat 2683317 2683334 . + 2 # 9 x AT Adh calypso tandemrepeat 2689260 2689281 . + 2 # 11 x AT Adh calypso tandemrepeat 2689260 2689281 . + 2 # 11 x AT Adh calypso tandemrepeat 2698422 2698439 . + 2 # 3 x ATAAAT Adh calypso tandemrepeat 2698422 2698439 . + 2 # 3 x ATAAAT Adh calypso tandemrepeat 2702531 2702545 . + 1 # 15 x T Adh calypso tandemrepeat 2702531 2702545 . + 1 # 15 x T Adh calypso tandemrepeat 2702531 2702545 . + 1 # 15 x T Adh calypso tandemrepeat 2702531 2702545 . + 1 # 15 x T Adh calypso tandemrepeat 2703085 2703102 . + 0 # 3 x ATAGAT Adh calypso tandemrepeat 2703085 2703102 . + 0 # 3 x ATAGAT Adh calypso tandemrepeat 2703085 2703102 . + 0 # 3 x ATAGAT Adh calypso tandemrepeat 2703085 2703102 . + 0 # 3 x ATAGAT Adh calypso tandemrepeat 2704032 2704048 . + 2 # 17 x A Adh calypso tandemrepeat 2704032 2704048 . + 2 # 17 x A Adh calypso tandemrepeat 2704032 2704048 . + 2 # 17 x A Adh calypso tandemrepeat 2704032 2704048 . + 2 # 17 x A Adh calypso tandemrepeat 2713535 2713554 . + 1 # 10 x AT Adh calypso tandemrepeat 2713535 2713554 . + 1 # 10 x AT Adh calypso tandemrepeat 2713677 2713696 . + 2 # 4 x TTTTG Adh calypso tandemrepeat 2713677 2713696 . + 2 # 4 x TTTTG Adh calypso tandemrepeat 2714256 2714271 . + 2 # 4 x TGTA Adh calypso tandemrepeat 2714256 2714271 . + 2 # 4 x TGTA Adh calypso tandemrepeat 2717410 2717425 . + 0 # 8 x CT Adh calypso tandemrepeat 2717410 2717425 . + 0 # 8 x CT Adh calypso tandemrepeat 2718928 2718945 . + 0 # 9 x CT Adh calypso tandemrepeat 2718928 2718945 . + 0 # 9 x CT Adh calypso tandemrepeat 2725501 2725550 . + 0 # 25 x TA Adh calypso tandemrepeat 2725501 2725550 . + 0 # 25 x TA Adh calypso tandemrepeat 2726451 2726468 . + 2 # 6 x GTT Adh calypso tandemrepeat 2726451 2726468 . + 2 # 6 x GTT Adh calypso tandemrepeat 2733177 2733192 . + 2 # 16 x A Adh calypso tandemrepeat 2733177 2733192 . + 2 # 16 x A Adh calypso tandemrepeat 2733666 2733683 . + 2 # 18 x A Adh calypso tandemrepeat 2733666 2733683 . + 2 # 18 x A Adh calypso tandemrepeat 2736698 2736713 . + 1 # 8 x AG Adh calypso tandemrepeat 2736698 2736713 . + 1 # 8 x AG Adh calypso tandemrepeat 2738053 2738076 . + 0 # 8 x AGG Adh calypso tandemrepeat 2738053 2738076 . + 0 # 8 x AGG Adh calypso tandemrepeat 2738077 2738091 . + 0 # 5 x TGG Adh calypso tandemrepeat 2738077 2738091 . + 0 # 5 x TGG Adh calypso tandemrepeat 2742532 2742546 . + 0 # 5 x CTC Adh calypso tandemrepeat 2742532 2742546 . + 0 # 5 x CTC Adh calypso tandemrepeat 2748916 2748931 . + 0 # 8 x CT Adh calypso tandemrepeat 2748916 2748931 . + 0 # 8 x CT Adh calypso tandemrepeat 2748916 2748931 . + 0 # 8 x CT Adh calypso tandemrepeat 2748916 2748931 . + 0 # 8 x CT Adh calypso tandemrepeat 2750506 2750520 . + 0 # 5 x GAT Adh calypso tandemrepeat 2750506 2750520 . + 0 # 5 x GAT Adh calypso tandemrepeat 2751945 2751962 . + 2 # 3 x AAAAAC Adh calypso tandemrepeat 2751945 2751962 . + 2 # 3 x AAAAAC Adh calypso tandemrepeat 2761103 2761117 . + 1 # 3 x CTTTT Adh calypso tandemrepeat 2761103 2761117 . + 1 # 3 x CTTTT Adh calypso tandemrepeat 2768806 2768823 . + 0 # 6 x CTA Adh calypso tandemrepeat 2768806 2768823 . + 0 # 6 x CTA Adh calypso tandemrepeat 2792876 2792890 . + 1 # 3 x ATTTA Adh calypso tandemrepeat 2792876 2792890 . + 1 # 3 x ATTTA Adh calypso tandemrepeat 2792876 2792890 . + 1 # 3 x ATTTA Adh calypso tandemrepeat 2792876 2792890 . + 1 # 3 x ATTTA Adh calypso tandemrepeat 2808106 2808120 . + 0 # 15 x T Adh calypso tandemrepeat 2808106 2808120 . + 0 # 15 x T Adh calypso tandemrepeat 2809579 2809596 . + 0 # 9 x TG Adh calypso tandemrepeat 2809579 2809596 . + 0 # 9 x TG Adh calypso tandemrepeat 2816555 2816570 . + 1 # 4 x CATA Adh calypso tandemrepeat 2816555 2816570 . + 1 # 4 x CATA Adh calypso tandemrepeat 2820882 2820899 . + 2 # 6 x GTC Adh calypso tandemrepeat 2820882 2820899 . + 2 # 6 x GTC Adh calypso tandemrepeat 2827525 2827540 . + 0 # 8 x AC Adh calypso tandemrepeat 2827525 2827540 . + 0 # 8 x AC Adh calypso tandemrepeat 2835091 2835108 . + 0 # 18 x T Adh calypso tandemrepeat 2835091 2835108 . + 0 # 18 x T Adh calypso tandemrepeat 2835091 2835108 . + 0 # 18 x T Adh calypso tandemrepeat 2835091 2835108 . + 0 # 18 x T Adh calypso tandemrepeat 2837281 2837300 . + 0 # 5 x CAGC Adh calypso tandemrepeat 2837281 2837300 . + 0 # 5 x CAGC Adh calypso tandemrepeat 2837281 2837300 . + 0 # 5 x CAGC Adh calypso tandemrepeat 2837281 2837300 . + 0 # 5 x CAGC Adh calypso tandemrepeat 2850284 2850307 . + 1 # 4 x AGTGCA Adh calypso tandemrepeat 2850284 2850307 . + 1 # 4 x AGTGCA Adh calypso tandemrepeat 2856339 2856363 . + 2 # 5 x GGTAT Adh calypso tandemrepeat 2856339 2856363 . + 2 # 5 x GGTAT Adh calypso tandemrepeat 2862930 2862950 . + 2 # 7 x CAA Adh calypso tandemrepeat 2862930 2862950 . + 2 # 7 x CAA Adh calypso tandemrepeat 2879944 2879958 . + 0 # 3 x TGGGG Adh calypso tandemrepeat 2879944 2879958 . + 0 # 3 x TGGGG Adh calypso tandemrepeat 2880477 2880492 . + 2 # 4 x TATG Adh calypso tandemrepeat 2880477 2880492 . + 2 # 4 x TATG Adh calypso tandemrepeat 2880477 2880492 . + 2 # 4 x TATG Adh calypso tandemrepeat 2880477 2880492 . + 2 # 4 x TATG Adh calypso tandemrepeat 2884248 2884267 . + 2 # 4 x AAGTT Adh calypso tandemrepeat 2884248 2884267 . + 2 # 4 x AAGTT Adh calypso tandemrepeat 2884248 2884267 . + 2 # 4 x AAGTT Adh calypso tandemrepeat 2884248 2884267 . + 2 # 4 x AAGTT Adh calypso tandemrepeat 2887608 2887625 . + 2 # 9 x TA Adh calypso tandemrepeat 2887608 2887625 . + 2 # 9 x TA Adh calypso tandemrepeat 2888564 2888578 . + 1 # 3 x TGAAC Adh calypso tandemrepeat 2888564 2888578 . + 1 # 3 x TGAAC Adh calypso tandemrepeat 2888711 2888726 . + 1 # 8 x GT Adh calypso tandemrepeat 2888711 2888726 . + 1 # 8 x GT Adh calypso tandemrepeat 2892926 2892940 . + 1 # 3 x GTATT Adh calypso tandemrepeat 2892926 2892940 . + 1 # 3 x GTATT Adh calypso tandemrepeat 2907781 2907795 . + 0 # 15 x A Adh calypso tandemrepeat 2907781 2907795 . + 0 # 15 x A Adh calypso tandemrepeat 2913083 2913097 . + 1 # 5 x CAA Adh calypso tandemrepeat 2913083 2913097 . + 1 # 5 x CAA Adh calypso tandemrepeat 2913104 2913121 . + 1 # 6 x CAA Adh calypso tandemrepeat 2913104 2913121 . + 1 # 6 x CAA Adh calypso tandemrepeat 2914705 2914728 . + 0 # 12 x AT ##gff-version 2 ##source-version GH-fudged-GFF 1.0 # Thu Jul 22 11:59:08 1999 # #### # # compfly: 1. exon feature removed Jul 8 (MR) # 2. 5 extra genes removed to 38 genes Jan 19 (MR) # # Adh std1 stop_codon 133458 133460 . - . transcript "LD13077.con" Adh std1 CDS 133458 133548 . - . transcript "LD13077.con" Adh std1 splice3 133548 133549 0.96834 - 2 transcript "LD13077.con" Adh std1 splice5 133611 133612 0.76849 - 2 transcript "LD13077.con" Adh std1 CDS 133612 134233 . - . transcript "LD13077.con" Adh std1 splice3 134233 134234 0.993458 - 1 transcript "LD13077.con" Adh std1 splice5 134861 134862 0.924518 - 0 transcript "LD13077.con" Adh std1 CDS 134862 134967 . - . transcript "LD13077.con" Adh std1 start_codon 134965 134967 . - . transcript "LD13077.con" # #### #### # Adh std1 start_codon 264992 264994 . + . transcript "LD32761" Adh std1 CDS 264992 264997 . + . transcript "LD32761" Adh std1 splice5 264997 264998 0.93158 + 1 transcript "LD32761" Adh std1 splice3 265087 265088 0.906834 + 1 transcript "LD32761" Adh std1 CDS 265088 266322 . + . transcript "LD32761" Adh std1 splice5 266322 266323 0.869279 + 0 transcript "LD32761" Adh std1 splice3 266391 266392 0.474193 + 0 transcript "LD32761" Adh std1 CDS 266392 266619 . + . transcript "LD32761" Adh std1 splice5 266619 266620 0.917624 + 0 transcript "LD32761" Adh std1 splice3 266683 266684 0.90698 + 1 transcript "LD32761" Adh std1 CDS 266684 266867 . + . transcript "LD32761" Adh std1 splice5 266867 266868 0.918538 + 2 transcript "LD32761" Adh std1 splice3 266934 266935 0.99433 + 0 transcript "LD32761" Adh std1 CDS 266935 267073 . + . transcript "LD32761" Adh std1 splice5 267073 267074 0.822767 + 1 transcript "LD32761" Adh std1 splice3 267133 267134 0.662793 + 1 transcript "LD32761" Adh std1 CDS 267134 267234 . + . transcript "LD32761" Adh std1 stop_codon 267232 267234 . + . transcript "LD32761" # #### #### # Adh std1 start_codon 327175 327177 . + . transcript "LD09978-ADH.con" Adh std1 CDS 327175 328002 . + . transcript "LD09978-ADH.con" Adh std1 stop_codon 328000 328002 . + . transcript "LD09978-ADH.con" # #### #### # Adh std1 start_codon 341713 341715 . + . transcript "LP05733.con" Adh std1 CDS 341713 341857 . + . transcript "LP05733.con" Adh std1 splice5 341857 341858 0.912176 + 1 transcript "LP05733.con" Adh std1 splice3 342002 342003 0.61146 + 2 transcript "LP05733.con" Adh std1 CDS 342003 342751 . + . transcript "LP05733.con" Adh std1 stop_codon 342749 342751 . + . transcript "LP05733.con" # #### #### # Adh std1 start_codon 373286 373288 . + . transcript "LD11783" Adh std1 CDS 373286 373457 . + . transcript "LD11783" Adh std1 splice5 373457 373458 0.933466 + 2 transcript "LD11783" Adh std1 splice3 385050 385051 0.991652 + 0 transcript "LD11783" Adh std1 CDS 385051 385283 . + . transcript "LD11783" Adh std1 splice5 385283 385284 0.95516 + 2 transcript "LD11783" Adh std1 splice3 388779 388780 0.993013 + 0 transcript "LD11783" Adh std1 CDS 388780 388921 . + . transcript "LD11783" Adh std1 splice5 388921 388922 0.910938 + 1 transcript "LD11783" Adh std1 splice3 389005 389006 0.950296 + 1 transcript "LD11783" Adh std1 CDS 389006 389140 . + . transcript "LD11783" Adh std1 splice5 389140 389141 0.945288 + 1 transcript "LD11783" Adh std1 splice3 389207 389208 0.984869 + 2 transcript "LD11783" Adh std1 CDS 389208 390491 . + . transcript "LD11783" Adh std1 splice5 390491 390492 0.900353 + 2 transcript "LD11783" Adh std1 splice3 390555 390556 0.98129 + 0 transcript "LD11783" Adh std1 CDS 390556 390673 . + . transcript "LD11783" Adh std1 splice5 390673 390674 0.863471 + 1 transcript "LD11783" Adh std1 splice3 390736 390737 0.984923 + 1 transcript "LD11783" Adh std1 CDS 390737 391112 . + . transcript "LD11783" Adh std1 splice5 391112 391113 0.948849 + 2 transcript "LD11783" Adh std1 splice3 391176 391177 0.408731 + 0 transcript "LD11783" Adh std1 CDS 391177 391500 . + . transcript "LD11783" Adh std1 stop_codon 391498 391500 . + . transcript "LD11783" # #### #### # Adh std1 CDS 393573 393814 . - . transcript "LD02558" Adh std1 stop_codon 393573 393575 . - . transcript "LD02558" Adh std1 splice3 393814 393815 0.954668 - 1 transcript "LD02558" Adh std1 splice5 393893 393894 0.919564 - 0 transcript "LD02558" Adh std1 CDS 393894 394052 . - . transcript "LD02558" Adh std1 splice3 394052 394053 0.982193 - 0 transcript "LD02558" Adh std1 splice5 394382 394383 0.93305 - 0 transcript "LD02558" Adh std1 CDS 394383 395732 . - . transcript "LD02558" Adh std1 splice3 395732 395733 0.881054 - 0 transcript "LD02558" Adh std1 splice5 395825 395826 0.958123 - 0 transcript "LD02558" Adh std1 CDS 395826 397468 . - . transcript "LD02558" Adh std1 splice3 397468 397469 0.541744 - 1 transcript "LD02558" Adh std1 splice5 397531 397532 0.950599 - 1 transcript "LD02558" Adh std1 CDS 397532 397671 . - . transcript "LD02558" Adh std1 start_codon 397669 397671 . - . transcript "LD02558" Adh std1 splice3 397682 397683 0.395671 - 0 transcript "LD02558" Adh std1 splice5 398148 398149 0.653363 - 2 transcript "LD02558" # #### #### # Adh std1 stop_codon 438979 438981 . - . transcript "HL02234" Adh std1 CDS 438979 439800 . - . transcript "HL02234" Adh std1 splice3 439800 439801 0.995333 - 2 transcript "HL02234" Adh std1 splice5 440838 440839 0.829607 - 2 transcript "HL02234" Adh std1 CDS 440839 440850 . - . transcript "HL02234" Adh std1 start_codon 440848 440850 . - . transcript "HL02234" Adh std1 splice3 440877 440878 0.975589 - 2 transcript "HL02234" Adh std1 splice5 441147 441148 0.70241 - 2 transcript "HL02234" # #### #### # Adh std1 stop_codon 458837 458839 . - . transcript "HL01444" Adh std1 CDS 458837 459146 . - . transcript "HL01444" Adh std1 splice3 459146 459147 0.996797 - 0 transcript "HL01444" Adh std1 splice5 459224 459225 0.936646 - 0 transcript "HL01444" Adh std1 CDS 459225 459761 . - . transcript "HL01444" Adh std1 splice3 459761 459762 0.945978 - 0 transcript "HL01444" Adh std1 splice5 460255 460256 0.63275 - 1 transcript "HL01444" Adh std1 CDS 460256 460674 . - . transcript "HL01444" Adh std1 start_codon 460672 460674 . - . transcript "HL01444" # #### #### # Adh std1 stop_codon 462092 462094 . - . transcript "CK00536.con" Adh std1 CDS 462092 462584 . - . transcript "CK00536.con" Adh std1 splice3 462584 462585 0.990106 - 0 transcript "CK00536.con" Adh std1 splice5 462645 462646 0.792816 - 2 transcript "CK00536.con" Adh std1 CDS 462646 463209 . - . transcript "CK00536.con" Adh std1 splice3 463209 463210 0.503146 - 2 transcript "CK00536.con" Adh std1 splice5 463367 463368 0.787016 - 0 transcript "CK00536.con" Adh std1 CDS 463368 463657 . - . transcript "CK00536.con" Adh std1 start_codon 463655 463657 . - . transcript "CK00536.con" # #### #### # Adh std1 CDS 467979 469628 . - . transcript "LP05465" Adh std1 stop_codon 467979 467981 . - . transcript "LP05465" Adh std1 splice3 469628 469629 0.987362 - 0 transcript "LP05465" Adh std1 splice5 470225 470226 0.924237 - 0 transcript "LP05465" Adh std1 CDS 470226 470438 . - . transcript "LP05465" Adh std1 start_codon 470436 470438 . - . transcript "LP05465" # #### #### # Adh std1 splice5 507666 507667 0.933543 + 0 transcript "LD10778" Adh std1 splice3 509535 509536 0.661586 + 0 transcript "LD10778" Adh std1 start_codon 509545 509547 . + . transcript "LD10778" Adh std1 CDS 509545 509783 . + . transcript "LD10778" Adh std1 splice5 509783 509784 0.894676 + 2 transcript "LD10778" Adh std1 splice3 509880 509881 0.949652 + 0 transcript "LD10778" Adh std1 CDS 509881 510226 . + . transcript "LD10778" Adh std1 splice5 510226 510227 0.946104 + 1 transcript "LD10778" Adh std1 splice3 510286 510287 0.922199 + 1 transcript "LD10778" Adh std1 CDS 510287 510786 . + . transcript "LD10778" Adh std1 splice5 510786 510787 0.965435 + 0 transcript "LD10778" Adh std1 splice3 511783 511784 0.983276 + 1 transcript "LD10778" Adh std1 CDS 511784 512375 . + . transcript "LD10778" Adh std1 splice5 512375 512376 0.959547 + 2 transcript "LD10778" Adh std1 splice3 512434 512435 0.99482 + 1 transcript "LD10778" Adh std1 CDS 512435 512758 . + . transcript "LD10778" Adh std1 stop_codon 512756 512758 . + . transcript "LD10778" # #### #### # Adh std1 CDS 601945 602889 . - . transcript "HL03474" Adh std1 stop_codon 601945 601947 . - . transcript "HL03474" Adh std1 splice3 602889 602890 0.538971 - 2 transcript "HL03474" Adh std1 splice5 602943 602944 0.937227 - 2 transcript "HL03474" Adh std1 CDS 602944 603000 . - . transcript "HL03474" Adh std1 start_codon 602998 603000 . - . transcript "HL03474" # #### #### # Adh std1 stop_codon 846397 846399 . - . transcript "LD09509" Adh std1 CDS 846397 847372 . - . transcript "LD09509" Adh std1 splice3 847372 847373 0.937592 - 1 transcript "LD09509" Adh std1 splice5 847432 847433 0.965299 - 1 transcript "LD09509" Adh std1 CDS 847433 848154 . - . transcript "LD09509" Adh std1 splice3 848154 848155 0.757042 - 2 transcript "LD09509" Adh std1 splice5 848207 848208 0.93681 - 0 transcript "LD09509" Adh std1 CDS 848208 848609 . - . transcript "LD09509" Adh std1 splice3 848609 848610 0.920318 - 0 transcript "LD09509" Adh std1 splice5 848667 848668 0.87516 - 2 transcript "LD09509" Adh std1 CDS 848668 848733 . - . transcript "LD09509" Adh std1 start_codon 848731 848733 . - . transcript "LD09509" # #### #### # Adh std1 splice5 849209 849210 0.95638 + 2 transcript "LD03340" Adh std1 splice3 851076 851077 0.996516 + 0 transcript "LD03340" Adh std1 start_codon 851085 851087 . + . transcript "LD03340" Adh std1 CDS 851085 851190 . + . transcript "LD03340" Adh std1 splice5 851190 851191 0.844083 + 0 transcript "LD03340" Adh std1 splice3 851255 851256 0.728571 + 2 transcript "LD03340" Adh std1 CDS 851256 851436 . + . transcript "LD03340" Adh std1 splice5 851436 851437 0.863046 + 0 transcript "LD03340" Adh std1 splice3 851490 851491 0.905418 + 0 transcript "LD03340" Adh std1 CDS 851491 851673 . + . transcript "LD03340" Adh std1 splice5 851673 851674 0.911996 + 0 transcript "LD03340" Adh std1 splice3 851741 851742 0.722539 + 2 transcript "LD03340" Adh std1 CDS 851742 851919 . + . transcript "LD03340" Adh std1 stop_codon 851917 851919 . + . transcript "LD03340" # #### #### # Adh std1 start_codon 853116 853118 . + . transcript "LD24449" Adh std1 CDS 853116 855014 . + . transcript "LD24449" Adh std1 stop_codon 855012 855014 . + . transcript "LD24449" # #### #### # Adh std1 CDS 1231127 1231384 . - . transcript "LP03565" Adh std1 stop_codon 1231127 1231129 . - . transcript "LP03565" Adh std1 splice3 1231384 1231385 0.615477 - 1 transcript "LP03565" Adh std1 splice5 1231451 1231452 0.855764 - 0 transcript "LP03565" Adh std1 CDS 1231452 1231463 . - . transcript "LP03565" Adh std1 start_codon 1231461 1231463 . - . transcript "LP03565" # #### #### # Adh std1 CDS 1496304 1496815 . - . transcript "LD17234" Adh std1 stop_codon 1496304 1496306 . - . transcript "LD17234" Adh std1 splice3 1496815 1496816 0.929731 - 1 transcript "LD17234" Adh std1 splice5 1496864 1496865 0.950307 - 0 transcript "LD17234" Adh std1 CDS 1496865 1497000 . - . transcript "LD17234" Adh std1 start_codon 1496998 1497000 . - . transcript "LD17234" # #### #### # Adh std1 start_codon 1499670 1499672 . + . transcript "LD09819" Adh std1 CDS 1499670 1500870 . + . transcript "LD09819" Adh std1 splice5 1500870 1500871 0.908229 + 0 transcript "LD09819" Adh std1 splice3 1500927 1500928 0.962045 + 0 transcript "LD09819" Adh std1 CDS 1500928 1501010 . + . transcript "LD09819" Adh std1 stop_codon 1501008 1501010 . + . transcript "LD09819" # #### #### # Adh std1 stop_codon 1554085 1554087 . - . transcript "LD07162.con" Adh std1 CDS 1554085 1554599 . - . transcript "LD07162.con" Adh std1 splice3 1554599 1554600 0.994578 - 0 transcript "LD07162.con" Adh std1 splice5 1554840 1554841 0.875491 - 2 transcript "LD07162.con" Adh std1 CDS 1554841 1555107 . - . transcript "LD07162.con" Adh std1 splice3 1555107 1555108 0.952273 - 2 transcript "LD07162.con" Adh std1 splice5 1556587 1556588 0.945875 - 1 transcript "LD07162.con" Adh std1 CDS 1556588 1557278 . - . transcript "LD07162.con" Adh std1 start_codon 1557276 1557278 . - . transcript "LD07162.con" Adh std1 splice3 1557340 1557341 0.989298 - 1 transcript "LD07162.con" Adh std1 splice5 1557566 1557567 0.831372 - 0 transcript "LD07162.con" # #### #### # Adh std1 stop_codon 1744620 1744622 . - . transcript "LD09767" Adh std1 CDS 1744620 1745915 . - . transcript "LD09767" Adh std1 start_codon 1745913 1745915 . - . transcript "LD09767" # #### #### # Adh std1 CDS 1752891 1753316 . - . transcript "GH14032" Adh std1 stop_codon 1752891 1752893 . - . transcript "GH14032" Adh std1 splice3 1753316 1753317 0.971719 - 0 transcript "GH14032" Adh std1 splice5 1753421 1753422 0.933223 - 0 transcript "GH14032" Adh std1 CDS 1753422 1753778 . - . transcript "GH14032" Adh std1 start_codon 1753776 1753778 . - . transcript "GH14032" # #### #### # Adh std1 stop_codon 1763921 1763923 . - . transcript "GM01181" Adh std1 CDS 1763921 1764042 . - . transcript "GM01181" Adh std1 splice3 1764042 1764043 0.503562 - 2 transcript "GM01181" Adh std1 splice5 1764271 1764272 0.948258 - 1 transcript "GM01181" Adh std1 CDS 1764272 1764501 . - . transcript "GM01181" Adh std1 splice3 1764501 1764502 0.751667 - 2 transcript "GM01181" Adh std1 splice5 1764573 1764574 0.870029 - 2 transcript "GM01181" Adh std1 CDS 1764574 1764638 . - . transcript "GM01181" Adh std1 start_codon 1764636 1764638 . - . transcript "GM01181" # #### #### # Adh std1 start_codon 1988872 1988874 . + . transcript "LD17449" Adh std1 CDS 1988872 1989075 . + . transcript "LD17449" Adh std1 splice5 1989075 1989076 0.9266 + 0 transcript "LD17449" Adh std1 splice3 1991767 1991768 0.976655 + 1 transcript "LD17449" Adh std1 CDS 1991768 1992877 . + . transcript "LD17449" Adh std1 splice5 1992877 1992878 0.918599 + 1 transcript "LD17449" Adh std1 splice3 1992941 1992942 0.985702 + 2 transcript "LD17449" Adh std1 CDS 1992942 1993204 . + . transcript "LD17449" Adh std1 splice5 1993204 1993205 0.939697 + 1 transcript "LD17449" Adh std1 splice3 1993349 1993350 0.994379 + 2 transcript "LD17449" Adh std1 CDS 1993350 1993566 . + . transcript "LD17449" Adh std1 stop_codon 1993564 1993566 . + . transcript "LD17449" # #### #### # Adh std1 start_codon 2119874 2119876 . + . transcript "LP11031" Adh std1 CDS 2120382 2121269 . + . transcript "LP11031" Adh std1 splice5 2121269 2121270 0.950481 + 2 transcript "LP11031" Adh std1 splice3 2121335 2121336 0.935072 + 2 transcript "LP11031" Adh std1 CDS 2121336 2121745 . + . transcript "LP11031" Adh std1 stop_codon 2121743 2121745 . + . transcript "LP11031" # #### #### # Adh std1 stop_codon 2201422 2201424 . - . transcript "GH01660-ADH.con" Adh std1 CDS 2201426 2201677 . - . transcript "GH01660-ADH.con" Adh std1 splice3 2201677 2201678 0.946767 - 1 transcript "GH01660-ADH.con" Adh std1 splice5 2202375 2202376 0.941824 - 2 transcript "GH01660-ADH.con" Adh std1 CDS 2202376 2202477 . - . transcript "GH01660-ADH.con" Adh std1 splice3 2202477 2202478 0.739696 - 2 transcript "GH01660-ADH.con" Adh std1 splice5 2202547 2202548 0.940989 - 1 transcript "GH01660-ADH.con" Adh std1 CDS 2202548 2202802 . - . transcript "GH01660-ADH.con" Adh std1 start_codon 2202800 2202802 . - . transcript "GH01660-ADH.con" # #### #### # Adh std1 start_codon 2216202 2216204 . + . transcript "LD08227" Adh std1 CDS 2216202 2216447 . + . transcript "LD08227" Adh std1 splice5 2216447 2216448 0.926736 + 2 transcript "LD08227" Adh std1 splice3 2216608 2216609 0.77834 + 1 transcript "LD08227" Adh std1 CDS 2216609 2217034 . + . transcript "LD08227" Adh std1 splice5 2217034 2217035 0.951814 + 1 transcript "LD08227" Adh std1 splice3 2217098 2217099 0.870819 + 2 transcript "LD08227" Adh std1 CDS 2217099 2217403 . + . transcript "LD08227" Adh std1 splice5 2217403 2217404 0.390192 + 1 transcript "LD08227" Adh std1 splice3 2217500 2217501 0.852315 + 2 transcript "LD08227" Adh std1 CDS 2217501 2217537 . + . transcript "LD08227" Adh std1 stop_codon 2217535 2217537 . + . transcript "LD08227" # #### #### # Adh std1 stop_codon 2218461 2218463 . - . transcript "LD02957" Adh std1 CDS 2218461 2218494 . - . transcript "LD02957" Adh std1 splice3 2218494 2218495 0.987589 - 2 transcript "LD02957" Adh std1 splice5 2218558 2218559 0.623994 - 1 transcript "LD02957" Adh std1 CDS 2218559 2218905 . - . transcript "LD02957" Adh std1 splice3 2218905 2218906 0.98863 - 2 transcript "LD02957" Adh std1 splice5 2218965 2218966 0.803003 - 2 transcript "LD02957" Adh std1 CDS 2218966 2219841 . - . transcript "LD02957" Adh std1 start_codon 2219839 2219841 . - . transcript "LD02957" # #### #### # Adh std1 start_codon 2544295 2544297 . + . transcript "GH09478" Adh std1 CDS 2544295 2545201 . + . transcript "GH09478" Adh std1 stop_codon 2545201 2545203 . + . transcript "GH09478" # #### #### # Adh std1 stop_codon 2696335 2696337 . - . transcript "LD12894" Adh std1 CDS 2696335 2696446 . - . transcript "LD12894" Adh std1 splice3 2696446 2696447 0.878167 - 1 transcript "LD12894" Adh std1 splice5 2696512 2696513 0.885103 - 1 transcript "LD12894" Adh std1 CDS 2696513 2696644 . - . transcript "LD12894" Adh std1 splice3 2696644 2696645 0.980159 - 1 transcript "LD12894" Adh std1 splice5 2697861 2697862 0.748981 - 2 transcript "LD12894" Adh std1 CDS 2697862 2698028 . - . transcript "LD12894" Adh std1 splice3 2698028 2698029 0.938317 - 0 transcript "LD12894" Adh std1 splice5 2698090 2698091 0.946753 - 1 transcript "LD12894" Adh std1 CDS 2698091 2698210 . - . transcript "LD12894" Adh std1 start_codon 2698208 2698210 . - . transcript "LD12894" Adh std1 splice3 2698966 2698967 0.9706 - 1 transcript "LD12894" Adh std1 splice5 2699340 2699341 0.930689 - 2 transcript "LD12894" Adh std1 splice3 2699418 2699419 0.993701 - 2 transcript "LD12894" Adh std1 splice5 2706335 2706336 0.921609 - 0 transcript "LD12894" # #### #### # Adh std1 stop_codon 2751337 2751339 . - . transcript "GMF" Adh std1 CDS 2751337 2751465 . - . transcript "GMF" Adh std1 splice3 2751465 2751466 0.982813 - 2 transcript "GMF" Adh std1 splice5 2751520 2751521 0.800387 - 1 transcript "GMF" Adh std1 CDS 2751521 2751711 . - . transcript "GMF" Adh std1 splice3 2751711 2751712 0.992029 - 2 transcript "GMF" Adh std1 splice5 2751777 2751778 0.582019 - 2 transcript "GMF" Adh std1 CDS 2751778 2751871 . - . transcript "GMF" Adh std1 splice3 2751871 2751872 0.925812 - 1 transcript "GMF" Adh std1 splice5 2752030 2752031 0.805494 - 1 transcript "GMF" Adh std1 start_codon 2752031 2752033 . - . transcript "GMF" Adh std1 CDS 2752031 2752033 . - . transcript "GMF" # #### #### # Adh std1 stop_codon 2755219 2755221 . - . transcript "anon-35Fa" Adh std1 CDS 2755219 2755580 . - . transcript "anon-35Fa" Adh std1 splice3 2755580 2755581 0.988933 - 0 transcript "anon-35Fa" Adh std1 splice5 2755774 2755775 0.611767 - 1 transcript "anon-35Fa" Adh std1 CDS 2755775 2755883 . - . transcript "anon-35Fa" Adh std1 splice3 2755883 2755884 0.949182 - 0 transcript "anon-35Fa" Adh std1 splice5 2755953 2755954 0.863779 - 2 transcript "anon-35Fa" Adh std1 CDS 2755954 2756092 . - . transcript "anon-35Fa" Adh std1 splice3 2756092 2756093 0.947933 - 1 transcript "anon-35Fa" Adh std1 splice5 2756200 2756201 0.730331 - 1 transcript "anon-35Fa" Adh std1 CDS 2756201 2756274 . - . transcript "anon-35Fa" Adh std1 start_codon 2756272 2756274 . - . transcript "anon-35Fa" # #### #### # Adh std1 start_codon 2776417 2776419 . + . transcript "anon-35F-36A" Adh std1 CDS 2776417 2777295 . + . transcript "anon-35F-36A" Adh std1 stop_codon 2777293 2777295 . + . transcript "anon-35F-36A" # #### #### # Adh std1 CDS 2777390 2777609 . - . transcript "RPL4.FRAGA" Adh std1 stop_codon 2777390 2777392 . - . transcript "RPL4.FRAGA" Adh std1 splice3 2777609 2777610 0.917031 - 0 transcript "RPL4.FRAGA" Adh std1 splice5 2777671 2777672 0.668279 - 1 transcript "RPL4.FRAGA" Adh std1 CDS 2777672 2778342 . - . transcript "RPL4.FRAGA" Adh std1 start_codon 2778340 2778342 . - . transcript "RPL4.FRAGA" # #### #### # Adh std1 start_codon 2802355 2802357 . + . transcript "LD12474" Adh std1 CDS 2802355 2802394 . + . transcript "LD12474" Adh std1 splice5 2802394 2802395 0.785969 + 1 transcript "LD12474" Adh std1 splice3 2802472 2802473 0.917341 + 1 transcript "LD12474" Adh std1 CDS 2802473 2802813 . + . transcript "LD12474" Adh std1 stop_codon 2802811 2802813 . + . transcript "LD12474" # #### #### # Adh std1 CDS 2804442 2805730 . - . transcript "LD05503" Adh std1 stop_codon 2804442 2804444 . - . transcript "LD05503" Adh std1 splice3 2805730 2805731 0.923818 - 1 transcript "LD05503" Adh std1 splice5 2805799 2805800 0.961262 - 1 transcript "LD05503" Adh std1 CDS 2805800 2805812 . - . transcript "LD05503" Adh std1 start_codon 2805810 2805812 . - . transcript "LD05503" # #### #### # Adh std1 stop_codon 2849759 2849761 . - . transcript "CK01518.con" Adh std1 CDS 2849759 2849784 . - . transcript "CK01518.con" Adh std1 splice3 2849784 2849785 0.994871 - 2 transcript "CK01518.con" Adh std1 splice5 2853743 2853744 0.79435 - 0 transcript "CK01518.con" Adh std1 CDS 2853744 2854099 . - . transcript "CK01518.con" Adh std1 splice3 2854099 2854100 0.831761 - 1 transcript "CK01518.con" Adh std1 splice5 2854196 2854197 0.95305 - 0 transcript "CK01518.con" Adh std1 CDS 2854197 2854973 . - . transcript "CK01518.con" Adh std1 start_codon 2855180 2855182 . - . transcript "CK01518.con" # #### #### # Adh std1 start_codon 2896655 2896657 . + . transcript "GH12581" Adh std1 CDS 2896655 2896763 . + . transcript "GH12581" Adh std1 splice5 2896763 2896764 0.932977 + 2 transcript "GH12581" Adh std1 splice3 2898443 2898444 0.985499 + 2 transcript "GH12581" Adh std1 CDS 2898444 2899001 . + . transcript "GH12581" Adh std1 splice5 2899001 2899002 0.928387 + 2 transcript "GH12581" Adh std1 splice3 2899060 2899061 0.722139 + 1 transcript "GH12581" Adh std1 CDS 2899061 2899716 . + . transcript "GH12581" Adh std1 stop_codon 2899714 2899716 . + . transcript "GH12581" # #### #### # Adh std1 start_codon 2900448 2900450 . + . transcript "CK00436.con" Adh std1 CDS 2900448 2900565 . + . transcript "CK00436.con" Adh std1 splice5 2900565 2900566 0.965652 + 0 transcript "CK00436.con" Adh std1 splice3 2900633 2900634 0.951668 + 2 transcript "CK00436.con" Adh std1 CDS 2900634 2901185 . + . transcript "CK00436.con" Adh std1 splice5 2901185 2901186 0.925442 + 2 transcript "CK00436.con" Adh std1 splice3 2901451 2901452 0.873813 + 1 transcript "CK00436.con" Adh std1 CDS 2901452 2902107 . + . transcript "CK00436.con" Adh std1 stop_codon 2902105 2902107 . + . transcript "CK00436.con" # #### ##gff-version 2 ##source-version GH-fudged-GFF 1.0 # Thu Jul 22 11:55:54 1999 # ### # # # compfly: 1. exon feature removed Jul 8 (MR) # # Adh std3 start_codon 2582975 2582977 . + . transcript "BG:DS04095.2" Adh std3 stop_codon 2583545 2583547 . + . transcript "BG:DS04095.2" Adh std3 CDS 2582975 2583547 . + . transcript "BG:DS04095.2" # # ### ### # # Adh std3 start_codon 2544295 2544297 . + . transcript "BG:DS04095.1" Adh std3 stop_codon 2545201 2545203 . + . transcript "BG:DS04095.1" Adh std3 CDS 2544295 2545203 . + . transcript "BG:DS04095.1" # # ### ### # # Adh std3 start_codon 1484701 1484703 . + . transcript "BG:DS00929.16" Adh std3 stop_codon 1489832 1489834 . + . transcript "BG:DS00929.16" Adh std3 CDS 1484701 1484782 . + . transcript "BG:DS00929.16" Adh std3 CDS 1487158 1487326 . + . transcript "BG:DS00929.16" Adh std3 CDS 1488069 1488120 . + . transcript "BG:DS00929.16" Adh std3 CDS 1489262 1489834 . + . transcript "BG:DS00929.16" Adh std3 splice5 1484782 1484783 . + . transcript "BG:DS00929.16" Adh std3 splice3 1487157 1487158 . + . transcript "BG:DS00929.16" Adh std3 splice5 1487326 1487327 . + . transcript "BG:DS00929.16" Adh std3 splice3 1488068 1488069 . + . transcript "BG:DS00929.16" Adh std3 splice5 1488120 1488121 . + . transcript "BG:DS00929.16" Adh std3 splice3 1489261 1489262 . + . transcript "BG:DS00929.16" # # ### ### # # Adh std3 start_codon 1493680 1493682 . + . transcript "BG:DS00929.1" Adh std3 stop_codon 1496196 1496198 . + . transcript "BG:DS00929.1" Adh std3 CDS 1493680 1493718 . + . transcript "BG:DS00929.1" Adh std3 CDS 1495620 1496198 . + . transcript "BG:DS00929.1" Adh std3 splice5 1493718 1493719 . + . transcript "BG:DS00929.1" Adh std3 splice3 1495619 1495620 . + . transcript "BG:DS00929.1" # # ### ### # # Adh std3 start_codon 1496998 1497000 . - . transcript "BG:DS00929.2" Adh std3 stop_codon 1496304 1496306 . - . transcript "BG:DS00929.2" Adh std3 CDS 1496304 1496815 . - . transcript "BG:DS00929.2" Adh std3 CDS 1496865 1497000 . - . transcript "BG:DS00929.2" Adh std3 splice3 1496815 1496816 . - . transcript "BG:DS00929.2" Adh std3 splice5 1496864 1496865 . - . transcript "BG:DS00929.2" # # ### ### # # Adh std3 start_codon 1497576 1497578 . + . transcript "BG:DS00929.3" Adh std3 stop_codon 1498119 1498121 . + . transcript "BG:DS00929.3" Adh std3 CDS 1497576 1498121 . + . transcript "BG:DS00929.3" # # ### ### # # Adh std3 start_codon 1499247 1499249 . - . transcript "BG:DS00929.4" Adh std3 stop_codon 1498334 1498336 . - . transcript "BG:DS00929.4" Adh std3 CDS 1498334 1499046 . - . transcript "BG:DS00929.4" Adh std3 CDS 1499102 1499249 . - . transcript "BG:DS00929.4" Adh std3 splice3 1499046 1499047 . - . transcript "BG:DS00929.4" Adh std3 splice5 1499101 1499102 . - . transcript "BG:DS00929.4" # # ### ### # # Adh std3 start_codon 1499670 1499672 . + . transcript "l.2.35Bd" Adh std3 stop_codon 1501008 1501010 . + . transcript "l.2.35Bd" Adh std3 CDS 1499670 1500870 . + . transcript "l.2.35Bd" Adh std3 CDS 1500928 1501010 . + . transcript "l.2.35Bd" Adh std3 splice5 1500870 1500871 . + . transcript "l.2.35Bd" Adh std3 splice3 1500927 1500928 . + . transcript "l.2.35Bd" # # ### ### # # Adh std3 start_codon 1506022 1506024 . + . transcript "BG:DS00929.6" Adh std3 stop_codon 1521840 1521842 . + . transcript "BG:DS00929.6" Adh std3 CDS 1506022 1506086 . + . transcript "BG:DS00929.6" Adh std3 CDS 1506161 1506204 . + . transcript "BG:DS00929.6" Adh std3 CDS 1506806 1507048 . + . transcript "BG:DS00929.6" Adh std3 CDS 1508779 1508852 . + . transcript "BG:DS00929.6" Adh std3 CDS 1510744 1510998 . + . transcript "BG:DS00929.6" Adh std3 CDS 1515041 1515175 . + . transcript "BG:DS00929.6" Adh std3 CDS 1515266 1515436 . + . transcript "BG:DS00929.6" Adh std3 CDS 1515498 1515714 . + . transcript "BG:DS00929.6" Adh std3 CDS 1515807 1516279 . + . transcript "BG:DS00929.6" Adh std3 CDS 1516339 1516488 . + . transcript "BG:DS00929.6" Adh std3 CDS 1516560 1519039 . + . transcript "BG:DS00929.6" Adh std3 CDS 1519441 1519564 . + . transcript "BG:DS00929.6" Adh std3 CDS 1519897 1520023 . + . transcript "BG:DS00929.6" Adh std3 CDS 1520081 1520337 . + . transcript "BG:DS00929.6" Adh std3 CDS 1520398 1520535 . + . transcript "BG:DS00929.6" Adh std3 CDS 1521654 1521842 . + . transcript "BG:DS00929.6" Adh std3 splice5 1506086 1506087 . + . transcript "BG:DS00929.6" Adh std3 splice3 1506160 1506161 . + . transcript "BG:DS00929.6" Adh std3 splice5 1506204 1506205 . + . transcript "BG:DS00929.6" Adh std3 splice3 1506805 1506806 . + . transcript "BG:DS00929.6" Adh std3 splice5 1507048 1507049 . + . transcript "BG:DS00929.6" Adh std3 splice3 1508778 1508779 . + . transcript "BG:DS00929.6" Adh std3 splice5 1508852 1508853 . + . transcript "BG:DS00929.6" Adh std3 splice3 1510743 1510744 . + . transcript "BG:DS00929.6" Adh std3 splice5 1510998 1510999 . + . transcript "BG:DS00929.6" Adh std3 splice3 1515040 1515041 . + . transcript "BG:DS00929.6" Adh std3 splice5 1515175 1515176 . + . transcript "BG:DS00929.6" Adh std3 splice3 1515265 1515266 . + . transcript "BG:DS00929.6" Adh std3 splice5 1515436 1515437 . + . transcript "BG:DS00929.6" Adh std3 splice3 1515497 1515498 . + . transcript "BG:DS00929.6" Adh std3 splice5 1515714 1515715 . + . transcript "BG:DS00929.6" Adh std3 splice3 1515806 1515807 . + . transcript "BG:DS00929.6" Adh std3 splice5 1516279 1516280 . + . transcript "BG:DS00929.6" Adh std3 splice3 1516338 1516339 . + . transcript "BG:DS00929.6" Adh std3 splice5 1516488 1516489 . + . transcript "BG:DS00929.6" Adh std3 splice3 1516559 1516560 . + . transcript "BG:DS00929.6" Adh std3 splice5 1519039 1519040 . + . transcript "BG:DS00929.6" Adh std3 splice3 1519440 1519441 . + . transcript "BG:DS00929.6" Adh std3 splice5 1519564 1519565 . + . transcript "BG:DS00929.6" Adh std3 splice3 1519896 1519897 . + . transcript "BG:DS00929.6" Adh std3 splice5 1520023 1520024 . + . transcript "BG:DS00929.6" Adh std3 splice3 1520080 1520081 . + . transcript "BG:DS00929.6" Adh std3 splice5 1520337 1520338 . + . transcript "BG:DS00929.6" Adh std3 splice3 1520397 1520398 . + . transcript "BG:DS00929.6" Adh std3 splice5 1520535 1520536 . + . transcript "BG:DS00929.6" Adh std3 splice3 1521653 1521654 . + . transcript "BG:DS00929.6" # # ### ### # # Adh std3 start_codon 1521369 1521371 . - . transcript "BG:DS00929.7" Adh std3 stop_codon 1520808 1520810 . - . transcript "BG:DS00929.7" Adh std3 CDS 1520808 1521371 . - . transcript "BG:DS00929.7" # # ### ### # # Adh std3 start_codon 1525230 1525232 . + . transcript "BG:DS00929.8" Adh std3 stop_codon 1527377 1527379 . + . transcript "BG:DS00929.8" Adh std3 CDS 1525230 1525447 . + . transcript "BG:DS00929.8" Adh std3 CDS 1526237 1526642 . + . transcript "BG:DS00929.8" Adh std3 CDS 1526702 1527379 . + . transcript "BG:DS00929.8" Adh std3 splice5 1525447 1525448 . + . transcript "BG:DS00929.8" Adh std3 splice3 1526236 1526237 . + . transcript "BG:DS00929.8" Adh std3 splice5 1526642 1526643 . + . transcript "BG:DS00929.8" Adh std3 splice3 1526701 1526702 . + . transcript "BG:DS00929.8" # # ### ### # # Adh std3 start_codon 1528424 1528426 . - . transcript "l.2.35Bg" Adh std3 stop_codon 1527523 1527525 . - . transcript "l.2.35Bg" Adh std3 CDS 1527523 1527636 . - . transcript "l.2.35Bg" Adh std3 CDS 1527705 1528201 . - . transcript "l.2.35Bg" Adh std3 CDS 1528291 1528426 . - . transcript "l.2.35Bg" Adh std3 splice3 1526171 1526172 . - . transcript "l.2.35Bg" Adh std3 splice5 1526229 1526230 . - . transcript "l.2.35Bg" Adh std3 splice3 1527636 1527637 . - . transcript "l.2.35Bg" Adh std3 splice5 1527704 1527705 . - . transcript "l.2.35Bg" Adh std3 splice3 1528201 1528202 . - . transcript "l.2.35Bg" Adh std3 splice5 1528290 1528291 . - . transcript "l.2.35Bg" # # ### ### # # Adh std3 start_codon 1529588 1529590 . + . transcript "Su.H" Adh std3 stop_codon 1532267 1532269 . + . transcript "Su.H" Adh std3 CDS 1529588 1529971 . + . transcript "Su.H" Adh std3 CDS 1530746 1531626 . + . transcript "Su.H" Adh std3 CDS 1531685 1531892 . + . transcript "Su.H" Adh std3 CDS 1531958 1532269 . + . transcript "Su.H" Adh std3 splice5 1529971 1529972 . + . transcript "Su.H" Adh std3 splice3 1530745 1530746 . + . transcript "Su.H" Adh std3 splice5 1531626 1531627 . + . transcript "Su.H" Adh std3 splice3 1531684 1531685 . + . transcript "Su.H" Adh std3 splice5 1531892 1531893 . + . transcript "Su.H" Adh std3 splice3 1531957 1531958 . + . transcript "Su.H" # # ### ### # # Adh std3 start_codon 1543080 1543082 . - . transcript "ck" Adh std3 stop_codon 1535065 1535067 . - . transcript "ck" Adh std3 CDS 1535065 1535271 . - . transcript "ck" Adh std3 CDS 1535341 1535461 . - . transcript "ck" Adh std3 CDS 1535530 1535676 . - . transcript "ck" Adh std3 CDS 1535739 1536304 . - . transcript "ck" Adh std3 CDS 1536364 1537150 . - . transcript "ck" Adh std3 CDS 1537212 1538662 . - . transcript "ck" Adh std3 CDS 1538719 1541113 . - . transcript "ck" Adh std3 CDS 1541178 1541378 . - . transcript "ck" Adh std3 CDS 1541445 1541794 . - . transcript "ck" Adh std3 CDS 1542125 1542385 . - . transcript "ck" Adh std3 CDS 1543065 1543082 . - . transcript "ck" Adh std3 splice3 1535271 1535272 . - . transcript "ck" Adh std3 splice5 1535340 1535341 . - . transcript "ck" Adh std3 splice3 1535461 1535462 . - . transcript "ck" Adh std3 splice5 1535529 1535530 . - . transcript "ck" Adh std3 splice3 1535676 1535677 . - . transcript "ck" Adh std3 splice5 1535738 1535739 . - . transcript "ck" Adh std3 splice3 1536304 1536305 . - . transcript "ck" Adh std3 splice5 1536363 1536364 . - . transcript "ck" Adh std3 splice3 1537150 1537151 . - . transcript "ck" Adh std3 splice5 1537211 1537212 . - . transcript "ck" Adh std3 splice3 1538662 1538663 . - . transcript "ck" Adh std3 splice5 1538718 1538719 . - . transcript "ck" Adh std3 splice3 1541113 1541114 . - . transcript "ck" Adh std3 splice5 1541177 1541178 . - . transcript "ck" Adh std3 splice3 1541378 1541379 . - . transcript "ck" Adh std3 splice5 1541444 1541445 . - . transcript "ck" Adh std3 splice3 1541794 1541795 . - . transcript "ck" Adh std3 splice5 1542124 1542125 . - . transcript "ck" Adh std3 splice3 1542385 1542386 . - . transcript "ck" Adh std3 splice5 1543064 1543065 . - . transcript "ck" Adh std3 splice3 1543168 1543169 . - . transcript "ck" Adh std3 splice5 1547318 1547319 . - . transcript "ck" # # ### ### # # Adh std3 start_codon 1549931 1549933 . - . transcript "TfIIS" Adh std3 stop_codon 1549142 1549144 . - . transcript "TfIIS" Adh std3 CDS 1549142 1549933 . - . transcript "TfIIS" Adh std3 splice3 1550746 1550747 . - . transcript "TfIIS" Adh std3 splice5 1550772 1550773 . - . transcript "TfIIS" # # ### ### # # Adh std3 start_codon 1557276 1557278 . - . transcript "vig" Adh std3 stop_codon 1554085 1554087 . - . transcript "vig" Adh std3 CDS 1554085 1554599 . - . transcript "vig" Adh std3 CDS 1554841 1555107 . - . transcript "vig" Adh std3 CDS 1556588 1557278 . - . transcript "vig" Adh std3 splice3 1554599 1554600 . - . transcript "vig" Adh std3 splice5 1554840 1554841 . - . transcript "vig" Adh std3 splice3 1555107 1555108 . - . transcript "vig" Adh std3 splice5 1556587 1556588 . - . transcript "vig" Adh std3 splice3 1557340 1557341 . - . transcript "vig" Adh std3 splice5 1557566 1557567 . - . transcript "vig" # # ### ### # # Adh std3 start_codon 1558915 1558917 . + . transcript "BG:DS00929.15" Adh std3 stop_codon 1561692 1561694 . + . transcript "BG:DS00929.15" Adh std3 CDS 1558915 1559747 . + . transcript "BG:DS00929.15" Adh std3 CDS 1560074 1561694 . + . transcript "BG:DS00929.15" Adh std3 splice5 1559747 1559748 . + . transcript "BG:DS00929.15" Adh std3 splice3 1560073 1560074 . + . transcript "BG:DS00929.15" # # ### ### # # Adh std3 start_codon 1042686 1042688 . - . transcript "BG:DS04641.8" Adh std3 stop_codon 1041376 1041378 . - . transcript "BG:DS04641.8" Adh std3 CDS 1041376 1041530 . - . transcript "BG:DS04641.8" Adh std3 CDS 1041602 1041989 . - . transcript "BG:DS04641.8" Adh std3 CDS 1042386 1042688 . - . transcript "BG:DS04641.8" Adh std3 splice3 1041530 1041531 . - . transcript "BG:DS04641.8" Adh std3 splice5 1041601 1041602 . - . transcript "BG:DS04641.8" Adh std3 splice3 1041989 1041990 . - . transcript "BG:DS04641.8" Adh std3 splice5 1042385 1042386 . - . transcript "BG:DS04641.8" # # ### ### # # Adh std3 start_codon 984981 984983 . + . transcript "noc" Adh std3 stop_codon 986894 986896 . + . transcript "noc" Adh std3 CDS 984981 985070 . + . transcript "noc" Adh std3 CDS 985373 986896 . + . transcript "noc" Adh std3 splice5 985070 985071 . + . transcript "noc" Adh std3 splice3 985372 985373 . + . transcript "noc" # # ### ### # # Adh std3 start_codon 2619967 2619969 . + . transcript "Ca-alpha1D" Adh std3 stop_codon 2639004 2639006 . + . transcript "Ca-alpha1D" Adh std3 CDS 2619967 2620307 . + . transcript "Ca-alpha1D" Adh std3 CDS 2621231 2622507 . + . transcript "Ca-alpha1D" Adh std3 CDS 2622578 2622803 . + . transcript "Ca-alpha1D" Adh std3 CDS 2622977 2623082 . + . transcript "Ca-alpha1D" Adh std3 CDS 2623316 2623455 . + . transcript "Ca-alpha1D" Adh std3 CDS 2623675 2623781 . + . transcript "Ca-alpha1D" Adh std3 CDS 2624114 2624266 . + . transcript "Ca-alpha1D" Adh std3 CDS 2624694 2624875 . + . transcript "Ca-alpha1D" Adh std3 CDS 2624976 2625495 . + . transcript "Ca-alpha1D" Adh std3 CDS 2625559 2625784 . + . transcript "Ca-alpha1D" Adh std3 CDS 2625851 2626061 . + . transcript "Ca-alpha1D" Adh std3 CDS 2626124 2626333 . + . transcript "Ca-alpha1D" Adh std3 CDS 2626392 2626510 . + . transcript "Ca-alpha1D" Adh std3 CDS 2626595 2626653 . + . transcript "Ca-alpha1D" Adh std3 CDS 2627634 2627751 . + . transcript "Ca-alpha1D" Adh std3 CDS 2628166 2628295 . + . transcript "Ca-alpha1D" Adh std3 CDS 2628460 2628626 . + . transcript "Ca-alpha1D" Adh std3 CDS 2628718 2628805 . + . transcript "Ca-alpha1D" Adh std3 CDS 2629398 2629505 . + . transcript "Ca-alpha1D" Adh std3 CDS 2632038 2632090 . + . transcript "Ca-alpha1D" Adh std3 CDS 2632152 2632298 . + . transcript "Ca-alpha1D" Adh std3 CDS 2632363 2632834 . + . transcript "Ca-alpha1D" Adh std3 CDS 2632889 2632972 . + . transcript "Ca-alpha1D" Adh std3 CDS 2633028 2633093 . + . transcript "Ca-alpha1D" Adh std3 CDS 2633149 2633337 . + . transcript "Ca-alpha1D" Adh std3 CDS 2633397 2633645 . + . transcript "Ca-alpha1D" Adh std3 CDS 2633706 2634365 . + . transcript "Ca-alpha1D" Adh std3 CDS 2634452 2634885 . + . transcript "Ca-alpha1D" Adh std3 CDS 2635370 2635410 . + . transcript "Ca-alpha1D" Adh std3 CDS 2638284 2638414 . + . transcript "Ca-alpha1D" Adh std3 CDS 2638470 2639006 . + . transcript "Ca-alpha1D" Adh std3 splice5 2620307 2620308 . + . transcript "Ca-alpha1D" Adh std3 splice3 2621230 2621231 . + . transcript "Ca-alpha1D" Adh std3 splice5 2622507 2622508 . + . transcript "Ca-alpha1D" Adh std3 splice3 2622577 2622578 . + . transcript "Ca-alpha1D" Adh std3 splice5 2622803 2622804 . + . transcript "Ca-alpha1D" Adh std3 splice3 2622976 2622977 . + . transcript "Ca-alpha1D" Adh std3 splice5 2623082 2623083 . + . transcript "Ca-alpha1D" Adh std3 splice3 2623315 2623316 . + . transcript "Ca-alpha1D" Adh std3 splice5 2623455 2623456 . + . transcript "Ca-alpha1D" Adh std3 splice3 2623674 2623675 . + . transcript "Ca-alpha1D" Adh std3 splice5 2623781 2623782 . + . transcript "Ca-alpha1D" Adh std3 splice3 2624113 2624114 . + . transcript "Ca-alpha1D" Adh std3 splice5 2624266 2624267 . + . transcript "Ca-alpha1D" Adh std3 splice3 2624693 2624694 . + . transcript "Ca-alpha1D" Adh std3 splice5 2624875 2624876 . + . transcript "Ca-alpha1D" Adh std3 splice3 2624975 2624976 . + . transcript "Ca-alpha1D" Adh std3 splice5 2625495 2625496 . + . transcript "Ca-alpha1D" Adh std3 splice3 2625558 2625559 . + . transcript "Ca-alpha1D" Adh std3 splice5 2625784 2625785 . + . transcript "Ca-alpha1D" Adh std3 splice3 2625850 2625851 . + . transcript "Ca-alpha1D" Adh std3 splice5 2626061 2626062 . + . transcript "Ca-alpha1D" Adh std3 splice3 2626123 2626124 . + . transcript "Ca-alpha1D" Adh std3 splice5 2626333 2626334 . + . transcript "Ca-alpha1D" Adh std3 splice3 2626391 2626392 . + . transcript "Ca-alpha1D" Adh std3 splice5 2626510 2626511 . + . transcript "Ca-alpha1D" Adh std3 splice3 2626594 2626595 . + . transcript "Ca-alpha1D" Adh std3 splice5 2626653 2626654 . + . transcript "Ca-alpha1D" Adh std3 splice3 2627633 2627634 . + . transcript "Ca-alpha1D" Adh std3 splice5 2627751 2627752 . + . transcript "Ca-alpha1D" Adh std3 splice3 2628165 2628166 . + . transcript "Ca-alpha1D" Adh std3 splice5 2628295 2628296 . + . transcript "Ca-alpha1D" Adh std3 splice3 2628459 2628460 . + . transcript "Ca-alpha1D" Adh std3 splice5 2628626 2628627 . + . transcript "Ca-alpha1D" Adh std3 splice3 2628717 2628718 . + . transcript "Ca-alpha1D" Adh std3 splice5 2628805 2628806 . + . transcript "Ca-alpha1D" Adh std3 splice3 2629397 2629398 . + . transcript "Ca-alpha1D" Adh std3 splice5 2629505 2629506 . + . transcript "Ca-alpha1D" Adh std3 splice3 2632037 2632038 . + . transcript "Ca-alpha1D" Adh std3 splice5 2632090 2632091 . + . transcript "Ca-alpha1D" Adh std3 splice3 2632151 2632152 . + . transcript "Ca-alpha1D" Adh std3 splice5 2632298 2632299 . + . transcript "Ca-alpha1D" Adh std3 splice3 2632362 2632363 . + . transcript "Ca-alpha1D" Adh std3 splice5 2632834 2632835 . + . transcript "Ca-alpha1D" Adh std3 splice3 2632888 2632889 . + . transcript "Ca-alpha1D" Adh std3 splice5 2632972 2632973 . + . transcript "Ca-alpha1D" Adh std3 splice3 2633027 2633028 . + . transcript "Ca-alpha1D" Adh std3 splice5 2633093 2633094 . + . transcript "Ca-alpha1D" Adh std3 splice3 2633148 2633149 . + . transcript "Ca-alpha1D" Adh std3 splice5 2633337 2633338 . + . transcript "Ca-alpha1D" Adh std3 splice3 2633396 2633397 . + . transcript "Ca-alpha1D" Adh std3 splice5 2633645 2633646 . + . transcript "Ca-alpha1D" Adh std3 splice3 2633705 2633706 . + . transcript "Ca-alpha1D" Adh std3 splice5 2634365 2634366 . + . transcript "Ca-alpha1D" Adh std3 splice3 2634451 2634452 . + . transcript "Ca-alpha1D" Adh std3 splice5 2634885 2634886 . + . transcript "Ca-alpha1D" Adh std3 splice3 2635369 2635370 . + . transcript "Ca-alpha1D" Adh std3 splice5 2635410 2635411 . + . transcript "Ca-alpha1D" Adh std3 splice3 2638283 2638284 . + . transcript "Ca-alpha1D" Adh std3 splice5 2638414 2638415 . + . transcript "Ca-alpha1D" Adh std3 splice3 2638469 2638470 . + . transcript "Ca-alpha1D" # # ### ### # # Adh std3 start_codon 2660848 2660850 . + . transcript "BG:DS02795.3" Adh std3 stop_codon 2662317 2662319 . + . transcript "BG:DS02795.3" Adh std3 CDS 2660848 2661318 . + . transcript "BG:DS02795.3" Adh std3 CDS 2661378 2662319 . + . transcript "BG:DS02795.3" Adh std3 splice5 2661318 2661319 . + . transcript "BG:DS02795.3" Adh std3 splice3 2661377 2661378 . + . transcript "BG:DS02795.3" # # ### ### # # Adh std3 start_codon 29477 29479 . - . transcript "BG:BACR48E02.1" Adh std3 stop_codon 29156 29158 . - . transcript "BG:BACR48E02.1" Adh std3 CDS 29156 29479 . - . transcript "BG:BACR48E02.1" # # ### ### # # Adh std3 start_codon 32232 32234 . + . transcript "BG:BACR48E02.2" Adh std3 stop_codon 35769 35771 . + . transcript "BG:BACR48E02.2" Adh std3 CDS 32232 32319 . + . transcript "BG:BACR48E02.2" Adh std3 CDS 34532 34822 . + . transcript "BG:BACR48E02.2" Adh std3 CDS 34857 35107 . + . transcript "BG:BACR48E02.2" Adh std3 CDS 35161 35502 . + . transcript "BG:BACR48E02.2" Adh std3 CDS 35547 35771 . + . transcript "BG:BACR48E02.2" Adh std3 splice5 32319 32320 . + . transcript "BG:BACR48E02.2" Adh std3 splice3 34531 34532 . + . transcript "BG:BACR48E02.2" Adh std3 splice5 34822 34823 . + . transcript "BG:BACR48E02.2" Adh std3 splice3 34856 34857 . + . transcript "BG:BACR48E02.2" Adh std3 splice5 35107 35108 . + . transcript "BG:BACR48E02.2" Adh std3 splice3 35160 35161 . + . transcript "BG:BACR48E02.2" Adh std3 splice5 35502 35503 . + . transcript "BG:BACR48E02.2" Adh std3 splice3 35546 35547 . + . transcript "BG:BACR48E02.2" # # ### ### # # Adh std3 start_codon 36410 36412 . + . transcript "BG:BACR48E02.3" Adh std3 stop_codon 37313 37315 . + . transcript "BG:BACR48E02.3" Adh std3 CDS 36410 37315 . + . transcript "BG:BACR48E02.3" # # ### ### # # Adh std3 start_codon 45358 45360 . + . transcript "kuz" Adh std3 stop_codon 130399 130401 . + . transcript "kuz" Adh std3 CDS 45358 45425 . + . transcript "kuz" Adh std3 CDS 103520 103739 . + . transcript "kuz" Adh std3 CDS 103808 104330 . + . transcript "kuz" Adh std3 CDS 124458 124936 . + . transcript "kuz" Adh std3 CDS 127146 127292 . + . transcript "kuz" Adh std3 CDS 127771 127931 . + . transcript "kuz" Adh std3 CDS 127991 128225 . + . transcript "kuz" Adh std3 CDS 128296 129342 . + . transcript "kuz" Adh std3 CDS 129401 129965 . + . transcript "kuz" Adh std3 CDS 130136 130401 . + . transcript "kuz" Adh std3 splice5 44175 44176 . + . transcript "kuz" Adh std3 splice3 44896 44897 . + . transcript "kuz" Adh std3 splice5 45425 45426 . + . transcript "kuz" Adh std3 splice3 103519 103520 . + . transcript "kuz" Adh std3 splice5 103739 103740 . + . transcript "kuz" Adh std3 splice3 103807 103808 . + . transcript "kuz" Adh std3 splice5 104330 104331 . + . transcript "kuz" Adh std3 splice3 124457 124458 . + . transcript "kuz" Adh std3 splice5 124936 124937 . + . transcript "kuz" Adh std3 splice3 127145 127146 . + . transcript "kuz" Adh std3 splice5 127292 127293 . + . transcript "kuz" Adh std3 splice3 127770 127771 . + . transcript "kuz" Adh std3 splice5 127931 127932 . + . transcript "kuz" Adh std3 splice3 127990 127991 . + . transcript "kuz" Adh std3 splice5 128225 128226 . + . transcript "kuz" Adh std3 splice3 128295 128296 . + . transcript "kuz" Adh std3 splice5 129342 129343 . + . transcript "kuz" Adh std3 splice3 129400 129401 . + . transcript "kuz" Adh std3 splice5 129965 129966 . + . transcript "kuz" Adh std3 splice3 130135 130136 . + . transcript "kuz" Adh std3 splice5 130595 130596 . + . transcript "kuz" Adh std3 splice3 131039 131040 . + . transcript "kuz" # # ### ### # # Adh std3 start_codon 90664 90666 . - . transcript "BG:DS07660.1" Adh std3 stop_codon 89305 89307 . - . transcript "BG:DS07660.1" Adh std3 CDS 89305 90666 . - . transcript "BG:DS07660.1" # # ### ### # # Adh std3 start_codon 134965 134967 . - . transcript "BG:BACR48E02.4" Adh std3 stop_codon 133458 133460 . - . transcript "BG:BACR48E02.4" Adh std3 CDS 133458 133548 . - . transcript "BG:BACR48E02.4" Adh std3 CDS 133612 134233 . - . transcript "BG:BACR48E02.4" Adh std3 CDS 134862 134967 . - . transcript "BG:BACR48E02.4" Adh std3 splice3 133548 133549 . - . transcript "BG:BACR48E02.4" Adh std3 splice5 133611 133612 . - . transcript "BG:BACR48E02.4" Adh std3 splice3 134233 134234 . - . transcript "BG:BACR48E02.4" Adh std3 splice5 134861 134862 . - . transcript "BG:BACR48E02.4" # # ### ### # # Adh std3 start_codon 2101334 2101336 . - . transcript "BG:BACR44L22.1" Adh std3 stop_codon 2100551 2100553 . - . transcript "BG:BACR44L22.1" Adh std3 CDS 2100551 2101336 . - . transcript "BG:BACR44L22.1" # # ### ### # # Adh std3 start_codon 2102975 2102977 . - . transcript "BG:BACR44L22.8" Adh std3 stop_codon 2102169 2102171 . - . transcript "BG:BACR44L22.8" Adh std3 CDS 2102169 2102752 . - . transcript "BG:BACR44L22.8" Adh std3 CDS 2102776 2102977 . - . transcript "BG:BACR44L22.8" Adh std3 splice3 2102752 2102753 . - . transcript "BG:BACR44L22.8" Adh std3 splice5 2102775 2102776 . - . transcript "BG:BACR44L22.8" # # ### ### # # Adh std3 start_codon 2104440 2104442 . - . transcript "BG:BACR44L22.2" Adh std3 stop_codon 2103622 2103624 . - . transcript "BG:BACR44L22.2" Adh std3 CDS 2103622 2104169 . - . transcript "BG:BACR44L22.2" Adh std3 CDS 2104226 2104442 . - . transcript "BG:BACR44L22.2" Adh std3 splice3 2104169 2104170 . - . transcript "BG:BACR44L22.2" Adh std3 splice5 2104225 2104226 . - . transcript "BG:BACR44L22.2" # # ### ### # # Adh std3 start_codon 2105982 2105984 . - . transcript "BG:BACR44L22.3" Adh std3 stop_codon 2105170 2105172 . - . transcript "BG:BACR44L22.3" Adh std3 CDS 2105170 2105720 . - . transcript "BG:BACR44L22.3" Adh std3 CDS 2105774 2105984 . - . transcript "BG:BACR44L22.3" Adh std3 splice3 2105720 2105721 . - . transcript "BG:BACR44L22.3" Adh std3 splice5 2105773 2105774 . - . transcript "BG:BACR44L22.3" # # ### ### # # Adh std3 start_codon 2106653 2106655 . + . transcript "BG:BACR44L22.4" Adh std3 stop_codon 2107443 2107445 . + . transcript "BG:BACR44L22.4" Adh std3 CDS 2106653 2106860 . + . transcript "BG:BACR44L22.4" Adh std3 CDS 2106931 2107445 . + . transcript "BG:BACR44L22.4" Adh std3 splice5 2106860 2106861 . + . transcript "BG:BACR44L22.4" Adh std3 splice3 2106930 2106931 . + . transcript "BG:BACR44L22.4" # # ### ### # # Adh std3 start_codon 2113207 2113209 . - . transcript "BG:BACR44L22.5" Adh std3 stop_codon 2109315 2109317 . - . transcript "BG:BACR44L22.5" Adh std3 CDS 2109315 2109407 . - . transcript "BG:BACR44L22.5" Adh std3 CDS 2111897 2112079 . - . transcript "BG:BACR44L22.5" Adh std3 CDS 2112328 2113209 . - . transcript "BG:BACR44L22.5" Adh std3 splice3 2109407 2109408 . - . transcript "BG:BACR44L22.5" Adh std3 splice5 2111896 2111897 . - . transcript "BG:BACR44L22.5" Adh std3 splice3 2112079 2112080 . - . transcript "BG:BACR44L22.5" Adh std3 splice5 2112327 2112328 . - . transcript "BG:BACR44L22.5" # # ### ### # # Adh std3 start_codon 2118335 2118337 . + . transcript "BG:BACR44L22.6" Adh std3 stop_codon 2119159 2119161 . + . transcript "BG:BACR44L22.6" Adh std3 CDS 2118335 2118551 . + . transcript "BG:BACR44L22.6" Adh std3 CDS 2118614 2119161 . + . transcript "BG:BACR44L22.6" Adh std3 splice5 2118551 2118552 . + . transcript "BG:BACR44L22.6" Adh std3 splice3 2118613 2118614 . + . transcript "BG:BACR44L22.6" # # ### ### # # Adh std3 start_codon 2119874 2119876 . + . transcript "BG:DS07108.4" Adh std3 stop_codon 2121743 2121745 . + . transcript "BG:DS07108.4" Adh std3 CDS 2119874 2120025 . + . transcript "BG:DS07108.4" Adh std3 CDS 2120092 2120194 . + . transcript "BG:DS07108.4" Adh std3 CDS 2120312 2121269 . + . transcript "BG:DS07108.4" Adh std3 CDS 2121336 2121745 . + . transcript "BG:DS07108.4" Adh std3 splice5 2120025 2120026 . + . transcript "BG:DS07108.4" Adh std3 splice3 2120091 2120092 . + . transcript "BG:DS07108.4" Adh std3 splice5 2120194 2120195 . + . transcript "BG:DS07108.4" Adh std3 splice3 2120311 2120312 . + . transcript "BG:DS07108.4" Adh std3 splice5 2121269 2121270 . + . transcript "BG:DS07108.4" Adh std3 splice3 2121335 2121336 . + . transcript "BG:DS07108.4" # # ### ### # # Adh std3 start_codon 602998 603000 . - . transcript "BG:DS01759.2" Adh std3 stop_codon 601945 601947 . - . transcript "BG:DS01759.2" Adh std3 CDS 601945 602889 . - . transcript "BG:DS01759.2" Adh std3 CDS 602944 603000 . - . transcript "BG:DS01759.2" Adh std3 splice3 602889 602890 . - . transcript "BG:DS01759.2" Adh std3 splice5 602943 602944 . - . transcript "BG:DS01759.2" # # ### ### # # Adh std3 start_codon 598403 598405 . + . transcript "BG:DS01759.1" Adh std3 stop_codon 600431 600433 . + . transcript "BG:DS01759.1" Adh std3 CDS 598403 598796 . + . transcript "BG:DS01759.1" Adh std3 CDS 598857 599119 . + . transcript "BG:DS01759.1" Adh std3 CDS 599219 600433 . + . transcript "BG:DS01759.1" Adh std3 splice5 598796 598797 . + . transcript "BG:DS01759.1" Adh std3 splice3 598856 598857 . + . transcript "BG:DS01759.1" Adh std3 splice5 599119 599120 . + . transcript "BG:DS01759.1" Adh std3 splice3 599218 599219 . + . transcript "BG:DS01759.1" # # ### ### # # Adh std3 start_codon 1823746 1823748 . + . transcript "esg" Adh std3 stop_codon 1825156 1825158 . + . transcript "esg" Adh std3 CDS 1823746 1825158 . + . transcript "esg" # # ### ### # # Adh std3 start_codon 1809556 1809558 . - . transcript "BG:DS07851.6" Adh std3 stop_codon 1807761 1807763 . - . transcript "BG:DS07851.6" Adh std3 CDS 1807761 1808476 . - . transcript "BG:DS07851.6" Adh std3 CDS 1809495 1809558 . - . transcript "BG:DS07851.6" Adh std3 splice3 1808476 1808477 . - . transcript "BG:DS07851.6" Adh std3 splice5 1809494 1809495 . - . transcript "BG:DS07851.6" # # ### ### # # Adh std3 start_codon 1787599 1787601 . + . transcript "BG:DS07851.5" Adh std3 stop_codon 1788913 1788915 . + . transcript "BG:DS07851.5" Adh std3 CDS 1787599 1788915 . + . transcript "BG:DS07851.5" # # ### ### # # Adh std3 start_codon 1786407 1786409 . - . transcript "ms.2.35Ci" Adh std3 stop_codon 1782412 1782414 . - . transcript "ms.2.35Ci" Adh std3 CDS 1782412 1782827 . - . transcript "ms.2.35Ci" Adh std3 CDS 1783140 1783286 . - . transcript "ms.2.35Ci" Adh std3 CDS 1783610 1783696 . - . transcript "ms.2.35Ci" Adh std3 CDS 1784926 1785036 . - . transcript "ms.2.35Ci" Adh std3 CDS 1785511 1785654 . - . transcript "ms.2.35Ci" Adh std3 CDS 1786132 1786291 . - . transcript "ms.2.35Ci" Adh std3 CDS 1786326 1786409 . - . transcript "ms.2.35Ci" Adh std3 splice3 1782827 1782828 . - . transcript "ms.2.35Ci" Adh std3 splice5 1783139 1783140 . - . transcript "ms.2.35Ci" Adh std3 splice3 1783286 1783287 . - . transcript "ms.2.35Ci" Adh std3 splice5 1783609 1783610 . - . transcript "ms.2.35Ci" Adh std3 splice3 1783696 1783697 . - . transcript "ms.2.35Ci" Adh std3 splice5 1784925 1784926 . - . transcript "ms.2.35Ci" Adh std3 splice3 1785036 1785037 . - . transcript "ms.2.35Ci" Adh std3 splice5 1785510 1785511 . - . transcript "ms.2.35Ci" Adh std3 splice3 1785654 1785655 . - . transcript "ms.2.35Ci" Adh std3 splice5 1786131 1786132 . - . transcript "ms.2.35Ci" Adh std3 splice3 1786291 1786292 . - . transcript "ms.2.35Ci" Adh std3 splice5 1786325 1786326 . - . transcript "ms.2.35Ci" # # ### ### # # Adh std3 start_codon 1781823 1781825 . - . transcript "BG:DS07851.8" Adh std3 stop_codon 1780341 1780343 . - . transcript "BG:DS07851.8" Adh std3 CDS 1780341 1780496 . - . transcript "BG:DS07851.8" Adh std3 CDS 1781148 1781825 . - . transcript "BG:DS07851.8" Adh std3 splice3 1780496 1780497 . - . transcript "BG:DS07851.8" Adh std3 splice5 1781147 1781148 . - . transcript "BG:DS07851.8" # # ### ### # # Adh std3 start_codon 1774679 1774681 . + . transcript "BG:DS07851.4" Adh std3 stop_codon 1775555 1775557 . + . transcript "BG:DS07851.4" Adh std3 CDS 1774679 1775557 . + . transcript "BG:DS07851.4" # # ### ### # # Adh std3 start_codon 1764636 1764638 . - . transcript "BG:DS07851.3" Adh std3 stop_codon 1763921 1763923 . - . transcript "BG:DS07851.3" Adh std3 CDS 1763921 1764042 . - . transcript "BG:DS07851.3" Adh std3 CDS 1764272 1764501 . - . transcript "BG:DS07851.3" Adh std3 CDS 1764574 1764638 . - . transcript "BG:DS07851.3" Adh std3 splice3 1764042 1764043 . - . transcript "BG:DS07851.3" Adh std3 splice5 1764271 1764272 . - . transcript "BG:DS07851.3" Adh std3 splice3 1764501 1764502 . - . transcript "BG:DS07851.3" Adh std3 splice5 1764573 1764574 . - . transcript "BG:DS07851.3" # # ### ### # # Adh std3 start_codon 1760614 1760616 . - . transcript "gft" Adh std3 stop_codon 1756026 1756028 . - . transcript "gft" Adh std3 CDS 1756026 1756178 . - . transcript "gft" Adh std3 CDS 1756248 1756386 . - . transcript "gft" Adh std3 CDS 1756448 1756671 . - . transcript "gft" Adh std3 CDS 1756797 1756939 . - . transcript "gft" Adh std3 CDS 1757005 1757119 . - . transcript "gft" Adh std3 CDS 1757182 1757352 . - . transcript "gft" Adh std3 CDS 1757415 1757585 . - . transcript "gft" Adh std3 CDS 1757648 1758409 . - . transcript "gft" Adh std3 CDS 1758473 1758856 . - . transcript "gft" Adh std3 CDS 1760557 1760616 . - . transcript "gft" Adh std3 splice3 1756178 1756179 . - . transcript "gft" Adh std3 splice5 1756247 1756248 . - . transcript "gft" Adh std3 splice3 1756386 1756387 . - . transcript "gft" Adh std3 splice5 1756447 1756448 . - . transcript "gft" Adh std3 splice3 1756671 1756672 . - . transcript "gft" Adh std3 splice5 1756796 1756797 . - . transcript "gft" Adh std3 splice3 1756939 1756940 . - . transcript "gft" Adh std3 splice5 1757004 1757005 . - . transcript "gft" Adh std3 splice3 1757119 1757120 . - . transcript "gft" Adh std3 splice5 1757181 1757182 . - . transcript "gft" Adh std3 splice3 1757352 1757353 . - . transcript "gft" Adh std3 splice5 1757414 1757415 . - . transcript "gft" Adh std3 splice3 1757585 1757586 . - . transcript "gft" Adh std3 splice5 1757647 1757648 . - . transcript "gft" Adh std3 splice3 1758409 1758410 . - . transcript "gft" Adh std3 splice5 1758472 1758473 . - . transcript "gft" Adh std3 splice3 1758856 1758857 . - . transcript "gft" Adh std3 splice5 1760556 1760557 . - . transcript "gft" Adh std3 splice3 1760795 1760796 . - . transcript "gft" Adh std3 splice5 1761485 1761486 . - . transcript "gft" # # ### ### # # Adh std3 start_codon 1753776 1753778 . - . transcript "BG:DS07851.11" Adh std3 stop_codon 1752891 1752893 . - . transcript "BG:DS07851.11" Adh std3 CDS 1752891 1753316 . - . transcript "BG:DS07851.11" Adh std3 CDS 1753422 1753778 . - . transcript "BG:DS07851.11" Adh std3 splice3 1753316 1753317 . - . transcript "BG:DS07851.11" Adh std3 splice5 1753421 1753422 . - . transcript "BG:DS07851.11" # # ### ### # # Adh std3 start_codon 1432221 1432223 . - . transcript "BG:DS01219.3" Adh std3 stop_codon 1421921 1421923 . - . transcript "BG:DS01219.3" Adh std3 CDS 1421921 1422143 . - . transcript "BG:DS01219.3" Adh std3 CDS 1422176 1422320 . - . transcript "BG:DS01219.3" Adh std3 CDS 1424531 1424676 . - . transcript "BG:DS01219.3" Adh std3 CDS 1424907 1425003 . - . transcript "BG:DS01219.3" Adh std3 CDS 1425549 1425752 . - . transcript "BG:DS01219.3" Adh std3 CDS 1426168 1426281 . - . transcript "BG:DS01219.3" Adh std3 CDS 1426393 1426486 . - . transcript "BG:DS01219.3" Adh std3 CDS 1428573 1428690 . - . transcript "BG:DS01219.3" Adh std3 CDS 1431180 1431306 . - . transcript "BG:DS01219.3" Adh std3 CDS 1432142 1432223 . - . transcript "BG:DS01219.3" Adh std3 splice3 1422143 1422144 . - . transcript "BG:DS01219.3" Adh std3 splice5 1422175 1422176 . - . transcript "BG:DS01219.3" Adh std3 splice3 1422320 1422321 . - . transcript "BG:DS01219.3" Adh std3 splice5 1424530 1424531 . - . transcript "BG:DS01219.3" Adh std3 splice3 1424676 1424677 . - . transcript "BG:DS01219.3" Adh std3 splice5 1424906 1424907 . - . transcript "BG:DS01219.3" Adh std3 splice3 1425003 1425004 . - . transcript "BG:DS01219.3" Adh std3 splice5 1425548 1425549 . - . transcript "BG:DS01219.3" Adh std3 splice3 1425752 1425753 . - . transcript "BG:DS01219.3" Adh std3 splice5 1426167 1426168 . - . transcript "BG:DS01219.3" Adh std3 splice3 1426281 1426282 . - . transcript "BG:DS01219.3" Adh std3 splice5 1426392 1426393 . - . transcript "BG:DS01219.3" Adh std3 splice3 1426486 1426487 . - . transcript "BG:DS01219.3" Adh std3 splice5 1428572 1428573 . - . transcript "BG:DS01219.3" Adh std3 splice3 1428690 1428691 . - . transcript "BG:DS01219.3" Adh std3 splice5 1431179 1431180 . - . transcript "BG:DS01219.3" Adh std3 splice3 1431306 1431307 . - . transcript "BG:DS01219.3" Adh std3 splice5 1432141 1432142 . - . transcript "BG:DS01219.3" # # ### ### # # Adh std3 start_codon 2182861 2182863 . - . transcript "CycE-type1" Adh std3 stop_codon 2180707 2180709 . - . transcript "CycE-type1" Adh std3 CDS 2180707 2180982 . - . transcript "CycE-type1" Adh std3 CDS 2181100 2181325 . - . transcript "CycE-type1" Adh std3 CDS 2181392 2182662 . - . transcript "CycE-type1" Adh std3 CDS 2182828 2182863 . - . transcript "CycE-type1" Adh std3 splice3 2172011 2172012 . - . transcript "CycE-type1" Adh std3 splice5 2179394 2179395 . - . transcript "CycE-type1" Adh std3 splice3 2180982 2180983 . - . transcript "CycE-type1" Adh std3 splice5 2181099 2181100 . - . transcript "CycE-type1" Adh std3 splice3 2181325 2181326 . - . transcript "CycE-type1" Adh std3 splice5 2181391 2181392 . - . transcript "CycE-type1" Adh std3 splice3 2182662 2182663 . - . transcript "CycE-type1" Adh std3 splice5 2182827 2182828 . - . transcript "CycE-type1" # # ### ### # # Adh std3 start_codon 2158476 2158478 . + . transcript "BG:DS07108.5" Adh std3 stop_codon 2159458 2159460 . + . transcript "BG:DS07108.5" Adh std3 CDS 2158476 2158559 . + . transcript "BG:DS07108.5" Adh std3 CDS 2158660 2159460 . + . transcript "BG:DS07108.5" Adh std3 splice5 2158559 2158560 . + . transcript "BG:DS07108.5" Adh std3 splice3 2158659 2158660 . + . transcript "BG:DS07108.5" # # ### ### # # Adh std3 start_codon 2149283 2149285 . + . transcript "BG:DS07108.1" Adh std3 stop_codon 2150905 2150907 . + . transcript "BG:DS07108.1" Adh std3 CDS 2149283 2149510 . + . transcript "BG:DS07108.1" Adh std3 CDS 2149741 2150907 . + . transcript "BG:DS07108.1" Adh std3 splice5 2149510 2149511 . + . transcript "BG:DS07108.1" Adh std3 splice3 2149740 2149741 . + . transcript "BG:DS07108.1" # # ### ### # # Adh std3 start_codon 2146971 2146973 . - . transcript "BG:DS07108.2" Adh std3 stop_codon 2137486 2137488 . - . transcript "BG:DS07108.2" Adh std3 CDS 2137486 2137679 . - . transcript "BG:DS07108.2" Adh std3 CDS 2137746 2137902 . - . transcript "BG:DS07108.2" Adh std3 CDS 2137961 2138116 . - . transcript "BG:DS07108.2" Adh std3 CDS 2138186 2138671 . - . transcript "BG:DS07108.2" Adh std3 CDS 2138733 2138994 . - . transcript "BG:DS07108.2" Adh std3 CDS 2139065 2139169 . - . transcript "BG:DS07108.2" Adh std3 CDS 2139824 2140056 . - . transcript "BG:DS07108.2" Adh std3 CDS 2140199 2140353 . - . transcript "BG:DS07108.2" Adh std3 CDS 2140417 2140630 . - . transcript "BG:DS07108.2" Adh std3 CDS 2140705 2141412 . - . transcript "BG:DS07108.2" Adh std3 CDS 2141468 2141749 . - . transcript "BG:DS07108.2" Adh std3 CDS 2141998 2142471 . - . transcript "BG:DS07108.2" Adh std3 CDS 2146632 2146973 . - . transcript "BG:DS07108.2" Adh std3 splice3 2137679 2137680 . - . transcript "BG:DS07108.2" Adh std3 splice5 2137745 2137746 . - . transcript "BG:DS07108.2" Adh std3 splice3 2137902 2137903 . - . transcript "BG:DS07108.2" Adh std3 splice5 2137960 2137961 . - . transcript "BG:DS07108.2" Adh std3 splice3 2138116 2138117 . - . transcript "BG:DS07108.2" Adh std3 splice5 2138185 2138186 . - . transcript "BG:DS07108.2" Adh std3 splice3 2138671 2138672 . - . transcript "BG:DS07108.2" Adh std3 splice5 2138732 2138733 . - . transcript "BG:DS07108.2" Adh std3 splice3 2138994 2138995 . - . transcript "BG:DS07108.2" Adh std3 splice5 2139064 2139065 . - . transcript "BG:DS07108.2" Adh std3 splice3 2139169 2139170 . - . transcript "BG:DS07108.2" Adh std3 splice5 2139823 2139824 . - . transcript "BG:DS07108.2" Adh std3 splice3 2140056 2140057 . - . transcript "BG:DS07108.2" Adh std3 splice5 2140198 2140199 . - . transcript "BG:DS07108.2" Adh std3 splice3 2140353 2140354 . - . transcript "BG:DS07108.2" Adh std3 splice5 2140416 2140417 . - . transcript "BG:DS07108.2" Adh std3 splice3 2140630 2140631 . - . transcript "BG:DS07108.2" Adh std3 splice5 2140704 2140705 . - . transcript "BG:DS07108.2" Adh std3 splice3 2141412 2141413 . - . transcript "BG:DS07108.2" Adh std3 splice5 2141467 2141468 . - . transcript "BG:DS07108.2" Adh std3 splice3 2141749 2141750 . - . transcript "BG:DS07108.2" Adh std3 splice5 2141997 2141998 . - . transcript "BG:DS07108.2" Adh std3 splice3 2142471 2142472 . - . transcript "BG:DS07108.2" Adh std3 splice5 2146631 2146632 . - . transcript "BG:DS07108.2" # # ### ### # # Adh std3 start_codon 568986 568988 . + . transcript "BG:DS05899.4" Adh std3 stop_codon 575531 575533 . + . transcript "BG:DS05899.4" Adh std3 CDS 568986 569222 . + . transcript "BG:DS05899.4" Adh std3 CDS 570329 570621 . + . transcript "BG:DS05899.4" Adh std3 CDS 570790 570947 . + . transcript "BG:DS05899.4" Adh std3 CDS 574289 574483 . + . transcript "BG:DS05899.4" Adh std3 CDS 575409 575533 . + . transcript "BG:DS05899.4" Adh std3 splice5 569222 569223 . + . transcript "BG:DS05899.4" Adh std3 splice3 570328 570329 . + . transcript "BG:DS05899.4" Adh std3 splice5 570621 570622 . + . transcript "BG:DS05899.4" Adh std3 splice3 570789 570790 . + . transcript "BG:DS05899.4" Adh std3 splice5 570947 570948 . + . transcript "BG:DS05899.4" Adh std3 splice3 574288 574289 . + . transcript "BG:DS05899.4" Adh std3 splice5 574483 574484 . + . transcript "BG:DS05899.4" Adh std3 splice3 575408 575409 . + . transcript "BG:DS05899.4" # # ### ### # # Adh std3 start_codon 555360 555362 . + . transcript "BG:DS05899.5" Adh std3 stop_codon 556628 556630 . + . transcript "BG:DS05899.5" Adh std3 CDS 555360 555824 . + . transcript "BG:DS05899.5" Adh std3 CDS 555920 556630 . + . transcript "BG:DS05899.5" Adh std3 splice5 555824 555825 . + . transcript "BG:DS05899.5" Adh std3 splice3 555919 555920 . + . transcript "BG:DS05899.5" # # ### ### # # Adh std3 start_codon 541380 541382 . + . transcript "BG:DS05899.3" Adh std3 stop_codon 542511 542513 . + . transcript "BG:DS05899.3" Adh std3 CDS 541380 542513 . + . transcript "BG:DS05899.3" # # ### ### # # Adh std3 start_codon 536911 536913 . - . transcript "BG:DS05899.6" Adh std3 stop_codon 533592 533594 . - . transcript "BG:DS05899.6" Adh std3 CDS 533592 533994 . - . transcript "BG:DS05899.6" Adh std3 CDS 534017 534188 . - . transcript "BG:DS05899.6" Adh std3 CDS 534467 534571 . - . transcript "BG:DS05899.6" Adh std3 CDS 536670 536913 . - . transcript "BG:DS05899.6" Adh std3 splice3 533994 533995 . - . transcript "BG:DS05899.6" Adh std3 splice5 534016 534017 . - . transcript "BG:DS05899.6" Adh std3 splice3 534188 534189 . - . transcript "BG:DS05899.6" Adh std3 splice5 534466 534467 . - . transcript "BG:DS05899.6" Adh std3 splice3 534571 534572 . - . transcript "BG:DS05899.6" Adh std3 splice5 536669 536670 . - . transcript "BG:DS05899.6" # # ### ### # # Adh std3 start_codon 525281 525283 . - . transcript "BG:DS05899.7" Adh std3 stop_codon 523395 523397 . - . transcript "BG:DS05899.7" Adh std3 CDS 523395 523601 . - . transcript "BG:DS05899.7" Adh std3 CDS 523660 524253 . - . transcript "BG:DS05899.7" Adh std3 CDS 524438 525283 . - . transcript "BG:DS05899.7" Adh std3 splice3 523601 523602 . - . transcript "BG:DS05899.7" Adh std3 splice5 523659 523660 . - . transcript "BG:DS05899.7" Adh std3 splice3 524253 524254 . - . transcript "BG:DS05899.7" Adh std3 splice5 524437 524438 . - . transcript "BG:DS05899.7" # # ### ### # # Adh std3 start_codon 520781 520783 . + . transcript "BG:DS05899.1" Adh std3 stop_codon 522986 522988 . + . transcript "BG:DS05899.1" Adh std3 CDS 520781 521850 . + . transcript "BG:DS05899.1" Adh std3 CDS 522013 522988 . + . transcript "BG:DS05899.1" Adh std3 splice5 521850 521851 . + . transcript "BG:DS05899.1" Adh std3 splice3 522012 522013 . + . transcript "BG:DS05899.1" # # ### ### # # Adh std3 start_codon 1628242 1628244 . + . transcript "BG:DS03192.3" Adh std3 stop_codon 1628410 1628412 . + . transcript "BG:DS03192.3" Adh std3 CDS 1628242 1628412 . + . transcript "BG:DS03192.3" # # ### ### # # Adh std3 start_codon 1667968 1667970 . - . transcript "BG:DS03192.2" Adh std3 stop_codon 1653146 1653148 . - . transcript "BG:DS03192.2" Adh std3 CDS 1653146 1653412 . - . transcript "BG:DS03192.2" Adh std3 CDS 1653857 1657133 . - . transcript "BG:DS03192.2" Adh std3 CDS 1657232 1657342 . - . transcript "BG:DS03192.2" Adh std3 CDS 1661045 1661189 . - . transcript "BG:DS03192.2" Adh std3 CDS 1661787 1661932 . - . transcript "BG:DS03192.2" Adh std3 CDS 1665755 1665947 . - . transcript "BG:DS03192.2" Adh std3 CDS 1667694 1667970 . - . transcript "BG:DS03192.2" Adh std3 splice3 1653412 1653413 . - . transcript "BG:DS03192.2" Adh std3 splice5 1653856 1653857 . - . transcript "BG:DS03192.2" Adh std3 splice3 1657133 1657134 . - . transcript "BG:DS03192.2" Adh std3 splice5 1657231 1657232 . - . transcript "BG:DS03192.2" Adh std3 splice3 1657342 1657343 . - . transcript "BG:DS03192.2" Adh std3 splice5 1661044 1661045 . - . transcript "BG:DS03192.2" Adh std3 splice3 1661189 1661190 . - . transcript "BG:DS03192.2" Adh std3 splice5 1661786 1661787 . - . transcript "BG:DS03192.2" Adh std3 splice3 1661932 1661933 . - . transcript "BG:DS03192.2" Adh std3 splice5 1665754 1665755 . - . transcript "BG:DS03192.2" Adh std3 splice3 1665947 1665948 . - . transcript "BG:DS03192.2" Adh std3 splice5 1667693 1667694 . - . transcript "BG:DS03192.2" # # ### ### # # Adh std3 start_codon 1663161 1663163 . - . transcript "BG:DS03192.4" Adh std3 stop_codon 1663026 1663028 . - . transcript "BG:DS03192.4" Adh std3 CDS 1663026 1663163 . - . transcript "BG:DS03192.4" # # ### ### # # Adh std3 start_codon 1737244 1737246 . - . transcript "BG:DS07295.1" Adh std3 stop_codon 1718580 1718582 . - . transcript "BG:DS07295.1" Adh std3 CDS 1718580 1718725 . - . transcript "BG:DS07295.1" Adh std3 CDS 1719195 1719342 . - . transcript "BG:DS07295.1" Adh std3 CDS 1719504 1720005 . - . transcript "BG:DS07295.1" Adh std3 CDS 1726256 1726435 . - . transcript "BG:DS07295.1" Adh std3 CDS 1730116 1730236 . - . transcript "BG:DS07295.1" Adh std3 CDS 1731062 1731172 . - . transcript "BG:DS07295.1" Adh std3 CDS 1735826 1736004 . - . transcript "BG:DS07295.1" Adh std3 CDS 1737215 1737246 . - . transcript "BG:DS07295.1" Adh std3 splice3 1718725 1718726 . - . transcript "BG:DS07295.1" Adh std3 splice5 1719194 1719195 . - . transcript "BG:DS07295.1" Adh std3 splice3 1719342 1719343 . - . transcript "BG:DS07295.1" Adh std3 splice5 1719503 1719504 . - . transcript "BG:DS07295.1" Adh std3 splice3 1720005 1720006 . - . transcript "BG:DS07295.1" Adh std3 splice5 1726255 1726256 . - . transcript "BG:DS07295.1" Adh std3 splice3 1726435 1726436 . - . transcript "BG:DS07295.1" Adh std3 splice5 1730115 1730116 . - . transcript "BG:DS07295.1" Adh std3 splice3 1730236 1730237 . - . transcript "BG:DS07295.1" Adh std3 splice5 1731061 1731062 . - . transcript "BG:DS07295.1" Adh std3 splice3 1731172 1731173 . - . transcript "BG:DS07295.1" Adh std3 splice5 1735825 1735826 . - . transcript "BG:DS07295.1" Adh std3 splice3 1736004 1736005 . - . transcript "BG:DS07295.1" Adh std3 splice5 1737214 1737215 . - . transcript "BG:DS07295.1" # # ### ### # # Adh std3 start_codon 1721863 1721865 . + . transcript "BG:DS07295.4" Adh std3 stop_codon 1728734 1728736 . + . transcript "BG:DS07295.4" Adh std3 CDS 1721863 1721967 . + . transcript "BG:DS07295.4" Adh std3 CDS 1722243 1722408 . + . transcript "BG:DS07295.4" Adh std3 CDS 1722493 1722656 . + . transcript "BG:DS07295.4" Adh std3 CDS 1724226 1724372 . + . transcript "BG:DS07295.4" Adh std3 CDS 1725680 1726192 . + . transcript "BG:DS07295.4" Adh std3 CDS 1726279 1726480 . + . transcript "BG:DS07295.4" Adh std3 CDS 1727221 1727390 . + . transcript "BG:DS07295.4" Adh std3 CDS 1728458 1728736 . + . transcript "BG:DS07295.4" Adh std3 splice5 1721967 1721968 . + . transcript "BG:DS07295.4" Adh std3 splice3 1722242 1722243 . + . transcript "BG:DS07295.4" Adh std3 splice5 1722408 1722409 . + . transcript "BG:DS07295.4" Adh std3 splice3 1722492 1722493 . + . transcript "BG:DS07295.4" Adh std3 splice5 1722656 1722657 . + . transcript "BG:DS07295.4" Adh std3 splice3 1724225 1724226 . + . transcript "BG:DS07295.4" Adh std3 splice5 1724372 1724373 . + . transcript "BG:DS07295.4" Adh std3 splice3 1725679 1725680 . + . transcript "BG:DS07295.4" Adh std3 splice5 1726192 1726193 . + . transcript "BG:DS07295.4" Adh std3 splice3 1726278 1726279 . + . transcript "BG:DS07295.4" Adh std3 splice5 1726480 1726481 . + . transcript "BG:DS07295.4" Adh std3 splice3 1727220 1727221 . + . transcript "BG:DS07295.4" Adh std3 splice5 1727390 1727391 . + . transcript "BG:DS07295.4" Adh std3 splice3 1728457 1728458 . + . transcript "BG:DS07295.4" # # ### ### # # Adh std3 start_codon 1738791 1738793 . + . transcript "BG:DS07295.2" Adh std3 stop_codon 1743191 1743193 . + . transcript "BG:DS07295.2" Adh std3 CDS 1738791 1739218 . + . transcript "BG:DS07295.2" Adh std3 CDS 1740300 1740540 . + . transcript "BG:DS07295.2" Adh std3 CDS 1740659 1740939 . + . transcript "BG:DS07295.2" Adh std3 CDS 1740995 1742042 . + . transcript "BG:DS07295.2" Adh std3 CDS 1742104 1742446 . + . transcript "BG:DS07295.2" Adh std3 CDS 1742886 1743193 . + . transcript "BG:DS07295.2" Adh std3 splice5 1739218 1739219 . + . transcript "BG:DS07295.2" Adh std3 splice3 1740299 1740300 . + . transcript "BG:DS07295.2" Adh std3 splice5 1740540 1740541 . + . transcript "BG:DS07295.2" Adh std3 splice3 1740658 1740659 . + . transcript "BG:DS07295.2" Adh std3 splice5 1740939 1740940 . + . transcript "BG:DS07295.2" Adh std3 splice3 1740994 1740995 . + . transcript "BG:DS07295.2" Adh std3 splice5 1742042 1742043 . + . transcript "BG:DS07295.2" Adh std3 splice3 1742103 1742104 . + . transcript "BG:DS07295.2" Adh std3 splice5 1742446 1742447 . + . transcript "BG:DS07295.2" Adh std3 splice3 1742885 1742886 . + . transcript "BG:DS07295.2" # # ### ### # # Adh std3 start_codon 1745913 1745915 . - . transcript "BG:DS07295.3" Adh std3 stop_codon 1744620 1744622 . - . transcript "BG:DS07295.3" Adh std3 CDS 1744620 1745915 . - . transcript "BG:DS07295.3" # # ### ### # # Adh std3 start_codon 1746303 1746305 . + . transcript "BG:DS07295.5" Adh std3 stop_codon 1746840 1746842 . + . transcript "BG:DS07295.5" Adh std3 CDS 1746303 1746349 . + . transcript "BG:DS07295.5" Adh std3 CDS 1746401 1746842 . + . transcript "BG:DS07295.5" Adh std3 splice5 1746349 1746350 . + . transcript "BG:DS07295.5" Adh std3 splice3 1746400 1746401 . + . transcript "BG:DS07295.5" # # ### ### # # Adh std3 start_codon 1250633 1250635 . + . transcript "BG:DS06874.1" Adh std3 stop_codon 1251419 1251421 . + . transcript "BG:DS06874.1" Adh std3 CDS 1250633 1251421 . + . transcript "BG:DS06874.1" # # ### ### # # Adh std3 start_codon 1252544 1252546 . + . transcript "BG:DS06874.2" Adh std3 stop_codon 1253615 1253617 . + . transcript "BG:DS06874.2" Adh std3 CDS 1252544 1253617 . + . transcript "BG:DS06874.2" # # ### ### # # Adh std3 start_codon 1255669 1255671 . + . transcript "BG:DS06874.3" Adh std3 stop_codon 1256821 1256823 . + . transcript "BG:DS06874.3" Adh std3 CDS 1255669 1256823 . + . transcript "BG:DS06874.3" # # ### ### # # Adh std3 start_codon 1276357 1276359 . - . transcript "BG:DS06874.4" Adh std3 stop_codon 1271377 1271379 . - . transcript "BG:DS06874.4" Adh std3 CDS 1271377 1272140 . - . transcript "BG:DS06874.4" Adh std3 CDS 1272217 1272395 . - . transcript "BG:DS06874.4" Adh std3 CDS 1273203 1273596 . - . transcript "BG:DS06874.4" Adh std3 CDS 1273652 1273822 . - . transcript "BG:DS06874.4" Adh std3 CDS 1274014 1274154 . - . transcript "BG:DS06874.4" Adh std3 CDS 1276206 1276359 . - . transcript "BG:DS06874.4" Adh std3 splice3 1272140 1272141 . - . transcript "BG:DS06874.4" Adh std3 splice5 1272216 1272217 . - . transcript "BG:DS06874.4" Adh std3 splice3 1272395 1272396 . - . transcript "BG:DS06874.4" Adh std3 splice5 1273202 1273203 . - . transcript "BG:DS06874.4" Adh std3 splice3 1273596 1273597 . - . transcript "BG:DS06874.4" Adh std3 splice5 1273651 1273652 . - . transcript "BG:DS06874.4" Adh std3 splice3 1273822 1273823 . - . transcript "BG:DS06874.4" Adh std3 splice5 1274013 1274014 . - . transcript "BG:DS06874.4" Adh std3 splice3 1274154 1274155 . - . transcript "BG:DS06874.4" Adh std3 splice5 1276205 1276206 . - . transcript "BG:DS06874.4" # # ### ### # # Adh std3 start_codon 1286197 1286199 . - . transcript "BG:DS06874.6" Adh std3 stop_codon 1285030 1285032 . - . transcript "BG:DS06874.6" Adh std3 CDS 1285030 1285502 . - . transcript "BG:DS06874.6" Adh std3 CDS 1285595 1285746 . - . transcript "BG:DS06874.6" Adh std3 CDS 1285814 1285859 . - . transcript "BG:DS06874.6" Adh std3 CDS 1285971 1286199 . - . transcript "BG:DS06874.6" Adh std3 splice3 1285502 1285503 . - . transcript "BG:DS06874.6" Adh std3 splice5 1285594 1285595 . - . transcript "BG:DS06874.6" Adh std3 splice3 1285746 1285747 . - . transcript "BG:DS06874.6" Adh std3 splice5 1285813 1285814 . - . transcript "BG:DS06874.6" Adh std3 splice3 1285859 1285860 . - . transcript "BG:DS06874.6" Adh std3 splice5 1285970 1285971 . - . transcript "BG:DS06874.6" # # ### ### # # Adh std3 start_codon 1300469 1300471 . + . transcript "BG:DS06874.7" Adh std3 stop_codon 1315920 1315922 . + . transcript "BG:DS06874.7" Adh std3 CDS 1300469 1300474 . + . transcript "BG:DS06874.7" Adh std3 CDS 1300535 1302030 . + . transcript "BG:DS06874.7" Adh std3 CDS 1303048 1303240 . + . transcript "BG:DS06874.7" Adh std3 CDS 1306976 1307130 . + . transcript "BG:DS06874.7" Adh std3 CDS 1312765 1312941 . + . transcript "BG:DS06874.7" Adh std3 CDS 1315829 1315922 . + . transcript "BG:DS06874.7" Adh std3 splice5 1300474 1300475 . + . transcript "BG:DS06874.7" Adh std3 splice3 1300534 1300535 . + . transcript "BG:DS06874.7" Adh std3 splice5 1302030 1302031 . + . transcript "BG:DS06874.7" Adh std3 splice3 1303047 1303048 . + . transcript "BG:DS06874.7" Adh std3 splice5 1303240 1303241 . + . transcript "BG:DS06874.7" Adh std3 splice3 1306975 1306976 . + . transcript "BG:DS06874.7" Adh std3 splice5 1307130 1307131 . + . transcript "BG:DS06874.7" Adh std3 splice3 1312764 1312765 . + . transcript "BG:DS06874.7" Adh std3 splice5 1312941 1312942 . + . transcript "BG:DS06874.7" Adh std3 splice3 1315828 1315829 . + . transcript "BG:DS06874.7" # # ### ### # # Adh std3 start_codon 264992 264994 . + . transcript "BG:DS00797.1" Adh std3 stop_codon 267232 267234 . + . transcript "BG:DS00797.1" Adh std3 CDS 264992 264997 . + . transcript "BG:DS00797.1" Adh std3 CDS 265088 266322 . + . transcript "BG:DS00797.1" Adh std3 CDS 266392 266619 . + . transcript "BG:DS00797.1" Adh std3 CDS 266684 266867 . + . transcript "BG:DS00797.1" Adh std3 CDS 266935 267073 . + . transcript "BG:DS00797.1" Adh std3 CDS 267134 267234 . + . transcript "BG:DS00797.1" Adh std3 splice5 264997 264998 . + . transcript "BG:DS00797.1" Adh std3 splice3 265087 265088 . + . transcript "BG:DS00797.1" Adh std3 splice5 266322 266323 . + . transcript "BG:DS00797.1" Adh std3 splice3 266391 266392 . + . transcript "BG:DS00797.1" Adh std3 splice5 266619 266620 . + . transcript "BG:DS00797.1" Adh std3 splice3 266683 266684 . + . transcript "BG:DS00797.1" Adh std3 splice5 266867 266868 . + . transcript "BG:DS00797.1" Adh std3 splice3 266934 266935 . + . transcript "BG:DS00797.1" Adh std3 splice5 267073 267074 . + . transcript "BG:DS00797.1" Adh std3 splice3 267133 267134 . + . transcript "BG:DS00797.1" # # ### ### # # Adh std3 start_codon 273481 273483 . - . transcript "BG:DS00797.2" Adh std3 stop_codon 268751 268753 . - . transcript "BG:DS00797.2" Adh std3 CDS 268751 268798 . - . transcript "BG:DS00797.2" Adh std3 CDS 269006 269157 . - . transcript "BG:DS00797.2" Adh std3 CDS 269222 269559 . - . transcript "BG:DS00797.2" Adh std3 CDS 269629 269785 . - . transcript "BG:DS00797.2" Adh std3 CDS 269849 269907 . - . transcript "BG:DS00797.2" Adh std3 CDS 271522 271573 . - . transcript "BG:DS00797.2" Adh std3 CDS 273396 273483 . - . transcript "BG:DS00797.2" Adh std3 splice3 268798 268799 . - . transcript "BG:DS00797.2" Adh std3 splice5 269005 269006 . - . transcript "BG:DS00797.2" Adh std3 splice3 269157 269158 . - . transcript "BG:DS00797.2" Adh std3 splice5 269221 269222 . - . transcript "BG:DS00797.2" Adh std3 splice3 269559 269560 . - . transcript "BG:DS00797.2" Adh std3 splice5 269628 269629 . - . transcript "BG:DS00797.2" Adh std3 splice3 269785 269786 . - . transcript "BG:DS00797.2" Adh std3 splice5 269848 269849 . - . transcript "BG:DS00797.2" Adh std3 splice3 269907 269908 . - . transcript "BG:DS00797.2" Adh std3 splice5 271521 271522 . - . transcript "BG:DS00797.2" Adh std3 splice3 271573 271574 . - . transcript "BG:DS00797.2" Adh std3 splice5 273395 273396 . - . transcript "BG:DS00797.2" # # ### ### # # Adh std3 start_codon 274751 274753 . + . transcript "p38b" Adh std3 stop_codon 275846 275848 . + . transcript "p38b" Adh std3 CDS 274751 275110 . + . transcript "p38b" Adh std3 CDS 275123 275848 . + . transcript "p38b" Adh std3 splice5 274515 274516 . + . transcript "p38b" Adh std3 splice3 274617 274618 . + . transcript "p38b" Adh std3 splice5 275110 275111 . + . transcript "p38b" Adh std3 splice3 275122 275123 . + . transcript "p38b" # # ### ### # # Adh std3 start_codon 277186 277188 . - . transcript "BG:DS00797.4" Adh std3 stop_codon 276361 276363 . - . transcript "BG:DS00797.4" Adh std3 CDS 276361 276696 . - . transcript "BG:DS00797.4" Adh std3 CDS 276748 277188 . - . transcript "BG:DS00797.4" Adh std3 splice3 276696 276697 . - . transcript "BG:DS00797.4" Adh std3 splice5 276747 276748 . - . transcript "BG:DS00797.4" # # ### ### # # Adh std3 start_codon 281649 281651 . + . transcript "BG:DS00797.5" Adh std3 stop_codon 284050 284052 . + . transcript "BG:DS00797.5" Adh std3 CDS 281649 281787 . + . transcript "BG:DS00797.5" Adh std3 CDS 281848 282471 . + . transcript "BG:DS00797.5" Adh std3 CDS 282539 283541 . + . transcript "BG:DS00797.5" Adh std3 CDS 283608 284052 . + . transcript "BG:DS00797.5" Adh std3 splice5 281787 281788 . + . transcript "BG:DS00797.5" Adh std3 splice3 281847 281848 . + . transcript "BG:DS00797.5" Adh std3 splice5 282471 282472 . + . transcript "BG:DS00797.5" Adh std3 splice3 282538 282539 . + . transcript "BG:DS00797.5" Adh std3 splice5 283541 283542 . + . transcript "BG:DS00797.5" Adh std3 splice3 283607 283608 . + . transcript "BG:DS00797.5" # # ### ### # # Adh std3 start_codon 284779 284781 . + . transcript "BG:DS00797.6" Adh std3 stop_codon 286884 286886 . + . transcript "BG:DS00797.6" Adh std3 CDS 284779 284915 . + . transcript "BG:DS00797.6" Adh std3 CDS 284969 285346 . + . transcript "BG:DS00797.6" Adh std3 CDS 285416 286886 . + . transcript "BG:DS00797.6" Adh std3 splice5 284915 284916 . + . transcript "BG:DS00797.6" Adh std3 splice3 284968 284969 . + . transcript "BG:DS00797.6" Adh std3 splice5 285346 285347 . + . transcript "BG:DS00797.6" Adh std3 splice3 285415 285416 . + . transcript "BG:DS00797.6" # # ### ### # # Adh std3 start_codon 287599 287601 . + . transcript "BG:DS00797.7" Adh std3 stop_codon 292894 292896 . + . transcript "BG:DS00797.7" Adh std3 CDS 287599 288374 . + . transcript "BG:DS00797.7" Adh std3 CDS 288642 292689 . + . transcript "BG:DS00797.7" Adh std3 CDS 292759 292896 . + . transcript "BG:DS00797.7" Adh std3 splice5 288374 288375 . + . transcript "BG:DS00797.7" Adh std3 splice3 288641 288642 . + . transcript "BG:DS00797.7" Adh std3 splice5 292689 292690 . + . transcript "BG:DS00797.7" Adh std3 splice3 292758 292759 . + . transcript "BG:DS00797.7" # # ### ### # # Adh std3 start_codon 2505534 2505536 . + . transcript "beat" Adh std3 stop_codon 2530154 2530156 . + . transcript "beat" Adh std3 CDS 2505534 2505597 . + . transcript "beat" Adh std3 CDS 2524357 2524565 . + . transcript "beat" Adh std3 CDS 2525929 2526064 . + . transcript "beat" Adh std3 CDS 2527415 2527548 . + . transcript "beat" Adh std3 CDS 2529073 2529195 . + . transcript "beat" Adh std3 CDS 2529260 2529455 . + . transcript "beat" Adh std3 CDS 2529735 2530156 . + . transcript "beat" Adh std3 splice5 2499969 2499970 . + . transcript "beat" Adh std3 splice3 2505510 2505511 . + . transcript "beat" Adh std3 splice5 2505597 2505598 . + . transcript "beat" Adh std3 splice3 2524356 2524357 . + . transcript "beat" Adh std3 splice5 2524565 2524566 . + . transcript "beat" Adh std3 splice3 2525928 2525929 . + . transcript "beat" Adh std3 splice5 2526064 2526065 . + . transcript "beat" Adh std3 splice3 2527414 2527415 . + . transcript "beat" Adh std3 splice5 2527548 2527549 . + . transcript "beat" Adh std3 splice3 2529072 2529073 . + . transcript "beat" Adh std3 splice5 2529195 2529196 . + . transcript "beat" Adh std3 splice3 2529259 2529260 . + . transcript "beat" Adh std3 splice5 2529455 2529456 . + . transcript "beat" Adh std3 splice3 2529734 2529735 . + . transcript "beat" # # ### ### # # Adh std3 start_codon 2493314 2493316 . + . transcript "BicC" Adh std3 stop_codon 2497462 2497464 . + . transcript "BicC" Adh std3 CDS 2493314 2493620 . + . transcript "BicC" Adh std3 CDS 2493682 2493731 . + . transcript "BicC" Adh std3 CDS 2494047 2494116 . + . transcript "BicC" Adh std3 CDS 2494180 2494259 . + . transcript "BicC" Adh std3 CDS 2494325 2494651 . + . transcript "BicC" Adh std3 CDS 2495100 2495225 . + . transcript "BicC" Adh std3 CDS 2495286 2495667 . + . transcript "BicC" Adh std3 CDS 2495861 2496988 . + . transcript "BicC" Adh std3 CDS 2497217 2497464 . + . transcript "BicC" Adh std3 splice5 2493620 2493621 . + . transcript "BicC" Adh std3 splice3 2493681 2493682 . + . transcript "BicC" Adh std3 splice5 2493731 2493732 . + . transcript "BicC" Adh std3 splice3 2494046 2494047 . + . transcript "BicC" Adh std3 splice5 2494116 2494117 . + . transcript "BicC" Adh std3 splice3 2494179 2494180 . + . transcript "BicC" Adh std3 splice5 2494259 2494260 . + . transcript "BicC" Adh std3 splice3 2494324 2494325 . + . transcript "BicC" Adh std3 splice5 2494651 2494652 . + . transcript "BicC" Adh std3 splice3 2495099 2495100 . + . transcript "BicC" Adh std3 splice5 2495225 2495226 . + . transcript "BicC" Adh std3 splice3 2495285 2495286 . + . transcript "BicC" Adh std3 splice5 2495667 2495668 . + . transcript "BicC" Adh std3 splice3 2495860 2495861 . + . transcript "BicC" Adh std3 splice5 2496988 2496989 . + . transcript "BicC" Adh std3 splice3 2497216 2497217 . + . transcript "BicC" # # ### ### # # Adh std3 start_codon 1923109 1923111 . + . transcript "BG:DS03023.2" Adh std3 stop_codon 1924561 1924563 . + . transcript "BG:DS03023.2" Adh std3 CDS 1923109 1924563 . + . transcript "BG:DS03023.2" # # ### ### # # Adh std3 start_codon 1914946 1914948 . - . transcript "wor" Adh std3 stop_codon 1913374 1913376 . - . transcript "wor" Adh std3 CDS 1913374 1914948 . - . transcript "wor" # # ### ### # # Adh std3 start_codon 1895877 1895879 . - . transcript "BG:DS03023.4" Adh std3 stop_codon 1875987 1875989 . - . transcript "BG:DS03023.4" Adh std3 CDS 1875987 1876447 . - . transcript "BG:DS03023.4" Adh std3 CDS 1878988 1879161 . - . transcript "BG:DS03023.4" Adh std3 CDS 1881548 1881779 . - . transcript "BG:DS03023.4" Adh std3 CDS 1883261 1883385 . - . transcript "BG:DS03023.4" Adh std3 CDS 1883560 1883683 . - . transcript "BG:DS03023.4" Adh std3 CDS 1884195 1884559 . - . transcript "BG:DS03023.4" Adh std3 CDS 1885049 1885269 . - . transcript "BG:DS03023.4" Adh std3 CDS 1885421 1885599 . - . transcript "BG:DS03023.4" Adh std3 CDS 1886301 1886582 . - . transcript "BG:DS03023.4" Adh std3 CDS 1889969 1890043 . - . transcript "BG:DS03023.4" Adh std3 CDS 1891514 1891654 . - . transcript "BG:DS03023.4" Adh std3 CDS 1891981 1892047 . - . transcript "BG:DS03023.4" Adh std3 CDS 1893271 1893751 . - . transcript "BG:DS03023.4" Adh std3 CDS 1895585 1895879 . - . transcript "BG:DS03023.4" Adh std3 splice3 1876447 1876448 . - . transcript "BG:DS03023.4" Adh std3 splice5 1878987 1878988 . - . transcript "BG:DS03023.4" Adh std3 splice3 1879161 1879162 . - . transcript "BG:DS03023.4" Adh std3 splice5 1881547 1881548 . - . transcript "BG:DS03023.4" Adh std3 splice3 1881779 1881780 . - . transcript "BG:DS03023.4" Adh std3 splice5 1883260 1883261 . - . transcript "BG:DS03023.4" Adh std3 splice3 1883385 1883386 . - . transcript "BG:DS03023.4" Adh std3 splice5 1883559 1883560 . - . transcript "BG:DS03023.4" Adh std3 splice3 1883683 1883684 . - . transcript "BG:DS03023.4" Adh std3 splice5 1884194 1884195 . - . transcript "BG:DS03023.4" Adh std3 splice3 1884559 1884560 . - . transcript "BG:DS03023.4" Adh std3 splice5 1885048 1885049 . - . transcript "BG:DS03023.4" Adh std3 splice3 1885269 1885270 . - . transcript "BG:DS03023.4" Adh std3 splice5 1885420 1885421 . - . transcript "BG:DS03023.4" Adh std3 splice3 1885599 1885600 . - . transcript "BG:DS03023.4" Adh std3 splice5 1886300 1886301 . - . transcript "BG:DS03023.4" Adh std3 splice3 1886582 1886583 . - . transcript "BG:DS03023.4" Adh std3 splice5 1889968 1889969 . - . transcript "BG:DS03023.4" Adh std3 splice3 1890043 1890044 . - . transcript "BG:DS03023.4" Adh std3 splice5 1891513 1891514 . - . transcript "BG:DS03023.4" Adh std3 splice3 1891654 1891655 . - . transcript "BG:DS03023.4" Adh std3 splice5 1891980 1891981 . - . transcript "BG:DS03023.4" Adh std3 splice3 1892047 1892048 . - . transcript "BG:DS03023.4" Adh std3 splice5 1893270 1893271 . - . transcript "BG:DS03023.4" Adh std3 splice3 1893751 1893752 . - . transcript "BG:DS03023.4" Adh std3 splice5 1895584 1895585 . - . transcript "BG:DS03023.4" # # ### ### # # Adh std3 start_codon 343169 343171 . + . transcript "BG:DS00941.15" Adh std3 stop_codon 343982 343984 . + . transcript "BG:DS00941.15" Adh std3 CDS 343169 343368 . + . transcript "BG:DS00941.15" Adh std3 CDS 343432 343984 . + . transcript "BG:DS00941.15" Adh std3 splice5 343368 343369 . + . transcript "BG:DS00941.15" Adh std3 splice3 343431 343432 . + . transcript "BG:DS00941.15" # # ### ### # # Adh std3 start_codon 341713 341715 . + . transcript "BG:DS00941.14" Adh std3 stop_codon 342749 342751 . + . transcript "BG:DS00941.14" Adh std3 CDS 341713 341857 . + . transcript "BG:DS00941.14" Adh std3 CDS 342003 342751 . + . transcript "BG:DS00941.14" Adh std3 splice5 341857 341858 . + . transcript "BG:DS00941.14" Adh std3 splice3 342002 342003 . + . transcript "BG:DS00941.14" # # ### ### # # Adh std3 start_codon 340529 340531 . + . transcript "BG:DS00941.13" Adh std3 stop_codon 341551 341553 . + . transcript "BG:DS00941.13" Adh std3 CDS 340529 340634 . + . transcript "BG:DS00941.13" Adh std3 CDS 340705 340870 . + . transcript "BG:DS00941.13" Adh std3 CDS 340926 341551 . + . transcript "BG:DS00941.13" Adh std3 splice5 340634 340635 . + . transcript "BG:DS00941.13" Adh std3 splice3 340704 340705 . + . transcript "BG:DS00941.13" Adh std3 splice5 340870 340871 . + . transcript "BG:DS00941.13" Adh std3 splice3 340925 340926 . + . transcript "BG:DS00941.13" # # ### ### # # Adh std3 start_codon 339011 339013 . - . transcript "BG:DS00941.12" Adh std3 stop_codon 338167 338169 . - . transcript "BG:DS00941.12" Adh std3 CDS 338167 338879 . - . transcript "BG:DS00941.12" Adh std3 CDS 338944 339013 . - . transcript "BG:DS00941.12" Adh std3 splice3 338879 338880 . - . transcript "BG:DS00941.12" Adh std3 splice5 338943 338944 . - . transcript "BG:DS00941.12" # # ### ### # # Adh std3 start_codon 337455 337457 . - . transcript "BG:DS00941.11" Adh std3 stop_codon 334589 334591 . - . transcript "BG:DS00941.11" Adh std3 CDS 334589 335125 . - . transcript "BG:DS00941.11" Adh std3 CDS 336758 337317 . - . transcript "BG:DS00941.11" Adh std3 CDS 337379 337457 . - . transcript "BG:DS00941.11" Adh std3 splice3 335125 335126 . - . transcript "BG:DS00941.11" Adh std3 splice5 336757 336758 . - . transcript "BG:DS00941.11" Adh std3 splice3 337317 337318 . - . transcript "BG:DS00941.11" Adh std3 splice5 337378 337379 . - . transcript "BG:DS00941.11" # # ### ### # # Adh std3 start_codon 327175 327177 . + . transcript "RpII33" Adh std3 stop_codon 328000 328002 . + . transcript "RpII33" Adh std3 CDS 327175 328002 . + . transcript "RpII33" # # ### ### # # Adh std3 start_codon 326377 326379 . - . transcript "MtPolB" Adh std3 stop_codon 325240 325242 . - . transcript "MtPolB" Adh std3 CDS 325240 325634 . - . transcript "MtPolB" Adh std3 CDS 325689 326379 . - . transcript "MtPolB" Adh std3 splice3 325634 325635 . - . transcript "MtPolB" Adh std3 splice5 325688 325689 . - . transcript "MtPolB" # # ### ### # # Adh std3 start_codon 323788 323790 . + . transcript "Orc5" Adh std3 stop_codon 325221 325223 . + . transcript "Orc5" Adh std3 CDS 323788 324885 . + . transcript "Orc5" Adh std3 CDS 324939 325223 . + . transcript "Orc5" Adh std3 splice5 324885 324886 . + . transcript "Orc5" Adh std3 splice3 324938 324939 . + . transcript "Orc5" # # ### ### # # Adh std3 start_codon 323167 323169 . - . transcript "Sop2" Adh std3 stop_codon 321967 321969 . - . transcript "Sop2" Adh std3 CDS 321967 323027 . - . transcript "Sop2" Adh std3 CDS 323097 323169 . - . transcript "Sop2" Adh std3 splice3 323027 323028 . - . transcript "Sop2" Adh std3 splice5 323096 323097 . - . transcript "Sop2" # # ### ### # # Adh std3 start_codon 321440 321442 . - . transcript "tamas" Adh std3 stop_codon 317891 317893 . - . transcript "tamas" Adh std3 CDS 317891 318548 . - . transcript "tamas" Adh std3 CDS 318608 319430 . - . transcript "tamas" Adh std3 CDS 319486 321442 . - . transcript "tamas" Adh std3 splice3 318548 318549 . - . transcript "tamas" Adh std3 splice5 318607 318608 . - . transcript "tamas" Adh std3 splice3 319430 319431 . - . transcript "tamas" Adh std3 splice5 319485 319486 . - . transcript "tamas" # # ### ### # # Adh std3 start_codon 315138 315140 . + . transcript "b" Adh std3 stop_codon 317460 317462 . + . transcript "b" Adh std3 CDS 315138 315899 . + . transcript "b" Adh std3 CDS 316433 316800 . + . transcript "b" Adh std3 CDS 316865 317462 . + . transcript "b" Adh std3 splice5 315899 315900 . + . transcript "b" Adh std3 splice3 316432 316433 . + . transcript "b" Adh std3 splice5 316800 316801 . + . transcript "b" Adh std3 splice3 316864 316865 . + . transcript "b" # # ### ### # # Adh std3 start_codon 307965 307967 . + . transcript "Sos" Adh std3 stop_codon 313127 313129 . + . transcript "Sos" Adh std3 CDS 307965 309056 . + . transcript "Sos" Adh std3 CDS 309110 309467 . + . transcript "Sos" Adh std3 CDS 309530 310452 . + . transcript "Sos" Adh std3 CDS 310517 311365 . + . transcript "Sos" Adh std3 CDS 311428 312318 . + . transcript "Sos" Adh std3 CDS 312387 313020 . + . transcript "Sos" Adh std3 CDS 313086 313129 . + . transcript "Sos" Adh std3 splice5 309056 309057 . + . transcript "Sos" Adh std3 splice3 309109 309110 . + . transcript "Sos" Adh std3 splice5 309467 309468 . + . transcript "Sos" Adh std3 splice3 309529 309530 . + . transcript "Sos" Adh std3 splice5 310452 310453 . + . transcript "Sos" Adh std3 splice3 310516 310517 . + . transcript "Sos" Adh std3 splice5 311365 311366 . + . transcript "Sos" Adh std3 splice3 311427 311428 . + . transcript "Sos" Adh std3 splice5 312318 312319 . + . transcript "Sos" Adh std3 splice3 312386 312387 . + . transcript "Sos" Adh std3 splice5 313020 313021 . + . transcript "Sos" Adh std3 splice3 313085 313086 . + . transcript "Sos" Adh std3 splice5 313424 313425 . + . transcript "Sos" Adh std3 splice3 313424 313425 . + . transcript "Sos" # # ### ### # # Adh std3 start_codon 305396 305398 . + . transcript "BG:DS00941.3" Adh std3 stop_codon 306383 306385 . + . transcript "BG:DS00941.3" Adh std3 CDS 305396 305516 . + . transcript "BG:DS00941.3" Adh std3 CDS 305577 305737 . + . transcript "BG:DS00941.3" Adh std3 CDS 305803 306108 . + . transcript "BG:DS00941.3" Adh std3 CDS 306230 306385 . + . transcript "BG:DS00941.3" Adh std3 splice5 305516 305517 . + . transcript "BG:DS00941.3" Adh std3 splice3 305576 305577 . + . transcript "BG:DS00941.3" Adh std3 splice5 305737 305738 . + . transcript "BG:DS00941.3" Adh std3 splice3 305802 305803 . + . transcript "BG:DS00941.3" Adh std3 splice5 306108 306109 . + . transcript "BG:DS00941.3" Adh std3 splice3 306229 306230 . + . transcript "BG:DS00941.3" # # ### ### # # Adh std3 start_codon 305199 305201 . - . transcript "BG:DS00941.2" Adh std3 stop_codon 303960 303962 . - . transcript "BG:DS00941.2" Adh std3 CDS 303960 304272 . - . transcript "BG:DS00941.2" Adh std3 CDS 304330 305201 . - . transcript "BG:DS00941.2" Adh std3 splice3 304272 304273 . - . transcript "BG:DS00941.2" Adh std3 splice5 304329 304330 . - . transcript "BG:DS00941.2" # # ### ### # # Adh std3 start_codon 297680 297682 . + . transcript "BG:DS00941.1" Adh std3 stop_codon 303403 303405 . + . transcript "BG:DS00941.1" Adh std3 CDS 297680 297713 . + . transcript "BG:DS00941.1" Adh std3 CDS 302560 302718 . + . transcript "BG:DS00941.1" Adh std3 CDS 302786 303405 . + . transcript "BG:DS00941.1" Adh std3 splice5 297713 297714 . + . transcript "BG:DS00941.1" Adh std3 splice3 302559 302560 . + . transcript "BG:DS00941.1" Adh std3 splice5 302718 302719 . + . transcript "BG:DS00941.1" Adh std3 splice3 302785 302786 . + . transcript "BG:DS00941.1" # # ### ### # # Adh std3 start_codon 1565296 1565298 . + . transcript "BG:DS04929.1" Adh std3 stop_codon 1585378 1585380 . + . transcript "BG:DS04929.1" Adh std3 CDS 1565296 1565530 . + . transcript "BG:DS04929.1" Adh std3 CDS 1576691 1576943 . + . transcript "BG:DS04929.1" Adh std3 CDS 1577036 1577406 . + . transcript "BG:DS04929.1" Adh std3 CDS 1577568 1577860 . + . transcript "BG:DS04929.1" Adh std3 CDS 1577926 1578081 . + . transcript "BG:DS04929.1" Adh std3 CDS 1580550 1580685 . + . transcript "BG:DS04929.1" Adh std3 CDS 1580750 1580880 . + . transcript "BG:DS04929.1" Adh std3 CDS 1580946 1581227 . + . transcript "BG:DS04929.1" Adh std3 CDS 1581294 1581623 . + . transcript "BG:DS04929.1" Adh std3 CDS 1581774 1582136 . + . transcript "BG:DS04929.1" Adh std3 CDS 1582201 1582292 . + . transcript "BG:DS04929.1" Adh std3 CDS 1582550 1582687 . + . transcript "BG:DS04929.1" Adh std3 CDS 1583070 1583334 . + . transcript "BG:DS04929.1" Adh std3 CDS 1583785 1583883 . + . transcript "BG:DS04929.1" Adh std3 CDS 1584330 1584828 . + . transcript "BG:DS04929.1" Adh std3 CDS 1584949 1585094 . + . transcript "BG:DS04929.1" Adh std3 CDS 1585153 1585380 . + . transcript "BG:DS04929.1" Adh std3 splice5 1565530 1565531 . + . transcript "BG:DS04929.1" Adh std3 splice3 1576690 1576691 . + . transcript "BG:DS04929.1" Adh std3 splice5 1576943 1576944 . + . transcript "BG:DS04929.1" Adh std3 splice3 1577035 1577036 . + . transcript "BG:DS04929.1" Adh std3 splice5 1577406 1577407 . + . transcript "BG:DS04929.1" Adh std3 splice3 1577567 1577568 . + . transcript "BG:DS04929.1" Adh std3 splice5 1577860 1577861 . + . transcript "BG:DS04929.1" Adh std3 splice3 1577925 1577926 . + . transcript "BG:DS04929.1" Adh std3 splice5 1578081 1578082 . + . transcript "BG:DS04929.1" Adh std3 splice3 1580549 1580550 . + . transcript "BG:DS04929.1" Adh std3 splice5 1580685 1580686 . + . transcript "BG:DS04929.1" Adh std3 splice3 1580749 1580750 . + . transcript "BG:DS04929.1" Adh std3 splice5 1580880 1580881 . + . transcript "BG:DS04929.1" Adh std3 splice3 1580945 1580946 . + . transcript "BG:DS04929.1" Adh std3 splice5 1581227 1581228 . + . transcript "BG:DS04929.1" Adh std3 splice3 1581293 1581294 . + . transcript "BG:DS04929.1" Adh std3 splice5 1581623 1581624 . + . transcript "BG:DS04929.1" Adh std3 splice3 1581773 1581774 . + . transcript "BG:DS04929.1" Adh std3 splice5 1582136 1582137 . + . transcript "BG:DS04929.1" Adh std3 splice3 1582200 1582201 . + . transcript "BG:DS04929.1" Adh std3 splice5 1582292 1582293 . + . transcript "BG:DS04929.1" Adh std3 splice3 1582549 1582550 . + . transcript "BG:DS04929.1" Adh std3 splice5 1582687 1582688 . + . transcript "BG:DS04929.1" Adh std3 splice3 1583069 1583070 . + . transcript "BG:DS04929.1" Adh std3 splice5 1583334 1583335 . + . transcript "BG:DS04929.1" Adh std3 splice3 1583784 1583785 . + . transcript "BG:DS04929.1" Adh std3 splice5 1583883 1583884 . + . transcript "BG:DS04929.1" Adh std3 splice3 1584329 1584330 . + . transcript "BG:DS04929.1" Adh std3 splice5 1584828 1584829 . + . transcript "BG:DS04929.1" Adh std3 splice3 1584948 1584949 . + . transcript "BG:DS04929.1" Adh std3 splice5 1585094 1585095 . + . transcript "BG:DS04929.1" Adh std3 splice3 1585152 1585153 . + . transcript "BG:DS04929.1" # # ### ### # # Adh std3 start_codon 1599236 1599238 . + . transcript "BG:DS04929.3" Adh std3 stop_codon 1602563 1602565 . + . transcript "BG:DS04929.3" Adh std3 CDS 1599236 1600177 . + . transcript "BG:DS04929.3" Adh std3 CDS 1601744 1602565 . + . transcript "BG:DS04929.3" Adh std3 splice5 1600177 1600178 . + . transcript "BG:DS04929.3" Adh std3 splice3 1601743 1601744 . + . transcript "BG:DS04929.3" # # ### ### # # Adh std3 start_codon 1603541 1603543 . + . transcript "stc" Adh std3 stop_codon 1607304 1607306 . + . transcript "stc" Adh std3 CDS 1603541 1603885 . + . transcript "stc" Adh std3 CDS 1603951 1605404 . + . transcript "stc" Adh std3 CDS 1605651 1606718 . + . transcript "stc" Adh std3 CDS 1606791 1607142 . + . transcript "stc" Adh std3 CDS 1607205 1607306 . + . transcript "stc" Adh std3 splice5 1603885 1603886 . + . transcript "stc" Adh std3 splice3 1603950 1603951 . + . transcript "stc" Adh std3 splice5 1605404 1605405 . + . transcript "stc" Adh std3 splice3 1605650 1605651 . + . transcript "stc" Adh std3 splice5 1606718 1606719 . + . transcript "stc" Adh std3 splice3 1606790 1606791 . + . transcript "stc" Adh std3 splice5 1607142 1607143 . + . transcript "stc" Adh std3 splice3 1607204 1607205 . + . transcript "stc" # # ### ### # # Adh std3 start_codon 2040123 2040125 . + . transcript "BG:DS04862.2" Adh std3 stop_codon 2052899 2052901 . + . transcript "BG:DS04862.2" Adh std3 CDS 2040123 2040280 . + . transcript "BG:DS04862.2" Adh std3 CDS 2040432 2040689 . + . transcript "BG:DS04862.2" Adh std3 CDS 2041374 2041494 . + . transcript "BG:DS04862.2" Adh std3 CDS 2044388 2044681 . + . transcript "BG:DS04862.2" Adh std3 CDS 2049236 2049415 . + . transcript "BG:DS04862.2" Adh std3 CDS 2050204 2050341 . + . transcript "BG:DS04862.2" Adh std3 CDS 2052716 2052901 . + . transcript "BG:DS04862.2" Adh std3 splice5 2040280 2040281 . + . transcript "BG:DS04862.2" Adh std3 splice3 2040431 2040432 . + . transcript "BG:DS04862.2" Adh std3 splice5 2040689 2040690 . + . transcript "BG:DS04862.2" Adh std3 splice3 2041373 2041374 . + . transcript "BG:DS04862.2" Adh std3 splice5 2041494 2041495 . + . transcript "BG:DS04862.2" Adh std3 splice3 2044387 2044388 . + . transcript "BG:DS04862.2" Adh std3 splice5 2044681 2044682 . + . transcript "BG:DS04862.2" Adh std3 splice3 2049235 2049236 . + . transcript "BG:DS04862.2" Adh std3 splice5 2049415 2049416 . + . transcript "BG:DS04862.2" Adh std3 splice3 2050203 2050204 . + . transcript "BG:DS04862.2" Adh std3 splice5 2050341 2050342 . + . transcript "BG:DS04862.2" Adh std3 splice3 2052715 2052716 . + . transcript "BG:DS04862.2" # # ### ### # # Adh std3 start_codon 2068604 2068606 . + . transcript "kek3" Adh std3 stop_codon 2072675 2072677 . + . transcript "kek3" Adh std3 CDS 2068604 2070501 . + . transcript "kek3" Adh std3 CDS 2071510 2072677 . + . transcript "kek3" Adh std3 splice5 2070501 2070502 . + . transcript "kek3" Adh std3 splice3 2071509 2071510 . + . transcript "kek3" # # ### ### # # Adh std3 start_codon 646068 646070 . + . transcript "BG:DS01523.1" Adh std3 stop_codon 652822 652824 . + . transcript "BG:DS01523.1" Adh std3 CDS 646068 646145 . + . transcript "BG:DS01523.1" Adh std3 CDS 650611 651153 . + . transcript "BG:DS01523.1" Adh std3 CDS 651278 651478 . + . transcript "BG:DS01523.1" Adh std3 CDS 651583 652282 . + . transcript "BG:DS01523.1" Adh std3 CDS 652397 652824 . + . transcript "BG:DS01523.1" Adh std3 splice5 646145 646146 . + . transcript "BG:DS01523.1" Adh std3 splice3 650610 650611 . + . transcript "BG:DS01523.1" Adh std3 splice5 651153 651154 . + . transcript "BG:DS01523.1" Adh std3 splice3 651277 651278 . + . transcript "BG:DS01523.1" Adh std3 splice5 651478 651479 . + . transcript "BG:DS01523.1" Adh std3 splice3 651582 651583 . + . transcript "BG:DS01523.1" Adh std3 splice5 652282 652283 . + . transcript "BG:DS01523.1" Adh std3 splice3 652396 652397 . + . transcript "BG:DS01523.1" # # ### ### # # Adh std3 start_codon 667103 667105 . - . transcript "BG:DS01523.2" Adh std3 stop_codon 654984 654986 . - . transcript "BG:DS01523.2" Adh std3 CDS 654984 656897 . - . transcript "BG:DS01523.2" Adh std3 CDS 656952 657179 . - . transcript "BG:DS01523.2" Adh std3 CDS 657772 658001 . - . transcript "BG:DS01523.2" Adh std3 CDS 658058 658265 . - . transcript "BG:DS01523.2" Adh std3 CDS 658326 658463 . - . transcript "BG:DS01523.2" Adh std3 CDS 658526 660852 . - . transcript "BG:DS01523.2" Adh std3 CDS 660917 661331 . - . transcript "BG:DS01523.2" Adh std3 CDS 662256 662303 . - . transcript "BG:DS01523.2" Adh std3 CDS 665700 665782 . - . transcript "BG:DS01523.2" Adh std3 CDS 667015 667105 . - . transcript "BG:DS01523.2" Adh std3 splice3 656897 656898 . - . transcript "BG:DS01523.2" Adh std3 splice5 656951 656952 . - . transcript "BG:DS01523.2" Adh std3 splice3 657179 657180 . - . transcript "BG:DS01523.2" Adh std3 splice5 657771 657772 . - . transcript "BG:DS01523.2" Adh std3 splice3 658001 658002 . - . transcript "BG:DS01523.2" Adh std3 splice5 658057 658058 . - . transcript "BG:DS01523.2" Adh std3 splice3 658265 658266 . - . transcript "BG:DS01523.2" Adh std3 splice5 658325 658326 . - . transcript "BG:DS01523.2" Adh std3 splice3 658463 658464 . - . transcript "BG:DS01523.2" Adh std3 splice5 658525 658526 . - . transcript "BG:DS01523.2" Adh std3 splice3 660852 660853 . - . transcript "BG:DS01523.2" Adh std3 splice5 660916 660917 . - . transcript "BG:DS01523.2" Adh std3 splice3 661331 661332 . - . transcript "BG:DS01523.2" Adh std3 splice5 662255 662256 . - . transcript "BG:DS01523.2" Adh std3 splice3 662303 662304 . - . transcript "BG:DS01523.2" Adh std3 splice5 665699 665700 . - . transcript "BG:DS01523.2" Adh std3 splice3 665782 665783 . - . transcript "BG:DS01523.2" Adh std3 splice5 667014 667015 . - . transcript "BG:DS01523.2" # # ### ### # # Adh std3 start_codon 2305038 2305040 . + . transcript "BG:DS02252.2" Adh std3 stop_codon 2306949 2306951 . + . transcript "BG:DS02252.2" Adh std3 CDS 2305038 2305397 . + . transcript "BG:DS02252.2" Adh std3 CDS 2305489 2305763 . + . transcript "BG:DS02252.2" Adh std3 CDS 2305829 2306951 . + . transcript "BG:DS02252.2" Adh std3 splice5 2305397 2305398 . + . transcript "BG:DS02252.2" Adh std3 splice3 2305488 2305489 . + . transcript "BG:DS02252.2" Adh std3 splice5 2305763 2305764 . + . transcript "BG:DS02252.2" Adh std3 splice3 2305828 2305829 . + . transcript "BG:DS02252.2" # # ### ### # # Adh std3 start_codon 2331308 2331310 . - . transcript "BG:DS00365.1" Adh std3 stop_codon 2328290 2328292 . - . transcript "BG:DS00365.1" Adh std3 CDS 2328290 2328403 . - . transcript "BG:DS00365.1" Adh std3 CDS 2328611 2329967 . - . transcript "BG:DS00365.1" Adh std3 CDS 2330026 2330181 . - . transcript "BG:DS00365.1" Adh std3 CDS 2330600 2330652 . - . transcript "BG:DS00365.1" Adh std3 CDS 2331101 2331310 . - . transcript "BG:DS00365.1" Adh std3 splice3 2328403 2328404 . - . transcript "BG:DS00365.1" Adh std3 splice5 2328610 2328611 . - . transcript "BG:DS00365.1" Adh std3 splice3 2329967 2329968 . - . transcript "BG:DS00365.1" Adh std3 splice5 2330025 2330026 . - . transcript "BG:DS00365.1" Adh std3 splice3 2330181 2330182 . - . transcript "BG:DS00365.1" Adh std3 splice5 2330599 2330600 . - . transcript "BG:DS00365.1" Adh std3 splice3 2330652 2330653 . - . transcript "BG:DS00365.1" Adh std3 splice5 2331100 2331101 . - . transcript "BG:DS00365.1" # # ### ### # # Adh std3 start_codon 2343907 2343909 . - . transcript "BG:DS00365.2" Adh std3 stop_codon 2339377 2339379 . - . transcript "BG:DS00365.2" Adh std3 CDS 2339377 2340420 . - . transcript "BG:DS00365.2" Adh std3 CDS 2340535 2341630 . - . transcript "BG:DS00365.2" Adh std3 CDS 2341725 2341808 . - . transcript "BG:DS00365.2" Adh std3 CDS 2342156 2342274 . - . transcript "BG:DS00365.2" Adh std3 CDS 2342341 2342602 . - . transcript "BG:DS00365.2" Adh std3 CDS 2342664 2343851 . - . transcript "BG:DS00365.2" Adh std3 CDS 2343893 2343909 . - . transcript "BG:DS00365.2" Adh std3 splice3 2340420 2340421 . - . transcript "BG:DS00365.2" Adh std3 splice5 2340534 2340535 . - . transcript "BG:DS00365.2" Adh std3 splice3 2341630 2341631 . - . transcript "BG:DS00365.2" Adh std3 splice5 2341724 2341725 . - . transcript "BG:DS00365.2" Adh std3 splice3 2341808 2341809 . - . transcript "BG:DS00365.2" Adh std3 splice5 2342155 2342156 . - . transcript "BG:DS00365.2" Adh std3 splice3 2342274 2342275 . - . transcript "BG:DS00365.2" Adh std3 splice5 2342340 2342341 . - . transcript "BG:DS00365.2" Adh std3 splice3 2342602 2342603 . - . transcript "BG:DS00365.2" Adh std3 splice5 2342663 2342664 . - . transcript "BG:DS00365.2" Adh std3 splice3 2343851 2343852 . - . transcript "BG:DS00365.2" Adh std3 splice5 2343892 2343893 . - . transcript "BG:DS00365.2" # # ### ### # # Adh std3 start_codon 2353050 2353052 . - . transcript "BG:DS00365.3" Adh std3 stop_codon 2348982 2348984 . - . transcript "BG:DS00365.3" Adh std3 CDS 2348982 2349115 . - . transcript "BG:DS00365.3" Adh std3 CDS 2349968 2350879 . - . transcript "BG:DS00365.3" Adh std3 CDS 2352080 2353052 . - . transcript "BG:DS00365.3" Adh std3 splice3 2349115 2349116 . - . transcript "BG:DS00365.3" Adh std3 splice5 2349967 2349968 . - . transcript "BG:DS00365.3" Adh std3 splice3 2350879 2350880 . - . transcript "BG:DS00365.3" Adh std3 splice5 2352079 2352080 . - . transcript "BG:DS00365.3" # # ### ### # # Adh std3 start_codon 2202800 2202802 . - . transcript "BG:DS09217.1" Adh std3 stop_codon 2201422 2201424 . - . transcript "BG:DS09217.1" Adh std3 CDS 2201424 2201677 . - . transcript "BG:DS09217.1" Adh std3 CDS 2202376 2202477 . - . transcript "BG:DS09217.1" Adh std3 CDS 2202548 2202802 . - . transcript "BG:DS09217.1" Adh std3 splice3 2201677 2201678 . - . transcript "BG:DS09217.1" Adh std3 splice5 2202375 2202376 . - . transcript "BG:DS09217.1" Adh std3 splice3 2202477 2202478 . - . transcript "BG:DS09217.1" Adh std3 splice5 2202547 2202548 . - . transcript "BG:DS09217.1" # # ### ### # # Adh std3 start_codon 2204183 2204185 . + . transcript "l.2.35Df" Adh std3 stop_codon 2207401 2207403 . + . transcript "l.2.35Df" Adh std3 CDS 2204183 2205278 . + . transcript "l.2.35Df" Adh std3 CDS 2205332 2207403 . + . transcript "l.2.35Df" Adh std3 splice5 2205278 2205279 . + . transcript "l.2.35Df" Adh std3 splice3 2205331 2205332 . + . transcript "l.2.35Df" # # ### ### # # Adh std3 start_codon 2212392 2212394 . - . transcript "Gli" Adh std3 stop_codon 2208922 2208924 . - . transcript "Gli" Adh std3 CDS 2208922 2209531 . - . transcript "Gli" Adh std3 CDS 2209593 2209904 . - . transcript "Gli" Adh std3 CDS 2209967 2211186 . - . transcript "Gli" Adh std3 CDS 2211243 2211671 . - . transcript "Gli" Adh std3 CDS 2212036 2212168 . - . transcript "Gli" Adh std3 CDS 2212228 2212394 . - . transcript "Gli" Adh std3 splice3 2208763 2208764 . - . transcript "Gli" Adh std3 splice5 2208829 2208830 . - . transcript "Gli" Adh std3 splice3 2209531 2209532 . - . transcript "Gli" Adh std3 splice5 2209592 2209593 . - . transcript "Gli" Adh std3 splice3 2209904 2209905 . - . transcript "Gli" Adh std3 splice5 2209966 2209967 . - . transcript "Gli" Adh std3 splice3 2211186 2211187 . - . transcript "Gli" Adh std3 splice5 2211242 2211243 . - . transcript "Gli" Adh std3 splice3 2211671 2211672 . - . transcript "Gli" Adh std3 splice5 2212035 2212036 . - . transcript "Gli" Adh std3 splice3 2212168 2212169 . - . transcript "Gli" Adh std3 splice5 2212227 2212228 . - . transcript "Gli" Adh std3 splice3 2212400 2212401 . - . transcript "Gli" Adh std3 splice5 2214394 2214395 . - . transcript "Gli" # # ### ### # # Adh std3 start_codon 2216202 2216204 . + . transcript "BG:DS09217.4" Adh std3 stop_codon 2217535 2217537 . + . transcript "BG:DS09217.4" Adh std3 CDS 2216202 2216447 . + . transcript "BG:DS09217.4" Adh std3 CDS 2216609 2217034 . + . transcript "BG:DS09217.4" Adh std3 CDS 2217099 2217403 . + . transcript "BG:DS09217.4" Adh std3 CDS 2217501 2217537 . + . transcript "BG:DS09217.4" Adh std3 splice5 2216447 2216448 . + . transcript "BG:DS09217.4" Adh std3 splice3 2216608 2216609 . + . transcript "BG:DS09217.4" Adh std3 splice5 2217034 2217035 . + . transcript "BG:DS09217.4" Adh std3 splice3 2217098 2217099 . + . transcript "BG:DS09217.4" Adh std3 splice5 2217403 2217404 . + . transcript "BG:DS09217.4" Adh std3 splice3 2217500 2217501 . + . transcript "BG:DS09217.4" # # ### ### # # Adh std3 start_codon 2219839 2219841 . - . transcript "l.2.35Ea" Adh std3 stop_codon 2218461 2218463 . - . transcript "l.2.35Ea" Adh std3 CDS 2218461 2218494 . - . transcript "l.2.35Ea" Adh std3 CDS 2218559 2218905 . - . transcript "l.2.35Ea" Adh std3 CDS 2218966 2219841 . - . transcript "l.2.35Ea" Adh std3 splice3 2218494 2218495 . - . transcript "l.2.35Ea" Adh std3 splice5 2218558 2218559 . - . transcript "l.2.35Ea" Adh std3 splice3 2218905 2218906 . - . transcript "l.2.35Ea" Adh std3 splice5 2218965 2218966 . - . transcript "l.2.35Ea" # # ### ### # # Adh std3 start_codon 2224365 2224367 . - . transcript "BG:DS09217.6" Adh std3 stop_codon 2220563 2220565 . - . transcript "BG:DS09217.6" Adh std3 CDS 2220565 2222197 . - . transcript "BG:DS09217.6" Adh std3 CDS 2222257 2222379 . - . transcript "BG:DS09217.6" Adh std3 CDS 2222435 2222667 . - . transcript "BG:DS09217.6" Adh std3 CDS 2222723 2222818 . - . transcript "BG:DS09217.6" Adh std3 CDS 2223403 2223577 . - . transcript "BG:DS09217.6" Adh std3 CDS 2223854 2224229 . - . transcript "BG:DS09217.6" Adh std3 CDS 2224289 2224367 . - . transcript "BG:DS09217.6" Adh std3 splice3 2222197 2222198 . - . transcript "BG:DS09217.6" Adh std3 splice5 2222256 2222257 . - . transcript "BG:DS09217.6" Adh std3 splice3 2222379 2222380 . - . transcript "BG:DS09217.6" Adh std3 splice5 2222434 2222435 . - . transcript "BG:DS09217.6" Adh std3 splice3 2222667 2222668 . - . transcript "BG:DS09217.6" Adh std3 splice5 2222722 2222723 . - . transcript "BG:DS09217.6" Adh std3 splice3 2222818 2222819 . - . transcript "BG:DS09217.6" Adh std3 splice5 2223402 2223403 . - . transcript "BG:DS09217.6" Adh std3 splice3 2223577 2223578 . - . transcript "BG:DS09217.6" Adh std3 splice5 2223853 2223854 . - . transcript "BG:DS09217.6" Adh std3 splice3 2224229 2224230 . - . transcript "BG:DS09217.6" Adh std3 splice5 2224288 2224289 . - . transcript "BG:DS09217.6" # # ### ### # # Adh std3 start_codon 2707374 2707376 . + . transcript "BG:DS07473.2" Adh std3 stop_codon 2708520 2708522 . + . transcript "BG:DS07473.2" Adh std3 CDS 2707374 2707439 . + . transcript "BG:DS07473.2" Adh std3 CDS 2707509 2708522 . + . transcript "BG:DS07473.2" Adh std3 splice5 2707439 2707440 . + . transcript "BG:DS07473.2" Adh std3 splice3 2707508 2707509 . + . transcript "BG:DS07473.2" # # ### ### # # Adh std3 start_codon 2698208 2698210 . - . transcript "PRL-1" Adh std3 stop_codon 2696335 2696337 . - . transcript "PRL-1" Adh std3 CDS 2696335 2696446 . - . transcript "PRL-1" Adh std3 CDS 2696513 2696644 . - . transcript "PRL-1" Adh std3 CDS 2697862 2698028 . - . transcript "PRL-1" Adh std3 CDS 2698091 2698210 . - . transcript "PRL-1" Adh std3 splice3 2696446 2696447 . - . transcript "PRL-1" Adh std3 splice5 2696512 2696513 . - . transcript "PRL-1" Adh std3 splice3 2696644 2696645 . - . transcript "PRL-1" Adh std3 splice5 2697861 2697862 . - . transcript "PRL-1" Adh std3 splice3 2698028 2698029 . - . transcript "PRL-1" Adh std3 splice5 2698090 2698091 . - . transcript "PRL-1" Adh std3 splice3 2698966 2698967 . - . transcript "PRL-1" Adh std3 splice5 2699340 2699341 . - . transcript "PRL-1" Adh std3 splice3 2699418 2699419 . - . transcript "PRL-1" Adh std3 splice5 2706335 2706336 . - . transcript "PRL-1" # # ### ### # # Adh std3 start_codon 2683427 2683429 . + . transcript "BG:DS07473.1" Adh std3 stop_codon 2694717 2694719 . + . transcript "BG:DS07473.1" Adh std3 CDS 2683427 2683473 . + . transcript "BG:DS07473.1" Adh std3 CDS 2684880 2686209 . + . transcript "BG:DS07473.1" Adh std3 CDS 2686394 2686570 . + . transcript "BG:DS07473.1" Adh std3 CDS 2686628 2686705 . + . transcript "BG:DS07473.1" Adh std3 CDS 2686770 2687146 . + . transcript "BG:DS07473.1" Adh std3 CDS 2687211 2687359 . + . transcript "BG:DS07473.1" Adh std3 CDS 2687415 2687794 . + . transcript "BG:DS07473.1" Adh std3 CDS 2687988 2688204 . + . transcript "BG:DS07473.1" Adh std3 CDS 2688462 2688883 . + . transcript "BG:DS07473.1" Adh std3 CDS 2691203 2694219 . + . transcript "BG:DS07473.1" Adh std3 CDS 2694277 2694414 . + . transcript "BG:DS07473.1" Adh std3 CDS 2694479 2694719 . + . transcript "BG:DS07473.1" Adh std3 splice5 2683473 2683474 . + . transcript "BG:DS07473.1" Adh std3 splice3 2684879 2684880 . + . transcript "BG:DS07473.1" Adh std3 splice5 2686209 2686210 . + . transcript "BG:DS07473.1" Adh std3 splice3 2686393 2686394 . + . transcript "BG:DS07473.1" Adh std3 splice5 2686570 2686571 . + . transcript "BG:DS07473.1" Adh std3 splice3 2686627 2686628 . + . transcript "BG:DS07473.1" Adh std3 splice5 2686705 2686706 . + . transcript "BG:DS07473.1" Adh std3 splice3 2686769 2686770 . + . transcript "BG:DS07473.1" Adh std3 splice5 2687146 2687147 . + . transcript "BG:DS07473.1" Adh std3 splice3 2687210 2687211 . + . transcript "BG:DS07473.1" Adh std3 splice5 2687359 2687360 . + . transcript "BG:DS07473.1" Adh std3 splice3 2687414 2687415 . + . transcript "BG:DS07473.1" Adh std3 splice5 2687794 2687795 . + . transcript "BG:DS07473.1" Adh std3 splice3 2687987 2687988 . + . transcript "BG:DS07473.1" Adh std3 splice5 2688204 2688205 . + . transcript "BG:DS07473.1" Adh std3 splice3 2688461 2688462 . + . transcript "BG:DS07473.1" Adh std3 splice5 2688883 2688884 . + . transcript "BG:DS07473.1" Adh std3 splice3 2691202 2691203 . + . transcript "BG:DS07473.1" Adh std3 splice5 2694219 2694220 . + . transcript "BG:DS07473.1" Adh std3 splice3 2694276 2694277 . + . transcript "BG:DS07473.1" Adh std3 splice5 2694414 2694415 . + . transcript "BG:DS07473.1" Adh std3 splice3 2694478 2694479 . + . transcript "BG:DS07473.1" # # ### ### # # Adh std3 start_codon 2855180 2855182 . - . transcript "BG:DS02780.1" Adh std3 stop_codon 2849759 2849761 . - . transcript "BG:DS02780.1" Adh std3 CDS 2849759 2849784 . - . transcript "BG:DS02780.1" Adh std3 CDS 2853744 2854099 . - . transcript "BG:DS02780.1" Adh std3 CDS 2854197 2855182 . - . transcript "BG:DS02780.1" Adh std3 splice3 2849784 2849785 . - . transcript "BG:DS02780.1" Adh std3 splice5 2853743 2853744 . - . transcript "BG:DS02780.1" Adh std3 splice3 2854099 2854100 . - . transcript "BG:DS02780.1" Adh std3 splice5 2854196 2854197 . - . transcript "BG:DS02780.1" # # ### ### # # Adh std3 start_codon 2894587 2894589 . + . transcript "Idgf1" Adh std3 stop_codon 2895975 2895977 . + . transcript "Idgf1" Adh std3 CDS 2894587 2895247 . + . transcript "Idgf1" Adh std3 CDS 2895319 2895977 . + . transcript "Idgf1" Adh std3 splice5 2895247 2895248 . + . transcript "Idgf1" Adh std3 splice3 2895318 2895319 . + . transcript "Idgf1" # # ### ### # # Adh std3 start_codon 2896655 2896657 . + . transcript "Idgf2" Adh std3 stop_codon 2899714 2899716 . + . transcript "Idgf2" Adh std3 CDS 2896655 2896763 . + . transcript "Idgf2" Adh std3 CDS 2898444 2899001 . + . transcript "Idgf2" Adh std3 CDS 2899061 2899716 . + . transcript "Idgf2" Adh std3 splice5 2896763 2896764 . + . transcript "Idgf2" Adh std3 splice3 2898443 2898444 . + . transcript "Idgf2" Adh std3 splice5 2899001 2899002 . + . transcript "Idgf2" Adh std3 splice3 2899060 2899061 . + . transcript "Idgf2" # # ### ### # # Adh std3 start_codon 2900448 2900450 . + . transcript "Idgf3" Adh std3 stop_codon 2902105 2902107 . + . transcript "Idgf3" Adh std3 CDS 2900448 2900565 . + . transcript "Idgf3" Adh std3 CDS 2900634 2901185 . + . transcript "Idgf3" Adh std3 CDS 2901452 2902107 . + . transcript "Idgf3" Adh std3 splice5 2900565 2900566 . + . transcript "Idgf3" Adh std3 splice3 2900633 2900634 . + . transcript "Idgf3" Adh std3 splice5 2901185 2901186 . + . transcript "Idgf3" Adh std3 splice3 2901451 2901452 . + . transcript "Idgf3" # # ### ### # # Adh std3 start_codon 1152128 1152130 . + . transcript "BG:DS07721.1" Adh std3 stop_codon 1152383 1152385 . + . transcript "BG:DS07721.1" Adh std3 CDS 1152128 1152385 . + . transcript "BG:DS07721.1" # # ### ### # # Adh std3 start_codon 1205439 1205441 . + . transcript "BG:DS07721.3" Adh std3 stop_codon 1213323 1213325 . + . transcript "BG:DS07721.3" Adh std3 CDS 1205439 1205597 . + . transcript "BG:DS07721.3" Adh std3 CDS 1206614 1206790 . + . transcript "BG:DS07721.3" Adh std3 CDS 1207666 1207906 . + . transcript "BG:DS07721.3" Adh std3 CDS 1209000 1209064 . + . transcript "BG:DS07721.3" Adh std3 CDS 1211030 1211110 . + . transcript "BG:DS07721.3" Adh std3 CDS 1213212 1213325 . + . transcript "BG:DS07721.3" Adh std3 splice5 1205597 1205598 . + . transcript "BG:DS07721.3" Adh std3 splice3 1206613 1206614 . + . transcript "BG:DS07721.3" Adh std3 splice5 1206790 1206791 . + . transcript "BG:DS07721.3" Adh std3 splice3 1207665 1207666 . + . transcript "BG:DS07721.3" Adh std3 splice5 1207906 1207907 . + . transcript "BG:DS07721.3" Adh std3 splice3 1208999 1209000 . + . transcript "BG:DS07721.3" Adh std3 splice5 1209064 1209065 . + . transcript "BG:DS07721.3" Adh std3 splice3 1211029 1211030 . + . transcript "BG:DS07721.3" Adh std3 splice5 1211110 1211111 . + . transcript "BG:DS07721.3" Adh std3 splice3 1213211 1213212 . + . transcript "BG:DS07721.3" # # ### ### # # Adh std3 start_codon 1225740 1225742 . - . transcript "BG:DS07721.6" Adh std3 stop_codon 1216389 1216391 . - . transcript "BG:DS07721.6" Adh std3 CDS 1216389 1216489 . - . transcript "BG:DS07721.6" Adh std3 CDS 1218654 1220253 . - . transcript "BG:DS07721.6" Adh std3 CDS 1220453 1221762 . - . transcript "BG:DS07721.6" Adh std3 CDS 1222288 1222395 . - . transcript "BG:DS07721.6" Adh std3 CDS 1222483 1223742 . - . transcript "BG:DS07721.6" Adh std3 CDS 1225056 1225291 . - . transcript "BG:DS07721.6" Adh std3 CDS 1225603 1225742 . - . transcript "BG:DS07721.6" Adh std3 splice3 1216489 1216490 . - . transcript "BG:DS07721.6" Adh std3 splice5 1218653 1218654 . - . transcript "BG:DS07721.6" Adh std3 splice3 1220253 1220254 . - . transcript "BG:DS07721.6" Adh std3 splice5 1220452 1220453 . - . transcript "BG:DS07721.6" Adh std3 splice3 1221762 1221763 . - . transcript "BG:DS07721.6" Adh std3 splice5 1222287 1222288 . - . transcript "BG:DS07721.6" Adh std3 splice3 1222395 1222396 . - . transcript "BG:DS07721.6" Adh std3 splice5 1222482 1222483 . - . transcript "BG:DS07721.6" Adh std3 splice3 1223742 1223743 . - . transcript "BG:DS07721.6" Adh std3 splice5 1225055 1225056 . - . transcript "BG:DS07721.6" Adh std3 splice3 1225291 1225292 . - . transcript "BG:DS07721.6" Adh std3 splice5 1225602 1225603 . - . transcript "BG:DS07721.6" # # ### ### # # Adh std3 start_codon 498520 498522 . + . transcript "BG:DS01514.3" Adh std3 stop_codon 507579 507581 . + . transcript "BG:DS01514.3" Adh std3 CDS 498520 498979 . + . transcript "BG:DS01514.3" Adh std3 CDS 499082 499159 . + . transcript "BG:DS01514.3" Adh std3 CDS 499280 499563 . + . transcript "BG:DS01514.3" Adh std3 CDS 507216 507581 . + . transcript "BG:DS01514.3" Adh std3 splice5 498979 498980 . + . transcript "BG:DS01514.3" Adh std3 splice3 499081 499082 . + . transcript "BG:DS01514.3" Adh std3 splice5 499159 499160 . + . transcript "BG:DS01514.3" Adh std3 splice3 499279 499280 . + . transcript "BG:DS01514.3" Adh std3 splice5 499563 499564 . + . transcript "BG:DS01514.3" Adh std3 splice3 507215 507216 . + . transcript "BG:DS01514.3" # # ### ### # # Adh std3 start_codon 473959 473961 . + . transcript "BG:DS00180.14" Adh std3 stop_codon 476387 476389 . + . transcript "BG:DS00180.14" Adh std3 CDS 473959 474023 . + . transcript "BG:DS00180.14" Adh std3 CDS 474365 475283 . + . transcript "BG:DS00180.14" Adh std3 CDS 475427 476389 . + . transcript "BG:DS00180.14" Adh std3 splice5 474023 474024 . + . transcript "BG:DS00180.14" Adh std3 splice3 474364 474365 . + . transcript "BG:DS00180.14" Adh std3 splice5 475283 475284 . + . transcript "BG:DS00180.14" Adh std3 splice3 475426 475427 . + . transcript "BG:DS00180.14" # # ### ### # # Adh std3 start_codon 471109 471111 . + . transcript "BG:DS00180.11" Adh std3 stop_codon 473126 473128 . + . transcript "BG:DS00180.11" Adh std3 CDS 471109 471296 . + . transcript "BG:DS00180.11" Adh std3 CDS 471441 471687 . + . transcript "BG:DS00180.11" Adh std3 CDS 471752 471856 . + . transcript "BG:DS00180.11" Adh std3 CDS 471944 472490 . + . transcript "BG:DS00180.11" Adh std3 CDS 472557 472823 . + . transcript "BG:DS00180.11" Adh std3 CDS 472965 473128 . + . transcript "BG:DS00180.11" Adh std3 splice5 471296 471297 . + . transcript "BG:DS00180.11" Adh std3 splice3 471440 471441 . + . transcript "BG:DS00180.11" Adh std3 splice5 471687 471688 . + . transcript "BG:DS00180.11" Adh std3 splice3 471751 471752 . + . transcript "BG:DS00180.11" Adh std3 splice5 471856 471857 . + . transcript "BG:DS00180.11" Adh std3 splice3 471943 471944 . + . transcript "BG:DS00180.11" Adh std3 splice5 472490 472491 . + . transcript "BG:DS00180.11" Adh std3 splice3 472556 472557 . + . transcript "BG:DS00180.11" Adh std3 splice5 472823 472824 . + . transcript "BG:DS00180.11" Adh std3 splice3 472964 472965 . + . transcript "BG:DS00180.11" # # ### ### # # Adh std3 start_codon 470436 470438 . - . transcript "BG:DS00180.10" Adh std3 stop_codon 467979 467981 . - . transcript "BG:DS00180.10" Adh std3 CDS 467979 469628 . - . transcript "BG:DS00180.10" Adh std3 CDS 470226 470438 . - . transcript "BG:DS00180.10" Adh std3 splice3 469628 469629 . - . transcript "BG:DS00180.10" Adh std3 splice5 470225 470226 . - . transcript "BG:DS00180.10" # # ### ### # # Adh std3 start_codon 464308 464310 . + . transcript "BG:DS00180.9" Adh std3 stop_codon 465432 465434 . + . transcript "BG:DS00180.9" Adh std3 CDS 464308 464615 . + . transcript "BG:DS00180.9" Adh std3 CDS 464888 465434 . + . transcript "BG:DS00180.9" Adh std3 splice5 464615 464616 . + . transcript "BG:DS00180.9" Adh std3 splice3 464887 464888 . + . transcript "BG:DS00180.9" # # ### ### # # Adh std3 start_codon 463655 463657 . - . transcript "BG:DS00180.8" Adh std3 stop_codon 462092 462094 . - . transcript "BG:DS00180.8" Adh std3 CDS 462092 462584 . - . transcript "BG:DS00180.8" Adh std3 CDS 462646 463209 . - . transcript "BG:DS00180.8" Adh std3 CDS 463368 463657 . - . transcript "BG:DS00180.8" Adh std3 splice3 462584 462585 . - . transcript "BG:DS00180.8" Adh std3 splice5 462645 462646 . - . transcript "BG:DS00180.8" Adh std3 splice3 463209 463210 . - . transcript "BG:DS00180.8" Adh std3 splice5 463367 463368 . - . transcript "BG:DS00180.8" # # ### ### # # Adh std3 start_codon 460672 460674 . - . transcript "BG:DS00180.7" Adh std3 stop_codon 458837 458839 . - . transcript "BG:DS00180.7" Adh std3 CDS 458837 459146 . - . transcript "BG:DS00180.7" Adh std3 CDS 459225 459761 . - . transcript "BG:DS00180.7" Adh std3 CDS 460256 460674 . - . transcript "BG:DS00180.7" Adh std3 splice3 459146 459147 . - . transcript "BG:DS00180.7" Adh std3 splice5 459224 459225 . - . transcript "BG:DS00180.7" Adh std3 splice3 459761 459762 . - . transcript "BG:DS00180.7" Adh std3 splice5 460255 460256 . - . transcript "BG:DS00180.7" # # ### ### # # Adh std3 start_codon 457298 457300 . + . transcript "BG:DS00180.12" Adh std3 stop_codon 458800 458802 . + . transcript "BG:DS00180.12" Adh std3 CDS 457298 457488 . + . transcript "BG:DS00180.12" Adh std3 CDS 457649 458206 . + . transcript "BG:DS00180.12" Adh std3 CDS 458285 458488 . + . transcript "BG:DS00180.12" Adh std3 CDS 458547 458802 . + . transcript "BG:DS00180.12" Adh std3 splice5 457488 457489 . + . transcript "BG:DS00180.12" Adh std3 splice3 457648 457649 . + . transcript "BG:DS00180.12" Adh std3 splice5 458206 458207 . + . transcript "BG:DS00180.12" Adh std3 splice3 458284 458285 . + . transcript "BG:DS00180.12" Adh std3 splice5 458488 458489 . + . transcript "BG:DS00180.12" Adh std3 splice3 458546 458547 . + . transcript "BG:DS00180.12" # # ### ### # # Adh std3 start_codon 445189 445191 . + . transcript "BG:DS00180.5" Adh std3 stop_codon 456315 456317 . + . transcript "BG:DS00180.5" Adh std3 CDS 445189 445277 . + . transcript "BG:DS00180.5" Adh std3 CDS 446294 446429 . + . transcript "BG:DS00180.5" Adh std3 CDS 446732 447001 . + . transcript "BG:DS00180.5" Adh std3 CDS 448492 448607 . + . transcript "BG:DS00180.5" Adh std3 CDS 449015 449247 . + . transcript "BG:DS00180.5" Adh std3 CDS 451744 451902 . + . transcript "BG:DS00180.5" Adh std3 CDS 452734 452909 . + . transcript "BG:DS00180.5" Adh std3 CDS 455021 455702 . + . transcript "BG:DS00180.5" Adh std3 CDS 455974 456317 . + . transcript "BG:DS00180.5" Adh std3 splice5 445277 445278 . + . transcript "BG:DS00180.5" Adh std3 splice3 446293 446294 . + . transcript "BG:DS00180.5" Adh std3 splice5 446429 446430 . + . transcript "BG:DS00180.5" Adh std3 splice3 446731 446732 . + . transcript "BG:DS00180.5" Adh std3 splice5 447001 447002 . + . transcript "BG:DS00180.5" Adh std3 splice3 448491 448492 . + . transcript "BG:DS00180.5" Adh std3 splice5 448607 448608 . + . transcript "BG:DS00180.5" Adh std3 splice3 449014 449015 . + . transcript "BG:DS00180.5" Adh std3 splice5 449247 449248 . + . transcript "BG:DS00180.5" Adh std3 splice3 451743 451744 . + . transcript "BG:DS00180.5" Adh std3 splice5 451902 451903 . + . transcript "BG:DS00180.5" Adh std3 splice3 452733 452734 . + . transcript "BG:DS00180.5" Adh std3 splice5 452909 452910 . + . transcript "BG:DS00180.5" Adh std3 splice3 455020 455021 . + . transcript "BG:DS00180.5" Adh std3 splice5 455702 455703 . + . transcript "BG:DS00180.5" Adh std3 splice3 455973 455974 . + . transcript "BG:DS00180.5" # # ### ### # # Adh std3 start_codon 440848 440850 . - . transcript "BG:DS00180.3" Adh std3 stop_codon 438979 438981 . - . transcript "BG:DS00180.3" Adh std3 CDS 438979 439800 . - . transcript "BG:DS00180.3" Adh std3 CDS 440839 440850 . - . transcript "BG:DS00180.3" Adh std3 splice3 439800 439801 . - . transcript "BG:DS00180.3" Adh std3 splice5 440838 440839 . - . transcript "BG:DS00180.3" Adh std3 splice3 440877 440878 . - . transcript "BG:DS00180.3" Adh std3 splice5 441147 441148 . - . transcript "BG:DS00180.3" # # ### ### # # Adh std3 start_codon 417109 417111 . - . transcript "BG:DS00180.2" Adh std3 stop_codon 415576 415578 . - . transcript "BG:DS00180.2" Adh std3 CDS 415576 416211 . - . transcript "BG:DS00180.2" Adh std3 CDS 416276 416749 . - . transcript "BG:DS00180.2" Adh std3 CDS 417100 417111 . - . transcript "BG:DS00180.2" Adh std3 splice3 416211 416212 . - . transcript "BG:DS00180.2" Adh std3 splice5 416275 416276 . - . transcript "BG:DS00180.2" Adh std3 splice3 416749 416750 . - . transcript "BG:DS00180.2" Adh std3 splice5 417099 417100 . - . transcript "BG:DS00180.2" # # ### ### # # Adh std3 start_codon 405952 405954 . + . transcript "Acyp" Adh std3 stop_codon 406312 406314 . + . transcript "Acyp" Adh std3 CDS 405952 406314 . + . transcript "Acyp" # # ### ### # # Adh std3 start_codon 185613 185615 . - . transcript "BG:DS08249.1" Adh std3 stop_codon 172106 172108 . - . transcript "BG:DS08249.1" Adh std3 CDS 172106 172869 . - . transcript "BG:DS08249.1" Adh std3 CDS 177956 178015 . - . transcript "BG:DS08249.1" Adh std3 CDS 178136 178300 . - . transcript "BG:DS08249.1" Adh std3 CDS 179847 179900 . - . transcript "BG:DS08249.1" Adh std3 CDS 181272 181409 . - . transcript "BG:DS08249.1" Adh std3 CDS 183107 183235 . - . transcript "BG:DS08249.1" Adh std3 CDS 183341 183496 . - . transcript "BG:DS08249.1" Adh std3 CDS 183596 183635 . - . transcript "BG:DS08249.1" Adh std3 CDS 183835 184040 . - . transcript "BG:DS08249.1" Adh std3 CDS 184241 184282 . - . transcript "BG:DS08249.1" Adh std3 CDS 185558 185615 . - . transcript "BG:DS08249.1" Adh std3 splice3 172869 172870 . - . transcript "BG:DS08249.1" Adh std3 splice5 177955 177956 . - . transcript "BG:DS08249.1" Adh std3 splice3 178015 178016 . - . transcript "BG:DS08249.1" Adh std3 splice5 178135 178136 . - . transcript "BG:DS08249.1" Adh std3 splice3 178300 178301 . - . transcript "BG:DS08249.1" Adh std3 splice5 179846 179847 . - . transcript "BG:DS08249.1" Adh std3 splice3 179900 179901 . - . transcript "BG:DS08249.1" Adh std3 splice5 181271 181272 . - . transcript "BG:DS08249.1" Adh std3 splice3 181409 181410 . - . transcript "BG:DS08249.1" Adh std3 splice5 183106 183107 . - . transcript "BG:DS08249.1" Adh std3 splice3 183235 183236 . - . transcript "BG:DS08249.1" Adh std3 splice5 183340 183341 . - . transcript "BG:DS08249.1" Adh std3 splice3 183496 183497 . - . transcript "BG:DS08249.1" Adh std3 splice5 183595 183596 . - . transcript "BG:DS08249.1" Adh std3 splice3 183635 183636 . - . transcript "BG:DS08249.1" Adh std3 splice5 183834 183835 . - . transcript "BG:DS08249.1" Adh std3 splice3 184040 184041 . - . transcript "BG:DS08249.1" Adh std3 splice5 184240 184241 . - . transcript "BG:DS08249.1" Adh std3 splice3 184282 184283 . - . transcript "BG:DS08249.1" Adh std3 splice5 185557 185558 . - . transcript "BG:DS08249.1" # # ### ### # # Adh std3 start_codon 159578 159580 . + . transcript "BG:DS01368.1" Adh std3 stop_codon 163525 163527 . + . transcript "BG:DS01368.1" Adh std3 CDS 159578 159874 . + . transcript "BG:DS01368.1" Adh std3 CDS 161727 162105 . + . transcript "BG:DS01368.1" Adh std3 CDS 162442 162557 . + . transcript "BG:DS01368.1" Adh std3 CDS 162616 163137 . + . transcript "BG:DS01368.1" Adh std3 CDS 163297 163527 . + . transcript "BG:DS01368.1" Adh std3 splice5 159874 159875 . + . transcript "BG:DS01368.1" Adh std3 splice3 161726 161727 . + . transcript "BG:DS01368.1" Adh std3 splice5 162105 162106 . + . transcript "BG:DS01368.1" Adh std3 splice3 162441 162442 . + . transcript "BG:DS01368.1" Adh std3 splice5 162557 162558 . + . transcript "BG:DS01368.1" Adh std3 splice3 162615 162616 . + . transcript "BG:DS01368.1" Adh std3 splice5 163137 163138 . + . transcript "BG:DS01368.1" Adh std3 splice3 163296 163297 . + . transcript "BG:DS01368.1" Adh std3 splice5 163610 163611 . + . transcript "BG:DS01368.1" Adh std3 splice3 164189 164190 . + . transcript "BG:DS01368.1" # # ### ### # # Adh std3 start_codon 1233087 1233089 . + . transcript "BG:DS00810.3" Adh std3 stop_codon 1233291 1233293 . + . transcript "BG:DS00810.3" Adh std3 CDS 1233087 1233293 . + . transcript "BG:DS00810.3" Adh std3 splice5 1232969 1232970 . + . transcript "BG:DS00810.3" Adh std3 splice3 1233043 1233044 . + . transcript "BG:DS00810.3" # # ### ### # # Adh std3 start_codon 1231461 1231463 . - . transcript "BG:DS00810.2" Adh std3 stop_codon 1231127 1231129 . - . transcript "BG:DS00810.2" Adh std3 CDS 1231127 1231384 . - . transcript "BG:DS00810.2" Adh std3 CDS 1231452 1231463 . - . transcript "BG:DS00810.2" Adh std3 splice3 1231384 1231385 . - . transcript "BG:DS00810.2" Adh std3 splice5 1231451 1231452 . - . transcript "BG:DS00810.2" # # ### ### # # Adh std3 start_codon 1229684 1229686 . + . transcript "BG:DS00810.1" Adh std3 stop_codon 1230731 1230733 . + . transcript "BG:DS00810.1" Adh std3 CDS 1229684 1230733 . + . transcript "BG:DS00810.1" # # ### ### # # Adh std3 start_codon 874868 874870 . - . transcript "ppk" Adh std3 stop_codon 872557 872559 . - . transcript "ppk" Adh std3 CDS 872557 872818 . - . transcript "ppk" Adh std3 CDS 872891 873131 . - . transcript "ppk" Adh std3 CDS 873191 873321 . - . transcript "ppk" Adh std3 CDS 873388 873527 . - . transcript "ppk" Adh std3 CDS 873583 874093 . - . transcript "ppk" Adh std3 CDS 874278 874541 . - . transcript "ppk" Adh std3 CDS 874599 874870 . - . transcript "ppk" Adh std3 splice3 872818 872819 . - . transcript "ppk" Adh std3 splice5 872890 872891 . - . transcript "ppk" Adh std3 splice3 873131 873132 . - . transcript "ppk" Adh std3 splice5 873190 873191 . - . transcript "ppk" Adh std3 splice3 873321 873322 . - . transcript "ppk" Adh std3 splice5 873387 873388 . - . transcript "ppk" Adh std3 splice3 873527 873528 . - . transcript "ppk" Adh std3 splice5 873582 873583 . - . transcript "ppk" Adh std3 splice3 874093 874094 . - . transcript "ppk" Adh std3 splice5 874277 874278 . - . transcript "ppk" Adh std3 splice3 874541 874542 . - . transcript "ppk" Adh std3 splice5 874598 874599 . - . transcript "ppk" # # ### ### # # Adh std3 start_codon 901493 901495 . - . transcript "elB" Adh std3 stop_codon 880859 880861 . - . transcript "elB" Adh std3 CDS 880859 881091 . - . transcript "elB" Adh std3 CDS 883002 883191 . - . transcript "elB" Adh std3 CDS 884810 884937 . - . transcript "elB" Adh std3 CDS 885047 885736 . - . transcript "elB" Adh std3 CDS 885967 886798 . - . transcript "elB" Adh std3 CDS 888067 888286 . - . transcript "elB" Adh std3 CDS 901332 901495 . - . transcript "elB" Adh std3 splice3 881091 881092 . - . transcript "elB" Adh std3 splice5 883001 883002 . - . transcript "elB" Adh std3 splice3 883191 883192 . - . transcript "elB" Adh std3 splice5 884809 884810 . - . transcript "elB" Adh std3 splice3 884937 884938 . - . transcript "elB" Adh std3 splice5 885046 885047 . - . transcript "elB" Adh std3 splice3 885736 885737 . - . transcript "elB" Adh std3 splice5 885966 885967 . - . transcript "elB" Adh std3 splice3 886798 886799 . - . transcript "elB" Adh std3 splice5 888066 888067 . - . transcript "elB" Adh std3 splice3 888286 888287 . - . transcript "elB" Adh std3 splice5 901331 901332 . - . transcript "elB" # # ### ### # # Adh std3 start_codon 918867 918869 . - . transcript "BG:DS06238.4" Adh std3 stop_codon 918151 918153 . - . transcript "BG:DS06238.4" Adh std3 CDS 918151 918795 . - . transcript "BG:DS06238.4" Adh std3 CDS 918858 918869 . - . transcript "BG:DS06238.4" Adh std3 splice3 918795 918796 . - . transcript "BG:DS06238.4" Adh std3 splice5 918857 918858 . - . transcript "BG:DS06238.4" # # ### ### # # Adh std3 start_codon 853116 853118 . + . transcript "l.2.35Aa" Adh std3 stop_codon 855012 855014 . + . transcript "l.2.35Aa" Adh std3 CDS 853116 855014 . + . transcript "l.2.35Aa" # # ### ### # # Adh std3 start_codon 851085 851087 . + . transcript "Rab14" Adh std3 stop_codon 851917 851919 . + . transcript "Rab14" Adh std3 CDS 851085 851190 . + . transcript "Rab14" Adh std3 CDS 851256 851436 . + . transcript "Rab14" Adh std3 CDS 851491 851673 . + . transcript "Rab14" Adh std3 CDS 851742 851919 . + . transcript "Rab14" Adh std3 splice5 849209 849210 . + . transcript "Rab14" Adh std3 splice3 851076 851077 . + . transcript "Rab14" Adh std3 splice5 851190 851191 . + . transcript "Rab14" Adh std3 splice3 851255 851256 . + . transcript "Rab14" Adh std3 splice5 851436 851437 . + . transcript "Rab14" Adh std3 splice3 851490 851491 . + . transcript "Rab14" Adh std3 splice5 851673 851674 . + . transcript "Rab14" Adh std3 splice3 851741 851742 . + . transcript "Rab14" # # ### ### # # Adh std3 start_codon 848731 848733 . - . transcript "BG:DS01068.6" Adh std3 stop_codon 846397 846399 . - . transcript "BG:DS01068.6" Adh std3 CDS 846397 847372 . - . transcript "BG:DS01068.6" Adh std3 CDS 847433 848154 . - . transcript "BG:DS01068.6" Adh std3 CDS 848208 848609 . - . transcript "BG:DS01068.6" Adh std3 CDS 848668 848733 . - . transcript "BG:DS01068.6" Adh std3 splice3 847372 847373 . - . transcript "BG:DS01068.6" Adh std3 splice5 847432 847433 . - . transcript "BG:DS01068.6" Adh std3 splice3 848154 848155 . - . transcript "BG:DS01068.6" Adh std3 splice5 848207 848208 . - . transcript "BG:DS01068.6" Adh std3 splice3 848609 848610 . - . transcript "BG:DS01068.6" Adh std3 splice5 848667 848668 . - . transcript "BG:DS01068.6" # # ### ### # # Adh std3 start_codon 843514 843516 . - . transcript "BG:DS01068.5" Adh std3 stop_codon 842968 842970 . - . transcript "BG:DS01068.5" Adh std3 CDS 842968 843375 . - . transcript "BG:DS01068.5" Adh std3 CDS 843445 843516 . - . transcript "BG:DS01068.5" Adh std3 splice3 843375 843376 . - . transcript "BG:DS01068.5" Adh std3 splice5 843444 843445 . - . transcript "BG:DS01068.5" # # ### ### # # Adh std3 start_codon 842440 842442 . - . transcript "BG:DS01068.4" Adh std3 stop_codon 841091 841093 . - . transcript "BG:DS01068.4" Adh std3 CDS 841091 841333 . - . transcript "BG:DS01068.4" Adh std3 CDS 841389 841969 . - . transcript "BG:DS01068.4" Adh std3 CDS 842034 842442 . - . transcript "BG:DS01068.4" Adh std3 splice3 841333 841334 . - . transcript "BG:DS01068.4" Adh std3 splice5 841388 841389 . - . transcript "BG:DS01068.4" Adh std3 splice3 841969 841970 . - . transcript "BG:DS01068.4" Adh std3 splice5 842033 842034 . - . transcript "BG:DS01068.4" # # ### ### # # Adh std3 start_codon 840388 840390 . - . transcript "BG:DS01068.10" Adh std3 stop_codon 839671 839673 . - . transcript "BG:DS01068.10" Adh std3 CDS 839671 840390 . - . transcript "BG:DS01068.10" # # ### ### # # Adh std3 start_codon 835092 835094 . + . transcript "BG:DS01068.2" Adh std3 stop_codon 839074 839076 . + . transcript "BG:DS01068.2" Adh std3 CDS 835092 835312 . + . transcript "BG:DS01068.2" Adh std3 CDS 836514 837106 . + . transcript "BG:DS01068.2" Adh std3 CDS 837173 837428 . + . transcript "BG:DS01068.2" Adh std3 CDS 837486 837859 . + . transcript "BG:DS01068.2" Adh std3 CDS 837919 838152 . + . transcript "BG:DS01068.2" Adh std3 CDS 838217 839076 . + . transcript "BG:DS01068.2" Adh std3 splice5 835312 835313 . + . transcript "BG:DS01068.2" Adh std3 splice3 836513 836514 . + . transcript "BG:DS01068.2" Adh std3 splice5 837106 837107 . + . transcript "BG:DS01068.2" Adh std3 splice3 837172 837173 . + . transcript "BG:DS01068.2" Adh std3 splice5 837428 837429 . + . transcript "BG:DS01068.2" Adh std3 splice3 837485 837486 . + . transcript "BG:DS01068.2" Adh std3 splice5 837859 837860 . + . transcript "BG:DS01068.2" Adh std3 splice3 837918 837919 . + . transcript "BG:DS01068.2" Adh std3 splice5 838152 838153 . + . transcript "BG:DS01068.2" Adh std3 splice3 838216 838217 . + . transcript "BG:DS01068.2" # # ### ### # # Adh std3 start_codon 828047 828049 . + . transcript "BG:DS01068.11" Adh std3 stop_codon 833670 833672 . + . transcript "BG:DS01068.11" Adh std3 CDS 828047 828306 . + . transcript "BG:DS01068.11" Adh std3 CDS 832073 833672 . + . transcript "BG:DS01068.11" Adh std3 splice5 828306 828307 . + . transcript "BG:DS01068.11" Adh std3 splice3 832072 832073 . + . transcript "BG:DS01068.11" # # ### ### # # Adh std3 start_codon 822205 822207 . + . transcript "BG:DS01068.1" Adh std3 stop_codon 827509 827511 . + . transcript "BG:DS01068.1" Adh std3 CDS 822205 822454 . + . transcript "BG:DS01068.1" Adh std3 CDS 822511 822848 . + . transcript "BG:DS01068.1" Adh std3 CDS 822874 824011 . + . transcript "BG:DS01068.1" Adh std3 CDS 824074 824822 . + . transcript "BG:DS01068.1" Adh std3 CDS 824885 825688 . + . transcript "BG:DS01068.1" Adh std3 CDS 825804 826423 . + . transcript "BG:DS01068.1" Adh std3 CDS 826499 826653 . + . transcript "BG:DS01068.1" Adh std3 CDS 826714 826921 . + . transcript "BG:DS01068.1" Adh std3 CDS 826980 827087 . + . transcript "BG:DS01068.1" Adh std3 CDS 827148 827511 . + . transcript "BG:DS01068.1" Adh std3 splice5 822454 822455 . + . transcript "BG:DS01068.1" Adh std3 splice3 822510 822511 . + . transcript "BG:DS01068.1" Adh std3 splice5 822848 822849 . + . transcript "BG:DS01068.1" Adh std3 splice3 822873 822874 . + . transcript "BG:DS01068.1" Adh std3 splice5 824011 824012 . + . transcript "BG:DS01068.1" Adh std3 splice3 824073 824074 . + . transcript "BG:DS01068.1" Adh std3 splice5 824822 824823 . + . transcript "BG:DS01068.1" Adh std3 splice3 824884 824885 . + . transcript "BG:DS01068.1" Adh std3 splice5 825688 825689 . + . transcript "BG:DS01068.1" Adh std3 splice3 825803 825804 . + . transcript "BG:DS01068.1" Adh std3 splice5 826423 826424 . + . transcript "BG:DS01068.1" Adh std3 splice3 826498 826499 . + . transcript "BG:DS01068.1" Adh std3 splice5 826653 826654 . + . transcript "BG:DS01068.1" Adh std3 splice3 826713 826714 . + . transcript "BG:DS01068.1" Adh std3 splice5 826921 826922 . + . transcript "BG:DS01068.1" Adh std3 splice3 826979 826980 . + . transcript "BG:DS01068.1" Adh std3 splice5 827087 827088 . + . transcript "BG:DS01068.1" Adh std3 splice3 827147 827148 . + . transcript "BG:DS01068.1" # # ### ### # # Adh std3 start_codon 801894 801896 . + . transcript "BG:DS03792.2" Adh std3 stop_codon 804733 804735 . + . transcript "BG:DS03792.2" Adh std3 CDS 801894 802914 . + . transcript "BG:DS03792.2" Adh std3 CDS 803148 803203 . + . transcript "BG:DS03792.2" Adh std3 CDS 804010 804157 . + . transcript "BG:DS03792.2" Adh std3 CDS 804584 804735 . + . transcript "BG:DS03792.2" Adh std3 splice5 802914 802915 . + . transcript "BG:DS03792.2" Adh std3 splice3 803147 803148 . + . transcript "BG:DS03792.2" Adh std3 splice5 803203 803204 . + . transcript "BG:DS03792.2" Adh std3 splice3 804009 804010 . + . transcript "BG:DS03792.2" Adh std3 splice5 804157 804158 . + . transcript "BG:DS03792.2" Adh std3 splice3 804583 804584 . + . transcript "BG:DS03792.2" # # ### ### # # Adh std3 start_codon 202128 202130 . + . transcript "BG:DS08249.2" Adh std3 stop_codon 204197 204199 . + . transcript "BG:DS08249.2" Adh std3 CDS 202128 202646 . + . transcript "BG:DS08249.2" Adh std3 CDS 202700 204199 . + . transcript "BG:DS08249.2" Adh std3 splice5 202646 202647 . + . transcript "BG:DS08249.2" Adh std3 splice3 202699 202700 . + . transcript "BG:DS08249.2" # # ### ### # # Adh std3 start_codon 217186 217188 . - . transcript "BG:DS08249.3" Adh std3 stop_codon 213507 213509 . - . transcript "BG:DS08249.3" Adh std3 CDS 213507 213602 . - . transcript "BG:DS08249.3" Adh std3 CDS 216171 216761 . - . transcript "BG:DS08249.3" Adh std3 CDS 216820 217188 . - . transcript "BG:DS08249.3" Adh std3 splice3 213602 213603 . - . transcript "BG:DS08249.3" Adh std3 splice5 216170 216171 . - . transcript "BG:DS08249.3" Adh std3 splice3 216761 216762 . - . transcript "BG:DS08249.3" Adh std3 splice5 216819 216820 . - . transcript "BG:DS08249.3" # # ### ### # # Adh std3 start_codon 227121 227123 . + . transcript "BG:DS08249.4" Adh std3 stop_codon 230460 230462 . + . transcript "BG:DS08249.4" Adh std3 CDS 227121 227312 . + . transcript "BG:DS08249.4" Adh std3 CDS 227793 227992 . + . transcript "BG:DS08249.4" Adh std3 CDS 229661 230462 . + . transcript "BG:DS08249.4" Adh std3 splice5 227312 227313 . + . transcript "BG:DS08249.4" Adh std3 splice3 227792 227793 . + . transcript "BG:DS08249.4" Adh std3 splice5 227992 227993 . + . transcript "BG:DS08249.4" Adh std3 splice3 229660 229661 . + . transcript "BG:DS08249.4" # # ### ### # # Adh std3 start_codon 240150 240152 . - . transcript "BG:DS08249.5" Adh std3 stop_codon 230985 230987 . - . transcript "BG:DS08249.5" Adh std3 CDS 230985 231322 . - . transcript "BG:DS08249.5" Adh std3 CDS 231417 231549 . - . transcript "BG:DS08249.5" Adh std3 CDS 234442 234563 . - . transcript "BG:DS08249.5" Adh std3 CDS 235723 235990 . - . transcript "BG:DS08249.5" Adh std3 CDS 236859 236980 . - . transcript "BG:DS08249.5" Adh std3 CDS 237092 237123 . - . transcript "BG:DS08249.5" Adh std3 CDS 239944 240152 . - . transcript "BG:DS08249.5" Adh std3 splice3 231322 231323 . - . transcript "BG:DS08249.5" Adh std3 splice5 231416 231417 . - . transcript "BG:DS08249.5" Adh std3 splice3 231549 231550 . - . transcript "BG:DS08249.5" Adh std3 splice5 234441 234442 . - . transcript "BG:DS08249.5" Adh std3 splice3 234563 234564 . - . transcript "BG:DS08249.5" Adh std3 splice5 235722 235723 . - . transcript "BG:DS08249.5" Adh std3 splice3 235990 235991 . - . transcript "BG:DS08249.5" Adh std3 splice5 236858 236859 . - . transcript "BG:DS08249.5" Adh std3 splice3 236980 236981 . - . transcript "BG:DS08249.5" Adh std3 splice5 237091 237092 . - . transcript "BG:DS08249.5" Adh std3 splice3 237123 237124 . - . transcript "BG:DS08249.5" Adh std3 splice5 239943 239944 . - . transcript "BG:DS08249.5" # # ### ### # # Adh std3 start_codon 514048 514050 . - . transcript "l.2.34Fa" Adh std3 stop_codon 513238 513240 . - . transcript "l.2.34Fa" Adh std3 CDS 513238 514050 . - . transcript "l.2.34Fa" # # ### ### # # Adh std3 start_codon 944596 944598 . - . transcript "BG:DS08340.1" Adh std3 stop_codon 941115 941117 . - . transcript "BG:DS08340.1" Adh std3 CDS 941115 941176 . - . transcript "BG:DS08340.1" Adh std3 CDS 941646 941731 . - . transcript "BG:DS08340.1" Adh std3 CDS 942328 942612 . - . transcript "BG:DS08340.1" Adh std3 CDS 943030 943151 . - . transcript "BG:DS08340.1" Adh std3 CDS 944233 944598 . - . transcript "BG:DS08340.1" Adh std3 splice3 941176 941177 . - . transcript "BG:DS08340.1" Adh std3 splice5 941645 941646 . - . transcript "BG:DS08340.1" Adh std3 splice3 941731 941732 . - . transcript "BG:DS08340.1" Adh std3 splice5 942327 942328 . - . transcript "BG:DS08340.1" Adh std3 splice3 942612 942613 . - . transcript "BG:DS08340.1" Adh std3 splice5 943029 943030 . - . transcript "BG:DS08340.1" Adh std3 splice3 943151 943152 . - . transcript "BG:DS08340.1" Adh std3 splice5 944232 944233 . - . transcript "BG:DS08340.1" # # ### ### # # Adh std3 start_codon 1752778 1752780 . - . transcript "BG:DS05639.1" Adh std3 stop_codon 1747063 1747065 . - . transcript "BG:DS05639.1" Adh std3 CDS 1747065 1747238 . - . transcript "BG:DS05639.1" Adh std3 CDS 1747451 1747757 . - . transcript "BG:DS05639.1" Adh std3 CDS 1747825 1748093 . - . transcript "BG:DS05639.1" Adh std3 CDS 1748156 1748361 . - . transcript "BG:DS05639.1" Adh std3 CDS 1748434 1748590 . - . transcript "BG:DS05639.1" Adh std3 CDS 1748671 1748943 . - . transcript "BG:DS05639.1" Adh std3 CDS 1751370 1751492 . - . transcript "BG:DS05639.1" Adh std3 CDS 1751564 1751664 . - . transcript "BG:DS05639.1" Adh std3 CDS 1751722 1751956 . - . transcript "BG:DS05639.1" Adh std3 CDS 1752027 1752278 . - . transcript "BG:DS05639.1" Adh std3 CDS 1752622 1752780 . - . transcript "BG:DS05639.1" Adh std3 splice3 1747238 1747239 . - . transcript "BG:DS05639.1" Adh std3 splice5 1747450 1747451 . - . transcript "BG:DS05639.1" Adh std3 splice3 1747757 1747758 . - . transcript "BG:DS05639.1" Adh std3 splice5 1747824 1747825 . - . transcript "BG:DS05639.1" Adh std3 splice3 1748093 1748094 . - . transcript "BG:DS05639.1" Adh std3 splice5 1748155 1748156 . - . transcript "BG:DS05639.1" Adh std3 splice3 1748361 1748362 . - . transcript "BG:DS05639.1" Adh std3 splice5 1748433 1748434 . - . transcript "BG:DS05639.1" Adh std3 splice3 1748590 1748591 . - . transcript "BG:DS05639.1" Adh std3 splice5 1748670 1748671 . - . transcript "BG:DS05639.1" Adh std3 splice3 1748943 1748944 . - . transcript "BG:DS05639.1" Adh std3 splice5 1751369 1751370 . - . transcript "BG:DS05639.1" Adh std3 splice3 1751492 1751493 . - . transcript "BG:DS05639.1" Adh std3 splice5 1751563 1751564 . - . transcript "BG:DS05639.1" Adh std3 splice3 1751664 1751665 . - . transcript "BG:DS05639.1" Adh std3 splice5 1751721 1751722 . - . transcript "BG:DS05639.1" Adh std3 splice3 1751956 1751957 . - . transcript "BG:DS05639.1" Adh std3 splice5 1752026 1752027 . - . transcript "BG:DS05639.1" Adh std3 splice3 1752278 1752279 . - . transcript "BG:DS05639.1" Adh std3 splice5 1752621 1752622 . - . transcript "BG:DS05639.1" # # ### ### # # Adh std3 start_codon 2815178 2815180 . + . transcript "BG:DS09218.5" Adh std3 stop_codon 2820924 2820926 . + . transcript "BG:DS09218.5" Adh std3 CDS 2815178 2815829 . + . transcript "BG:DS09218.5" Adh std3 CDS 2815894 2816001 . + . transcript "BG:DS09218.5" Adh std3 CDS 2820072 2820194 . + . transcript "BG:DS09218.5" Adh std3 CDS 2820862 2820926 . + . transcript "BG:DS09218.5" Adh std3 splice5 2815829 2815830 . + . transcript "BG:DS09218.5" Adh std3 splice3 2815893 2815894 . + . transcript "BG:DS09218.5" Adh std3 splice5 2816001 2816002 . + . transcript "BG:DS09218.5" Adh std3 splice3 2820071 2820072 . + . transcript "BG:DS09218.5" Adh std3 splice5 2820194 2820195 . + . transcript "BG:DS09218.5" Adh std3 splice3 2820861 2820862 . + . transcript "BG:DS09218.5" # # ### ### # # Adh std3 start_codon 2805810 2805812 . - . transcript "BG:DS09218.4" Adh std3 stop_codon 2804442 2804444 . - . transcript "BG:DS09218.4" Adh std3 CDS 2804442 2805730 . - . transcript "BG:DS09218.4" Adh std3 CDS 2805800 2805812 . - . transcript "BG:DS09218.4" Adh std3 splice3 2805730 2805731 . - . transcript "BG:DS09218.4" Adh std3 splice5 2805799 2805800 . - . transcript "BG:DS09218.4" # # ### ### # # Adh std3 start_codon 2802355 2802357 . + . transcript "BG:DS09218.3" Adh std3 stop_codon 2802811 2802813 . + . transcript "BG:DS09218.3" Adh std3 CDS 2802355 2802394 . + . transcript "BG:DS09218.3" Adh std3 CDS 2802473 2802813 . + . transcript "BG:DS09218.3" Adh std3 splice5 2802394 2802395 . + . transcript "BG:DS09218.3" Adh std3 splice3 2802472 2802473 . + . transcript "BG:DS09218.3" # # ### ### # # Adh std3 start_codon 2798711 2798713 . - . transcript "chif" Adh std3 stop_codon 2793626 2793628 . - . transcript "chif" Adh std3 CDS 2793626 2798713 . - . transcript "chif" Adh std3 splice3 2798728 2798729 . - . transcript "chif" Adh std3 splice5 2801182 2801183 . - . transcript "chif" # # ### ### # # Adh std3 start_codon 2792599 2792601 . - . transcript "BG:DS09218.1" Adh std3 stop_codon 2791866 2791868 . - . transcript "BG:DS09218.1" Adh std3 CDS 2791866 2792011 . - . transcript "BG:DS09218.1" Adh std3 CDS 2792082 2792601 . - . transcript "BG:DS09218.1" Adh std3 splice3 2792011 2792012 . - . transcript "BG:DS09218.1" Adh std3 splice5 2792081 2792082 . - . transcript "BG:DS09218.1" # # ### ### # # Adh std3 start_codon 2791501 2791503 . - . transcript "BG:DS02740.19" Adh std3 stop_codon 2787421 2787423 . - . transcript "BG:DS02740.19" Adh std3 CDS 2787421 2787885 . - . transcript "BG:DS02740.19" Adh std3 CDS 2787948 2788316 . - . transcript "BG:DS02740.19" Adh std3 CDS 2788569 2788684 . - . transcript "BG:DS02740.19" Adh std3 CDS 2788808 2789082 . - . transcript "BG:DS02740.19" Adh std3 CDS 2789143 2789471 . - . transcript "BG:DS02740.19" Adh std3 CDS 2789812 2791503 . - . transcript "BG:DS02740.19" Adh std3 splice3 2787885 2787886 . - . transcript "BG:DS02740.19" Adh std3 splice5 2787947 2787948 . - . transcript "BG:DS02740.19" Adh std3 splice3 2788316 2788317 . - . transcript "BG:DS02740.19" Adh std3 splice5 2788568 2788569 . - . transcript "BG:DS02740.19" Adh std3 splice3 2788684 2788685 . - . transcript "BG:DS02740.19" Adh std3 splice5 2788807 2788808 . - . transcript "BG:DS02740.19" Adh std3 splice3 2789082 2789083 . - . transcript "BG:DS02740.19" Adh std3 splice5 2789142 2789143 . - . transcript "BG:DS02740.19" Adh std3 splice3 2789471 2789472 . - . transcript "BG:DS02740.19" Adh std3 splice5 2789811 2789812 . - . transcript "BG:DS02740.19" # # ### ### # # Adh std3 start_codon 2787065 2787067 . - . transcript "BG:DS02740.18" Adh std3 stop_codon 2779883 2779885 . - . transcript "BG:DS02740.18" Adh std3 CDS 2779883 2785491 . - . transcript "BG:DS02740.18" Adh std3 CDS 2785552 2786722 . - . transcript "BG:DS02740.18" Adh std3 CDS 2786999 2787067 . - . transcript "BG:DS02740.18" Adh std3 splice3 2785491 2785492 . - . transcript "BG:DS02740.18" Adh std3 splice5 2785551 2785552 . - . transcript "BG:DS02740.18" Adh std3 splice3 2786722 2786723 . - . transcript "BG:DS02740.18" Adh std3 splice5 2786998 2786999 . - . transcript "BG:DS02740.18" # # ### ### # # Adh std3 start_codon 2778340 2778342 . - . transcript "l.2.35Fe" Adh std3 stop_codon 2777390 2777392 . - . transcript "l.2.35Fe" Adh std3 CDS 2777390 2777609 . - . transcript "l.2.35Fe" Adh std3 CDS 2777672 2778342 . - . transcript "l.2.35Fe" Adh std3 splice3 2777609 2777610 . - . transcript "l.2.35Fe" Adh std3 splice5 2777671 2777672 . - . transcript "l.2.35Fe" # # ### ### # # Adh std3 start_codon 2776417 2776419 . + . transcript "anon-35F.36A" Adh std3 stop_codon 2777293 2777295 . + . transcript "anon-35F.36A" Adh std3 CDS 2776417 2777295 . + . transcript "anon-35F.36A" # # ### ### # # Adh std3 start_codon 2774285 2774287 . - . transcript "cact" Adh std3 stop_codon 2762639 2762641 . - . transcript "cact" Adh std3 CDS 2762639 2762710 . - . transcript "cact" Adh std3 CDS 2763711 2763968 . - . transcript "cact" Adh std3 CDS 2764030 2764118 . - . transcript "cact" Adh std3 CDS 2772220 2772430 . - . transcript "cact" Adh std3 CDS 2772600 2772777 . - . transcript "cact" Adh std3 CDS 2773593 2774287 . - . transcript "cact" Adh std3 splice3 2762710 2762711 . - . transcript "cact" Adh std3 splice5 2763710 2763711 . - . transcript "cact" Adh std3 splice3 2763968 2763969 . - . transcript "cact" Adh std3 splice5 2764029 2764030 . - . transcript "cact" Adh std3 splice3 2764118 2764119 . - . transcript "cact" Adh std3 splice5 2772219 2772220 . - . transcript "cact" Adh std3 splice3 2772430 2772431 . - . transcript "cact" Adh std3 splice5 2772599 2772600 . - . transcript "cact" Adh std3 splice3 2772777 2772778 . - . transcript "cact" Adh std3 splice5 2773592 2773593 . - . transcript "cact" Adh std3 splice3 2774314 2774315 . - . transcript "cact" Adh std3 splice5 2774753 2774754 . - . transcript "cact" # # ### ### # # Adh std3 start_codon 2760361 2760363 . + . transcript "fzy" Adh std3 stop_codon 2762085 2762087 . + . transcript "fzy" Adh std3 CDS 2760361 2760672 . + . transcript "fzy" Adh std3 CDS 2760766 2761087 . + . transcript "fzy" Adh std3 CDS 2761141 2762087 . + . transcript "fzy" Adh std3 splice5 2760672 2760673 . + . transcript "fzy" Adh std3 splice3 2760765 2760766 . + . transcript "fzy" Adh std3 splice5 2761087 2761088 . + . transcript "fzy" Adh std3 splice3 2761140 2761141 . + . transcript "fzy" # # ### ### # # Adh std3 start_codon 2759848 2759850 . - . transcript "cni" Adh std3 stop_codon 2759163 2759165 . - . transcript "cni" Adh std3 CDS 2759163 2759190 . - . transcript "cni" Adh std3 CDS 2759260 2759403 . - . transcript "cni" Adh std3 CDS 2759527 2759639 . - . transcript "cni" Adh std3 CDS 2759701 2759850 . - . transcript "cni" Adh std3 splice3 2759190 2759191 . - . transcript "cni" Adh std3 splice5 2759259 2759260 . - . transcript "cni" Adh std3 splice3 2759403 2759404 . - . transcript "cni" Adh std3 splice5 2759526 2759527 . - . transcript "cni" Adh std3 splice3 2759639 2759640 . - . transcript "cni" Adh std3 splice5 2759700 2759701 . - . transcript "cni" # # ### ### # # Adh std3 start_codon 2757391 2757393 . + . transcript "Sed5" Adh std3 stop_codon 2758388 2758390 . + . transcript "Sed5" Adh std3 CDS 2757391 2757589 . + . transcript "Sed5" Adh std3 CDS 2757658 2758388 . + . transcript "Sed5" Adh std3 splice5 2757589 2757590 . + . transcript "Sed5" Adh std3 splice3 2757657 2757658 . + . transcript "Sed5" # # ### ### # # Adh std3 start_codon 2756272 2756274 . - . transcript "anon-35Fa" Adh std3 stop_codon 2755219 2755221 . - . transcript "anon-35Fa" Adh std3 CDS 2755219 2755580 . - . transcript "anon-35Fa" Adh std3 CDS 2755775 2755883 . - . transcript "anon-35Fa" Adh std3 CDS 2755954 2756092 . - . transcript "anon-35Fa" Adh std3 CDS 2756201 2756274 . - . transcript "anon-35Fa" Adh std3 splice3 2752742 2752743 . - . transcript "anon-35Fa" Adh std3 splice5 2755087 2755088 . - . transcript "anon-35Fa" Adh std3 splice3 2755580 2755581 . - . transcript "anon-35Fa" Adh std3 splice5 2755774 2755775 . - . transcript "anon-35Fa" Adh std3 splice3 2755883 2755884 . - . transcript "anon-35Fa" Adh std3 splice5 2755953 2755954 . - . transcript "anon-35Fa" Adh std3 splice3 2756092 2756093 . - . transcript "anon-35Fa" Adh std3 splice5 2756200 2756201 . - . transcript "anon-35Fa" # # ### ### # # Adh std3 start_codon 2752612 2752614 . + . transcript "BG:DS02740.10" Adh std3 stop_codon 2754737 2754739 . + . transcript "BG:DS02740.10" Adh std3 CDS 2752612 2752742 . + . transcript "BG:DS02740.10" Adh std3 CDS 2752822 2752985 . + . transcript "BG:DS02740.10" Adh std3 CDS 2753042 2753322 . + . transcript "BG:DS02740.10" Adh std3 CDS 2753382 2753565 . + . transcript "BG:DS02740.10" Adh std3 CDS 2753620 2753995 . + . transcript "BG:DS02740.10" Adh std3 CDS 2754057 2754364 . + . transcript "BG:DS02740.10" Adh std3 CDS 2754423 2754557 . + . transcript "BG:DS02740.10" Adh std3 CDS 2754615 2754739 . + . transcript "BG:DS02740.10" Adh std3 splice5 2752742 2752743 . + . transcript "BG:DS02740.10" Adh std3 splice3 2752821 2752822 . + . transcript "BG:DS02740.10" Adh std3 splice5 2752985 2752986 . + . transcript "BG:DS02740.10" Adh std3 splice3 2753041 2753042 . + . transcript "BG:DS02740.10" Adh std3 splice5 2753322 2753323 . + . transcript "BG:DS02740.10" Adh std3 splice3 2753381 2753382 . + . transcript "BG:DS02740.10" Adh std3 splice5 2753565 2753566 . + . transcript "BG:DS02740.10" Adh std3 splice3 2753619 2753620 . + . transcript "BG:DS02740.10" Adh std3 splice5 2753995 2753996 . + . transcript "BG:DS02740.10" Adh std3 splice3 2754056 2754057 . + . transcript "BG:DS02740.10" Adh std3 splice5 2754364 2754365 . + . transcript "BG:DS02740.10" Adh std3 splice3 2754422 2754423 . + . transcript "BG:DS02740.10" Adh std3 splice5 2754557 2754558 . + . transcript "BG:DS02740.10" Adh std3 splice3 2754614 2754615 . + . transcript "BG:DS02740.10" # # ### ### # # Adh std3 start_codon 2752031 2752033 . - . transcript "BG:DS02740.9" Adh std3 stop_codon 2751337 2751339 . - . transcript "BG:DS02740.9" Adh std3 CDS 2751337 2751465 . - . transcript "BG:DS02740.9" Adh std3 CDS 2751521 2751711 . - . transcript "BG:DS02740.9" Adh std3 CDS 2751778 2751871 . - . transcript "BG:DS02740.9" Adh std3 CDS 2752031 2752033 . - . transcript "BG:DS02740.9" Adh std3 splice3 2751465 2751466 . - . transcript "BG:DS02740.9" Adh std3 splice5 2751520 2751521 . - . transcript "BG:DS02740.9" Adh std3 splice3 2751711 2751712 . - . transcript "BG:DS02740.9" Adh std3 splice5 2751777 2751778 . - . transcript "BG:DS02740.9" Adh std3 splice3 2751871 2751872 . - . transcript "BG:DS02740.9" Adh std3 splice5 2752030 2752031 . - . transcript "BG:DS02740.9" # # ### ### # # Adh std3 start_codon 2749571 2749573 . + . transcript "BG:DS02740.8" Adh std3 stop_codon 2750866 2750868 . + . transcript "BG:DS02740.8" Adh std3 CDS 2749571 2749699 . + . transcript "BG:DS02740.8" Adh std3 CDS 2749753 2750868 . + . transcript "BG:DS02740.8" Adh std3 splice5 2749699 2749700 . + . transcript "BG:DS02740.8" Adh std3 splice3 2749752 2749753 . + . transcript "BG:DS02740.8" # # ### ### # # Adh std3 start_codon 2748570 2748572 . - . transcript "heix" Adh std3 stop_codon 2746815 2746817 . - . transcript "heix" Adh std3 CDS 2746815 2747453 . - . transcript "heix" Adh std3 CDS 2748132 2748572 . - . transcript "heix" Adh std3 splice3 2747453 2747454 . - . transcript "heix" Adh std3 splice5 2748131 2748132 . - . transcript "heix" # # ### ### # # Adh std3 start_codon 2743611 2743613 . + . transcript "l.2.35Fb" Adh std3 stop_codon 2745120 2745122 . + . transcript "l.2.35Fb" Adh std3 CDS 2743611 2745122 . + . transcript "l.2.35Fb" # # ### ### # # Adh std3 start_codon 2740542 2740544 . + . transcript "BG:DS02740.5" Adh std3 stop_codon 2741088 2741090 . + . transcript "BG:DS02740.5" Adh std3 CDS 2740542 2741090 . + . transcript "BG:DS02740.5" # # ### ### # # Adh std3 start_codon 2737704 2737706 . + . transcript "BG:DS02740.4" Adh std3 stop_codon 2740037 2740039 . + . transcript "BG:DS02740.4" Adh std3 CDS 2737704 2737731 . + . transcript "BG:DS02740.4" Adh std3 CDS 2737860 2738132 . + . transcript "BG:DS02740.4" Adh std3 CDS 2738403 2739461 . + . transcript "BG:DS02740.4" Adh std3 CDS 2739531 2740039 . + . transcript "BG:DS02740.4" Adh std3 splice5 2737731 2737732 . + . transcript "BG:DS02740.4" Adh std3 splice3 2737859 2737860 . + . transcript "BG:DS02740.4" Adh std3 splice5 2738132 2738133 . + . transcript "BG:DS02740.4" Adh std3 splice3 2738402 2738403 . + . transcript "BG:DS02740.4" Adh std3 splice5 2739461 2739462 . + . transcript "BG:DS02740.4" Adh std3 splice3 2739530 2739531 . + . transcript "BG:DS02740.4" # # ### ### # # Adh std3 start_codon 2736447 2736449 . - . transcript "crp" Adh std3 stop_codon 2714362 2714364 . - . transcript "crp" Adh std3 CDS 2714362 2714383 . - . transcript "crp" Adh std3 CDS 2714899 2716277 . - . transcript "crp" Adh std3 CDS 2728123 2728429 . - . transcript "crp" Adh std3 CDS 2736358 2736449 . - . transcript "crp" Adh std3 splice3 2714383 2714384 . - . transcript "crp" Adh std3 splice5 2714898 2714899 . - . transcript "crp" Adh std3 splice3 2716277 2716278 . - . transcript "crp" Adh std3 splice5 2728122 2728123 . - . transcript "crp" Adh std3 splice3 2728429 2728430 . - . transcript "crp" Adh std3 splice5 2736357 2736358 . - . transcript "crp" # # ### ### # # Adh std3 start_codon 2711460 2711462 . + . transcript "BG:DS02740.2" Adh std3 stop_codon 2712644 2712646 . + . transcript "BG:DS02740.2" Adh std3 CDS 2711460 2711538 . + . transcript "BG:DS02740.2" Adh std3 CDS 2711599 2711717 . + . transcript "BG:DS02740.2" Adh std3 CDS 2711781 2711853 . + . transcript "BG:DS02740.2" Adh std3 CDS 2711910 2712440 . + . transcript "BG:DS02740.2" Adh std3 CDS 2712522 2712646 . + . transcript "BG:DS02740.2" Adh std3 splice5 2711538 2711539 . + . transcript "BG:DS02740.2" Adh std3 splice3 2711598 2711599 . + . transcript "BG:DS02740.2" Adh std3 splice5 2711717 2711718 . + . transcript "BG:DS02740.2" Adh std3 splice3 2711780 2711781 . + . transcript "BG:DS02740.2" Adh std3 splice5 2711853 2711854 . + . transcript "BG:DS02740.2" Adh std3 splice3 2711909 2711910 . + . transcript "BG:DS02740.2" Adh std3 splice5 2712440 2712441 . + . transcript "BG:DS02740.2" Adh std3 splice3 2712521 2712522 . + . transcript "BG:DS02740.2" # # ### ### # # Adh std3 start_codon 2710763 2710765 . - . transcript "twe" Adh std3 stop_codon 2709485 2709487 . - . transcript "twe" Adh std3 CDS 2709485 2710765 . - . transcript "twe" Adh std3 splice3 2710765 2710766 . - . transcript "twe" Adh std3 splice5 2710850 2710851 . - . transcript "twe" # # ### ### # # Adh std3 start_codon 397669 397671 . - . transcript "anon-34Ea" Adh std3 stop_codon 393573 393575 . - . transcript "anon-34Ea" Adh std3 CDS 393573 393814 . - . transcript "anon-34Ea" Adh std3 CDS 393894 394052 . - . transcript "anon-34Ea" Adh std3 CDS 394383 395732 . - . transcript "anon-34Ea" Adh std3 CDS 395826 397468 . - . transcript "anon-34Ea" Adh std3 CDS 397532 397671 . - . transcript "anon-34Ea" Adh std3 splice3 393814 393815 . - . transcript "anon-34Ea" Adh std3 splice5 393893 393894 . - . transcript "anon-34Ea" Adh std3 splice3 394052 394053 . - . transcript "anon-34Ea" Adh std3 splice5 394382 394383 . - . transcript "anon-34Ea" Adh std3 splice3 395732 395733 . - . transcript "anon-34Ea" Adh std3 splice5 395825 395826 . - . transcript "anon-34Ea" Adh std3 splice3 397468 397469 . - . transcript "anon-34Ea" Adh std3 splice5 397531 397532 . - . transcript "anon-34Ea" Adh std3 splice3 397682 397683 . - . transcript "anon-34Ea" Adh std3 splice5 398148 398149 . - . transcript "anon-34Ea" # # ### ### # # Adh std3 start_codon 1988872 1988874 . + . transcript "lace" Adh std3 stop_codon 1993564 1993566 . + . transcript "lace" Adh std3 CDS 1988872 1989075 . + . transcript "lace" Adh std3 CDS 1991768 1992877 . + . transcript "lace" Adh std3 CDS 1992942 1993204 . + . transcript "lace" Adh std3 CDS 1993350 1993566 . + . transcript "lace" Adh std3 splice5 1989075 1989076 . + . transcript "lace" Adh std3 splice3 1991767 1991768 . + . transcript "lace" Adh std3 splice5 1992877 1992878 . + . transcript "lace" Adh std3 splice3 1992941 1992942 . + . transcript "lace" Adh std3 splice5 1993204 1993205 . + . transcript "lace" Adh std3 splice3 1993349 1993350 . + . transcript "lace" # # ### ### # # Adh std3 start_codon 1974488 1974490 . + . transcript "Tim17" Adh std3 stop_codon 1983853 1983855 . + . transcript "Tim17" Adh std3 CDS 1974488 1974989 . + . transcript "Tim17" Adh std3 CDS 1975874 1976154 . + . transcript "Tim17" Adh std3 CDS 1980350 1980517 . + . transcript "Tim17" Adh std3 CDS 1983142 1983399 . + . transcript "Tim17" Adh std3 CDS 1983628 1983855 . + . transcript "Tim17" Adh std3 splice5 1974989 1974990 . + . transcript "Tim17" Adh std3 splice3 1975873 1975874 . + . transcript "Tim17" Adh std3 splice5 1976154 1976155 . + . transcript "Tim17" Adh std3 splice3 1980349 1980350 . + . transcript "Tim17" Adh std3 splice5 1980517 1980518 . + . transcript "Tim17" Adh std3 splice3 1983141 1983142 . + . transcript "Tim17" Adh std3 splice5 1983399 1983400 . + . transcript "Tim17" Adh std3 splice3 1983627 1983628 . + . transcript "Tim17" # # ### ### # # Adh std3 start_codon 1967756 1967758 . - . transcript "sna" Adh std3 stop_codon 1966586 1966588 . - . transcript "sna" Adh std3 CDS 1966586 1967758 . - . transcript "sna" # # ### ### # # Adh std3 start_codon 2236081 2236083 . + . transcript "BG:DS02252.3" Adh std3 stop_codon 2241874 2241876 . + . transcript "BG:DS02252.3" Adh std3 CDS 2236081 2241876 . + . transcript "BG:DS02252.3" # # ### ### # # Adh std3 start_codon 2287431 2287433 . - . transcript "BG:DS02252.4" Adh std3 stop_codon 2286435 2286437 . - . transcript "BG:DS02252.4" Adh std3 CDS 2286435 2287433 . - . transcript "BG:DS02252.4" # # ### ### # # Adh std3 start_codon 2303448 2303450 . + . transcript "BG:DS02252.1" Adh std3 stop_codon 2304639 2304641 . + . transcript "BG:DS02252.1" Adh std3 CDS 2303448 2304641 . + . transcript "BG:DS02252.1" # # ### ### # # Adh std3 start_codon 1149062 1149064 . - . transcript "BG:DS09219.1" Adh std3 stop_codon 1146799 1146801 . - . transcript "BG:DS09219.1" Adh std3 CDS 1146799 1147106 . - . transcript "BG:DS09219.1" Adh std3 CDS 1147866 1148064 . - . transcript "BG:DS09219.1" Adh std3 CDS 1148478 1148530 . - . transcript "BG:DS09219.1" Adh std3 CDS 1148830 1149064 . - . transcript "BG:DS09219.1" Adh std3 splice3 1147106 1147107 . - . transcript "BG:DS09219.1" Adh std3 splice5 1147865 1147866 . - . transcript "BG:DS09219.1" Adh std3 splice3 1148064 1148065 . - . transcript "BG:DS09219.1" Adh std3 splice5 1148477 1148478 . - . transcript "BG:DS09219.1" Adh std3 splice3 1148530 1148531 . - . transcript "BG:DS09219.1" Adh std3 splice5 1148829 1148830 . - . transcript "BG:DS09219.1" # # ### ### # # Adh std3 start_codon 1414397 1414399 . + . transcript "BG:DS03323.1" Adh std3 stop_codon 1419916 1419918 . + . transcript "BG:DS03323.1" Adh std3 CDS 1414397 1418081 . + . transcript "BG:DS03323.1" Adh std3 CDS 1418142 1419321 . + . transcript "BG:DS03323.1" Adh std3 CDS 1419378 1419918 . + . transcript "BG:DS03323.1" Adh std3 splice5 1418081 1418082 . + . transcript "BG:DS03323.1" Adh std3 splice3 1418141 1418142 . + . transcript "BG:DS03323.1" Adh std3 splice5 1419321 1419322 . + . transcript "BG:DS03323.1" Adh std3 splice3 1419377 1419378 . + . transcript "BG:DS03323.1" # # ### ### # # Adh std3 start_codon 2428833 2428835 . + . transcript "BG:DS07486.2" Adh std3 stop_codon 2429379 2429381 . + . transcript "BG:DS07486.2" Adh std3 CDS 2428833 2429381 . + . transcript "BG:DS07486.2" # # ### ### # # Adh std3 start_codon 2398367 2398369 . + . transcript "BG:DS07486.5" Adh std3 stop_codon 2410392 2410394 . + . transcript "BG:DS07486.5" Adh std3 CDS 2398367 2398380 . + . transcript "BG:DS07486.5" Adh std3 CDS 2406425 2406634 . + . transcript "BG:DS07486.5" Adh std3 CDS 2407447 2407845 . + . transcript "BG:DS07486.5" Adh std3 CDS 2407960 2408288 . + . transcript "BG:DS07486.5" Adh std3 CDS 2410246 2410394 . + . transcript "BG:DS07486.5" Adh std3 splice5 2398380 2398381 . + . transcript "BG:DS07486.5" Adh std3 splice3 2406424 2406425 . + . transcript "BG:DS07486.5" Adh std3 splice5 2406634 2406635 . + . transcript "BG:DS07486.5" Adh std3 splice3 2407446 2407447 . + . transcript "BG:DS07486.5" Adh std3 splice5 2407845 2407846 . + . transcript "BG:DS07486.5" Adh std3 splice3 2407959 2407960 . + . transcript "BG:DS07486.5" Adh std3 splice5 2408288 2408289 . + . transcript "BG:DS07486.5" Adh std3 splice3 2410245 2410246 . + . transcript "BG:DS07486.5" # # ### ### # # Adh std3 start_codon 2392181 2392183 . + . transcript "BG:DS07486.4" Adh std3 stop_codon 2395321 2395323 . + . transcript "BG:DS07486.4" Adh std3 CDS 2392181 2392737 . + . transcript "BG:DS07486.4" Adh std3 CDS 2392800 2393095 . + . transcript "BG:DS07486.4" Adh std3 CDS 2393155 2393333 . + . transcript "BG:DS07486.4" Adh std3 CDS 2395174 2395323 . + . transcript "BG:DS07486.4" Adh std3 splice5 2392737 2392738 . + . transcript "BG:DS07486.4" Adh std3 splice3 2392799 2392800 . + . transcript "BG:DS07486.4" Adh std3 splice5 2393095 2393096 . + . transcript "BG:DS07486.4" Adh std3 splice3 2393154 2393155 . + . transcript "BG:DS07486.4" Adh std3 splice5 2393333 2393334 . + . transcript "BG:DS07486.4" Adh std3 splice3 2395173 2395174 . + . transcript "BG:DS07486.4" # # ### ### # # Adh std3 start_codon 2374085 2374087 . + . transcript "BG:DS07486.3" Adh std3 stop_codon 2376715 2376717 . + . transcript "BG:DS07486.3" Adh std3 CDS 2374085 2374294 . + . transcript "BG:DS07486.3" Adh std3 CDS 2374356 2376450 . + . transcript "BG:DS07486.3" Adh std3 CDS 2376677 2376717 . + . transcript "BG:DS07486.3" Adh std3 splice5 2374294 2374295 . + . transcript "BG:DS07486.3" Adh std3 splice3 2374355 2374356 . + . transcript "BG:DS07486.3" Adh std3 splice5 2376450 2376451 . + . transcript "BG:DS07486.3" Adh std3 splice3 2376676 2376677 . + . transcript "BG:DS07486.3" # # ### ### # # Adh std3 start_codon 1338783 1338785 . - . transcript "BG:DS03431.1" Adh std3 stop_codon 1334780 1334782 . - . transcript "BG:DS03431.1" Adh std3 CDS 1334780 1335024 . - . transcript "BG:DS03431.1" Adh std3 CDS 1335080 1335356 . - . transcript "BG:DS03431.1" Adh std3 CDS 1335416 1336157 . - . transcript "BG:DS03431.1" Adh std3 CDS 1336453 1336680 . - . transcript "BG:DS03431.1" Adh std3 CDS 1337668 1338007 . - . transcript "BG:DS03431.1" Adh std3 CDS 1338337 1338640 . - . transcript "BG:DS03431.1" Adh std3 CDS 1338702 1338785 . - . transcript "BG:DS03431.1" Adh std3 splice3 1335024 1335025 . - . transcript "BG:DS03431.1" Adh std3 splice5 1335079 1335080 . - . transcript "BG:DS03431.1" Adh std3 splice3 1335356 1335357 . - . transcript "BG:DS03431.1" Adh std3 splice5 1335415 1335416 . - . transcript "BG:DS03431.1" Adh std3 splice3 1336157 1336158 . - . transcript "BG:DS03431.1" Adh std3 splice5 1336452 1336453 . - . transcript "BG:DS03431.1" Adh std3 splice3 1336680 1336681 . - . transcript "BG:DS03431.1" Adh std3 splice5 1337667 1337668 . - . transcript "BG:DS03431.1" Adh std3 splice3 1338007 1338008 . - . transcript "BG:DS03431.1" Adh std3 splice5 1338336 1338337 . - . transcript "BG:DS03431.1" Adh std3 splice3 1338640 1338641 . - . transcript "BG:DS03431.1" Adh std3 splice5 1338701 1338702 . - . transcript "BG:DS03431.1" # # ### ### # # Adh std3 start_codon 1369280 1369282 . - . transcript "Mst35Ba" Adh std3 stop_codon 1368793 1368795 . - . transcript "Mst35Ba" Adh std3 CDS 1368793 1368852 . - . transcript "Mst35Ba" Adh std3 CDS 1368902 1369282 . - . transcript "Mst35Ba" Adh std3 splice3 1368852 1368853 . - . transcript "Mst35Ba" Adh std3 splice5 1368901 1368902 . - . transcript "Mst35Ba" # # ### ### # # Adh std3 start_codon 1372349 1372351 . - . transcript "Mst35Bb" Adh std3 stop_codon 1371813 1371815 . - . transcript "Mst35Bb" Adh std3 CDS 1371813 1371921 . - . transcript "Mst35Bb" Adh std3 CDS 1372020 1372351 . - . transcript "Mst35Bb" Adh std3 splice3 1371921 1371922 . - . transcript "Mst35Bb" Adh std3 splice5 1372019 1372020 . - . transcript "Mst35Bb" # # ### ### # # Adh std3 start_codon 1413065 1413067 . - . transcript "BG:DS03144.1" Adh std3 stop_codon 1398183 1398185 . - . transcript "BG:DS03144.1" Adh std3 CDS 1398183 1398833 . - . transcript "BG:DS03144.1" Adh std3 CDS 1401633 1401874 . - . transcript "BG:DS03144.1" Adh std3 CDS 1402535 1402643 . - . transcript "BG:DS03144.1" Adh std3 CDS 1402808 1402995 . - . transcript "BG:DS03144.1" Adh std3 CDS 1403930 1404111 . - . transcript "BG:DS03144.1" Adh std3 CDS 1405762 1405903 . - . transcript "BG:DS03144.1" Adh std3 CDS 1406801 1406882 . - . transcript "BG:DS03144.1" Adh std3 CDS 1407035 1407146 . - . transcript "BG:DS03144.1" Adh std3 CDS 1408830 1408932 . - . transcript "BG:DS03144.1" Adh std3 CDS 1411600 1411759 . - . transcript "BG:DS03144.1" Adh std3 CDS 1412611 1412741 . - . transcript "BG:DS03144.1" Adh std3 CDS 1413022 1413067 . - . transcript "BG:DS03144.1" Adh std3 splice3 1398833 1398834 . - . transcript "BG:DS03144.1" Adh std3 splice5 1401632 1401633 . - . transcript "BG:DS03144.1" Adh std3 splice3 1401874 1401875 . - . transcript "BG:DS03144.1" Adh std3 splice5 1402534 1402535 . - . transcript "BG:DS03144.1" Adh std3 splice3 1402643 1402644 . - . transcript "BG:DS03144.1" Adh std3 splice5 1402807 1402808 . - . transcript "BG:DS03144.1" Adh std3 splice3 1402995 1402996 . - . transcript "BG:DS03144.1" Adh std3 splice5 1403929 1403930 . - . transcript "BG:DS03144.1" Adh std3 splice3 1404111 1404112 . - . transcript "BG:DS03144.1" Adh std3 splice5 1405761 1405762 . - . transcript "BG:DS03144.1" Adh std3 splice3 1405903 1405904 . - . transcript "BG:DS03144.1" Adh std3 splice5 1406800 1406801 . - . transcript "BG:DS03144.1" Adh std3 splice3 1406882 1406883 . - . transcript "BG:DS03144.1" Adh std3 splice5 1407034 1407035 . - . transcript "BG:DS03144.1" Adh std3 splice3 1407146 1407147 . - . transcript "BG:DS03144.1" Adh std3 splice5 1408829 1408830 . - . transcript "BG:DS03144.1" Adh std3 splice3 1408932 1408933 . - . transcript "BG:DS03144.1" Adh std3 splice5 1411599 1411600 . - . transcript "BG:DS03144.1" Adh std3 splice3 1411759 1411760 . - . transcript "BG:DS03144.1" Adh std3 splice5 1412610 1412611 . - . transcript "BG:DS03144.1" Adh std3 splice3 1412741 1412742 . - . transcript "BG:DS03144.1" Adh std3 splice5 1413021 1413022 . - . transcript "BG:DS03144.1" # # ### ### # # Adh std3 start_codon 1111283 1111285 . + . transcript "Adhr" Adh std3 stop_codon 1112575 1112577 . + . transcript "Adhr" Adh std3 CDS 1111283 1111378 . + . transcript "Adhr" Adh std3 CDS 1111805 1112209 . + . transcript "Adhr" Adh std3 CDS 1112231 1112575 . + . transcript "Adhr" Adh std3 splice5 1111378 1111379 . + . transcript "Adhr" Adh std3 splice3 1111804 1111805 . + . transcript "Adhr" Adh std3 splice5 1112209 1112210 . + . transcript "Adhr" Adh std3 splice3 1112230 1112231 . + . transcript "Adhr" # # ### ### # # Adh std3 start_codon 1110074 1110076 . + . transcript "Adh" Adh std3 stop_codon 1110976 1110978 . + . transcript "Adh" Adh std3 CDS 1110074 1110172 . + . transcript "Adh" Adh std3 CDS 1110241 1110642 . + . transcript "Adh" Adh std3 CDS 1110713 1110976 . + . transcript "Adh" Adh std3 splice5 1109378 1109379 . + . transcript "Adh" Adh std3 splice3 1110073 1110074 . + . transcript "Adh" Adh std3 splice5 1110172 1110173 . + . transcript "Adh" Adh std3 splice3 1110240 1110241 . + . transcript "Adh" Adh std3 splice5 1110642 1110643 . + . transcript "Adh" Adh std3 splice3 1110712 1110713 . + . transcript "Adh" # # ### ### # # Adh std3 start_codon 1098516 1098518 . - . transcript "osp-LD14119" Adh std3 stop_codon 1094605 1094607 . - . transcript "osp-LD14119" Adh std3 CDS 1094605 1094610 . - . transcript "osp-LD14119" Adh std3 CDS 1095422 1095533 . - . transcript "osp-LD14119" Adh std3 CDS 1095586 1095735 . - . transcript "osp-LD14119" Adh std3 CDS 1095848 1095987 . - . transcript "osp-LD14119" Adh std3 CDS 1096062 1096196 . - . transcript "osp-LD14119" Adh std3 CDS 1096326 1098518 . - . transcript "osp-LD14119" Adh std3 splice3 1094610 1094611 . - . transcript "osp-LD14119" Adh std3 splice5 1095421 1095422 . - . transcript "osp-LD14119" Adh std3 splice3 1095533 1095534 . - . transcript "osp-LD14119" Adh std3 splice5 1095585 1095586 . - . transcript "osp-LD14119" Adh std3 splice3 1095735 1095736 . - . transcript "osp-LD14119" Adh std3 splice5 1095847 1095848 . - . transcript "osp-LD14119" Adh std3 splice3 1095987 1095988 . - . transcript "osp-LD14119" Adh std3 splice5 1096061 1096062 . - . transcript "osp-LD14119" Adh std3 splice3 1096196 1096197 . - . transcript "osp-LD14119" Adh std3 splice5 1096325 1096326 . - . transcript "osp-LD14119" # # ### ### # # Adh std3 start_codon 1057312 1057314 . - . transcript "BG:DS01486.1" Adh std3 stop_codon 1051748 1051750 . - . transcript "BG:DS01486.1" Adh std3 CDS 1051748 1051953 . - . transcript "BG:DS01486.1" Adh std3 CDS 1056915 1057314 . - . transcript "BG:DS01486.1" Adh std3 splice3 1051953 1051954 . - . transcript "BG:DS01486.1" Adh std3 splice5 1056914 1056915 . - . transcript "BG:DS01486.1" # # ### ### # # Adh std3 start_codon 855885 855887 . + . transcript "spel1" Adh std3 stop_codon 858964 858966 . + . transcript "spel1" Adh std3 CDS 855885 855923 . + . transcript "spel1" Adh std3 CDS 855983 855997 . + . transcript "spel1" Adh std3 CDS 855999 856031 . + . transcript "spel1" Adh std3 CDS 856092 856876 . + . transcript "spel1" Adh std3 CDS 856942 858028 . + . transcript "spel1" Adh std3 CDS 858108 858341 . + . transcript "spel1" Adh std3 CDS 858346 858966 . + . transcript "spel1" Adh std3 splice5 855923 855924 . + . transcript "spel1" Adh std3 splice3 855982 855983 . + . transcript "spel1" Adh std3 splice5 855997 855998 . + . transcript "spel1" Adh std3 splice3 855998 855999 . + . transcript "spel1" Adh std3 splice5 856031 856032 . + . transcript "spel1" Adh std3 splice3 856091 856092 . + . transcript "spel1" Adh std3 splice5 856876 856877 . + . transcript "spel1" Adh std3 splice3 856941 856942 . + . transcript "spel1" Adh std3 splice5 858028 858029 . + . transcript "spel1" Adh std3 splice3 858107 858108 . + . transcript "spel1" Adh std3 splice5 858341 858342 . + . transcript "spel1" Adh std3 splice3 858345 858346 . + . transcript "spel1" # # ### ### # # Adh std3 start_codon 2199762 2199764 . - . transcript "CycE-type2" Adh std3 stop_codon 2182498 2182500 . - . transcript "CycE-type2" Adh std3 CDS 2182500 2182662 . - . transcript "CycE-type2" Adh std3 CDS 2189454 2189790 . - . transcript "CycE-type2" Adh std3 CDS 2192599 2192735 . - . transcript "CycE-type2" Adh std3 CDS 2199660 2199764 . - . transcript "CycE-type2" Adh std3 splice3 2182662 2182663 . - . transcript "CycE-type2" Adh std3 splice5 2189453 2189454 . - . transcript "CycE-type2" Adh std3 splice3 2189790 2189791 . - . transcript "CycE-type2" Adh std3 splice5 2192598 2192599 . - . transcript "CycE-type2" Adh std3 splice3 2192735 2192736 . - . transcript "CycE-type2" Adh std3 splice5 2199659 2199660 . - . transcript "CycE-type2" # # ### ### # # Adh std3 start_codon 2918518 2918520 . - . transcript "dac-3prime" Adh std3 stop_codon 2916879 2916881 . - . transcript "dac-3prime" Adh std3 CDS 2916879 2917012 . - . transcript "dac-3prime" Adh std3 CDS 2917311 2917504 . - . transcript "dac-3prime" Adh std3 CDS 2917751 2917988 . - . transcript "dac-3prime" Adh std3 CDS 2918253 2918520 . - . transcript "dac-3prime" Adh std3 splice3 2917012 2917013 . - . transcript "dac-3prime" Adh std3 splice5 2917310 2917311 . - . transcript "dac-3prime" Adh std3 splice3 2917504 2917505 . - . transcript "dac-3prime" Adh std3 splice5 2917750 2917751 . - . transcript "dac-3prime" Adh std3 splice3 2917988 2917989 . - . transcript "dac-3prime" Adh std3 splice5 2918252 2918253 . - . transcript "dac-3prime" # # ### ### # # Adh std3 start_codon 1558057 1558059 . + . transcript "vas" Adh std3 stop_codon 1563812 1563814 . + . transcript "vas" Adh std3 CDS 1558057 1558080 . + . transcript "vas" Adh std3 CDS 1558134 1558526 . + . transcript "vas" Adh std3 CDS 1561988 1562050 . + . transcript "vas" Adh std3 CDS 1562027 1562278 . + . transcript "vas" Adh std3 CDS 1562338 1563081 . + . transcript "vas" Adh std3 CDS 1563140 1563353 . + . transcript "vas" Adh std3 CDS 1563418 1563689 . + . transcript "vas" Adh std3 CDS 1563761 1563814 . + . transcript "vas" Adh std3 splice5 1551433 1551434 . + . transcript "vas" Adh std3 splice3 1558032 1558033 . + . transcript "vas" Adh std3 splice5 1558080 1558081 . + . transcript "vas" Adh std3 splice3 1558133 1558134 . + . transcript "vas" Adh std3 splice5 1558526 1558527 . + . transcript "vas" Adh std3 splice3 1561987 1561988 . + . transcript "vas" Adh std3 splice5 1562050 1562051 . + . transcript "vas" Adh std3 splice3 1562026 1562027 . + . transcript "vas" Adh std3 splice5 1562278 1562279 . + . transcript "vas" Adh std3 splice3 1562337 1562338 . + . transcript "vas" Adh std3 splice5 1563081 1563082 . + . transcript "vas" Adh std3 splice3 1563139 1563140 . + . transcript "vas" Adh std3 splice5 1563353 1563354 . + . transcript "vas" Adh std3 splice3 1563417 1563418 . + . transcript "vas" Adh std3 splice5 1563689 1563690 . + . transcript "vas" Adh std3 splice3 1563760 1563761 . + . transcript "vas" # # ### ### # # Adh std3 start_codon 2390106 2390108 . - . transcript "beat-B" Adh std3 stop_codon 2356352 2356354 . - . transcript "beat-B" Adh std3 CDS 2356352 2356488 . - . transcript "beat-B" Adh std3 CDS 2356993 2357164 . - . transcript "beat-B" Adh std3 CDS 2357224 2357480 . - . transcript "beat-B" Adh std3 CDS 2357539 2357674 . - . transcript "beat-B" Adh std3 CDS 2358742 2358950 . - . transcript "beat-B" Adh std3 CDS 2390039 2390108 . - . transcript "beat-B" Adh std3 splice3 2356488 2356489 . - . transcript "beat-B" Adh std3 splice5 2356992 2356993 . - . transcript "beat-B" Adh std3 splice3 2357164 2357165 . - . transcript "beat-B" Adh std3 splice5 2357223 2357224 . - . transcript "beat-B" Adh std3 splice3 2357480 2357481 . - . transcript "beat-B" Adh std3 splice5 2357538 2357539 . - . transcript "beat-B" Adh std3 splice3 2357674 2357675 . - . transcript "beat-B" Adh std3 splice5 2358741 2358742 . - . transcript "beat-B" Adh std3 splice3 2358950 2358951 . - . transcript "beat-B" Adh std3 splice5 2390038 2390039 . - . transcript "beat-B" Adh std3 splice3 2390757 2390758 . - . transcript "beat-B" Adh std3 splice5 2411269 2411270 . - . transcript "beat-B" # # ### ### # # Adh std3 start_codon 2463394 2463396 . + . transcript "beat-C" Adh std3 stop_codon 2488787 2488789 . + . transcript "beat-C" Adh std3 CDS 2463394 2463547 . + . transcript "beat-C" Adh std3 CDS 2481639 2481850 . + . transcript "beat-C" Adh std3 CDS 2483447 2483582 . + . transcript "beat-C" Adh std3 CDS 2483839 2483972 . + . transcript "beat-C" Adh std3 CDS 2486400 2486522 . + . transcript "beat-C" Adh std3 CDS 2486596 2486785 . + . transcript "beat-C" Adh std3 CDS 2488134 2488789 . + . transcript "beat-C" Adh std3 splice5 2450535 2450536 . + . transcript "beat-C" Adh std3 splice3 2463205 2463206 . + . transcript "beat-C" Adh std3 splice5 2463547 2463548 . + . transcript "beat-C" Adh std3 splice3 2481638 2481639 . + . transcript "beat-C" Adh std3 splice5 2481850 2481851 . + . transcript "beat-C" Adh std3 splice3 2483446 2483447 . + . transcript "beat-C" Adh std3 splice5 2483582 2483583 . + . transcript "beat-C" Adh std3 splice3 2483838 2483839 . + . transcript "beat-C" Adh std3 splice5 2483972 2483973 . + . transcript "beat-C" Adh std3 splice3 2486399 2486400 . + . transcript "beat-C" Adh std3 splice5 2486522 2486523 . + . transcript "beat-C" Adh std3 splice3 2486595 2486596 . + . transcript "beat-C" Adh std3 splice5 2486785 2486786 . + . transcript "beat-C" Adh std3 splice3 2488133 2488134 . + . transcript "beat-C" # # ### ### # # Adh std3 start_codon 1182413 1182415 . - . transcript "osp" Adh std3 stop_codon 1094414 1094416 . - . transcript "osp" Adh std3 CDS 1094414 1094610 . - . transcript "osp" Adh std3 CDS 1094867 1095215 . - . transcript "osp" Adh std3 CDS 1095422 1095533 . - . transcript "osp" Adh std3 CDS 1095586 1095735 . - . transcript "osp" Adh std3 CDS 1095848 1095987 . - . transcript "osp" Adh std3 CDS 1096062 1096196 . - . transcript "osp" Adh std3 CDS 1096326 1098979 . - . transcript "osp" Adh std3 CDS 1104419 1104995 . - . transcript "osp" Adh std3 CDS 1105586 1105651 . - . transcript "osp" Adh std3 CDS 1129815 1129900 . - . transcript "osp" Adh std3 CDS 1182202 1182415 . - . transcript "osp" Adh std3 splice3 1094610 1094611 . - . transcript "osp" Adh std3 splice5 1094866 1094867 . - . transcript "osp" Adh std3 splice3 1095215 1095216 . - . transcript "osp" Adh std3 splice5 1095421 1095422 . - . transcript "osp" Adh std3 splice3 1095533 1095534 . - . transcript "osp" Adh std3 splice5 1095585 1095586 . - . transcript "osp" Adh std3 splice3 1095735 1095736 . - . transcript "osp" Adh std3 splice5 1095847 1095848 . - . transcript "osp" Adh std3 splice3 1095987 1095988 . - . transcript "osp" Adh std3 splice5 1096061 1096062 . - . transcript "osp" Adh std3 splice3 1096196 1096197 . - . transcript "osp" Adh std3 splice5 1096325 1096326 . - . transcript "osp" Adh std3 splice3 1098979 1098980 . - . transcript "osp" Adh std3 splice5 1104418 1104419 . - . transcript "osp" Adh std3 splice3 1104995 1104996 . - . transcript "osp" Adh std3 splice5 1105585 1105586 . - . transcript "osp" Adh std3 splice3 1105651 1105652 . - . transcript "osp" Adh std3 splice5 1129814 1129815 . - . transcript "osp" Adh std3 splice3 1129900 1129901 . - . transcript "osp" Adh std3 splice5 1182201 1182202 . - . transcript "osp" # # ### ### # # Adh std3 start_codon 691414 691416 . - . transcript "smi35A" Adh std3 stop_codon 679874 679876 . - . transcript "smi35A" Adh std3 CDS 679874 680889 . - . transcript "smi35A" Adh std3 CDS 682600 682771 . - . transcript "smi35A" Adh std3 CDS 682831 682969 . - . transcript "smi35A" Adh std3 CDS 689469 689746 . - . transcript "smi35A" Adh std3 CDS 689811 689983 . - . transcript "smi35A" Adh std3 CDS 690663 691029 . - . transcript "smi35A" Adh std3 CDS 691393 691416 . - . transcript "smi35A" Adh std3 splice3 680889 680890 . - . transcript "smi35A" Adh std3 splice5 682599 682600 . - . transcript "smi35A" Adh std3 splice3 682771 682772 . - . transcript "smi35A" Adh std3 splice5 682830 682831 . - . transcript "smi35A" Adh std3 splice3 682969 682970 . - . transcript "smi35A" Adh std3 splice5 689468 689469 . - . transcript "smi35A" Adh std3 splice3 689746 689747 . - . transcript "smi35A" Adh std3 splice5 689810 689811 . - . transcript "smi35A" Adh std3 splice3 689983 689984 . - . transcript "smi35A" Adh std3 splice5 690662 690663 . - . transcript "smi35A" Adh std3 splice3 691029 691030 . - . transcript "smi35A" Adh std3 splice5 691392 691393 . - . transcript "smi35A" Adh std3 splice3 691600 691601 . - . transcript "smi35A" Adh std3 splice5 710762 710763 . - . transcript "smi35A" Adh std3 splice3 710803 710804 . - . transcript "smi35A" Adh std3 splice5 715752 715753 . - . transcript "smi35A" Adh std3 splice3 715823 715824 . - . transcript "smi35A" Adh std3 splice5 727383 727384 . - . transcript "smi35A" # # ### ### # # Adh std3 start_codon 373286 373288 . + . transcript "BG:DS08220.1" Adh std3 stop_codon 391498 391500 . + . transcript "BG:DS08220.1" Adh std3 CDS 373286 373457 . + . transcript "BG:DS08220.1" Adh std3 CDS 385048 385283 . + . transcript "BG:DS08220.1" Adh std3 CDS 388780 388921 . + . transcript "BG:DS08220.1" Adh std3 CDS 389006 389140 . + . transcript "BG:DS08220.1" Adh std3 CDS 389208 390491 . + . transcript "BG:DS08220.1" Adh std3 CDS 390556 390673 . + . transcript "BG:DS08220.1" Adh std3 CDS 390737 391112 . + . transcript "BG:DS08220.1" Adh std3 CDS 391177 391500 . + . transcript "BG:DS08220.1" Adh std3 splice5 373457 373458 . + . transcript "BG:DS08220.1" Adh std3 splice3 385047 385048 . + . transcript "BG:DS08220.1" Adh std3 splice5 385283 385284 . + . transcript "BG:DS08220.1" Adh std3 splice3 388779 388780 . + . transcript "BG:DS08220.1" Adh std3 splice5 388921 388922 . + . transcript "BG:DS08220.1" Adh std3 splice3 389005 389006 . + . transcript "BG:DS08220.1" Adh std3 splice5 389140 389141 . + . transcript "BG:DS08220.1" Adh std3 splice3 389207 389208 . + . transcript "BG:DS08220.1" Adh std3 splice5 390491 390492 . + . transcript "BG:DS08220.1" Adh std3 splice3 390555 390556 . + . transcript "BG:DS08220.1" Adh std3 splice5 390673 390674 . + . transcript "BG:DS08220.1" Adh std3 splice3 390736 390737 . + . transcript "BG:DS08220.1" Adh std3 splice5 391112 391113 . + . transcript "BG:DS08220.1" Adh std3 splice3 391176 391177 . + . transcript "BG:DS08220.1" # # ### ### # # Adh std3 start_codon 509545 509547 . + . transcript "BG:DS01514.2" Adh std3 stop_codon 512756 512758 . + . transcript "BG:DS01514.2" Adh std3 CDS 509545 509783 . + . transcript "BG:DS01514.2" Adh std3 CDS 509881 510226 . + . transcript "BG:DS01514.2" Adh std3 CDS 510287 510786 . + . transcript "BG:DS01514.2" Adh std3 CDS 511784 512375 . + . transcript "BG:DS01514.2" Adh std3 CDS 512435 512758 . + . transcript "BG:DS01514.2" Adh std3 splice5 507666 507667 . + . transcript "BG:DS01514.2" Adh std3 splice3 509535 509536 . + . transcript "BG:DS01514.2" Adh std3 splice5 509783 509784 . + . transcript "BG:DS01514.2" Adh std3 splice3 509880 509881 . + . transcript "BG:DS01514.2" Adh std3 splice5 510226 510227 . + . transcript "BG:DS01514.2" Adh std3 splice3 510286 510287 . + . transcript "BG:DS01514.2" Adh std3 splice5 510786 510787 . + . transcript "BG:DS01514.2" Adh std3 splice3 511783 511784 . + . transcript "BG:DS01514.2" Adh std3 splice5 512375 512376 . + . transcript "BG:DS01514.2" Adh std3 splice3 512434 512435 . + . transcript "BG:DS01514.2" Adh std3 splice5 512758 512759 . + . transcript "BG:DS01514.2" Adh std3 splice3 512924 512925 . + . transcript "BG:DS01514.2" # # ### ### # # Adh std3 start_codon 1473633 1473635 . - . transcript "BG:DS01219.1" Adh std3 stop_codon 1465977 1465979 . - . transcript "BG:DS01219.1" Adh std3 CDS 1465977 1466019 . - . transcript "BG:DS01219.1" Adh std3 CDS 1466153 1466744 . - . transcript "BG:DS01219.1" Adh std3 CDS 1466876 1467307 . - . transcript "BG:DS01219.1" Adh std3 CDS 1473611 1473635 . - . transcript "BG:DS01219.1" Adh std3 splice3 1466019 1466020 . - . transcript "BG:DS01219.1" Adh std3 splice5 1466152 1466153 . - . transcript "BG:DS01219.1" Adh std3 splice3 1466744 1466745 . - . transcript "BG:DS01219.1" Adh std3 splice5 1466875 1466876 . - . transcript "BG:DS01219.1" Adh std3 splice3 1467307 1467308 . - . transcript "BG:DS01219.1" Adh std3 splice5 1473610 1473611 . - . transcript "BG:DS01219.1" Adh std3 splice3 1473745 1473746 . - . transcript "BG:DS01219.1" Adh std3 splice5 1473856 1473857 . - . transcript "BG:DS01219.1" Adh std3 splice3 1473914 1473915 . - . transcript "BG:DS01219.1" Adh std3 splice5 1483557 1483558 . - . transcript "BG:DS01219.1" Adh std3 splice3 1483699 1483700 . - . transcript "BG:DS01219.1" Adh std3 splice5 1487179 1487180 . - . transcript "BG:DS01219.1" # # ### ### # # Adh std3 start_codon 400338 400340 . + . transcript "Ance" Adh std3 stop_codon 402858 402860 . + . transcript "Ance" Adh std3 CDS 400338 400922 . + . transcript "Ance" Adh std3 CDS 401343 401713 . + . transcript "Ance" Adh std3 CDS 401775 402341 . + . transcript "Ance" Adh std3 CDS 402399 402539 . + . transcript "Ance" Adh std3 CDS 402607 402779 . + . transcript "Ance" Adh std3 CDS 402844 402860 . + . transcript "Ance" Adh std3 splice5 399469 399470 . + . transcript "Ance" Adh std3 splice3 400316 400317 . + . transcript "Ance" Adh std3 splice5 400922 400923 . + . transcript "Ance" Adh std3 splice3 401342 401343 . + . transcript "Ance" Adh std3 splice5 401713 401714 . + . transcript "Ance" Adh std3 splice3 401774 401775 . + . transcript "Ance" Adh std3 splice5 402341 402342 . + . transcript "Ance" Adh std3 splice3 402398 402399 . + . transcript "Ance" Adh std3 splice5 402539 402540 . + . transcript "Ance" Adh std3 splice3 402606 402607 . + . transcript "Ance" Adh std3 splice5 402779 402780 . + . transcript "Ance" Adh std3 splice3 402843 402844 . + . transcript "Ance" # # ### ### # # Adh std3 start_codon 7016 7018 . - . transcript "B4-5prime" Adh std3 stop_codon -1 1 . - . transcript "B4-5prime" Adh std3 CDS 1 441 . - . transcript "B4-5prime" Adh std3 CDS 2379 2862 . - . transcript "B4-5prime" Adh std3 CDS 3225 3550 . - . transcript "B4-5prime" Adh std3 CDS 6718 7018 . - . transcript "B4-5prime" Adh std3 splice3 441 442 . - . transcript "B4-5prime" Adh std3 splice5 2378 2379 . - . transcript "B4-5prime" Adh std3 splice3 2862 2863 . - . transcript "B4-5prime" Adh std3 splice5 3224 3225 . - . transcript "B4-5prime" Adh std3 splice3 3550 3551 . - . transcript "B4-5prime" Adh std3 splice5 6717 6718 . - . transcript "B4-5prime" Adh std3 splice3 7231 7232 . - . transcript "B4-5prime" Adh std3 splice5 28664 28665 . - . transcript "B4-5prime" Adh std3 splice3 28784 28785 . - . transcript "B4-5prime" Adh std3 splice5 40668 40669 . - . transcript "B4-5prime" Adh std3 splice3 40919 40920 . - . transcript "B4-5prime" Adh std3 splice5 42886 42887 . - . transcript "B4-5prime" # # ### ### # # Adh std3 start_codon 757457 757459 . + . transcript "wb" Adh std3 stop_codon 821485 821487 . + . transcript "wb" Adh std3 CDS 757457 757859 . + . transcript "wb" Adh std3 CDS 771955 772295 . + . transcript "wb" Adh std3 CDS 779692 781583 . + . transcript "wb" Adh std3 CDS 781886 782694 . + . transcript "wb" Adh std3 CDS 813291 814650 . + . transcript "wb" Adh std3 CDS 814726 814981 . + . transcript "wb" Adh std3 CDS 815046 815442 . + . transcript "wb" Adh std3 CDS 815528 817215 . + . transcript "wb" Adh std3 CDS 817273 818025 . + . transcript "wb" Adh std3 CDS 818086 818367 . + . transcript "wb" Adh std3 CDS 818447 818574 . + . transcript "wb" Adh std3 CDS 818633 819290 . + . transcript "wb" Adh std3 CDS 820171 820789 . + . transcript "wb" Adh std3 CDS 820846 820979 . + . transcript "wb" Adh std3 CDS 821037 821265 . + . transcript "wb" Adh std3 CDS 821333 821487 . + . transcript "wb" Adh std3 splice5 757859 757860 . + . transcript "wb" Adh std3 splice3 771954 771955 . + . transcript "wb" Adh std3 splice5 772295 772296 . + . transcript "wb" Adh std3 splice3 779691 779692 . + . transcript "wb" Adh std3 splice5 781583 781584 . + . transcript "wb" Adh std3 splice3 781885 781886 . + . transcript "wb" Adh std3 splice5 782694 782695 . + . transcript "wb" Adh std3 splice3 813290 813291 . + . transcript "wb" Adh std3 splice5 814650 814651 . + . transcript "wb" Adh std3 splice3 814725 814726 . + . transcript "wb" Adh std3 splice5 814981 814982 . + . transcript "wb" Adh std3 splice3 815045 815046 . + . transcript "wb" Adh std3 splice5 815442 815443 . + . transcript "wb" Adh std3 splice3 815527 815528 . + . transcript "wb" Adh std3 splice5 817215 817216 . + . transcript "wb" Adh std3 splice3 817272 817273 . + . transcript "wb" Adh std3 splice5 818025 818026 . + . transcript "wb" Adh std3 splice3 818085 818086 . + . transcript "wb" Adh std3 splice5 818367 818368 . + . transcript "wb" Adh std3 splice3 818446 818447 . + . transcript "wb" Adh std3 splice5 818574 818575 . + . transcript "wb" Adh std3 splice3 818632 818633 . + . transcript "wb" Adh std3 splice5 819290 819291 . + . transcript "wb" Adh std3 splice3 820170 820171 . + . transcript "wb" Adh std3 splice5 820789 820790 . + . transcript "wb" Adh std3 splice3 820845 820846 . + . transcript "wb" Adh std3 splice5 820979 820980 . + . transcript "wb" Adh std3 splice3 821036 821037 . + . transcript "wb" Adh std3 splice5 821265 821266 . + . transcript "wb" Adh std3 splice3 821332 821333 . + . transcript "wb" # # ### ### # # Adh std3 start_codon 487234 487236 . - . transcript "rk" Adh std3 stop_codon 477171 477173 . - . transcript "rk" Adh std3 CDS 477171 477490 . - . transcript "rk" Adh std3 CDS 477548 479329 . - . transcript "rk" Adh std3 CDS 479386 479783 . - . transcript "rk" Adh std3 CDS 479815 479958 . - . transcript "rk" Adh std3 CDS 480147 480287 . - . transcript "rk" Adh std3 CDS 480343 480480 . - . transcript "rk" Adh std3 CDS 481570 481638 . - . transcript "rk" Adh std3 CDS 483386 483457 . - . transcript "rk" Adh std3 CDS 484195 484338 . - . transcript "rk" Adh std3 CDS 484664 484806 . - . transcript "rk" Adh std3 CDS 486685 487236 . - . transcript "rk" Adh std3 splice3 477490 477491 . - . transcript "rk" Adh std3 splice5 477547 477548 . - . transcript "rk" Adh std3 splice3 479329 479330 . - . transcript "rk" Adh std3 splice5 479385 479386 . - . transcript "rk" Adh std3 splice3 479783 479784 . - . transcript "rk" Adh std3 splice5 479814 479815 . - . transcript "rk" Adh std3 splice3 479958 479959 . - . transcript "rk" Adh std3 splice5 480146 480147 . - . transcript "rk" Adh std3 splice3 480287 480288 . - . transcript "rk" Adh std3 splice5 480342 480343 . - . transcript "rk" Adh std3 splice3 480480 480481 . - . transcript "rk" Adh std3 splice5 481569 481570 . - . transcript "rk" Adh std3 splice3 481638 481639 . - . transcript "rk" Adh std3 splice5 483385 483386 . - . transcript "rk" Adh std3 splice3 483457 483458 . - . transcript "rk" Adh std3 splice5 484194 484195 . - . transcript "rk" Adh std3 splice3 484338 484339 . - . transcript "rk" Adh std3 splice5 484663 484664 . - . transcript "rk" Adh std3 splice3 484806 484807 . - . transcript "rk" Adh std3 splice5 486684 486685 . - . transcript "rk" # # ### # # compfly: 1. Only grailexp CDSes extracted Jul 5 (MR) # 2. grailexp "exons" renamed to "CDS" Jul 5 (MR) # Adh grailexp CDS 2 441 0.97 - 2 transcript "286" Adh grailexp CDS 2379 2862 0.99 - 0 transcript "286" Adh grailexp CDS 3225 3550 0.99 - 2 transcript "286" Adh grailexp CDS 6718 7051 0.10 - 0 transcript "286" Adh grailexp CDS 10137 10220 0.24 - 2 transcript "285" Adh grailexp CDS 12308 12333 0.14 - 2 transcript "285" Adh grailexp CDS 28665 28784 1.00 - 0 transcript "285" Adh grailexp CDS 40669 40919 1.00 - 0 transcript "285" Adh grailexp CDS 41509 41534 0.88 - 1 transcript "285" Adh grailexp CDS 43919 44175 0.93 + 1 transcript "1" Adh grailexp CDS 50851 50863 0.23 + 0 transcript "2" Adh grailexp CDS 52555 52587 0.92 + 0 transcript "2" Adh grailexp CDS 103543 103739 1.00 + 2 transcript "2" Adh grailexp CDS 103808 104330 0.99 + 0 transcript "2" Adh grailexp CDS 124458 124936 0.96 + 2 transcript "2" Adh grailexp CDS 127146 127292 0.99 + 2 transcript "2" Adh grailexp CDS 127771 127931 0.94 + 1 transcript "2" Adh grailexp CDS 127991 128225 0.98 + 2 transcript "2" Adh grailexp CDS 128296 129342 1.08 + 2 transcript "2" Adh grailexp CDS 129401 129965 0.95 + 0 transcript "2" Adh grailexp CDS 130136 130595 0.99 + 1 transcript "2" Adh grailexp CDS 130996 131248 0.25 + 2 transcript "2" Adh grailexp CDS 133608 134233 0.96 - 2 transcript "284" Adh grailexp CDS 134862 134967 0.90 - 0 transcript "284" Adh grailexp CDS 144038 144192 0.44 - 0 transcript "283" Adh grailexp CDS 152142 152293 0.11 - 1 transcript "283" Adh grailexp CDS 159578 160063 0.39 + 2 transcript "3" Adh grailexp CDS 161881 162105 0.45 + 2 transcript "4" Adh grailexp CDS 162442 162557 0.47 + 2 transcript "4" Adh grailexp CDS 162616 163137 0.91 + 2 transcript "4" Adh grailexp CDS 164190 164417 0.84 + 2 transcript "4" Adh grailexp CDS 165423 165438 0.27 + 0 transcript "5" Adh grailexp CDS 172385 172503 0.01 + 2 transcript "5" Adh grailexp CDS 177956 178015 0.46 - 0 transcript "282" Adh grailexp CDS 178136 178300 0.09 - 0 transcript "282" Adh grailexp CDS 181272 181409 0.47 - 0 transcript "282" Adh grailexp CDS 182855 182865 0.39 - 1 transcript "282" Adh grailexp CDS 183099 183496 0.15 - 2 transcript "281" Adh grailexp CDS 183596 183635 0.47 - 0 transcript "281" Adh grailexp CDS 183699 183764 0.47 - 2 transcript "281" Adh grailexp CDS 183835 184040 0.47 - 2 transcript "281" Adh grailexp CDS 184241 184282 0.47 - 0 transcript "281" Adh grailexp CDS 197142 197159 0.00 + 2 transcript "6" Adh grailexp CDS 198043 198089 0.00 + 1 transcript "6" Adh grailexp CDS 199993 200101 0.14 + 2 transcript "6" Adh grailexp CDS 202128 202655 0.40 + 2 transcript "7" Adh grailexp CDS 203783 204199 0.18 + 2 transcript "8" Adh grailexp CDS 207689 207889 0.23 - 2 transcript "280" Adh grailexp CDS 216144 216781 0.35 - 2 transcript "279" Adh grailexp CDS 216896 217226 0.98 - 0 transcript "279" Adh grailexp CDS 224554 224563 0.42 + 0 transcript "9" Adh grailexp CDS 228521 228608 0.01 + 1 transcript "9" Adh grailexp CDS 229799 230462 0.41 + 2 transcript "9" Adh grailexp CDS 233922 233943 0.04 + 0 transcript "10" Adh grailexp CDS 235893 235948 0.40 + 2 transcript "10" Adh grailexp CDS 236671 236983 0.38 + 0 transcript "11" Adh grailexp CDS 240124 240236 0.13 + 2 transcript "11" Adh grailexp CDS 260540 260687 0.27 + 0 transcript "12" Adh grailexp CDS 264891 264997 0.98 + 2 transcript "12" Adh grailexp CDS 265088 265825 0.93 + 2 transcript "12" Adh grailexp CDS 265946 266322 0.93 + 1 transcript "13" Adh grailexp CDS 266392 266619 0.93 + 1 transcript "13" Adh grailexp CDS 266684 266876 0.01 + 2 transcript "13" Adh grailexp CDS 267633 267650 0.21 + 2 transcript "14" Adh grailexp CDS 274487 274515 0.90 + 1 transcript "14" Adh grailexp CDS 274618 275276 0.98 + 0 transcript "14" Adh grailexp CDS 276806 276954 0.17 + 2 transcript "14" Adh grailexp CDS 277921 278103 0.14 + 2 transcript "15" Adh grailexp CDS 278222 278345 0.40 + 0 transcript "15" Adh grailexp CDS 278537 278737 0.46 + 0 transcript "15" Adh grailexp CDS 278802 279280 0.00 + 2 transcript "15" Adh grailexp CDS 280043 280339 0.34 + 2 transcript "16" Adh grailexp CDS 280420 280610 0.10 + 1 transcript "17" Adh grailexp CDS 280674 280986 0.47 + 2 transcript "17" Adh grailexp CDS 281550 281787 0.46 + 0 transcript "17" Adh grailexp CDS 281848 282471 0.90 + 0 transcript "17" Adh grailexp CDS 282539 283030 0.88 + 0 transcript "17" Adh grailexp CDS 283112 283545 0.21 + 2 transcript "17" Adh grailexp CDS 283609 284052 0.43 + 2 transcript "18" Adh grailexp CDS 285426 286886 1.28 + 2 transcript "19" Adh grailexp CDS 287629 288379 0.81 + 0 transcript "20" Adh grailexp CDS 288647 292689 1.47 + 2 transcript "20" Adh grailexp CDS 292759 292896 0.20 + 2 transcript "20" Adh grailexp CDS 302782 303519 0.85 - 2 transcript "278" Adh grailexp CDS 304326 305201 1.26 - 2 transcript "277" Adh grailexp CDS 305782 306108 0.41 + 2 transcript "21" Adh grailexp CDS 306230 306385 0.40 + 2 transcript "21" Adh grailexp CDS 307965 309056 0.98 + 2 transcript "22" Adh grailexp CDS 309110 309467 0.98 + 0 transcript "22" Adh grailexp CDS 309530 310452 1.19 + 2 transcript "22" Adh grailexp CDS 310517 311365 1.19 + 2 transcript "22" Adh grailexp CDS 311428 312318 1.19 + 2 transcript "22" Adh grailexp CDS 312387 313020 0.98 + 0 transcript "22" Adh grailexp CDS 313086 313533 0.99 + 1 transcript "22" Adh grailexp CDS 315138 315899 1.14 + 2 transcript "23" Adh grailexp CDS 316433 316800 1.00 + 1 transcript "23" Adh grailexp CDS 316865 317645 0.99 + 2 transcript "23" Adh grailexp CDS 317891 318548 0.40 - 2 transcript "276" Adh grailexp CDS 318608 319430 1.46 - 1 transcript "276" Adh grailexp CDS 319486 321442 1.41 - 0 transcript "276" Adh grailexp CDS 321967 323027 1.09 - 2 transcript "275" Adh grailexp CDS 323097 323169 0.85 - 0 transcript "275" Adh grailexp CDS 323788 324885 1.19 + 2 transcript "24" Adh grailexp CDS 324939 325181 0.97 + 2 transcript "24" Adh grailexp CDS 325801 326007 0.01 + 2 transcript "24" Adh grailexp CDS 327175 328002 1.46 + 2 transcript "25" Adh grailexp CDS 328076 328279 0.34 + 2 transcript "26" Adh grailexp CDS 328788 328808 0.15 + 2 transcript "27" Adh grailexp CDS 329781 330245 0.34 + 2 transcript "27" Adh grailexp CDS 334589 334786 0.96 - 2 transcript "274" Adh grailexp CDS 334847 335125 0.94 - 2 transcript "274" Adh grailexp CDS 335195 335261 0.94 - 2 transcript "274" Adh grailexp CDS 336668 337323 0.41 - 2 transcript "273" Adh grailexp CDS 337379 337457 0.35 - 0 transcript "273" Adh grailexp CDS 338167 338879 0.94 - 2 transcript "272" Adh grailexp CDS 338944 339013 0.83 - 0 transcript "272" Adh grailexp CDS 340529 340634 0.97 + 0 transcript "28" Adh grailexp CDS 340705 340870 0.99 + 1 transcript "28" Adh grailexp CDS 340926 341235 0.99 + 2 transcript "28" Adh grailexp CDS 341311 341517 0.01 + 2 transcript "29" Adh grailexp CDS 341713 341857 0.96 + 0 transcript "30" Adh grailexp CDS 342003 342751 0.94 + 2 transcript "30" Adh grailexp CDS 343169 343368 0.97 + 1 transcript "31" Adh grailexp CDS 343432 343984 0.91 + 2 transcript "31" Adh grailexp CDS 360105 360259 0.29 - 2 transcript "271" Adh grailexp CDS 366840 366849 0.27 - 0 transcript "271" Adh grailexp CDS 373286 373501 0.25 + 2 transcript "32" Adh grailexp CDS 379118 379228 0.43 + 2 transcript "33" Adh grailexp CDS 384164 384285 0.00 + 1 transcript "33" Adh grailexp CDS 385067 385283 0.42 + 2 transcript "33" Adh grailexp CDS 388780 388921 0.47 + 0 transcript "33" Adh grailexp CDS 389006 389140 0.42 + 0 transcript "33" Adh grailexp CDS 389208 390491 1.44 + 0 transcript "33" Adh grailexp CDS 390556 390673 0.47 + 1 transcript "33" Adh grailexp CDS 390737 391112 0.94 + 2 transcript "33" Adh grailexp CDS 391177 391500 0.97 + 2 transcript "33" Adh grailexp CDS 393573 393814 0.26 - 2 transcript "270" Adh grailexp CDS 393894 394052 0.47 - 0 transcript "270" Adh grailexp CDS 394383 395732 1.47 - 0 transcript "270" Adh grailexp CDS 396240 397468 0.88 - 0 transcript "270" Adh grailexp CDS 397532 397682 0.99 - 1 transcript "270" Adh grailexp CDS 398149 398170 0.86 - 0 transcript "270" Adh grailexp CDS 399405 399469 0.94 + 2 transcript "34" Adh grailexp CDS 400317 400923 1.00 + 0 transcript "34" Adh grailexp CDS 401350 401713 0.98 + 1 transcript "34" Adh grailexp CDS 401775 402341 0.98 + 1 transcript "34" Adh grailexp CDS 402399 402539 0.98 + 1 transcript "34" Adh grailexp CDS 402607 402779 0.99 + 0 transcript "34" Adh grailexp CDS 402844 402923 0.96 + 2 transcript "34" Adh grailexp CDS 403468 404414 1.45 + 1 transcript "35" Adh grailexp CDS 404467 405027 0.45 + 1 transcript "35" Adh grailexp CDS 405085 405391 0.41 + 2 transcript "35" Adh grailexp CDS 405952 406314 0.38 + 2 transcript "36" Adh grailexp CDS 408759 409001 0.17 + 2 transcript "37" Adh grailexp CDS 409150 409656 0.20 + 2 transcript "37" Adh grailexp CDS 410157 410315 0.47 + 2 transcript "37" Adh grailexp CDS 410372 410612 0.46 + 0 transcript "37" Adh grailexp CDS 410677 411479 0.24 + 2 transcript "37" Adh grailexp CDS 415576 416211 0.41 - 2 transcript "269" Adh grailexp CDS 416276 416749 0.44 - 2 transcript "269" Adh grailexp CDS 417100 417111 0.39 - 2 transcript "269" Adh grailexp CDS 426746 427525 1.52 - 2 transcript "268" Adh grailexp CDS 438979 439790 1.10 - 2 transcript "267" Adh grailexp CDS 440839 440877 0.93 - 0 transcript "267" Adh grailexp CDS 441148 441210 0.94 - 0 transcript "267" Adh grailexp CDS 448467 448607 0.46 + 1 transcript "38" Adh grailexp CDS 449015 449330 0.41 + 2 transcript "38" Adh grailexp CDS 451600 451902 0.43 + 2 transcript "39" Adh grailexp CDS 454581 454771 0.15 + 1 transcript "39" Adh grailexp CDS 454999 455702 0.46 + 0 transcript "39" Adh grailexp CDS 455870 456267 0.40 + 2 transcript "39" Adh grailexp CDS 457298 457488 0.97 + 1 transcript "40" Adh grailexp CDS 457649 458210 0.94 + 2 transcript "40" Adh grailexp CDS 458837 459146 0.94 - 2 transcript "266" Adh grailexp CDS 459225 459761 0.97 - 1 transcript "266" Adh grailexp CDS 460256 460674 0.96 - 1 transcript "266" Adh grailexp CDS 462092 462584 0.41 - 2 transcript "265" Adh grailexp CDS 462646 463209 0.87 - 1 transcript "265" Adh grailexp CDS 463368 463710 0.99 - 1 transcript "265" Adh grailexp CDS 464878 465028 0.02 - 0 transcript "265" Adh grailexp CDS 466308 466360 0.40 - 2 transcript "264" Adh grailexp CDS 467993 469610 1.40 - 0 transcript "264" Adh grailexp CDS 471217 471296 0.95 + 1 transcript "41" Adh grailexp CDS 471441 471687 1.00 + 2 transcript "41" Adh grailexp CDS 471752 471856 0.98 + 2 transcript "41" Adh grailexp CDS 471944 472072 0.93 + 2 transcript "41" Adh grailexp CDS 472557 472823 0.47 + 0 transcript "41" Adh grailexp CDS 472965 473128 0.41 + 2 transcript "41" Adh grailexp CDS 474097 474189 0.43 + 2 transcript "42" Adh grailexp CDS 474251 474306 0.42 + 1 transcript "42" Adh grailexp CDS 474365 475283 1.44 + 2 transcript "42" Adh grailexp CDS 475427 476389 1.41 + 2 transcript "42" Adh grailexp CDS 477516 479329 1.25 - 2 transcript "263" Adh grailexp CDS 479386 479753 0.43 - 0 transcript "263" Adh grailexp CDS 479815 479958 0.47 - 1 transcript "263" Adh grailexp CDS 480147 480287 0.23 - 1 transcript "263" Adh grailexp CDS 480343 480480 0.20 - 1 transcript "263" Adh grailexp CDS 481570 481638 0.47 - 1 transcript "263" Adh grailexp CDS 484191 484338 0.40 - 2 transcript "262" Adh grailexp CDS 484664 484807 0.07 - 1 transcript "262" Adh grailexp CDS 485391 485462 0.43 - 1 transcript "262" Adh grailexp CDS 486686 487236 0.43 - 1 transcript "262" Adh grailexp CDS 497485 497503 0.12 + 0 transcript "43" Adh grailexp CDS 498635 499041 0.20 + 2 transcript "43" Adh grailexp CDS 510550 510756 0.11 - 2 transcript "261" Adh grailexp CDS 511962 512174 0.35 - 2 transcript "260" Adh grailexp CDS 513238 514050 1.44 - 2 transcript "259" Adh grailexp CDS 520781 521854 1.43 + 2 transcript "44" Adh grailexp CDS 522083 522988 1.46 + 2 transcript "45" Adh grailexp CDS 523495 523560 0.01 + 2 transcript "46" Adh grailexp CDS 528139 528231 0.14 + 2 transcript "46" Adh grailexp CDS 533735 533935 0.32 - 2 transcript "258" Adh grailexp CDS 541380 542513 0.68 + 2 transcript "47" Adh grailexp CDS 550841 550865 0.10 + 0 transcript "48" Adh grailexp CDS 555313 555854 0.33 + 2 transcript "48" Adh grailexp CDS 555938 556001 0.85 + 1 transcript "49" Adh grailexp CDS 558033 558061 0.82 + 0 transcript "49" Adh grailexp CDS 562333 562460 0.01 + 2 transcript "49" Adh grailexp CDS 566659 566706 0.10 + 2 transcript "50" Adh grailexp CDS 570329 570745 0.81 + 2 transcript "50" Adh grailexp CDS 574810 574871 0.45 + 1 transcript "51" Adh grailexp CDS 575409 575495 0.46 + 0 transcript "51" Adh grailexp CDS 593768 594158 0.17 + 1 transcript "51" Adh grailexp CDS 596802 596826 0.20 + 2 transcript "51" Adh grailexp CDS 598466 598796 0.17 + 0 transcript "51" Adh grailexp CDS 598857 599119 0.07 + 2 transcript "51" Adh grailexp CDS 599219 600433 1.26 + 2 transcript "51" Adh grailexp CDS 602240 602541 0.99 - 1 transcript "257" Adh grailexp CDS 602686 602889 1.00 - 2 transcript "257" Adh grailexp CDS 602944 603000 0.80 - 2 transcript "257" Adh grailexp CDS 603442 604269 0.26 - 2 transcript "256" Adh grailexp CDS 607042 607320 0.10 - 2 transcript "256" Adh grailexp CDS 615930 615946 0.14 + 1 transcript "52" Adh grailexp CDS 618724 618820 0.29 + 2 transcript "52" Adh grailexp CDS 635696 636034 0.35 - 2 transcript "255" Adh grailexp CDS 639175 639609 0.35 + 2 transcript "53" Adh grailexp CDS 650611 651153 0.47 + 2 transcript "54" Adh grailexp CDS 651278 651478 0.46 + 2 transcript "54" Adh grailexp CDS 651583 652290 0.41 + 2 transcript "54" Adh grailexp CDS 652417 652824 0.46 + 2 transcript "55" Adh grailexp CDS 657691 658001 0.41 - 2 transcript "254" Adh grailexp CDS 658058 658265 0.47 - 0 transcript "254" Adh grailexp CDS 658326 658463 0.47 - 2 transcript "254" Adh grailexp CDS 658526 660852 1.47 - 2 transcript "254" Adh grailexp CDS 660917 661331 0.18 - 0 transcript "254" Adh grailexp CDS 679874 680889 1.40 - 2 transcript "253" Adh grailexp CDS 682600 682771 0.89 - 0 transcript "253" Adh grailexp CDS 682831 682969 0.99 - 2 transcript "253" Adh grailexp CDS 689469 689746 0.98 - 1 transcript "253" Adh grailexp CDS 689811 689983 0.47 - 2 transcript "253" Adh grailexp CDS 690663 691029 0.12 - 0 transcript "253" Adh grailexp CDS 692030 692155 0.36 - 2 transcript "253" Adh grailexp CDS 704015 704227 0.35 - 2 transcript "252" Adh grailexp CDS 753588 753630 0.00 + 0 transcript "56" Adh grailexp CDS 754035 754129 0.17 + 2 transcript "56" Adh grailexp CDS 756663 756872 0.25 + 2 transcript "56" Adh grailexp CDS 757457 757873 0.45 + 2 transcript "57" Adh grailexp CDS 761650 761710 0.15 + 0 transcript "58" Adh grailexp CDS 771955 772295 0.47 + 2 transcript "58" Adh grailexp CDS 779692 781583 1.47 + 1 transcript "58" Adh grailexp CDS 781886 782694 1.47 + 0 transcript "58" Adh grailexp CDS 784197 784313 0.17 + 2 transcript "58" Adh grailexp CDS 788837 788917 0.24 - 2 transcript "251" Adh grailexp CDS 793158 793275 0.01 - 2 transcript "251" Adh grailexp CDS 796518 796758 0.12 - 0 transcript "251" Adh grailexp CDS 801924 802961 1.42 + 2 transcript "59" Adh grailexp CDS 813257 814650 1.41 + 1 transcript "60" Adh grailexp CDS 814726 814981 0.17 + 2 transcript "60" Adh grailexp CDS 815046 815442 0.43 + 0 transcript "60" Adh grailexp CDS 815528 817215 1.47 + 2 transcript "60" Adh grailexp CDS 817273 818025 0.47 + 2 transcript "60" Adh grailexp CDS 818086 818367 0.47 + 2 transcript "60" Adh grailexp CDS 818424 818574 0.47 + 1 transcript "60" Adh grailexp CDS 818633 819290 0.47 + 2 transcript "60" Adh grailexp CDS 820237 820789 0.17 + 0 transcript "60" Adh grailexp CDS 820846 820979 0.47 + 2 transcript "60" Adh grailexp CDS 821037 821265 0.43 + 0 transcript "60" Adh grailexp CDS 821333 821487 0.33 + 2 transcript "60" Adh grailexp CDS 822205 822454 0.17 + 0 transcript "61" Adh grailexp CDS 822511 822848 0.47 + 2 transcript "61" Adh grailexp CDS 822907 824011 1.15 + 0 transcript "61" Adh grailexp CDS 824074 824822 1.29 + 2 transcript "61" Adh grailexp CDS 824885 825688 0.35 + 2 transcript "61" Adh grailexp CDS 825804 826427 0.40 + 2 transcript "61" Adh grailexp CDS 826905 826921 0.13 + 1 transcript "62" Adh grailexp CDS 827148 827511 0.40 + 2 transcript "62" Adh grailexp CDS 828047 828306 0.45 + 1 transcript "63" Adh grailexp CDS 832925 832961 0.76 + 2 transcript "63" Adh grailexp CDS 833184 833672 0.09 + 2 transcript "63" Adh grailexp CDS 835107 835316 0.04 + 2 transcript "64" Adh grailexp CDS 836389 837106 0.43 + 0 transcript "65" Adh grailexp CDS 837173 837428 0.45 + 1 transcript "65" Adh grailexp CDS 837486 837859 0.98 + 0 transcript "65" Adh grailexp CDS 837919 838152 0.99 + 0 transcript "65" Adh grailexp CDS 838217 839076 1.15 + 2 transcript "65" Adh grailexp CDS 842968 843225 0.09 - 2 transcript "250" Adh grailexp CDS 843445 843518 0.45 - 2 transcript "250" Adh grailexp CDS 843799 843808 0.43 - 0 transcript "250" Adh grailexp CDS 846397 847365 1.46 - 2 transcript "249" Adh grailexp CDS 847429 848154 0.41 - 2 transcript "248" Adh grailexp CDS 848208 848609 0.99 - 2 transcript "248" Adh grailexp CDS 848668 848733 0.83 - 2 transcript "248" Adh grailexp CDS 848914 849209 0.99 + 0 transcript "66" Adh grailexp CDS 851077 851190 0.98 + 0 transcript "66" Adh grailexp CDS 851256 851436 0.98 + 1 transcript "66" Adh grailexp CDS 851491 851673 0.98 + 1 transcript "66" Adh grailexp CDS 851742 851919 0.91 + 2 transcript "66" Adh grailexp CDS 853119 855014 1.46 + 2 transcript "67" Adh grailexp CDS 855874 855922 0.86 + 0 transcript "68" Adh grailexp CDS 855982 856031 0.93 + 2 transcript "68" Adh grailexp CDS 856092 856876 0.99 + 1 transcript "68" Adh grailexp CDS 856942 858029 1.19 + 0 transcript "68" Adh grailexp CDS 858109 858395 0.84 + 2 transcript "68" Adh grailexp CDS 872557 872818 1.00 - 2 transcript "247" Adh grailexp CDS 872891 873131 0.99 - 1 transcript "247" Adh grailexp CDS 873191 873321 0.97 - 0 transcript "247" Adh grailexp CDS 873388 873527 0.93 - 1 transcript "247" Adh grailexp CDS 873583 874093 0.98 - 2 transcript "247" Adh grailexp CDS 874278 874541 1.00 - 1 transcript "247" Adh grailexp CDS 875601 875650 0.40 - 1 transcript "247" Adh grailexp CDS 884916 885806 1.20 - 2 transcript "246" Adh grailexp CDS 885881 886798 1.31 - 2 transcript "245" Adh grailexp CDS 905992 906071 0.35 - 1 transcript "245" Adh grailexp CDS 910874 911134 0.36 + 2 transcript "69" Adh grailexp CDS 918151 918795 0.41 - 2 transcript "244" Adh grailexp CDS 924200 924223 0.16 - 2 transcript "244" Adh grailexp CDS 934224 934243 0.00 + 1 transcript "70" Adh grailexp CDS 939589 939736 0.23 + 2 transcript "70" Adh grailexp CDS 944218 944493 0.80 - 2 transcript "243" Adh grailexp CDS 977804 978046 0.18 - 2 transcript "242" Adh grailexp CDS 984981 985070 0.82 + 2 transcript "71" Adh grailexp CDS 985373 986896 1.11 + 2 transcript "71" Adh grailexp CDS 1002359 1002471 0.28 - 2 transcript "241" Adh grailexp CDS 1003293 1003371 0.38 - 0 transcript "241" Adh grailexp CDS 1008067 1008249 0.10 - 2 transcript "240" Adh grailexp CDS 1015766 1015937 0.43 - 0 transcript "240" Adh grailexp CDS 1027037 1027195 0.14 - 2 transcript "239" Adh grailexp CDS 1029588 1029621 0.44 - 0 transcript "239" Adh grailexp CDS 1037169 1037252 0.15 - 2 transcript "238" Adh grailexp CDS 1041564 1041989 0.46 - 2 transcript "238" Adh grailexp CDS 1042386 1042688 0.45 - 2 transcript "238" Adh grailexp CDS 1043593 1043695 0.34 - 2 transcript "237" Adh grailexp CDS 1050773 1050821 0.01 - 0 transcript "237" Adh grailexp CDS 1056874 1057139 0.43 + 1 transcript "72" Adh grailexp CDS 1063610 1063766 0.04 + 2 transcript "72" Adh grailexp CDS 1075064 1075169 0.26 + 0 transcript "73" Adh grailexp CDS 1075573 1075695 0.02 + 0 transcript "73" Adh grailexp CDS 1078475 1078592 0.34 + 1 transcript "73" Adh grailexp CDS 1081755 1081896 0.06 + 2 transcript "73" Adh grailexp CDS 1088388 1088588 0.12 + 2 transcript "73" Adh grailexp CDS 1090024 1090389 0.27 + 2 transcript "73" Adh grailexp CDS 1095422 1095533 0.47 - 2 transcript "236" Adh grailexp CDS 1095586 1095735 0.43 - 1 transcript "236" Adh grailexp CDS 1095848 1095987 0.47 - 1 transcript "236" Adh grailexp CDS 1096326 1098971 1.47 - 2 transcript "236" Adh grailexp CDS 1101376 1101526 0.41 - 1 transcript "236" Adh grailexp CDS 1104419 1104995 0.46 - 0 transcript "236" Adh grailexp CDS 1105586 1105651 0.47 - 2 transcript "236" Adh grailexp CDS 1109286 1109378 0.98 + 2 transcript "74" Adh grailexp CDS 1110038 1110172 0.99 + 2 transcript "74" Adh grailexp CDS 1110238 1110642 0.99 + 2 transcript "74" Adh grailexp CDS 1110713 1110979 0.41 + 2 transcript "74" Adh grailexp CDS 1111805 1112209 0.97 + 2 transcript "75" Adh grailexp CDS 1112261 1112578 0.95 + 2 transcript "75" Adh grailexp CDS 1128664 1128863 0.25 - 2 transcript "235" Adh grailexp CDS 1129815 1129895 0.46 - 2 transcript "235" Adh grailexp CDS 1145411 1145429 0.45 + 0 transcript "76" Adh grailexp CDS 1145597 1145940 0.19 + 2 transcript "76" Adh grailexp CDS 1154838 1154848 0.41 + 1 transcript "77" Adh grailexp CDS 1168731 1168947 0.23 + 2 transcript "77" Adh grailexp CDS 1182164 1182430 0.01 - 2 transcript "234" Adh grailexp CDS 1185401 1185439 0.12 - 2 transcript "234" Adh grailexp CDS 1191250 1191269 0.36 + 1 transcript "78" Adh grailexp CDS 1207666 1207953 0.41 + 2 transcript "78" Adh grailexp CDS 1220426 1221762 1.41 - 2 transcript "233" Adh grailexp CDS 1222288 1222395 0.07 - 0 transcript "233" Adh grailexp CDS 1229684 1230733 1.41 + 2 transcript "79" Adh grailexp CDS 1231115 1231348 0.86 + 2 transcript "80" Adh grailexp CDS 1232958 1232969 0.81 + 2 transcript "81" Adh grailexp CDS 1233044 1233280 0.95 + 2 transcript "81" Adh grailexp CDS 1241714 1241776 0.38 - 2 transcript "232" Adh grailexp CDS 1244068 1244083 0.29 - 0 transcript "232" Adh grailexp CDS 1250633 1251421 0.88 + 2 transcript "82" Adh grailexp CDS 1252523 1253617 1.42 + 2 transcript "83" Adh grailexp CDS 1255669 1256823 1.43 + 2 transcript "84" Adh grailexp CDS 1271377 1272140 0.18 - 2 transcript "231" Adh grailexp CDS 1272217 1272395 0.46 - 0 transcript "231" Adh grailexp CDS 1273008 1273498 0.14 - 1 transcript "231" Adh grailexp CDS 1286168 1286225 0.26 + 0 transcript "85" Adh grailexp CDS 1291182 1291348 0.10 + 2 transcript "85" Adh grailexp CDS 1293718 1294187 0.98 - 1 transcript "230" Adh grailexp CDS 1297137 1297250 0.98 - 2 transcript "230" Adh grailexp CDS 1297317 1297352 0.90 - 2 transcript "230" Adh grailexp CDS 1308376 1308414 0.22 - 2 transcript "230" Adh grailexp CDS 1334780 1335024 0.92 - 2 transcript "229" Adh grailexp CDS 1335080 1335356 0.37 - 0 transcript "229" Adh grailexp CDS 1335416 1336157 0.45 - 2 transcript "229" Adh grailexp CDS 1336482 1336720 0.99 - 2 transcript "229" Adh grailexp CDS 1338337 1338640 0.93 - 0 transcript "229" Adh grailexp CDS 1338702 1338804 0.96 - 2 transcript "229" Adh grailexp CDS 1361484 1361548 0.12 - 1 transcript "229" Adh grailexp CDS 1365101 1365361 0.06 - 2 transcript "228" Adh grailexp CDS 1365421 1365611 0.26 - 2 transcript "228" Adh grailexp CDS 1365666 1365762 0.46 - 0 transcript "228" Adh grailexp CDS 1368707 1369303 0.94 - 2 transcript "228" Adh grailexp CDS 1371200 1371270 0.91 - 2 transcript "228" Adh grailexp CDS 1371783 1372372 0.98 - 0 transcript "228" Adh grailexp CDS 1373266 1373367 0.98 - 1 transcript "228" Adh grailexp CDS 1376588 1376598 0.39 - 1 transcript "228" Adh grailexp CDS 1379912 1380009 0.74 + 2 transcript "86" Adh grailexp CDS 1398183 1398911 0.42 - 2 transcript "227" Adh grailexp CDS 1401594 1401874 0.02 - 2 transcript "226" Adh grailexp CDS 1402451 1402460 0.40 - 0 transcript "226" Adh grailexp CDS 1402512 1402643 0.32 - 2 transcript "225" Adh grailexp CDS 1402808 1402995 0.06 - 2 transcript "225" Adh grailexp CDS 1406801 1406882 0.46 - 0 transcript "225" Adh grailexp CDS 1407035 1407146 0.01 - 2 transcript "225" Adh grailexp CDS 1408830 1408924 0.40 - 1 transcript "225" Adh grailexp CDS 1414397 1418081 1.41 + 0 transcript "87" Adh grailexp CDS 1418142 1419321 1.46 + 1 transcript "87" Adh grailexp CDS 1419378 1419918 0.39 + 2 transcript "87" Adh grailexp CDS 1424156 1424376 0.16 - 1 transcript "224" Adh grailexp CDS 1424531 1424676 0.47 - 2 transcript "224" Adh grailexp CDS 1425549 1425752 0.36 - 0 transcript "224" Adh grailexp CDS 1426168 1426281 0.42 - 0 transcript "224" Adh grailexp CDS 1428573 1428690 0.37 - 2 transcript "224" Adh grailexp CDS 1431180 1431306 0.37 - 1 transcript "224" Adh grailexp CDS 1439418 1439478 0.43 - 0 transcript "224" Adh grailexp CDS 1445532 1445710 0.46 + 2 transcript "88" Adh grailexp CDS 1448592 1448623 0.18 + 0 transcript "88" Adh grailexp CDS 1450916 1451020 0.45 + 0 transcript "88" Adh grailexp CDS 1465981 1466019 0.47 - 1 transcript "223" Adh grailexp CDS 1466153 1466744 0.91 - 1 transcript "223" Adh grailexp CDS 1466876 1467307 0.91 - 0 transcript "223" Adh grailexp CDS 1469347 1469359 0.39 - 0 transcript "223" Adh grailexp CDS 1470304 1470339 0.10 - 1 transcript "222" Adh grailexp CDS 1473611 1473745 0.99 - 1 transcript "222" Adh grailexp CDS 1473857 1473914 0.94 - 1 transcript "222" Adh grailexp CDS 1483558 1483694 0.99 - 0 transcript "222" Adh grailexp CDS 1487171 1487198 0.90 - 1 transcript "222" Adh grailexp CDS 1495402 1495535 1.00 + 2 transcript "89" Adh grailexp CDS 1495620 1495919 0.99 + 2 transcript "89" Adh grailexp CDS 1495977 1496171 0.46 + 2 transcript "89" Adh grailexp CDS 1497570 1498121 0.93 + 2 transcript "89" Adh grailexp CDS 1499670 1500914 1.12 + 2 transcript "90" Adh grailexp CDS 1510747 1510998 0.43 + 2 transcript "91" Adh grailexp CDS 1515041 1515175 0.46 + 2 transcript "91" Adh grailexp CDS 1515266 1515436 0.38 + 2 transcript "91" Adh grailexp CDS 1515498 1515714 0.20 + 0 transcript "91" Adh grailexp CDS 1515807 1515972 0.47 + 1 transcript "91" Adh grailexp CDS 1516036 1516279 0.32 + 2 transcript "91" Adh grailexp CDS 1516339 1516527 0.29 + 2 transcript "91" Adh grailexp CDS 1518399 1518939 0.14 + 0 transcript "92" Adh grailexp CDS 1520081 1520337 0.30 + 2 transcript "92" Adh grailexp CDS 1520398 1520535 0.47 + 2 transcript "92" Adh grailexp CDS 1521654 1521834 0.47 + 0 transcript "92" Adh grailexp CDS 1525228 1525447 0.98 + 1 transcript "92" Adh grailexp CDS 1526237 1526669 0.95 + 2 transcript "92" Adh grailexp CDS 1527062 1527379 0.03 + 2 transcript "93" Adh grailexp CDS 1529846 1529971 0.91 + 2 transcript "94" Adh grailexp CDS 1530746 1531626 0.93 + 1 transcript "94" Adh grailexp CDS 1531685 1531910 0.85 + 2 transcript "94" Adh grailexp CDS 1535341 1535461 0.40 - 2 transcript "221" Adh grailexp CDS 1535530 1535642 0.32 - 1 transcript "221" Adh grailexp CDS 1536067 1537150 1.35 - 2 transcript "220" Adh grailexp CDS 1537212 1538662 1.46 - 1 transcript "220" Adh grailexp CDS 1538719 1541113 1.47 - 2 transcript "220" Adh grailexp CDS 1541178 1541378 0.47 - 1 transcript "220" Adh grailexp CDS 1541445 1541794 0.89 - 1 transcript "220" Adh grailexp CDS 1542125 1542385 0.98 - 2 transcript "220" Adh grailexp CDS 1543067 1543173 0.98 - 2 transcript "220" Adh grailexp CDS 1547319 1547461 0.98 - 0 transcript "220" Adh grailexp CDS 1547681 1547715 0.40 - 1 transcript "220" Adh grailexp CDS 1549142 1550017 1.15 - 2 transcript "219" Adh grailexp CDS 1550084 1550149 0.76 - 2 transcript "219" Adh grailexp CDS 1551361 1551433 0.94 + 1 transcript "95" Adh grailexp CDS 1558033 1558080 0.94 + 1 transcript "95" Adh grailexp CDS 1558134 1558572 0.90 + 2 transcript "95" Adh grailexp CDS 1558642 1559747 1.37 + 1 transcript "96" Adh grailexp CDS 1561989 1562278 0.93 + 2 transcript "96" Adh grailexp CDS 1562338 1563081 0.94 + 2 transcript "96" Adh grailexp CDS 1563140 1563353 0.99 + 0 transcript "96" Adh grailexp CDS 1563418 1563689 0.98 + 2 transcript "96" Adh grailexp CDS 1565272 1565547 0.33 + 2 transcript "97" Adh grailexp CDS 1566588 1566621 0.33 + 0 transcript "98" Adh grailexp CDS 1576691 1576943 0.47 + 1 transcript "98" Adh grailexp CDS 1577036 1577406 0.47 + 0 transcript "98" Adh grailexp CDS 1580846 1580880 0.15 + 2 transcript "98" Adh grailexp CDS 1580946 1581227 0.20 + 2 transcript "98" Adh grailexp CDS 1581294 1581623 0.26 + 2 transcript "98" Adh grailexp CDS 1581774 1582136 0.46 + 2 transcript "98" Adh grailexp CDS 1582201 1582292 0.47 + 1 transcript "98" Adh grailexp CDS 1584621 1584828 0.43 + 0 transcript "98" Adh grailexp CDS 1584949 1585094 0.47 + 2 transcript "98" Adh grailexp CDS 1585153 1585380 0.40 + 2 transcript "98" Adh grailexp CDS 1599218 1600177 1.45 + 2 transcript "99" Adh grailexp CDS 1601744 1602565 1.35 + 2 transcript "99" Adh grailexp CDS 1603706 1603885 0.82 + 2 transcript "100" Adh grailexp CDS 1603951 1604326 1.00 + 0 transcript "100" Adh grailexp CDS 1605059 1605404 0.15 + 1 transcript "100" Adh grailexp CDS 1605651 1606718 1.19 + 1 transcript "100" Adh grailexp CDS 1606791 1607142 0.98 + 2 transcript "100" Adh grailexp CDS 1607205 1607306 0.86 + 2 transcript "100" Adh grailexp CDS 1624417 1624528 0.43 + 0 transcript "101" Adh grailexp CDS 1626928 1626998 0.26 + 2 transcript "101" Adh grailexp CDS 1627913 1627973 0.00 - 2 transcript "218" Adh grailexp CDS 1630351 1630487 0.43 - 1 transcript "218" Adh grailexp CDS 1634224 1634411 0.01 - 2 transcript "217" Adh grailexp CDS 1634782 1634821 0.43 - 0 transcript "217" Adh grailexp CDS 1641652 1641718 0.42 + 1 transcript "102" Adh grailexp CDS 1644188 1644362 0.31 + 2 transcript "102" Adh grailexp CDS 1651072 1651167 0.40 - 2 transcript "216" Adh grailexp CDS 1651337 1651403 0.41 - 2 transcript "216" Adh grailexp CDS 1653232 1653414 0.40 - 2 transcript "215" Adh grailexp CDS 1653857 1657133 1.47 - 2 transcript "215" Adh grailexp CDS 1657232 1657441 0.47 - 1 transcript "215" Adh grailexp CDS 1661045 1661184 0.32 - 1 transcript "215" Adh grailexp CDS 1667548 1667970 0.45 - 2 transcript "214" Adh grailexp CDS 1700818 1701162 0.09 - 2 transcript "213" Adh grailexp CDS 1717339 1717472 0.01 - 2 transcript "212" Adh grailexp CDS 1719195 1719342 0.47 - 0 transcript "212" Adh grailexp CDS 1719504 1720005 0.46 - 2 transcript "212" Adh grailexp CDS 1726256 1726435 0.92 - 1 transcript "212" Adh grailexp CDS 1730116 1730236 0.92 - 1 transcript "212" Adh grailexp CDS 1731062 1731172 0.99 - 0 transcript "212" Adh grailexp CDS 1735826 1736004 0.99 - 0 transcript "212" Adh grailexp CDS 1737215 1737294 0.95 - 1 transcript "212" Adh grailexp CDS 1738791 1739218 0.92 + 1 transcript "103" Adh grailexp CDS 1740300 1740540 0.46 + 2 transcript "103" Adh grailexp CDS 1740659 1740939 0.47 + 1 transcript "103" Adh grailexp CDS 1740995 1742042 1.47 + 2 transcript "103" Adh grailexp CDS 1742104 1742487 0.36 + 2 transcript "103" Adh grailexp CDS 1744620 1745915 1.46 - 2 transcript "211" Adh grailexp CDS 1746561 1746743 0.01 - 2 transcript "210" Adh grailexp CDS 1747451 1747777 0.45 - 2 transcript "210" Adh grailexp CDS 1748111 1748361 0.36 - 2 transcript "209" Adh grailexp CDS 1748434 1748590 0.00 - 0 transcript "209" Adh grailexp CDS 1751370 1751492 0.45 - 2 transcript "209" Adh grailexp CDS 1751564 1751652 0.18 - 2 transcript "209" Adh grailexp CDS 1752053 1752278 0.10 - 0 transcript "209" Adh grailexp CDS 1752622 1752780 0.47 - 2 transcript "209" Adh grailexp CDS 1752984 1753054 0.00 - 2 transcript "209" Adh grailexp CDS 1753136 1753316 0.85 - 0 transcript "209" Adh grailexp CDS 1753422 1753778 0.95 - 2 transcript "209" Adh grailexp CDS 1756026 1756178 0.41 - 2 transcript "208" Adh grailexp CDS 1756248 1756386 0.47 - 2 transcript "208" Adh grailexp CDS 1756448 1756671 0.21 - 1 transcript "208" Adh grailexp CDS 1756788 1756939 0.05 - 2 transcript "207" Adh grailexp CDS 1757005 1757119 0.46 - 0 transcript "207" Adh grailexp CDS 1757182 1757352 0.46 - 2 transcript "207" Adh grailexp CDS 1757415 1757585 0.47 - 2 transcript "207" Adh grailexp CDS 1757648 1758409 1.00 - 2 transcript "207" Adh grailexp CDS 1758473 1758856 0.99 - 2 transcript "207" Adh grailexp CDS 1760557 1760795 0.99 - 2 transcript "207" Adh grailexp CDS 1763921 1764042 0.94 - 2 transcript "206" Adh grailexp CDS 1764272 1764501 0.97 - 0 transcript "206" Adh grailexp CDS 1764574 1764638 0.82 - 1 transcript "206" Adh grailexp CDS 1774679 1775557 1.40 + 2 transcript "104" Adh grailexp CDS 1780341 1780544 0.10 - 2 transcript "205" Adh grailexp CDS 1781148 1781825 0.39 - 2 transcript "205" Adh grailexp CDS 1787599 1788915 1.40 + 2 transcript "105" Adh grailexp CDS 1790433 1790449 0.38 + 1 transcript "106" Adh grailexp CDS 1792246 1792331 0.10 + 0 transcript "106" Adh grailexp CDS 1792606 1792631 0.43 + 1 transcript "107" Adh grailexp CDS 1798592 1798702 0.35 + 2 transcript "107" Adh grailexp CDS 1807761 1808498 0.44 - 2 transcript "204" Adh grailexp CDS 1823746 1825158 1.45 + 2 transcript "108" Adh grailexp CDS 1826351 1826373 0.13 + 1 transcript "109" Adh grailexp CDS 1833915 1834002 0.12 + 2 transcript "109" Adh grailexp CDS 1850930 1851241 0.06 + 2 transcript "110" Adh grailexp CDS 1852974 1853126 0.01 + 2 transcript "110" Adh grailexp CDS 1884141 1884464 0.03 - 2 transcript "203" Adh grailexp CDS 1885049 1885144 0.43 - 2 transcript "203" Adh grailexp CDS 1886301 1886571 0.19 - 2 transcript "203" Adh grailexp CDS 1891981 1892003 0.45 - 1 transcript "203" Adh grailexp CDS 1908356 1908441 0.24 - 2 transcript "202" Adh grailexp CDS 1909292 1909323 0.02 - 0 transcript "202" Adh grailexp CDS 1912285 1912316 0.38 - 1 transcript "202" Adh grailexp CDS 1913374 1914932 1.02 - 2 transcript "201" Adh grailexp CDS 1914995 1915082 0.43 - 0 transcript "201" Adh grailexp CDS 1921206 1921230 0.42 + 0 transcript "111" Adh grailexp CDS 1922996 1924563 1.15 + 2 transcript "111" Adh grailexp CDS 1936726 1937031 0.35 + 2 transcript "112" Adh grailexp CDS 1938049 1938118 0.77 + 0 transcript "113" Adh grailexp CDS 1950791 1951201 0.32 - 2 transcript "200" Adh grailexp CDS 1951455 1951541 0.12 - 2 transcript "200" Adh grailexp CDS 1961881 1961901 0.32 + 2 transcript "114" Adh grailexp CDS 1962476 1962516 0.41 + 2 transcript "114" Adh grailexp CDS 1963364 1963651 0.31 + 2 transcript "115" Adh grailexp CDS 1966586 1967758 1.40 - 2 transcript "199" Adh grailexp CDS 1970601 1970641 0.30 + 1 transcript "116" Adh grailexp CDS 1974454 1975018 0.34 + 2 transcript "116" Adh grailexp CDS 1988872 1989075 0.87 + 2 transcript "117" Adh grailexp CDS 1991768 1992688 0.92 + 2 transcript "117" Adh grailexp CDS 1992942 1993204 0.22 + 1 transcript "117" Adh grailexp CDS 1993350 1993566 0.41 + 2 transcript "117" Adh grailexp CDS 2008029 2008162 0.14 - 2 transcript "198" Adh grailexp CDS 2010059 2010091 0.33 - 2 transcript "198" Adh grailexp CDS 2038745 2038806 0.17 + 1 transcript "118" Adh grailexp CDS 2040432 2040693 0.14 + 2 transcript "118" Adh grailexp CDS 2068604 2070501 1.45 + 1 transcript "119" Adh grailexp CDS 2071510 2072677 1.41 + 2 transcript "119" Adh grailexp CDS 2074630 2074665 0.38 + 2 transcript "120" Adh grailexp CDS 2074911 2075113 0.01 + 2 transcript "120" Adh grailexp CDS 2076918 2077326 0.85 + 0 transcript "121" Adh grailexp CDS 2091428 2091590 0.38 + 0 transcript "121" Adh grailexp CDS 2100551 2101336 0.42 - 2 transcript "197" Adh grailexp CDS 2102169 2102647 0.15 - 2 transcript "196" Adh grailexp CDS 2102776 2102797 0.10 - 0 transcript "196" Adh grailexp CDS 2103622 2104169 0.39 - 2 transcript "195" Adh grailexp CDS 2104226 2104442 0.20 - 0 transcript "195" Adh grailexp CDS 2105170 2105720 0.41 - 2 transcript "194" Adh grailexp CDS 2109817 2109901 0.26 - 0 transcript "194" Adh grailexp CDS 2118483 2118551 0.43 + 2 transcript "122" Adh grailexp CDS 2118614 2119161 0.41 + 2 transcript "122" Adh grailexp CDS 2119844 2120025 0.19 + 1 transcript "123" Adh grailexp CDS 2120092 2120194 0.47 + 2 transcript "123" Adh grailexp CDS 2120312 2121269 1.47 + 0 transcript "123" Adh grailexp CDS 2121336 2121745 0.41 + 2 transcript "123" Adh grailexp CDS 2137486 2137679 0.39 - 2 transcript "193" Adh grailexp CDS 2137746 2137902 0.47 - 0 transcript "193" Adh grailexp CDS 2137961 2138116 0.17 - 2 transcript "193" Adh grailexp CDS 2138186 2138671 0.42 - 2 transcript "193" Adh grailexp CDS 2138733 2138994 0.35 - 2 transcript "193" Adh grailexp CDS 2139065 2139169 0.47 - 1 transcript "193" Adh grailexp CDS 2139824 2140056 0.06 - 1 transcript "193" Adh grailexp CDS 2140148 2140353 0.15 - 2 transcript "193" Adh grailexp CDS 2140417 2140630 0.43 - 0 transcript "193" Adh grailexp CDS 2140705 2141412 0.41 - 2 transcript "192" Adh grailexp CDS 2141468 2141749 0.43 - 2 transcript "192" Adh grailexp CDS 2141998 2142465 0.41 - 2 transcript "192" Adh grailexp CDS 2145807 2145957 0.12 + 0 transcript "124" Adh grailexp CDS 2148796 2148854 0.17 + 2 transcript "124" Adh grailexp CDS 2149292 2149510 0.13 + 2 transcript "125" Adh grailexp CDS 2149741 2150907 1.41 + 2 transcript "125" Adh grailexp CDS 2161195 2161276 0.00 - 2 transcript "191" Adh grailexp CDS 2167365 2167477 0.38 - 1 transcript "191" Adh grailexp CDS 2180707 2180982 0.41 - 2 transcript "190" Adh grailexp CDS 2181100 2181325 0.98 - 2 transcript "190" Adh grailexp CDS 2181392 2182662 1.19 - 1 transcript "190" Adh grailexp CDS 2182828 2183604 0.97 - 2 transcript "190" Adh grailexp CDS 2189454 2189790 0.92 - 2 transcript "190" Adh grailexp CDS 2192598 2192725 0.99 - 1 transcript "190" Adh grailexp CDS 2199659 2199945 0.97 - 2 transcript "190" Adh grailexp CDS 2204183 2205278 1.37 + 0 transcript "126" Adh grailexp CDS 2205332 2207403 1.28 + 2 transcript "126" Adh grailexp CDS 2208830 2209531 0.99 - 1 transcript "189" Adh grailexp CDS 2209593 2209904 0.98 - 1 transcript "189" Adh grailexp CDS 2209967 2211186 1.19 - 1 transcript "189" Adh grailexp CDS 2211243 2211671 0.98 - 2 transcript "189" Adh grailexp CDS 2212036 2212168 0.94 - 2 transcript "189" Adh grailexp CDS 2212228 2212400 1.00 - 1 transcript "189" Adh grailexp CDS 2214395 2214568 0.97 - 2 transcript "189" Adh grailexp CDS 2216396 2217064 0.46 - 2 transcript "188" Adh grailexp CDS 2218461 2218494 0.40 - 2 transcript "187" Adh grailexp CDS 2218559 2218905 0.47 - 1 transcript "187" Adh grailexp CDS 2218966 2219871 0.98 - 2 transcript "187" Adh grailexp CDS 2219932 2220057 0.89 - 2 transcript "187" Adh grailexp CDS 2220565 2221536 1.44 - 2 transcript "186" Adh grailexp CDS 2222253 2222379 0.34 - 2 transcript "185" Adh grailexp CDS 2222435 2222667 0.21 - 1 transcript "185" Adh grailexp CDS 2222723 2222818 0.43 - 2 transcript "185" Adh grailexp CDS 2223403 2223577 0.46 - 2 transcript "185" Adh grailexp CDS 2223854 2224248 0.43 - 1 transcript "185" Adh grailexp CDS 2229177 2229218 0.44 - 2 transcript "185" Adh grailexp CDS 2231491 2231742 0.35 - 2 transcript "184" Adh grailexp CDS 2288700 2288778 0.23 - 2 transcript "183" Adh grailexp CDS 2295145 2295194 0.41 - 1 transcript "183" Adh grailexp CDS 2301891 2301939 0.15 + 0 transcript "127" Adh grailexp CDS 2303428 2304641 1.32 + 2 transcript "127" Adh grailexp CDS 2305038 2305397 0.95 + 2 transcript "128" Adh grailexp CDS 2305489 2305763 0.92 + 1 transcript "128" Adh grailexp CDS 2305829 2306951 1.41 + 2 transcript "128" Adh grailexp CDS 2315767 2315925 0.22 - 2 transcript "182" Adh grailexp CDS 2315991 2316098 0.07 - 2 transcript "182" Adh grailexp CDS 2327989 2328098 0.40 - 2 transcript "181" Adh grailexp CDS 2328611 2329261 0.20 - 2 transcript "181" Adh grailexp CDS 2329400 2329967 0.01 - 2 transcript "181" Adh grailexp CDS 2330026 2330181 0.21 - 1 transcript "181" Adh grailexp CDS 2333741 2333787 0.01 - 1 transcript "181" Adh grailexp CDS 2339377 2340420 1.41 - 2 transcript "180" Adh grailexp CDS 2340535 2341630 1.38 - 2 transcript "180" Adh grailexp CDS 2342664 2343851 1.41 - 1 transcript "180" Adh grailexp CDS 2348069 2348214 0.26 - 1 transcript "180" Adh grailexp CDS 2351716 2352026 0.36 - 2 transcript "179" Adh grailexp CDS 2352080 2353052 1.45 - 0 transcript "179" Adh grailexp CDS 2356272 2356488 0.30 - 2 transcript "178" Adh grailexp CDS 2357535 2357674 0.44 - 1 transcript "178" Adh grailexp CDS 2358742 2358953 0.46 - 2 transcript "178" Adh grailexp CDS 2365992 2366304 0.30 - 0 transcript "178" Adh grailexp CDS 2374085 2374294 0.99 + 2 transcript "129" Adh grailexp CDS 2374356 2375075 0.84 + 2 transcript "129" Adh grailexp CDS 2391780 2391944 0.04 + 2 transcript "129" Adh grailexp CDS 2392181 2392737 0.41 + 1 transcript "130" Adh grailexp CDS 2392800 2393095 0.21 + 0 transcript "130" Adh grailexp CDS 2408036 2408288 0.34 + 0 transcript "131" Adh grailexp CDS 2420842 2420985 0.28 + 2 transcript "131" Adh grailexp CDS 2428833 2429381 0.45 + 2 transcript "132" Adh grailexp CDS 2441963 2441976 0.40 + 1 transcript "133" Adh grailexp CDS 2443533 2443755 0.38 + 2 transcript "133" Adh grailexp CDS 2444164 2444213 0.43 + 1 transcript "134" Adh grailexp CDS 2445792 2445848 0.47 + 1 transcript "134" Adh grailexp CDS 2465772 2465965 0.43 + 1 transcript "135" Adh grailexp CDS 2481639 2481850 0.47 + 2 transcript "135" Adh grailexp CDS 2483447 2483582 0.46 + 0 transcript "135" Adh grailexp CDS 2483839 2483972 0.17 + 2 transcript "135" Adh grailexp CDS 2484693 2484860 0.14 + 2 transcript "135" Adh grailexp CDS 2486400 2486522 0.43 + 2 transcript "135" Adh grailexp CDS 2486596 2486808 0.36 + 2 transcript "135" Adh grailexp CDS 2493314 2493620 0.44 + 0 transcript "136" Adh grailexp CDS 2493682 2493731 0.46 + 2 transcript "136" Adh grailexp CDS 2494047 2494116 0.23 + 0 transcript "136" Adh grailexp CDS 2494568 2494651 0.82 + 2 transcript "137" Adh grailexp CDS 2495100 2495225 0.99 + 2 transcript "137" Adh grailexp CDS 2495286 2495667 0.99 + 0 transcript "137" Adh grailexp CDS 2495783 2496988 1.23 + 0 transcript "137" Adh grailexp CDS 2497217 2497464 0.41 + 2 transcript "137" Adh grailexp CDS 2505511 2505601 0.97 + 0 transcript "138" Adh grailexp CDS 2524357 2524565 0.96 + 2 transcript "138" Adh grailexp CDS 2525929 2526064 1.00 + 0 transcript "138" Adh grailexp CDS 2527415 2527548 0.97 + 2 transcript "138" Adh grailexp CDS 2529073 2529195 0.99 + 2 transcript "138" Adh grailexp CDS 2529260 2529455 0.97 + 0 transcript "138" Adh grailexp CDS 2539877 2540172 0.02 + 2 transcript "138" Adh grailexp CDS 2544295 2545203 1.16 + 2 transcript "139" Adh grailexp CDS 2554306 2554403 0.36 + 1 transcript "140" Adh grailexp CDS 2591868 2591903 0.90 + 1 transcript "140" Adh grailexp CDS 2591970 2592084 0.98 + 2 transcript "140" Adh grailexp CDS 2595035 2595504 0.97 + 1 transcript "140" Adh grailexp CDS 2596999 2597040 0.26 + 2 transcript "141" Adh grailexp CDS 2597544 2597725 0.10 + 2 transcript "141" Adh grailexp CDS 2599727 2599883 0.18 + 0 transcript "142" Adh grailexp CDS 2601492 2601517 0.46 + 2 transcript "142" Adh grailexp CDS 2619911 2620307 0.99 + 1 transcript "142" Adh grailexp CDS 2621231 2622507 1.19 + 0 transcript "142" Adh grailexp CDS 2622578 2622803 0.99 + 1 transcript "142" Adh grailexp CDS 2622977 2623082 0.99 + 2 transcript "142" Adh grailexp CDS 2623316 2623455 0.98 + 1 transcript "142" Adh grailexp CDS 2623675 2623781 0.91 + 0 transcript "142" Adh grailexp CDS 2624114 2624266 0.95 + 0 transcript "142" Adh grailexp CDS 2624694 2624875 1.00 + 2 transcript "142" Adh grailexp CDS 2624976 2625495 0.98 + 0 transcript "142" Adh grailexp CDS 2625559 2625784 0.98 + 1 transcript "142" Adh grailexp CDS 2625851 2626065 0.99 + 0 transcript "142" Adh grailexp CDS 2626124 2626333 0.99 + 2 transcript "142" Adh grailexp CDS 2626392 2626510 0.93 + 1 transcript "142" Adh grailexp CDS 2626595 2626653 0.89 + 0 transcript "142" Adh grailexp CDS 2627634 2627751 1.00 + 1 transcript "142" Adh grailexp CDS 2628166 2628295 0.90 + 2 transcript "142" Adh grailexp CDS 2628460 2628626 0.99 + 1 transcript "142" Adh grailexp CDS 2628718 2628805 0.97 + 2 transcript "142" Adh grailexp CDS 2629398 2629505 1.00 + 2 transcript "142" Adh grailexp CDS 2632038 2632090 0.94 + 1 transcript "142" Adh grailexp CDS 2632152 2632298 0.99 + 1 transcript "142" Adh grailexp CDS 2632363 2632834 0.99 + 2 transcript "142" Adh grailexp CDS 2632889 2632972 0.97 + 2 transcript "142" Adh grailexp CDS 2633028 2633337 0.98 + 0 transcript "142" Adh grailexp CDS 2633397 2633645 0.98 + 2 transcript "142" Adh grailexp CDS 2633706 2634365 0.98 + 2 transcript "142" Adh grailexp CDS 2634452 2634885 0.98 + 1 transcript "142" Adh grailexp CDS 2635370 2635410 0.93 + 0 transcript "142" Adh grailexp CDS 2638284 2638414 0.99 + 2 transcript "142" Adh grailexp CDS 2638470 2639006 0.92 + 2 transcript "142" Adh grailexp CDS 2660848 2661318 0.43 + 2 transcript "143" Adh grailexp CDS 2661378 2662319 1.41 + 2 transcript "143" Adh grailexp CDS 2671764 2671896 0.20 + 0 transcript "144" Adh grailexp CDS 2675909 2676030 0.06 + 2 transcript "144" Adh grailexp CDS 2681334 2681494 0.33 + 1 transcript "145" Adh grailexp CDS 2684880 2686209 1.47 + 2 transcript "145" Adh grailexp CDS 2686394 2686570 0.42 + 2 transcript "145" Adh grailexp CDS 2686628 2686705 0.01 + 2 transcript "145" Adh grailexp CDS 2686770 2687146 0.47 + 1 transcript "145" Adh grailexp CDS 2687211 2687359 0.10 + 0 transcript "145" Adh grailexp CDS 2687415 2687920 0.33 + 2 transcript "145" Adh grailexp CDS 2687988 2688296 0.17 + 2 transcript "145" Adh grailexp CDS 2688464 2688913 0.39 + 2 transcript "146" Adh grailexp CDS 2696335 2696446 1.00 - 2 transcript "177" Adh grailexp CDS 2696513 2696644 0.98 - 1 transcript "177" Adh grailexp CDS 2697858 2698028 0.88 - 2 transcript "177" Adh grailexp CDS 2707300 2707439 1.00 + 2 transcript "147" Adh grailexp CDS 2707509 2708522 1.10 + 2 transcript "147" Adh grailexp CDS 2709485 2710765 1.12 - 2 transcript "176" Adh grailexp CDS 2710851 2710951 0.98 - 2 transcript "176" Adh grailexp CDS 2714781 2716277 1.41 - 2 transcript "175" Adh grailexp CDS 2723585 2723607 0.27 - 1 transcript "175" Adh grailexp CDS 2728054 2728418 0.30 - 2 transcript "174" Adh grailexp CDS 2728802 2728830 0.38 - 0 transcript "174" Adh grailexp CDS 2736358 2736953 0.98 - 1 transcript "174" Adh grailexp CDS 2737860 2738132 0.99 + 0 transcript "148" Adh grailexp CDS 2738403 2739055 0.88 + 2 transcript "148" Adh grailexp CDS 2739266 2739461 0.03 + 0 transcript "148" Adh grailexp CDS 2739531 2740039 0.41 + 2 transcript "148" Adh grailexp CDS 2740542 2741090 0.45 + 2 transcript "149" Adh grailexp CDS 2741907 2742007 0.39 + 1 transcript "150" Adh grailexp CDS 2742269 2742500 0.21 + 2 transcript "150" Adh grailexp CDS 2744187 2745122 1.46 + 2 transcript "151" Adh grailexp CDS 2751337 2751465 0.83 - 2 transcript "173" Adh grailexp CDS 2751521 2751711 0.99 - 2 transcript "173" Adh grailexp CDS 2752612 2752742 0.93 + 1 transcript "152" Adh grailexp CDS 2752822 2752985 1.00 + 0 transcript "152" Adh grailexp CDS 2753042 2753322 0.85 + 2 transcript "152" Adh grailexp CDS 2754205 2754364 0.00 + 0 transcript "152" Adh grailexp CDS 2757391 2757589 0.91 + 0 transcript "153" Adh grailexp CDS 2757658 2758391 0.98 + 2 transcript "153" Adh grailexp CDS 2759770 2759892 0.00 + 2 transcript "154" Adh grailexp CDS 2760394 2760672 0.87 + 2 transcript "154" Adh grailexp CDS 2760766 2761087 0.98 + 0 transcript "154" Adh grailexp CDS 2761141 2762087 1.41 + 2 transcript "154" Adh grailexp CDS 2762287 2762710 0.99 - 0 transcript "172" Adh grailexp CDS 2763711 2763968 0.99 - 2 transcript "172" Adh grailexp CDS 2764030 2764118 0.97 - 2 transcript "172" Adh grailexp CDS 2772220 2772430 0.99 - 0 transcript "172" Adh grailexp CDS 2772600 2772777 0.99 - 2 transcript "172" Adh grailexp CDS 2773593 2774314 1.00 - 1 transcript "172" Adh grailexp CDS 2774754 2774927 0.99 - 2 transcript "172" Adh grailexp CDS 2776641 2777045 0.37 - 2 transcript "171" Adh grailexp CDS 2777390 2777609 0.41 - 2 transcript "170" Adh grailexp CDS 2777672 2778309 0.94 - 1 transcript "170" Adh grailexp CDS 2783806 2783886 0.28 - 2 transcript "170" Adh grailexp CDS 2786756 2787069 0.20 - 2 transcript "169" Adh grailexp CDS 2788407 2788454 0.12 - 0 transcript "169" Adh grailexp CDS 2788808 2789066 0.40 - 0 transcript "169" Adh grailexp CDS 2789139 2789567 0.38 - 2 transcript "168" Adh grailexp CDS 2792074 2792601 0.18 - 2 transcript "167" Adh grailexp CDS 2793626 2798713 1.37 - 2 transcript "166" Adh grailexp CDS 2804442 2805730 1.08 - 2 transcript "165" Adh grailexp CDS 2805800 2805903 0.98 - 0 transcript "165" Adh grailexp CDS 2815178 2815845 0.41 + 1 transcript "155" Adh grailexp CDS 2819863 2819929 0.40 + 2 transcript "155" Adh grailexp CDS 2849428 2849790 0.96 + 1 transcript "156" Adh grailexp CDS 2853764 2853994 0.97 + 1 transcript "156" Adh grailexp CDS 2854193 2855213 1.29 - 2 transcript "164" Adh grailexp CDS 2857635 2857663 0.17 - 1 transcript "164" Adh grailexp CDS 2860250 2860510 0.14 - 2 transcript "163" Adh grailexp CDS 2865306 2865339 0.32 - 0 transcript "163" Adh grailexp CDS 2871295 2871404 0.38 + 1 transcript "157" Adh grailexp CDS 2874237 2874469 0.18 + 0 transcript "157" Adh grailexp CDS 2884684 2884926 0.36 - 2 transcript "162" Adh grailexp CDS 2890670 2890686 0.45 + 1 transcript "158" Adh grailexp CDS 2894625 2895247 0.93 + 0 transcript "158" Adh grailexp CDS 2895319 2895977 0.92 + 2 transcript "158" Adh grailexp CDS 2896655 2896763 0.92 + 0 transcript "158" Adh grailexp CDS 2898444 2899001 0.98 + 0 transcript "158" Adh grailexp CDS 2899061 2899716 0.96 + 2 transcript "158" Adh grailexp CDS 2900448 2900565 0.94 + 0 transcript "159" Adh grailexp CDS 2900634 2901185 0.97 + 0 transcript "159" Adh grailexp CDS 2901452 2902107 0.93 + 2 transcript "159" Adh grailexp CDS 2910098 2910173 0.04 - 0 transcript "161" Adh grailexp CDS 2911759 2911898 0.45 - 2 transcript "161" Adh grailexp CDS 2914999 2915119 0.43 - 0 transcript "161" Adh grailexp CDS 2916879 2917012 0.41 - 2 transcript "160" Adh grailexp CDS 2917311 2917504 0.47 - 0 transcript "160" Adh grailexp CDS 2917751 2917988 0.98 - 1 transcript "160" Adh grailexp CDS 2918253 2918513 0.98 - 0 transcript "160" Adh grailexp CDS 2918684 2918711 0.33 - 0 transcript "160" # GeneMarkHMM Adh GeneMarkHMM splice5 53 54 . - . transcript "1" Adh GeneMarkHMM CDS 54 441 . - . transcript "1" Adh GeneMarkHMM splice3 441 442 . - . transcript "1" Adh GeneMarkHMM splice5 2378 2379 . - . transcript "1" Adh GeneMarkHMM CDS 2379 2862 . - . transcript "1" Adh GeneMarkHMM splice3 2862 2863 . - . transcript "1" Adh GeneMarkHMM splice5 3224 3225 . - . transcript "1" Adh GeneMarkHMM CDS 3225 3550 . - . transcript "1" Adh GeneMarkHMM splice3 3550 3551 . - . transcript "1" Adh GeneMarkHMM splice5 6717 6718 . - . transcript "1" Adh GeneMarkHMM CDS 6718 7051 . - . transcript "1" Adh GeneMarkHMM stop_codon 7049 7051 . - . transcript "1" Adh GeneMarkHMM start_codon 21599 21601 . + . transcript "2" Adh GeneMarkHMM CDS 21599 21979 . + . transcript "2" Adh GeneMarkHMM splice5 21979 21980 . + . transcript "2" Adh GeneMarkHMM splice3 22139 22140 . + . transcript "2" Adh GeneMarkHMM CDS 22140 22295 . + . transcript "2" Adh GeneMarkHMM stop_codon 22293 22295 . + . transcript "2" Adh GeneMarkHMM stop_codon 29156 29158 . - . transcript "3" Adh GeneMarkHMM CDS 29156 29479 . - . transcript "3" Adh GeneMarkHMM stop_codon 29477 29479 . - . transcript "3" Adh GeneMarkHMM start_codon 34558 34560 . + . transcript "4" Adh GeneMarkHMM CDS 34558 34822 . + . transcript "4" Adh GeneMarkHMM splice5 34822 34823 . + . transcript "4" Adh GeneMarkHMM splice3 34883 34884 . + . transcript "4" Adh GeneMarkHMM CDS 34884 35332 . + . transcript "4" Adh GeneMarkHMM stop_codon 35330 35332 . + . transcript "4" Adh GeneMarkHMM stop_codon 35433 35435 . - . transcript "5" Adh GeneMarkHMM CDS 35433 35749 . - . transcript "5" Adh GeneMarkHMM splice3 35749 35750 . - . transcript "5" Adh GeneMarkHMM splice5 35937 35938 . - . transcript "5" Adh GeneMarkHMM CDS 35938 36226 . - . transcript "5" Adh GeneMarkHMM stop_codon 36224 36226 . - . transcript "5" Adh GeneMarkHMM start_codon 36410 36412 . + . transcript "6" Adh GeneMarkHMM CDS 36410 37315 . + . transcript "6" Adh GeneMarkHMM stop_codon 37313 37315 . + . transcript "6" Adh GeneMarkHMM start_codon 54448 54450 . + . transcript "7" Adh GeneMarkHMM CDS 54448 54572 . + . transcript "7" Adh GeneMarkHMM splice5 54572 54573 . + . transcript "7" Adh GeneMarkHMM splice3 55154 55155 . + . transcript "7" Adh GeneMarkHMM CDS 55155 55365 . + . transcript "7" Adh GeneMarkHMM splice5 55365 55366 . + . transcript "7" Adh GeneMarkHMM splice3 55989 55990 . + . transcript "7" Adh GeneMarkHMM CDS 55990 56083 . + . transcript "7" Adh GeneMarkHMM splice5 56083 56084 . + . transcript "7" Adh GeneMarkHMM splice3 56154 56155 . + . transcript "7" Adh GeneMarkHMM CDS 56155 56456 . + . transcript "7" Adh GeneMarkHMM splice5 56456 56457 . + . transcript "7" Adh GeneMarkHMM splice3 56514 56515 . + . transcript "7" Adh GeneMarkHMM CDS 56515 56520 . + . transcript "7" Adh GeneMarkHMM stop_codon 56518 56520 . + . transcript "7" Adh GeneMarkHMM stop_codon 89305 89307 . - . transcript "8" Adh GeneMarkHMM CDS 89305 90750 . - . transcript "8" Adh GeneMarkHMM stop_codon 90748 90750 . - . transcript "8" Adh GeneMarkHMM stop_codon 93123 93125 . - . transcript "9" Adh GeneMarkHMM CDS 93123 93999 . - . transcript "9" Adh GeneMarkHMM splice3 93999 94000 . - . transcript "9" Adh GeneMarkHMM splice5 94265 94266 . - . transcript "9" Adh GeneMarkHMM CDS 94266 94333 . - . transcript "9" Adh GeneMarkHMM stop_codon 94331 94333 . - . transcript "9" Adh GeneMarkHMM start_codon 103746 103748 . + . transcript "10" Adh GeneMarkHMM CDS 103746 103769 . + . transcript "10" Adh GeneMarkHMM splice5 103769 103770 . + . transcript "10" Adh GeneMarkHMM splice3 103807 103808 . + . transcript "10" Adh GeneMarkHMM CDS 103808 104330 . + . transcript "10" Adh GeneMarkHMM splice5 104330 104331 . + . transcript "10" Adh GeneMarkHMM splice3 117405 117406 . + . transcript "10" Adh GeneMarkHMM CDS 117406 117527 . + . transcript "10" Adh GeneMarkHMM stop_codon 117525 117527 . + . transcript "10" Adh GeneMarkHMM start_codon 124325 124327 . + . transcript "11" Adh GeneMarkHMM CDS 124325 124936 . + . transcript "11" Adh GeneMarkHMM splice5 124936 124937 . + . transcript "11" Adh GeneMarkHMM splice3 127145 127146 . + . transcript "11" Adh GeneMarkHMM CDS 127146 127292 . + . transcript "11" Adh GeneMarkHMM splice5 127292 127293 . + . transcript "11" Adh GeneMarkHMM splice3 127770 127771 . + . transcript "11" Adh GeneMarkHMM CDS 127771 127931 . + . transcript "11" Adh GeneMarkHMM splice5 127931 127932 . + . transcript "11" Adh GeneMarkHMM splice3 127990 127991 . + . transcript "11" Adh GeneMarkHMM CDS 127991 128225 . + . transcript "11" Adh GeneMarkHMM splice5 128225 128226 . + . transcript "11" Adh GeneMarkHMM splice3 128295 128296 . + . transcript "11" Adh GeneMarkHMM CDS 128296 129342 . + . transcript "11" Adh GeneMarkHMM splice5 129342 129343 . + . transcript "11" Adh GeneMarkHMM splice3 129400 129401 . + . transcript "11" Adh GeneMarkHMM CDS 129401 129965 . + . transcript "11" Adh GeneMarkHMM splice5 129965 129966 . + . transcript "11" Adh GeneMarkHMM splice3 130135 130136 . + . transcript "11" Adh GeneMarkHMM CDS 130136 130285 . + . transcript "11" Adh GeneMarkHMM splice5 130285 130286 . + . transcript "11" Adh GeneMarkHMM splice3 131039 131040 . + . transcript "11" Adh GeneMarkHMM CDS 131040 131248 . + . transcript "11" Adh GeneMarkHMM stop_codon 131246 131248 . + . transcript "11" Adh GeneMarkHMM stop_codon 133608 133610 . - . transcript "12" Adh GeneMarkHMM CDS 133608 134233 . - . transcript "12" Adh GeneMarkHMM splice3 134233 134234 . - . transcript "12" Adh GeneMarkHMM splice5 134861 134862 . - . transcript "12" Adh GeneMarkHMM CDS 134862 134967 . - . transcript "12" Adh GeneMarkHMM stop_codon 134965 134967 . - . transcript "12" Adh GeneMarkHMM start_codon 159578 159580 . + . transcript "13" Adh GeneMarkHMM CDS 159578 159799 . + . transcript "13" Adh GeneMarkHMM splice5 159799 159800 . + . transcript "13" Adh GeneMarkHMM splice3 161726 161727 . + . transcript "13" Adh GeneMarkHMM CDS 161727 162105 . + . transcript "13" Adh GeneMarkHMM splice5 162105 162106 . + . transcript "13" Adh GeneMarkHMM splice3 162441 162442 . + . transcript "13" Adh GeneMarkHMM CDS 162442 162557 . + . transcript "13" Adh GeneMarkHMM splice5 162557 162558 . + . transcript "13" Adh GeneMarkHMM splice3 162615 162616 . + . transcript "13" Adh GeneMarkHMM CDS 162616 163137 . + . transcript "13" Adh GeneMarkHMM splice5 163137 163138 . + . transcript "13" Adh GeneMarkHMM splice3 163296 163297 . + . transcript "13" Adh GeneMarkHMM CDS 163297 163527 . + . transcript "13" Adh GeneMarkHMM stop_codon 163525 163527 . + . transcript "13" Adh GeneMarkHMM start_codon 164127 164129 . + . transcript "14" Adh GeneMarkHMM CDS 164127 164381 . + . transcript "14" Adh GeneMarkHMM splice5 164381 164382 . + . transcript "14" Adh GeneMarkHMM splice3 164601 164602 . + . transcript "14" Adh GeneMarkHMM CDS 164602 164607 . + . transcript "14" Adh GeneMarkHMM stop_codon 164605 164607 . + . transcript "14" Adh GeneMarkHMM start_codon 168293 168295 . + . transcript "15" Adh GeneMarkHMM CDS 168293 168344 . + . transcript "15" Adh GeneMarkHMM splice5 168344 168345 . + . transcript "15" Adh GeneMarkHMM splice3 168412 168413 . + . transcript "15" Adh GeneMarkHMM CDS 168413 168503 . + . transcript "15" Adh GeneMarkHMM splice5 168503 168504 . + . transcript "15" Adh GeneMarkHMM splice3 168558 168559 . + . transcript "15" Adh GeneMarkHMM CDS 168559 168634 . + . transcript "15" Adh GeneMarkHMM stop_codon 168632 168634 . + . transcript "15" Adh GeneMarkHMM stop_codon 171963 171965 . - . transcript "16" Adh GeneMarkHMM CDS 171963 172056 . - . transcript "16" Adh GeneMarkHMM splice3 172056 172057 . - . transcript "16" Adh GeneMarkHMM splice5 172368 172369 . - . transcript "16" Adh GeneMarkHMM CDS 172369 172562 . - . transcript "16" Adh GeneMarkHMM stop_codon 172560 172562 . - . transcript "16" Adh GeneMarkHMM stop_codon 172620 172622 . - . transcript "17" Adh GeneMarkHMM CDS 172620 172706 . - . transcript "17" Adh GeneMarkHMM splice3 172706 172707 . - . transcript "17" Adh GeneMarkHMM splice5 172828 172829 . - . transcript "17" Adh GeneMarkHMM CDS 172829 172869 . - . transcript "17" Adh GeneMarkHMM splice3 172869 172870 . - . transcript "17" Adh GeneMarkHMM splice5 177955 177956 . - . transcript "17" Adh GeneMarkHMM CDS 177956 178015 . - . transcript "17" Adh GeneMarkHMM splice3 178015 178016 . - . transcript "17" Adh GeneMarkHMM splice5 178135 178136 . - . transcript "17" Adh GeneMarkHMM CDS 178136 178300 . - . transcript "17" Adh GeneMarkHMM splice3 178300 178301 . - . transcript "17" Adh GeneMarkHMM splice5 181271 181272 . - . transcript "17" Adh GeneMarkHMM CDS 181272 181409 . - . transcript "17" Adh GeneMarkHMM splice3 181409 181410 . - . transcript "17" Adh GeneMarkHMM splice5 183106 183107 . - . transcript "17" Adh GeneMarkHMM CDS 183107 183496 . - . transcript "17" Adh GeneMarkHMM splice3 183496 183497 . - . transcript "17" Adh GeneMarkHMM splice5 183595 183596 . - . transcript "17" Adh GeneMarkHMM CDS 183596 183635 . - . transcript "17" Adh GeneMarkHMM splice3 183635 183636 . - . transcript "17" Adh GeneMarkHMM splice5 183698 183699 . - . transcript "17" Adh GeneMarkHMM CDS 183699 183764 . - . transcript "17" Adh GeneMarkHMM splice3 183764 183765 . - . transcript "17" Adh GeneMarkHMM splice5 183834 183835 . - . transcript "17" Adh GeneMarkHMM CDS 183835 184040 . - . transcript "17" Adh GeneMarkHMM splice3 184040 184041 . - . transcript "17" Adh GeneMarkHMM splice5 184240 184241 . - . transcript "17" Adh GeneMarkHMM CDS 184241 184282 . - . transcript "17" Adh GeneMarkHMM splice3 184282 184283 . - . transcript "17" Adh GeneMarkHMM splice5 185557 185558 . - . transcript "17" Adh GeneMarkHMM CDS 185558 185615 . - . transcript "17" Adh GeneMarkHMM stop_codon 185613 185615 . - . transcript "17" Adh GeneMarkHMM start_codon 202128 202130 . + . transcript "18" Adh GeneMarkHMM CDS 202128 202349 . + . transcript "18" Adh GeneMarkHMM splice5 202349 202350 . + . transcript "18" Adh GeneMarkHMM splice3 202409 202410 . + . transcript "18" Adh GeneMarkHMM CDS 202410 202646 . + . transcript "18" Adh GeneMarkHMM splice5 202646 202647 . + . transcript "18" Adh GeneMarkHMM splice3 202699 202700 . + . transcript "18" Adh GeneMarkHMM CDS 202700 204199 . + . transcript "18" Adh GeneMarkHMM stop_codon 204197 204199 . + . transcript "18" Adh GeneMarkHMM stop_codon 214878 214880 . - . transcript "19" Adh GeneMarkHMM CDS 214878 214978 . - . transcript "19" Adh GeneMarkHMM splice3 214978 214979 . - . transcript "19" Adh GeneMarkHMM splice5 216181 216182 . - . transcript "19" Adh GeneMarkHMM CDS 216182 216761 . - . transcript "19" Adh GeneMarkHMM splice3 216761 216762 . - . transcript "19" Adh GeneMarkHMM splice5 216819 216820 . - . transcript "19" Adh GeneMarkHMM CDS 216820 217188 . - . transcript "19" Adh GeneMarkHMM stop_codon 217186 217188 . - . transcript "19" Adh GeneMarkHMM start_codon 223587 223589 . + . transcript "20" Adh GeneMarkHMM CDS 223587 223680 . + . transcript "20" Adh GeneMarkHMM splice5 223680 223681 . + . transcript "20" Adh GeneMarkHMM splice3 227769 227770 . + . transcript "20" Adh GeneMarkHMM CDS 227770 227992 . + . transcript "20" Adh GeneMarkHMM splice5 227992 227993 . + . transcript "20" Adh GeneMarkHMM splice3 229840 229841 . + . transcript "20" Adh GeneMarkHMM CDS 229841 230462 . + . transcript "20" Adh GeneMarkHMM stop_codon 230460 230462 . + . transcript "20" Adh GeneMarkHMM stop_codon 230999 231001 . - . transcript "21" Adh GeneMarkHMM CDS 230999 231160 . - . transcript "21" Adh GeneMarkHMM splice3 231160 231161 . - . transcript "21" Adh GeneMarkHMM splice5 231209 231210 . - . transcript "21" Adh GeneMarkHMM CDS 231210 231322 . - . transcript "21" Adh GeneMarkHMM splice3 231322 231323 . - . transcript "21" Adh GeneMarkHMM splice5 231416 231417 . - . transcript "21" Adh GeneMarkHMM CDS 231417 231549 . - . transcript "21" Adh GeneMarkHMM splice3 231549 231550 . - . transcript "21" Adh GeneMarkHMM splice5 234441 234442 . - . transcript "21" Adh GeneMarkHMM CDS 234442 234534 . - . transcript "21" Adh GeneMarkHMM splice3 234534 234535 . - . transcript "21" Adh GeneMarkHMM splice5 235722 235723 . - . transcript "21" Adh GeneMarkHMM CDS 235723 235785 . - . transcript "21" Adh GeneMarkHMM splice3 235785 235786 . - . transcript "21" Adh GeneMarkHMM splice5 236645 236646 . - . transcript "21" Adh GeneMarkHMM CDS 236646 236810 . - . transcript "21" Adh GeneMarkHMM stop_codon 236808 236810 . - . transcript "21" Adh GeneMarkHMM stop_codon 248109 248111 . - . transcript "22" Adh GeneMarkHMM CDS 248109 248276 . - . transcript "22" Adh GeneMarkHMM splice3 248276 248277 . - . transcript "22" Adh GeneMarkHMM splice5 248696 248697 . - . transcript "22" Adh GeneMarkHMM CDS 248697 248849 . - . transcript "22" Adh GeneMarkHMM stop_codon 248847 248849 . - . transcript "22" Adh GeneMarkHMM start_codon 264992 264994 . + . transcript "23" Adh GeneMarkHMM CDS 264992 264997 . + . transcript "23" Adh GeneMarkHMM splice5 264997 264998 . + . transcript "23" Adh GeneMarkHMM splice3 265087 265088 . + . transcript "23" Adh GeneMarkHMM CDS 265088 266322 . + . transcript "23" Adh GeneMarkHMM splice5 266322 266323 . + . transcript "23" Adh GeneMarkHMM splice3 266391 266392 . + . transcript "23" Adh GeneMarkHMM CDS 266392 266619 . + . transcript "23" Adh GeneMarkHMM splice5 266619 266620 . + . transcript "23" Adh GeneMarkHMM splice3 266683 266684 . + . transcript "23" Adh GeneMarkHMM CDS 266684 266795 . + . transcript "23" Adh GeneMarkHMM splice5 266795 266796 . + . transcript "23" Adh GeneMarkHMM splice3 266855 266856 . + . transcript "23" Adh GeneMarkHMM CDS 266856 266867 . + . transcript "23" Adh GeneMarkHMM splice5 266867 266868 . + . transcript "23" Adh GeneMarkHMM splice3 266934 266935 . + . transcript "23" Adh GeneMarkHMM CDS 266935 266945 . + . transcript "23" Adh GeneMarkHMM splice5 266945 266946 . + . transcript "23" Adh GeneMarkHMM splice3 267002 267003 . + . transcript "23" Adh GeneMarkHMM CDS 267003 267073 . + . transcript "23" Adh GeneMarkHMM splice5 267073 267074 . + . transcript "23" Adh GeneMarkHMM splice3 267133 267134 . + . transcript "23" Adh GeneMarkHMM CDS 267134 267234 . + . transcript "23" Adh GeneMarkHMM stop_codon 267232 267234 . + . transcript "23" Adh GeneMarkHMM stop_codon 268751 268753 . - . transcript "24" Adh GeneMarkHMM CDS 268751 268798 . - . transcript "24" Adh GeneMarkHMM splice3 268798 268799 . - . transcript "24" Adh GeneMarkHMM splice5 268993 268994 . - . transcript "24" Adh GeneMarkHMM CDS 268994 269157 . - . transcript "24" Adh GeneMarkHMM splice3 269157 269158 . - . transcript "24" Adh GeneMarkHMM splice5 269221 269222 . - . transcript "24" Adh GeneMarkHMM CDS 269222 269559 . - . transcript "24" Adh GeneMarkHMM splice3 269559 269560 . - . transcript "24" Adh GeneMarkHMM splice5 269628 269629 . - . transcript "24" Adh GeneMarkHMM CDS 269629 269907 . - . transcript "24" Adh GeneMarkHMM splice3 269907 269908 . - . transcript "24" Adh GeneMarkHMM splice5 271521 271522 . - . transcript "24" Adh GeneMarkHMM CDS 271522 271573 . - . transcript "24" Adh GeneMarkHMM splice3 271573 271574 . - . transcript "24" Adh GeneMarkHMM splice5 273395 273396 . - . transcript "24" Adh GeneMarkHMM CDS 273396 273483 . - . transcript "24" Adh GeneMarkHMM stop_codon 273481 273483 . - . transcript "24" Adh GeneMarkHMM start_codon 274763 274765 . + . transcript "25" Adh GeneMarkHMM CDS 274763 275848 . + . transcript "25" Adh GeneMarkHMM stop_codon 275846 275848 . + . transcript "25" Adh GeneMarkHMM stop_codon 276361 276363 . - . transcript "26" Adh GeneMarkHMM CDS 276361 276696 . - . transcript "26" Adh GeneMarkHMM splice3 276696 276697 . - . transcript "26" Adh GeneMarkHMM splice5 276747 276748 . - . transcript "26" Adh GeneMarkHMM CDS 276748 277188 . - . transcript "26" Adh GeneMarkHMM stop_codon 277186 277188 . - . transcript "26" Adh GeneMarkHMM start_codon 277921 277923 . + . transcript "27" Adh GeneMarkHMM CDS 277921 278103 . + . transcript "27" Adh GeneMarkHMM splice5 278103 278104 . + . transcript "27" Adh GeneMarkHMM splice3 278221 278222 . + . transcript "27" Adh GeneMarkHMM CDS 278222 278345 . + . transcript "27" Adh GeneMarkHMM splice5 278345 278346 . + . transcript "27" Adh GeneMarkHMM splice3 278536 278537 . + . transcript "27" Adh GeneMarkHMM CDS 278537 278737 . + . transcript "27" Adh GeneMarkHMM splice5 278737 278738 . + . transcript "27" Adh GeneMarkHMM splice3 278801 278802 . + . transcript "27" Adh GeneMarkHMM CDS 278802 279272 . + . transcript "27" Adh GeneMarkHMM splice5 279272 279273 . + . transcript "27" Adh GeneMarkHMM splice3 279547 279548 . + . transcript "27" Adh GeneMarkHMM CDS 279548 279726 . + . transcript "27" Adh GeneMarkHMM splice5 279726 279727 . + . transcript "27" Adh GeneMarkHMM splice3 280030 280031 . + . transcript "27" Adh GeneMarkHMM CDS 280031 280247 . + . transcript "27" Adh GeneMarkHMM splice5 280247 280248 . + . transcript "27" Adh GeneMarkHMM splice3 280309 280310 . + . transcript "27" Adh GeneMarkHMM CDS 280310 280610 . + . transcript "27" Adh GeneMarkHMM splice5 280610 280611 . + . transcript "27" Adh GeneMarkHMM splice3 280673 280674 . + . transcript "27" Adh GeneMarkHMM CDS 280674 280986 . + . transcript "27" Adh GeneMarkHMM splice5 280986 280987 . + . transcript "27" Adh GeneMarkHMM splice3 281050 281051 . + . transcript "27" Adh GeneMarkHMM CDS 281051 281202 . + . transcript "27" Adh GeneMarkHMM splice5 281202 281203 . + . transcript "27" Adh GeneMarkHMM splice3 281263 281264 . + . transcript "27" Adh GeneMarkHMM CDS 281264 281390 . + . transcript "27" Adh GeneMarkHMM splice5 281390 281391 . + . transcript "27" Adh GeneMarkHMM splice3 281549 281550 . + . transcript "27" Adh GeneMarkHMM CDS 281550 281787 . + . transcript "27" Adh GeneMarkHMM splice5 281787 281788 . + . transcript "27" Adh GeneMarkHMM splice3 281847 281848 . + . transcript "27" Adh GeneMarkHMM CDS 281848 282471 . + . transcript "27" Adh GeneMarkHMM splice5 282471 282472 . + . transcript "27" Adh GeneMarkHMM splice3 282538 282539 . + . transcript "27" Adh GeneMarkHMM CDS 282539 283541 . + . transcript "27" Adh GeneMarkHMM splice5 283541 283542 . + . transcript "27" Adh GeneMarkHMM splice3 283607 283608 . + . transcript "27" Adh GeneMarkHMM CDS 283608 284052 . + . transcript "27" Adh GeneMarkHMM stop_codon 284050 284052 . + . transcript "27" Adh GeneMarkHMM start_codon 284779 284781 . + . transcript "28" Adh GeneMarkHMM CDS 284779 284915 . + . transcript "28" Adh GeneMarkHMM splice5 284915 284916 . + . transcript "28" Adh GeneMarkHMM splice3 284968 284969 . + . transcript "28" Adh GeneMarkHMM CDS 284969 285346 . + . transcript "28" Adh GeneMarkHMM splice5 285346 285347 . + . transcript "28" Adh GeneMarkHMM splice3 285415 285416 . + . transcript "28" Adh GeneMarkHMM CDS 285416 286886 . + . transcript "28" Adh GeneMarkHMM stop_codon 286884 286886 . + . transcript "28" Adh GeneMarkHMM start_codon 287599 287601 . + . transcript "29" Adh GeneMarkHMM CDS 287599 288379 . + . transcript "29" Adh GeneMarkHMM splice5 288379 288380 . + . transcript "29" Adh GeneMarkHMM splice3 288646 288647 . + . transcript "29" Adh GeneMarkHMM CDS 288647 292689 . + . transcript "29" Adh GeneMarkHMM splice5 292689 292690 . + . transcript "29" Adh GeneMarkHMM splice3 292758 292759 . + . transcript "29" Adh GeneMarkHMM CDS 292759 292896 . + . transcript "29" Adh GeneMarkHMM stop_codon 292894 292896 . + . transcript "29" Adh GeneMarkHMM start_codon 297680 297682 . + . transcript "30" Adh GeneMarkHMM CDS 297680 297713 . + . transcript "30" Adh GeneMarkHMM splice5 297713 297714 . + . transcript "30" Adh GeneMarkHMM splice3 302559 302560 . + . transcript "30" Adh GeneMarkHMM CDS 302560 302718 . + . transcript "30" Adh GeneMarkHMM splice5 302718 302719 . + . transcript "30" Adh GeneMarkHMM splice3 302785 302786 . + . transcript "30" Adh GeneMarkHMM CDS 302786 303405 . + . transcript "30" Adh GeneMarkHMM stop_codon 303403 303405 . + . transcript "30" Adh GeneMarkHMM stop_codon 303960 303962 . - . transcript "31" Adh GeneMarkHMM CDS 303960 304272 . - . transcript "31" Adh GeneMarkHMM splice3 304272 304273 . - . transcript "31" Adh GeneMarkHMM splice5 304329 304330 . - . transcript "31" Adh GeneMarkHMM CDS 304330 305201 . - . transcript "31" Adh GeneMarkHMM stop_codon 305199 305201 . - . transcript "31" Adh GeneMarkHMM start_codon 305396 305398 . + . transcript "32" Adh GeneMarkHMM CDS 305396 305516 . + . transcript "32" Adh GeneMarkHMM splice5 305516 305517 . + . transcript "32" Adh GeneMarkHMM splice3 305576 305577 . + . transcript "32" Adh GeneMarkHMM CDS 305577 305737 . + . transcript "32" Adh GeneMarkHMM splice5 305737 305738 . + . transcript "32" Adh GeneMarkHMM splice3 305802 305803 . + . transcript "32" Adh GeneMarkHMM CDS 305803 306108 . + . transcript "32" Adh GeneMarkHMM splice5 306108 306109 . + . transcript "32" Adh GeneMarkHMM splice3 306229 306230 . + . transcript "32" Adh GeneMarkHMM CDS 306230 306385 . + . transcript "32" Adh GeneMarkHMM stop_codon 306383 306385 . + . transcript "32" Adh GeneMarkHMM stop_codon 306476 306478 . - . transcript "33" Adh GeneMarkHMM CDS 306476 306985 . - . transcript "33" Adh GeneMarkHMM stop_codon 306983 306985 . - . transcript "33" Adh GeneMarkHMM start_codon 307774 307776 . + . transcript "34" Adh GeneMarkHMM CDS 307774 307790 . + . transcript "34" Adh GeneMarkHMM splice5 307790 307791 . + . transcript "34" Adh GeneMarkHMM splice3 307840 307841 . + . transcript "34" Adh GeneMarkHMM CDS 307841 309056 . + . transcript "34" Adh GeneMarkHMM splice5 309056 309057 . + . transcript "34" Adh GeneMarkHMM splice3 309109 309110 . + . transcript "34" Adh GeneMarkHMM CDS 309110 309467 . + . transcript "34" Adh GeneMarkHMM splice5 309467 309468 . + . transcript "34" Adh GeneMarkHMM splice3 309529 309530 . + . transcript "34" Adh GeneMarkHMM CDS 309530 310452 . + . transcript "34" Adh GeneMarkHMM splice5 310452 310453 . + . transcript "34" Adh GeneMarkHMM splice3 310516 310517 . + . transcript "34" Adh GeneMarkHMM CDS 310517 311365 . + . transcript "34" Adh GeneMarkHMM splice5 311365 311366 . + . transcript "34" Adh GeneMarkHMM splice3 311427 311428 . + . transcript "34" Adh GeneMarkHMM CDS 311428 312318 . + . transcript "34" Adh GeneMarkHMM splice5 312318 312319 . + . transcript "34" Adh GeneMarkHMM splice3 312386 312387 . + . transcript "34" Adh GeneMarkHMM CDS 312387 313020 . + . transcript "34" Adh GeneMarkHMM splice5 313020 313021 . + . transcript "34" Adh GeneMarkHMM splice3 313085 313086 . + . transcript "34" Adh GeneMarkHMM CDS 313086 313091 . + . transcript "34" Adh GeneMarkHMM splice5 313091 313092 . + . transcript "34" Adh GeneMarkHMM splice3 314120 314121 . + . transcript "34" Adh GeneMarkHMM CDS 314121 314181 . + . transcript "34" Adh GeneMarkHMM splice5 314181 314182 . + . transcript "34" Adh GeneMarkHMM splice3 315199 315200 . + . transcript "34" Adh GeneMarkHMM CDS 315200 315899 . + . transcript "34" Adh GeneMarkHMM splice5 315899 315900 . + . transcript "34" Adh GeneMarkHMM splice3 316432 316433 . + . transcript "34" Adh GeneMarkHMM CDS 316433 316800 . + . transcript "34" Adh GeneMarkHMM splice5 316800 316801 . + . transcript "34" Adh GeneMarkHMM splice3 316864 316865 . + . transcript "34" Adh GeneMarkHMM CDS 316865 317462 . + . transcript "34" Adh GeneMarkHMM stop_codon 317460 317462 . + . transcript "34" Adh GeneMarkHMM stop_codon 317803 317805 . - . transcript "35" Adh GeneMarkHMM CDS 317803 317843 . - . transcript "35" Adh GeneMarkHMM splice3 317843 317844 . - . transcript "35" Adh GeneMarkHMM splice5 317895 317896 . - . transcript "35" Adh GeneMarkHMM CDS 317896 318548 . - . transcript "35" Adh GeneMarkHMM splice3 318548 318549 . - . transcript "35" Adh GeneMarkHMM splice5 318607 318608 . - . transcript "35" Adh GeneMarkHMM CDS 318608 319430 . - . transcript "35" Adh GeneMarkHMM splice3 319430 319431 . - . transcript "35" Adh GeneMarkHMM splice5 319485 319486 . - . transcript "35" Adh GeneMarkHMM CDS 319486 321443 . - . transcript "35" Adh GeneMarkHMM splice3 321443 321444 . - . transcript "35" Adh GeneMarkHMM splice5 321967 321968 . - . transcript "35" Adh GeneMarkHMM CDS 321968 323027 . - . transcript "35" Adh GeneMarkHMM splice3 323027 323028 . - . transcript "35" Adh GeneMarkHMM splice5 323096 323097 . - . transcript "35" Adh GeneMarkHMM CDS 323097 323169 . - . transcript "35" Adh GeneMarkHMM stop_codon 323167 323169 . - . transcript "35" Adh GeneMarkHMM start_codon 323788 323790 . + . transcript "36" Adh GeneMarkHMM CDS 323788 324885 . + . transcript "36" Adh GeneMarkHMM splice5 324885 324886 . + . transcript "36" Adh GeneMarkHMM splice3 324938 324939 . + . transcript "36" Adh GeneMarkHMM CDS 324939 325223 . + . transcript "36" Adh GeneMarkHMM stop_codon 325221 325223 . + . transcript "36" Adh GeneMarkHMM stop_codon 325240 325242 . - . transcript "37" Adh GeneMarkHMM CDS 325240 325634 . - . transcript "37" Adh GeneMarkHMM splice3 325634 325635 . - . transcript "37" Adh GeneMarkHMM splice5 325688 325689 . - . transcript "37" Adh GeneMarkHMM CDS 325689 326352 . - . transcript "37" Adh GeneMarkHMM splice3 326352 326353 . - . transcript "37" Adh GeneMarkHMM splice5 326432 326433 . - . transcript "37" Adh GeneMarkHMM CDS 326433 326822 . - . transcript "37" Adh GeneMarkHMM stop_codon 326820 326822 . - . transcript "37" Adh GeneMarkHMM start_codon 327175 327177 . + . transcript "38" Adh GeneMarkHMM CDS 327175 328002 . + . transcript "38" Adh GeneMarkHMM stop_codon 328000 328002 . + . transcript "38" Adh GeneMarkHMM stop_codon 328048 328050 . - . transcript "39" Adh GeneMarkHMM CDS 328048 328411 . - . transcript "39" Adh GeneMarkHMM splice3 328411 328412 . - . transcript "39" Adh GeneMarkHMM splice5 328472 328473 . - . transcript "39" Adh GeneMarkHMM CDS 328473 328634 . - . transcript "39" Adh GeneMarkHMM splice3 328634 328635 . - . transcript "39" Adh GeneMarkHMM splice5 328689 328690 . - . transcript "39" Adh GeneMarkHMM CDS 328690 328733 . - . transcript "39" Adh GeneMarkHMM stop_codon 328731 328733 . - . transcript "39" Adh GeneMarkHMM start_codon 329808 329810 . + . transcript "40" Adh GeneMarkHMM CDS 329808 330183 . + . transcript "40" Adh GeneMarkHMM splice5 330183 330184 . + . transcript "40" Adh GeneMarkHMM splice3 330238 330239 . + . transcript "40" Adh GeneMarkHMM CDS 330239 330252 . + . transcript "40" Adh GeneMarkHMM stop_codon 330250 330252 . + . transcript "40" Adh GeneMarkHMM stop_codon 331099 331101 . - . transcript "41" Adh GeneMarkHMM CDS 331099 331197 . - . transcript "41" Adh GeneMarkHMM splice3 331197 331198 . - . transcript "41" Adh GeneMarkHMM splice5 334621 334622 . - . transcript "41" Adh GeneMarkHMM CDS 334622 334786 . - . transcript "41" Adh GeneMarkHMM splice3 334786 334787 . - . transcript "41" Adh GeneMarkHMM splice5 334846 334847 . - . transcript "41" Adh GeneMarkHMM CDS 334847 335125 . - . transcript "41" Adh GeneMarkHMM splice3 335125 335126 . - . transcript "41" Adh GeneMarkHMM splice5 335194 335195 . - . transcript "41" Adh GeneMarkHMM CDS 335195 335202 . - . transcript "41" Adh GeneMarkHMM splice3 335202 335203 . - . transcript "41" Adh GeneMarkHMM splice5 336702 336703 . - . transcript "41" Adh GeneMarkHMM CDS 336703 337323 . - . transcript "41" Adh GeneMarkHMM splice3 337323 337324 . - . transcript "41" Adh GeneMarkHMM splice5 337378 337379 . - . transcript "41" Adh GeneMarkHMM CDS 337379 337457 . - . transcript "41" Adh GeneMarkHMM stop_codon 337455 337457 . - . transcript "41" Adh GeneMarkHMM stop_codon 338167 338169 . - . transcript "42" Adh GeneMarkHMM CDS 338167 338879 . - . transcript "42" Adh GeneMarkHMM splice3 338879 338880 . - . transcript "42" Adh GeneMarkHMM splice5 338943 338944 . - . transcript "42" Adh GeneMarkHMM CDS 338944 339013 . - . transcript "42" Adh GeneMarkHMM stop_codon 339011 339013 . - . transcript "42" Adh GeneMarkHMM start_codon 340529 340531 . + . transcript "43" Adh GeneMarkHMM CDS 340529 340634 . + . transcript "43" Adh GeneMarkHMM splice5 340634 340635 . + . transcript "43" Adh GeneMarkHMM splice3 340704 340705 . + . transcript "43" Adh GeneMarkHMM CDS 340705 340870 . + . transcript "43" Adh GeneMarkHMM splice5 340870 340871 . + . transcript "43" Adh GeneMarkHMM splice3 340925 340926 . + . transcript "43" Adh GeneMarkHMM CDS 340926 341517 . + . transcript "43" Adh GeneMarkHMM stop_codon 341515 341517 . + . transcript "43" Adh GeneMarkHMM start_codon 341713 341715 . + . transcript "44" Adh GeneMarkHMM CDS 341713 341857 . + . transcript "44" Adh GeneMarkHMM splice5 341857 341858 . + . transcript "44" Adh GeneMarkHMM splice3 342002 342003 . + . transcript "44" Adh GeneMarkHMM CDS 342003 342751 . + . transcript "44" Adh GeneMarkHMM stop_codon 342749 342751 . + . transcript "44" Adh GeneMarkHMM start_codon 343169 343171 . + . transcript "45" Adh GeneMarkHMM CDS 343169 343368 . + . transcript "45" Adh GeneMarkHMM splice5 343368 343369 . + . transcript "45" Adh GeneMarkHMM splice3 343431 343432 . + . transcript "45" Adh GeneMarkHMM CDS 343432 343984 . + . transcript "45" Adh GeneMarkHMM stop_codon 343982 343984 . + . transcript "45" Adh GeneMarkHMM stop_codon 354817 354819 . - . transcript "46" Adh GeneMarkHMM CDS 354817 354964 . - . transcript "46" Adh GeneMarkHMM splice3 354964 354965 . - . transcript "46" Adh GeneMarkHMM splice5 359447 359448 . - . transcript "46" Adh GeneMarkHMM CDS 359448 359547 . - . transcript "46" Adh GeneMarkHMM splice3 359547 359548 . - . transcript "46" Adh GeneMarkHMM splice5 360188 360189 . - . transcript "46" Adh GeneMarkHMM CDS 360189 360259 . - . transcript "46" Adh GeneMarkHMM splice3 360259 360260 . - . transcript "46" Adh GeneMarkHMM splice5 360321 360322 . - . transcript "46" Adh GeneMarkHMM CDS 360322 360383 . - . transcript "46" Adh GeneMarkHMM stop_codon 360381 360383 . - . transcript "46" Adh GeneMarkHMM start_codon 373286 373288 . + . transcript "47" Adh GeneMarkHMM CDS 373286 373457 . + . transcript "47" Adh GeneMarkHMM splice5 373457 373458 . + . transcript "47" Adh GeneMarkHMM splice3 385050 385051 . + . transcript "47" Adh GeneMarkHMM CDS 385051 385283 . + . transcript "47" Adh GeneMarkHMM splice5 385283 385284 . + . transcript "47" Adh GeneMarkHMM splice3 388779 388780 . + . transcript "47" Adh GeneMarkHMM CDS 388780 388921 . + . transcript "47" Adh GeneMarkHMM splice5 388921 388922 . + . transcript "47" Adh GeneMarkHMM splice3 389005 389006 . + . transcript "47" Adh GeneMarkHMM CDS 389006 389140 . + . transcript "47" Adh GeneMarkHMM splice5 389140 389141 . + . transcript "47" Adh GeneMarkHMM splice3 389207 389208 . + . transcript "47" Adh GeneMarkHMM CDS 389208 390491 . + . transcript "47" Adh GeneMarkHMM splice5 390491 390492 . + . transcript "47" Adh GeneMarkHMM splice3 390555 390556 . + . transcript "47" Adh GeneMarkHMM CDS 390556 390673 . + . transcript "47" Adh GeneMarkHMM splice5 390673 390674 . + . transcript "47" Adh GeneMarkHMM splice3 390736 390737 . + . transcript "47" Adh GeneMarkHMM CDS 390737 391112 . + . transcript "47" Adh GeneMarkHMM splice5 391112 391113 . + . transcript "47" Adh GeneMarkHMM splice3 391176 391177 . + . transcript "47" Adh GeneMarkHMM CDS 391177 391500 . + . transcript "47" Adh GeneMarkHMM stop_codon 391498 391500 . + . transcript "47" Adh GeneMarkHMM stop_codon 393573 393575 . - . transcript "48" Adh GeneMarkHMM CDS 393573 393814 . - . transcript "48" Adh GeneMarkHMM splice3 393814 393815 . - . transcript "48" Adh GeneMarkHMM splice5 393893 393894 . - . transcript "48" Adh GeneMarkHMM CDS 393894 394052 . - . transcript "48" Adh GeneMarkHMM splice3 394052 394053 . - . transcript "48" Adh GeneMarkHMM splice5 394382 394383 . - . transcript "48" Adh GeneMarkHMM CDS 394383 395732 . - . transcript "48" Adh GeneMarkHMM splice3 395732 395733 . - . transcript "48" Adh GeneMarkHMM splice5 395825 395826 . - . transcript "48" Adh GeneMarkHMM CDS 395826 397468 . - . transcript "48" Adh GeneMarkHMM splice3 397468 397469 . - . transcript "48" Adh GeneMarkHMM splice5 397531 397532 . - . transcript "48" Adh GeneMarkHMM CDS 397532 397671 . - . transcript "48" Adh GeneMarkHMM stop_codon 397669 397671 . - . transcript "48" Adh GeneMarkHMM start_codon 400338 400340 . + . transcript "49" Adh GeneMarkHMM CDS 400338 400923 . + . transcript "49" Adh GeneMarkHMM splice5 400923 400924 . + . transcript "49" Adh GeneMarkHMM splice3 401349 401350 . + . transcript "49" Adh GeneMarkHMM CDS 401350 401713 . + . transcript "49" Adh GeneMarkHMM splice5 401713 401714 . + . transcript "49" Adh GeneMarkHMM splice3 401774 401775 . + . transcript "49" Adh GeneMarkHMM CDS 401775 402341 . + . transcript "49" Adh GeneMarkHMM splice5 402341 402342 . + . transcript "49" Adh GeneMarkHMM splice3 402398 402399 . + . transcript "49" Adh GeneMarkHMM CDS 402399 402539 . + . transcript "49" Adh GeneMarkHMM splice5 402539 402540 . + . transcript "49" Adh GeneMarkHMM splice3 402606 402607 . + . transcript "49" Adh GeneMarkHMM CDS 402607 402779 . + . transcript "49" Adh GeneMarkHMM splice5 402779 402780 . + . transcript "49" Adh GeneMarkHMM splice3 403233 403234 . + . transcript "49" Adh GeneMarkHMM CDS 403234 403277 . + . transcript "49" Adh GeneMarkHMM splice5 403277 403278 . + . transcript "49" Adh GeneMarkHMM splice3 403467 403468 . + . transcript "49" Adh GeneMarkHMM CDS 403468 404414 . + . transcript "49" Adh GeneMarkHMM splice5 404414 404415 . + . transcript "49" Adh GeneMarkHMM splice3 404466 404467 . + . transcript "49" Adh GeneMarkHMM CDS 404467 405027 . + . transcript "49" Adh GeneMarkHMM splice5 405027 405028 . + . transcript "49" Adh GeneMarkHMM splice3 405084 405085 . + . transcript "49" Adh GeneMarkHMM CDS 405085 405391 . + . transcript "49" Adh GeneMarkHMM stop_codon 405389 405391 . + . transcript "49" Adh GeneMarkHMM start_codon 405952 405954 . + . transcript "50" Adh GeneMarkHMM CDS 405952 406314 . + . transcript "50" Adh GeneMarkHMM stop_codon 406312 406314 . + . transcript "50" Adh GeneMarkHMM start_codon 408759 408761 . + . transcript "51" Adh GeneMarkHMM CDS 408759 409001 . + . transcript "51" Adh GeneMarkHMM splice5 409001 409002 . + . transcript "51" Adh GeneMarkHMM splice3 409149 409150 . + . transcript "51" Adh GeneMarkHMM CDS 409150 409656 . + . transcript "51" Adh GeneMarkHMM splice5 409656 409657 . + . transcript "51" Adh GeneMarkHMM splice3 410171 410172 . + . transcript "51" Adh GeneMarkHMM CDS 410172 410315 . + . transcript "51" Adh GeneMarkHMM splice5 410315 410316 . + . transcript "51" Adh GeneMarkHMM splice3 410371 410372 . + . transcript "51" Adh GeneMarkHMM CDS 410372 410612 . + . transcript "51" Adh GeneMarkHMM splice5 410612 410613 . + . transcript "51" Adh GeneMarkHMM splice3 410676 410677 . + . transcript "51" Adh GeneMarkHMM CDS 410677 411401 . + . transcript "51" Adh GeneMarkHMM splice5 411401 411402 . + . transcript "51" Adh GeneMarkHMM splice3 411727 411728 . + . transcript "51" Adh GeneMarkHMM CDS 411728 411831 . + . transcript "51" Adh GeneMarkHMM splice5 411831 411832 . + . transcript "51" Adh GeneMarkHMM splice3 411897 411898 . + . transcript "51" Adh GeneMarkHMM CDS 411898 412000 . + . transcript "51" Adh GeneMarkHMM stop_codon 411998 412000 . + . transcript "51" Adh GeneMarkHMM stop_codon 414755 414757 . - . transcript "52" Adh GeneMarkHMM CDS 414755 414778 . - . transcript "52" Adh GeneMarkHMM splice3 414778 414779 . - . transcript "52" Adh GeneMarkHMM splice5 414842 414843 . - . transcript "52" Adh GeneMarkHMM CDS 414843 415055 . - . transcript "52" Adh GeneMarkHMM splice3 415055 415056 . - . transcript "52" Adh GeneMarkHMM splice5 415400 415401 . - . transcript "52" Adh GeneMarkHMM CDS 415401 415519 . - . transcript "52" Adh GeneMarkHMM splice3 415519 415520 . - . transcript "52" Adh GeneMarkHMM splice5 415583 415584 . - . transcript "52" Adh GeneMarkHMM CDS 415584 416211 . - . transcript "52" Adh GeneMarkHMM splice3 416211 416212 . - . transcript "52" Adh GeneMarkHMM splice5 416275 416276 . - . transcript "52" Adh GeneMarkHMM CDS 416276 416749 . - . transcript "52" Adh GeneMarkHMM splice3 416749 416750 . - . transcript "52" Adh GeneMarkHMM splice5 417099 417100 . - . transcript "52" Adh GeneMarkHMM CDS 417100 417111 . - . transcript "52" Adh GeneMarkHMM stop_codon 417109 417111 . - . transcript "52" Adh GeneMarkHMM stop_codon 426746 426748 . - . transcript "53" Adh GeneMarkHMM CDS 426746 427525 . - . transcript "53" Adh GeneMarkHMM stop_codon 427523 427525 . - . transcript "53" Adh GeneMarkHMM stop_codon 438979 438981 . - . transcript "54" Adh GeneMarkHMM CDS 438979 439800 . - . transcript "54" Adh GeneMarkHMM splice3 439800 439801 . - . transcript "54" Adh GeneMarkHMM splice5 442717 442718 . - . transcript "54" Adh GeneMarkHMM CDS 442718 442849 . - . transcript "54" Adh GeneMarkHMM stop_codon 442847 442849 . - . transcript "54" Adh GeneMarkHMM start_codon 448386 448388 . + . transcript "55" Adh GeneMarkHMM CDS 448386 448426 . + . transcript "55" Adh GeneMarkHMM splice5 448426 448427 . + . transcript "55" Adh GeneMarkHMM splice3 448466 448467 . + . transcript "55" Adh GeneMarkHMM CDS 448467 448607 . + . transcript "55" Adh GeneMarkHMM splice5 448607 448608 . + . transcript "55" Adh GeneMarkHMM splice3 449014 449015 . + . transcript "55" Adh GeneMarkHMM CDS 449015 449247 . + . transcript "55" Adh GeneMarkHMM splice5 449247 449248 . + . transcript "55" Adh GeneMarkHMM splice3 451666 451667 . + . transcript "55" Adh GeneMarkHMM CDS 451667 451902 . + . transcript "55" Adh GeneMarkHMM splice5 451902 451903 . + . transcript "55" Adh GeneMarkHMM splice3 451944 451945 . + . transcript "55" Adh GeneMarkHMM CDS 451945 452184 . + . transcript "55" Adh GeneMarkHMM stop_codon 452182 452184 . + . transcript "55" Adh GeneMarkHMM start_codon 454209 454211 . + . transcript "56" Adh GeneMarkHMM CDS 454209 454325 . + . transcript "56" Adh GeneMarkHMM splice5 454325 454326 . + . transcript "56" Adh GeneMarkHMM splice3 454580 454581 . + . transcript "56" Adh GeneMarkHMM CDS 454581 454755 . + . transcript "56" Adh GeneMarkHMM splice5 454755 454756 . + . transcript "56" Adh GeneMarkHMM splice3 454813 454814 . + . transcript "56" Adh GeneMarkHMM CDS 454814 454931 . + . transcript "56" Adh GeneMarkHMM splice5 454931 454932 . + . transcript "56" Adh GeneMarkHMM splice3 454998 454999 . + . transcript "56" Adh GeneMarkHMM CDS 454999 455702 . + . transcript "56" Adh GeneMarkHMM splice5 455702 455703 . + . transcript "56" Adh GeneMarkHMM splice3 455869 455870 . + . transcript "56" Adh GeneMarkHMM CDS 455870 456267 . + . transcript "56" Adh GeneMarkHMM stop_codon 456265 456267 . + . transcript "56" Adh GeneMarkHMM start_codon 457298 457300 . + . transcript "57" Adh GeneMarkHMM CDS 457298 457488 . + . transcript "57" Adh GeneMarkHMM splice5 457488 457489 . + . transcript "57" Adh GeneMarkHMM splice3 457648 457649 . + . transcript "57" Adh GeneMarkHMM CDS 457649 458206 . + . transcript "57" Adh GeneMarkHMM splice5 458206 458207 . + . transcript "57" Adh GeneMarkHMM splice3 458284 458285 . + . transcript "57" Adh GeneMarkHMM CDS 458285 458488 . + . transcript "57" Adh GeneMarkHMM splice5 458488 458489 . + . transcript "57" Adh GeneMarkHMM splice3 458546 458547 . + . transcript "57" Adh GeneMarkHMM CDS 458547 458802 . + . transcript "57" Adh GeneMarkHMM stop_codon 458800 458802 . + . transcript "57" Adh GeneMarkHMM stop_codon 458837 458839 . - . transcript "58" Adh GeneMarkHMM CDS 458837 459146 . - . transcript "58" Adh GeneMarkHMM splice3 459146 459147 . - . transcript "58" Adh GeneMarkHMM splice5 459224 459225 . - . transcript "58" Adh GeneMarkHMM CDS 459225 459761 . - . transcript "58" Adh GeneMarkHMM splice3 459761 459762 . - . transcript "58" Adh GeneMarkHMM splice5 460255 460256 . - . transcript "58" Adh GeneMarkHMM CDS 460256 460669 . - . transcript "58" Adh GeneMarkHMM splice3 460669 460670 . - . transcript "58" Adh GeneMarkHMM splice5 461290 461291 . - . transcript "58" Adh GeneMarkHMM CDS 461291 461443 . - . transcript "58" Adh GeneMarkHMM splice3 461443 461444 . - . transcript "58" Adh GeneMarkHMM splice5 461499 461500 . - . transcript "58" Adh GeneMarkHMM CDS 461500 461675 . - . transcript "58" Adh GeneMarkHMM splice3 461675 461676 . - . transcript "58" Adh GeneMarkHMM splice5 462095 462096 . - . transcript "58" Adh GeneMarkHMM CDS 462096 462110 . - . transcript "58" Adh GeneMarkHMM splice3 462110 462111 . - . transcript "58" Adh GeneMarkHMM splice5 462178 462179 . - . transcript "58" Adh GeneMarkHMM CDS 462179 462584 . - . transcript "58" Adh GeneMarkHMM splice3 462584 462585 . - . transcript "58" Adh GeneMarkHMM splice5 462645 462646 . - . transcript "58" Adh GeneMarkHMM CDS 462646 463209 . - . transcript "58" Adh GeneMarkHMM splice3 463209 463210 . - . transcript "58" Adh GeneMarkHMM splice5 463367 463368 . - . transcript "58" Adh GeneMarkHMM CDS 463368 463657 . - . transcript "58" Adh GeneMarkHMM stop_codon 463655 463657 . - . transcript "58" Adh GeneMarkHMM start_codon 464308 464310 . + . transcript "59" Adh GeneMarkHMM CDS 464308 464456 . + . transcript "59" Adh GeneMarkHMM splice5 464456 464457 . + . transcript "59" Adh GeneMarkHMM splice3 464887 464888 . + . transcript "59" Adh GeneMarkHMM CDS 464888 465434 . + . transcript "59" Adh GeneMarkHMM stop_codon 465432 465434 . + . transcript "59" Adh GeneMarkHMM stop_codon 466308 466310 . - . transcript "60" Adh GeneMarkHMM CDS 466308 466360 . - . transcript "60" Adh GeneMarkHMM splice3 466360 466361 . - . transcript "60" Adh GeneMarkHMM splice5 467992 467993 . - . transcript "60" Adh GeneMarkHMM CDS 467993 469610 . - . transcript "60" Adh GeneMarkHMM stop_codon 469608 469610 . - . transcript "60" Adh GeneMarkHMM start_codon 471109 471111 . + . transcript "61" Adh GeneMarkHMM CDS 471109 471296 . + . transcript "61" Adh GeneMarkHMM splice5 471296 471297 . + . transcript "61" Adh GeneMarkHMM splice3 471440 471441 . + . transcript "61" Adh GeneMarkHMM CDS 471441 471687 . + . transcript "61" Adh GeneMarkHMM splice5 471687 471688 . + . transcript "61" Adh GeneMarkHMM splice3 471751 471752 . + . transcript "61" Adh GeneMarkHMM CDS 471752 471856 . + . transcript "61" Adh GeneMarkHMM splice5 471856 471857 . + . transcript "61" Adh GeneMarkHMM splice3 471943 471944 . + . transcript "61" Adh GeneMarkHMM CDS 471944 472490 . + . transcript "61" Adh GeneMarkHMM splice5 472490 472491 . + . transcript "61" Adh GeneMarkHMM splice3 472556 472557 . + . transcript "61" Adh GeneMarkHMM CDS 472557 472823 . + . transcript "61" Adh GeneMarkHMM splice5 472823 472824 . + . transcript "61" Adh GeneMarkHMM splice3 472964 472965 . + . transcript "61" Adh GeneMarkHMM CDS 472965 473128 . + . transcript "61" Adh GeneMarkHMM stop_codon 473126 473128 . + . transcript "61" Adh GeneMarkHMM start_codon 474097 474099 . + . transcript "62" Adh GeneMarkHMM CDS 474097 474189 . + . transcript "62" Adh GeneMarkHMM splice5 474189 474190 . + . transcript "62" Adh GeneMarkHMM splice3 474250 474251 . + . transcript "62" Adh GeneMarkHMM CDS 474251 474306 . + . transcript "62" Adh GeneMarkHMM splice5 474306 474307 . + . transcript "62" Adh GeneMarkHMM splice3 474364 474365 . + . transcript "62" Adh GeneMarkHMM CDS 474365 475283 . + . transcript "62" Adh GeneMarkHMM splice5 475283 475284 . + . transcript "62" Adh GeneMarkHMM splice3 475426 475427 . + . transcript "62" Adh GeneMarkHMM CDS 475427 476389 . + . transcript "62" Adh GeneMarkHMM stop_codon 476387 476389 . + . transcript "62" Adh GeneMarkHMM stop_codon 477171 477173 . - . transcript "63" Adh GeneMarkHMM CDS 477171 477490 . - . transcript "63" Adh GeneMarkHMM splice3 477490 477491 . - . transcript "63" Adh GeneMarkHMM splice5 477547 477548 . - . transcript "63" Adh GeneMarkHMM CDS 477548 479329 . - . transcript "63" Adh GeneMarkHMM splice3 479329 479330 . - . transcript "63" Adh GeneMarkHMM splice5 479385 479386 . - . transcript "63" Adh GeneMarkHMM CDS 479386 479753 . - . transcript "63" Adh GeneMarkHMM splice3 479753 479754 . - . transcript "63" Adh GeneMarkHMM splice5 479814 479815 . - . transcript "63" Adh GeneMarkHMM CDS 479815 479958 . - . transcript "63" Adh GeneMarkHMM splice3 479958 479959 . - . transcript "63" Adh GeneMarkHMM splice5 480015 480016 . - . transcript "63" Adh GeneMarkHMM CDS 480016 480081 . - . transcript "63" Adh GeneMarkHMM splice3 480081 480082 . - . transcript "63" Adh GeneMarkHMM splice5 480146 480147 . - . transcript "63" Adh GeneMarkHMM CDS 480147 480287 . - . transcript "63" Adh GeneMarkHMM splice3 480287 480288 . - . transcript "63" Adh GeneMarkHMM splice5 480342 480343 . - . transcript "63" Adh GeneMarkHMM CDS 480343 480480 . - . transcript "63" Adh GeneMarkHMM splice3 480480 480481 . - . transcript "63" Adh GeneMarkHMM splice5 481569 481570 . - . transcript "63" Adh GeneMarkHMM CDS 481570 481638 . - . transcript "63" Adh GeneMarkHMM splice3 481638 481639 . - . transcript "63" Adh GeneMarkHMM splice5 484194 484195 . - . transcript "63" Adh GeneMarkHMM CDS 484195 484338 . - . transcript "63" Adh GeneMarkHMM splice3 484338 484339 . - . transcript "63" Adh GeneMarkHMM splice5 484663 484664 . - . transcript "63" Adh GeneMarkHMM CDS 484664 484807 . - . transcript "63" Adh GeneMarkHMM splice3 484807 484808 . - . transcript "63" Adh GeneMarkHMM splice5 485390 485391 . - . transcript "63" Adh GeneMarkHMM CDS 485391 485462 . - . transcript "63" Adh GeneMarkHMM splice3 485462 485463 . - . transcript "63" Adh GeneMarkHMM splice5 486685 486686 . - . transcript "63" Adh GeneMarkHMM CDS 486686 487143 . - . transcript "63" Adh GeneMarkHMM stop_codon 487141 487143 . - . transcript "63" Adh GeneMarkHMM start_codon 509545 509547 . + . transcript "64" Adh GeneMarkHMM CDS 509545 509783 . + . transcript "64" Adh GeneMarkHMM splice5 509783 509784 . + . transcript "64" Adh GeneMarkHMM splice3 509880 509881 . + . transcript "64" Adh GeneMarkHMM CDS 509881 510226 . + . transcript "64" Adh GeneMarkHMM splice5 510226 510227 . + . transcript "64" Adh GeneMarkHMM splice3 510286 510287 . + . transcript "64" Adh GeneMarkHMM CDS 510287 510786 . + . transcript "64" Adh GeneMarkHMM splice5 510786 510787 . + . transcript "64" Adh GeneMarkHMM splice3 511783 511784 . + . transcript "64" Adh GeneMarkHMM CDS 511784 512375 . + . transcript "64" Adh GeneMarkHMM splice5 512375 512376 . + . transcript "64" Adh GeneMarkHMM splice3 512434 512435 . + . transcript "64" Adh GeneMarkHMM CDS 512435 512758 . + . transcript "64" Adh GeneMarkHMM stop_codon 512756 512758 . + . transcript "64" Adh GeneMarkHMM stop_codon 513238 513240 . - . transcript "65" Adh GeneMarkHMM CDS 513238 513921 . - . transcript "65" Adh GeneMarkHMM stop_codon 513919 513921 . - . transcript "65" Adh GeneMarkHMM start_codon 520781 520783 . + . transcript "66" Adh GeneMarkHMM CDS 520781 521850 . + . transcript "66" Adh GeneMarkHMM splice5 521850 521851 . + . transcript "66" Adh GeneMarkHMM splice3 522012 522013 . + . transcript "66" Adh GeneMarkHMM CDS 522013 522988 . + . transcript "66" Adh GeneMarkHMM stop_codon 522986 522988 . + . transcript "66" Adh GeneMarkHMM stop_codon 523149 523151 . - . transcript "67" Adh GeneMarkHMM CDS 523149 523205 . - . transcript "67" Adh GeneMarkHMM splice3 523205 523206 . - . transcript "67" Adh GeneMarkHMM splice5 523403 523404 . - . transcript "67" Adh GeneMarkHMM CDS 523404 523601 . - . transcript "67" Adh GeneMarkHMM splice3 523601 523602 . - . transcript "67" Adh GeneMarkHMM splice5 523659 523660 . - . transcript "67" Adh GeneMarkHMM CDS 523660 524253 . - . transcript "67" Adh GeneMarkHMM splice3 524253 524254 . - . transcript "67" Adh GeneMarkHMM splice5 524437 524438 . - . transcript "67" Adh GeneMarkHMM CDS 524438 525283 . - . transcript "67" Adh GeneMarkHMM stop_codon 525281 525283 . - . transcript "67" Adh GeneMarkHMM start_codon 527046 527048 . + . transcript "68" Adh GeneMarkHMM CDS 527046 527116 . + . transcript "68" Adh GeneMarkHMM splice5 527116 527117 . + . transcript "68" Adh GeneMarkHMM splice3 528098 528099 . + . transcript "68" Adh GeneMarkHMM CDS 528099 528231 . + . transcript "68" Adh GeneMarkHMM stop_codon 528229 528231 . + . transcript "68" Adh GeneMarkHMM stop_codon 532974 532976 . - . transcript "69" Adh GeneMarkHMM CDS 532974 533068 . - . transcript "69" Adh GeneMarkHMM splice3 533068 533069 . - . transcript "69" Adh GeneMarkHMM splice5 536669 536670 . - . transcript "69" Adh GeneMarkHMM CDS 536670 536913 . - . transcript "69" Adh GeneMarkHMM stop_codon 536911 536913 . - . transcript "69" Adh GeneMarkHMM start_codon 541380 541382 . + . transcript "70" Adh GeneMarkHMM CDS 541380 542513 . + . transcript "70" Adh GeneMarkHMM stop_codon 542511 542513 . + . transcript "70" Adh GeneMarkHMM stop_codon 544950 544952 . - . transcript "71" Adh GeneMarkHMM CDS 544950 545051 . - . transcript "71" Adh GeneMarkHMM splice3 545051 545052 . - . transcript "71" Adh GeneMarkHMM splice5 553887 553888 . - . transcript "71" Adh GeneMarkHMM CDS 553888 554016 . - . transcript "71" Adh GeneMarkHMM stop_codon 554014 554016 . - . transcript "71" Adh GeneMarkHMM start_codon 555360 555362 . + . transcript "72" Adh GeneMarkHMM CDS 555360 555824 . + . transcript "72" Adh GeneMarkHMM splice5 555824 555825 . + . transcript "72" Adh GeneMarkHMM splice3 555919 555920 . + . transcript "72" Adh GeneMarkHMM CDS 555920 556168 . + . transcript "72" Adh GeneMarkHMM splice5 556168 556169 . + . transcript "72" Adh GeneMarkHMM splice3 556227 556228 . + . transcript "72" Adh GeneMarkHMM CDS 556228 556260 . + . transcript "72" Adh GeneMarkHMM stop_codon 556258 556260 . + . transcript "72" Adh GeneMarkHMM start_codon 570015 570017 . + . transcript "73" Adh GeneMarkHMM CDS 570015 570098 . + . transcript "73" Adh GeneMarkHMM splice5 570098 570099 . + . transcript "73" Adh GeneMarkHMM splice3 570328 570329 . + . transcript "73" Adh GeneMarkHMM CDS 570329 570703 . + . transcript "73" Adh GeneMarkHMM splice5 570703 570704 . + . transcript "73" Adh GeneMarkHMM splice3 570871 570872 . + . transcript "73" Adh GeneMarkHMM CDS 570872 570947 . + . transcript "73" Adh GeneMarkHMM splice5 570947 570948 . + . transcript "73" Adh GeneMarkHMM splice3 574288 574289 . + . transcript "73" Adh GeneMarkHMM CDS 574289 574465 . + . transcript "73" Adh GeneMarkHMM splice5 574465 574466 . + . transcript "73" Adh GeneMarkHMM splice3 575408 575409 . + . transcript "73" Adh GeneMarkHMM CDS 575409 575533 . + . transcript "73" Adh GeneMarkHMM stop_codon 575531 575533 . + . transcript "73" Adh GeneMarkHMM stop_codon 581722 581724 . - . transcript "74" Adh GeneMarkHMM CDS 581722 581866 . - . transcript "74" Adh GeneMarkHMM splice3 581866 581867 . - . transcript "74" Adh GeneMarkHMM splice5 589627 589628 . - . transcript "74" Adh GeneMarkHMM CDS 589628 589720 . - . transcript "74" Adh GeneMarkHMM splice3 589720 589721 . - . transcript "74" Adh GeneMarkHMM splice5 590104 590105 . - . transcript "74" Adh GeneMarkHMM CDS 590105 590169 . - . transcript "74" Adh GeneMarkHMM stop_codon 590167 590169 . - . transcript "74" Adh GeneMarkHMM start_codon 598403 598405 . + . transcript "75" Adh GeneMarkHMM CDS 598403 598796 . + . transcript "75" Adh GeneMarkHMM splice5 598796 598797 . + . transcript "75" Adh GeneMarkHMM splice3 598856 598857 . + . transcript "75" Adh GeneMarkHMM CDS 598857 599119 . + . transcript "75" Adh GeneMarkHMM splice5 599119 599120 . + . transcript "75" Adh GeneMarkHMM splice3 599218 599219 . + . transcript "75" Adh GeneMarkHMM CDS 599219 600433 . + . transcript "75" Adh GeneMarkHMM stop_codon 600431 600433 . + . transcript "75" Adh GeneMarkHMM stop_codon 601945 601947 . - . transcript "76" Adh GeneMarkHMM CDS 601945 602889 . - . transcript "76" Adh GeneMarkHMM splice3 602889 602890 . - . transcript "76" Adh GeneMarkHMM splice5 602943 602944 . - . transcript "76" Adh GeneMarkHMM CDS 602944 603029 . - . transcript "76" Adh GeneMarkHMM splice3 603029 603030 . - . transcript "76" Adh GeneMarkHMM splice5 603476 603477 . - . transcript "76" Adh GeneMarkHMM CDS 603477 604158 . - . transcript "76" Adh GeneMarkHMM stop_codon 604156 604158 . - . transcript "76" Adh GeneMarkHMM stop_codon 620744 620746 . - . transcript "77" Adh GeneMarkHMM CDS 620744 620960 . - . transcript "77" Adh GeneMarkHMM splice3 620960 620961 . - . transcript "77" Adh GeneMarkHMM splice5 622932 622933 . - . transcript "77" Adh GeneMarkHMM CDS 622933 623026 . - . transcript "77" Adh GeneMarkHMM splice3 623026 623027 . - . transcript "77" Adh GeneMarkHMM splice5 623089 623090 . - . transcript "77" Adh GeneMarkHMM CDS 623090 623174 . - . transcript "77" Adh GeneMarkHMM stop_codon 623172 623174 . - . transcript "77" Adh GeneMarkHMM start_codon 647744 647746 . + . transcript "78" Adh GeneMarkHMM CDS 647744 647830 . + . transcript "78" Adh GeneMarkHMM splice5 647830 647831 . + . transcript "78" Adh GeneMarkHMM splice3 650610 650611 . + . transcript "78" Adh GeneMarkHMM CDS 650611 651153 . + . transcript "78" Adh GeneMarkHMM splice5 651153 651154 . + . transcript "78" Adh GeneMarkHMM splice3 651277 651278 . + . transcript "78" Adh GeneMarkHMM CDS 651278 651478 . + . transcript "78" Adh GeneMarkHMM splice5 651478 651479 . + . transcript "78" Adh GeneMarkHMM splice3 651582 651583 . + . transcript "78" Adh GeneMarkHMM CDS 651583 652282 . + . transcript "78" Adh GeneMarkHMM splice5 652282 652283 . + . transcript "78" Adh GeneMarkHMM splice3 652396 652397 . + . transcript "78" Adh GeneMarkHMM CDS 652397 652824 . + . transcript "78" Adh GeneMarkHMM stop_codon 652822 652824 . + . transcript "78" Adh GeneMarkHMM stop_codon 654984 654986 . - . transcript "79" Adh GeneMarkHMM CDS 654984 656089 . - . transcript "79" Adh GeneMarkHMM splice3 656089 656090 . - . transcript "79" Adh GeneMarkHMM splice5 656164 656165 . - . transcript "79" Adh GeneMarkHMM CDS 656165 656741 . - . transcript "79" Adh GeneMarkHMM splice3 656741 656742 . - . transcript "79" Adh GeneMarkHMM splice5 657723 657724 . - . transcript "79" Adh GeneMarkHMM CDS 657724 658001 . - . transcript "79" Adh GeneMarkHMM splice3 658001 658002 . - . transcript "79" Adh GeneMarkHMM splice5 658057 658058 . - . transcript "79" Adh GeneMarkHMM CDS 658058 658265 . - . transcript "79" Adh GeneMarkHMM splice3 658265 658266 . - . transcript "79" Adh GeneMarkHMM splice5 658325 658326 . - . transcript "79" Adh GeneMarkHMM CDS 658326 658463 . - . transcript "79" Adh GeneMarkHMM splice3 658463 658464 . - . transcript "79" Adh GeneMarkHMM splice5 658525 658526 . - . transcript "79" Adh GeneMarkHMM CDS 658526 660852 . - . transcript "79" Adh GeneMarkHMM splice3 660852 660853 . - . transcript "79" Adh GeneMarkHMM splice5 660916 660917 . - . transcript "79" Adh GeneMarkHMM CDS 660917 661331 . - . transcript "79" Adh GeneMarkHMM splice3 661331 661332 . - . transcript "79" Adh GeneMarkHMM splice5 662946 662947 . - . transcript "79" Adh GeneMarkHMM CDS 662947 662971 . - . transcript "79" Adh GeneMarkHMM splice3 662971 662972 . - . transcript "79" Adh GeneMarkHMM splice5 664034 664035 . - . transcript "79" Adh GeneMarkHMM CDS 664035 664204 . - . transcript "79" Adh GeneMarkHMM stop_codon 664202 664204 . - . transcript "79" Adh GeneMarkHMM start_codon 672131 672133 . + . transcript "80" Adh GeneMarkHMM CDS 672131 672241 . + . transcript "80" Adh GeneMarkHMM splice5 672241 672242 . + . transcript "80" Adh GeneMarkHMM splice3 672514 672515 . + . transcript "80" Adh GeneMarkHMM CDS 672515 672520 . + . transcript "80" Adh GeneMarkHMM stop_codon 672518 672520 . + . transcript "80" Adh GeneMarkHMM stop_codon 679874 679876 . - . transcript "81" Adh GeneMarkHMM CDS 679874 680889 . - . transcript "81" Adh GeneMarkHMM splice3 680889 680890 . - . transcript "81" Adh GeneMarkHMM splice5 681904 681905 . - . transcript "81" Adh GeneMarkHMM CDS 681905 682015 . - . transcript "81" Adh GeneMarkHMM splice3 682015 682016 . - . transcript "81" Adh GeneMarkHMM splice5 682599 682600 . - . transcript "81" Adh GeneMarkHMM CDS 682600 682750 . - . transcript "81" Adh GeneMarkHMM splice3 682750 682751 . - . transcript "81" Adh GeneMarkHMM splice5 682830 682831 . - . transcript "81" Adh GeneMarkHMM CDS 682831 682969 . - . transcript "81" Adh GeneMarkHMM splice3 682969 682970 . - . transcript "81" Adh GeneMarkHMM splice5 689468 689469 . - . transcript "81" Adh GeneMarkHMM CDS 689469 689746 . - . transcript "81" Adh GeneMarkHMM splice3 689746 689747 . - . transcript "81" Adh GeneMarkHMM splice5 689810 689811 . - . transcript "81" Adh GeneMarkHMM CDS 689811 689983 . - . transcript "81" Adh GeneMarkHMM splice3 689983 689984 . - . transcript "81" Adh GeneMarkHMM splice5 690662 690663 . - . transcript "81" Adh GeneMarkHMM CDS 690663 691029 . - . transcript "81" Adh GeneMarkHMM splice3 691029 691030 . - . transcript "81" Adh GeneMarkHMM splice5 691392 691393 . - . transcript "81" Adh GeneMarkHMM CDS 691393 691416 . - . transcript "81" Adh GeneMarkHMM stop_codon 691414 691416 . - . transcript "81" Adh GeneMarkHMM start_codon 720335 720337 . + . transcript "82" Adh GeneMarkHMM CDS 720335 720408 . + . transcript "82" Adh GeneMarkHMM splice5 720408 720409 . + . transcript "82" Adh GeneMarkHMM splice3 720478 720479 . + . transcript "82" Adh GeneMarkHMM CDS 720479 720493 . + . transcript "82" Adh GeneMarkHMM splice5 720493 720494 . + . transcript "82" Adh GeneMarkHMM splice3 720756 720757 . + . transcript "82" Adh GeneMarkHMM CDS 720757 720823 . + . transcript "82" Adh GeneMarkHMM stop_codon 720821 720823 . + . transcript "82" Adh GeneMarkHMM start_codon 757457 757459 . + . transcript "83" Adh GeneMarkHMM CDS 757457 757859 . + . transcript "83" Adh GeneMarkHMM splice5 757859 757860 . + . transcript "83" Adh GeneMarkHMM splice3 758123 758124 . + . transcript "83" Adh GeneMarkHMM CDS 758124 758188 . + . transcript "83" Adh GeneMarkHMM stop_codon 758186 758188 . + . transcript "83" Adh GeneMarkHMM stop_codon 763773 763775 . - . transcript "84" Adh GeneMarkHMM CDS 763773 763859 . - . transcript "84" Adh GeneMarkHMM splice3 763859 763860 . - . transcript "84" Adh GeneMarkHMM splice5 767648 767649 . - . transcript "84" Adh GeneMarkHMM CDS 767649 767787 . - . transcript "84" Adh GeneMarkHMM splice3 767787 767788 . - . transcript "84" Adh GeneMarkHMM splice5 767843 767844 . - . transcript "84" Adh GeneMarkHMM CDS 767844 768100 . - . transcript "84" Adh GeneMarkHMM stop_codon 768098 768100 . - . transcript "84" Adh GeneMarkHMM start_codon 771216 771218 . + . transcript "85" Adh GeneMarkHMM CDS 771216 771615 . + . transcript "85" Adh GeneMarkHMM splice5 771615 771616 . + . transcript "85" Adh GeneMarkHMM splice3 771954 771955 . + . transcript "85" Adh GeneMarkHMM CDS 771955 772295 . + . transcript "85" Adh GeneMarkHMM splice5 772295 772296 . + . transcript "85" Adh GeneMarkHMM splice3 779691 779692 . + . transcript "85" Adh GeneMarkHMM CDS 779692 781583 . + . transcript "85" Adh GeneMarkHMM splice5 781583 781584 . + . transcript "85" Adh GeneMarkHMM splice3 781885 781886 . + . transcript "85" Adh GeneMarkHMM CDS 781886 782726 . + . transcript "85" Adh GeneMarkHMM stop_codon 782724 782726 . + . transcript "85" Adh GeneMarkHMM start_codon 801999 802001 . + . transcript "86" Adh GeneMarkHMM CDS 801999 802914 . + . transcript "86" Adh GeneMarkHMM splice5 802914 802915 . + . transcript "86" Adh GeneMarkHMM splice3 813290 813291 . + . transcript "86" Adh GeneMarkHMM CDS 813291 814650 . + . transcript "86" Adh GeneMarkHMM splice5 814650 814651 . + . transcript "86" Adh GeneMarkHMM splice3 814725 814726 . + . transcript "86" Adh GeneMarkHMM CDS 814726 814981 . + . transcript "86" Adh GeneMarkHMM splice5 814981 814982 . + . transcript "86" Adh GeneMarkHMM splice3 815045 815046 . + . transcript "86" Adh GeneMarkHMM CDS 815046 815442 . + . transcript "86" Adh GeneMarkHMM splice5 815442 815443 . + . transcript "86" Adh GeneMarkHMM splice3 815527 815528 . + . transcript "86" Adh GeneMarkHMM CDS 815528 817215 . + . transcript "86" Adh GeneMarkHMM splice5 817215 817216 . + . transcript "86" Adh GeneMarkHMM splice3 817272 817273 . + . transcript "86" Adh GeneMarkHMM CDS 817273 818025 . + . transcript "86" Adh GeneMarkHMM splice5 818025 818026 . + . transcript "86" Adh GeneMarkHMM splice3 818085 818086 . + . transcript "86" Adh GeneMarkHMM CDS 818086 818367 . + . transcript "86" Adh GeneMarkHMM splice5 818367 818368 . + . transcript "86" Adh GeneMarkHMM splice3 818446 818447 . + . transcript "86" Adh GeneMarkHMM CDS 818447 818574 . + . transcript "86" Adh GeneMarkHMM splice5 818574 818575 . + . transcript "86" Adh GeneMarkHMM splice3 818632 818633 . + . transcript "86" Adh GeneMarkHMM CDS 818633 819290 . + . transcript "86" Adh GeneMarkHMM splice5 819290 819291 . + . transcript "86" Adh GeneMarkHMM splice3 820170 820171 . + . transcript "86" Adh GeneMarkHMM CDS 820171 820789 . + . transcript "86" Adh GeneMarkHMM splice5 820789 820790 . + . transcript "86" Adh GeneMarkHMM splice3 820845 820846 . + . transcript "86" Adh GeneMarkHMM CDS 820846 820979 . + . transcript "86" Adh GeneMarkHMM splice5 820979 820980 . + . transcript "86" Adh GeneMarkHMM splice3 821036 821037 . + . transcript "86" Adh GeneMarkHMM CDS 821037 821265 . + . transcript "86" Adh GeneMarkHMM splice5 821265 821266 . + . transcript "86" Adh GeneMarkHMM splice3 821332 821333 . + . transcript "86" Adh GeneMarkHMM CDS 821333 821487 . + . transcript "86" Adh GeneMarkHMM stop_codon 821485 821487 . + . transcript "86" Adh GeneMarkHMM start_codon 822205 822207 . + . transcript "87" Adh GeneMarkHMM CDS 822205 822454 . + . transcript "87" Adh GeneMarkHMM splice5 822454 822455 . + . transcript "87" Adh GeneMarkHMM splice3 822510 822511 . + . transcript "87" Adh GeneMarkHMM CDS 822511 822848 . + . transcript "87" Adh GeneMarkHMM splice5 822848 822849 . + . transcript "87" Adh GeneMarkHMM splice3 822906 822907 . + . transcript "87" Adh GeneMarkHMM CDS 822907 824011 . + . transcript "87" Adh GeneMarkHMM splice5 824011 824012 . + . transcript "87" Adh GeneMarkHMM splice3 824073 824074 . + . transcript "87" Adh GeneMarkHMM CDS 824074 824822 . + . transcript "87" Adh GeneMarkHMM splice5 824822 824823 . + . transcript "87" Adh GeneMarkHMM splice3 824884 824885 . + . transcript "87" Adh GeneMarkHMM CDS 824885 825688 . + . transcript "87" Adh GeneMarkHMM splice5 825688 825689 . + . transcript "87" Adh GeneMarkHMM splice3 825803 825804 . + . transcript "87" Adh GeneMarkHMM CDS 825804 826423 . + . transcript "87" Adh GeneMarkHMM splice5 826423 826424 . + . transcript "87" Adh GeneMarkHMM splice3 826498 826499 . + . transcript "87" Adh GeneMarkHMM CDS 826499 826533 . + . transcript "87" Adh GeneMarkHMM splice5 826533 826534 . + . transcript "87" Adh GeneMarkHMM splice3 826921 826922 . + . transcript "87" Adh GeneMarkHMM CDS 826922 827087 . + . transcript "87" Adh GeneMarkHMM splice5 827087 827088 . + . transcript "87" Adh GeneMarkHMM splice3 827147 827148 . + . transcript "87" Adh GeneMarkHMM CDS 827148 827511 . + . transcript "87" Adh GeneMarkHMM stop_codon 827509 827511 . + . transcript "87" Adh GeneMarkHMM start_codon 828047 828049 . + . transcript "88" Adh GeneMarkHMM CDS 828047 828289 . + . transcript "88" Adh GeneMarkHMM splice5 828289 828290 . + . transcript "88" Adh GeneMarkHMM splice3 828733 828734 . + . transcript "88" Adh GeneMarkHMM CDS 828734 828739 . + . transcript "88" Adh GeneMarkHMM stop_codon 828737 828739 . + . transcript "88" Adh GeneMarkHMM start_codon 832137 832139 . + . transcript "89" Adh GeneMarkHMM CDS 832137 833668 . + . transcript "89" Adh GeneMarkHMM splice5 833668 833669 . + . transcript "89" Adh GeneMarkHMM splice3 835042 835043 . + . transcript "89" Adh GeneMarkHMM CDS 835043 835312 . + . transcript "89" Adh GeneMarkHMM splice5 835312 835313 . + . transcript "89" Adh GeneMarkHMM splice3 836513 836514 . + . transcript "89" Adh GeneMarkHMM CDS 836514 837106 . + . transcript "89" Adh GeneMarkHMM splice5 837106 837107 . + . transcript "89" Adh GeneMarkHMM splice3 837172 837173 . + . transcript "89" Adh GeneMarkHMM CDS 837173 837428 . + . transcript "89" Adh GeneMarkHMM splice5 837428 837429 . + . transcript "89" Adh GeneMarkHMM splice3 837485 837486 . + . transcript "89" Adh GeneMarkHMM CDS 837486 837859 . + . transcript "89" Adh GeneMarkHMM splice5 837859 837860 . + . transcript "89" Adh GeneMarkHMM splice3 837918 837919 . + . transcript "89" Adh GeneMarkHMM CDS 837919 838152 . + . transcript "89" Adh GeneMarkHMM splice5 838152 838153 . + . transcript "89" Adh GeneMarkHMM splice3 838216 838217 . + . transcript "89" Adh GeneMarkHMM CDS 838217 839076 . + . transcript "89" Adh GeneMarkHMM stop_codon 839074 839076 . + . transcript "89" Adh GeneMarkHMM stop_codon 839723 839725 . - . transcript "90" Adh GeneMarkHMM CDS 839723 839740 . - . transcript "90" Adh GeneMarkHMM splice3 839740 839741 . - . transcript "90" Adh GeneMarkHMM splice5 839796 839797 . - . transcript "90" Adh GeneMarkHMM CDS 839797 840448 . - . transcript "90" Adh GeneMarkHMM splice3 840448 840449 . - . transcript "90" Adh GeneMarkHMM splice5 841060 841061 . - . transcript "90" Adh GeneMarkHMM CDS 841061 841127 . - . transcript "90" Adh GeneMarkHMM splice3 841127 841128 . - . transcript "90" Adh GeneMarkHMM splice5 841203 841204 . - . transcript "90" Adh GeneMarkHMM CDS 841204 841333 . - . transcript "90" Adh GeneMarkHMM splice3 841333 841334 . - . transcript "90" Adh GeneMarkHMM splice5 841388 841389 . - . transcript "90" Adh GeneMarkHMM CDS 841389 841969 . - . transcript "90" Adh GeneMarkHMM splice3 841969 841970 . - . transcript "90" Adh GeneMarkHMM splice5 842033 842034 . - . transcript "90" Adh GeneMarkHMM CDS 842034 842419 . - . transcript "90" Adh GeneMarkHMM splice3 842419 842420 . - . transcript "90" Adh GeneMarkHMM splice5 842971 842972 . - . transcript "90" Adh GeneMarkHMM CDS 842972 843375 . - . transcript "90" Adh GeneMarkHMM splice3 843375 843376 . - . transcript "90" Adh GeneMarkHMM splice5 843444 843445 . - . transcript "90" Adh GeneMarkHMM CDS 843445 843516 . - . transcript "90" Adh GeneMarkHMM stop_codon 843514 843516 . - . transcript "90" Adh GeneMarkHMM start_codon 845892 845894 . + . transcript "91" Adh GeneMarkHMM CDS 845892 846081 . + . transcript "91" Adh GeneMarkHMM splice5 846081 846082 . + . transcript "91" Adh GeneMarkHMM splice3 846133 846134 . + . transcript "91" Adh GeneMarkHMM CDS 846134 846339 . + . transcript "91" Adh GeneMarkHMM stop_codon 846337 846339 . + . transcript "91" Adh GeneMarkHMM stop_codon 846397 846399 . - . transcript "92" Adh GeneMarkHMM CDS 846397 847372 . - . transcript "92" Adh GeneMarkHMM splice3 847372 847373 . - . transcript "92" Adh GeneMarkHMM splice5 847432 847433 . - . transcript "92" Adh GeneMarkHMM CDS 847433 848154 . - . transcript "92" Adh GeneMarkHMM splice3 848154 848155 . - . transcript "92" Adh GeneMarkHMM splice5 848207 848208 . - . transcript "92" Adh GeneMarkHMM CDS 848208 848609 . - . transcript "92" Adh GeneMarkHMM splice3 848609 848610 . - . transcript "92" Adh GeneMarkHMM splice5 848667 848668 . - . transcript "92" Adh GeneMarkHMM CDS 848668 848733 . - . transcript "92" Adh GeneMarkHMM stop_codon 848731 848733 . - . transcript "92" Adh GeneMarkHMM start_codon 850944 850946 . + . transcript "93" Adh GeneMarkHMM CDS 850944 851007 . + . transcript "93" Adh GeneMarkHMM splice5 851007 851008 . + . transcript "93" Adh GeneMarkHMM splice3 851076 851077 . + . transcript "93" Adh GeneMarkHMM CDS 851077 851190 . + . transcript "93" Adh GeneMarkHMM splice5 851190 851191 . + . transcript "93" Adh GeneMarkHMM splice3 851255 851256 . + . transcript "93" Adh GeneMarkHMM CDS 851256 851436 . + . transcript "93" Adh GeneMarkHMM splice5 851436 851437 . + . transcript "93" Adh GeneMarkHMM splice3 851490 851491 . + . transcript "93" Adh GeneMarkHMM CDS 851491 851673 . + . transcript "93" Adh GeneMarkHMM splice5 851673 851674 . + . transcript "93" Adh GeneMarkHMM splice3 851741 851742 . + . transcript "93" Adh GeneMarkHMM CDS 851742 851919 . + . transcript "93" Adh GeneMarkHMM stop_codon 851917 851919 . + . transcript "93" Adh GeneMarkHMM start_codon 853119 853121 . + . transcript "94" Adh GeneMarkHMM CDS 853119 855014 . + . transcript "94" Adh GeneMarkHMM stop_codon 855012 855014 . + . transcript "94" Adh GeneMarkHMM start_codon 855874 855876 . + . transcript "95" Adh GeneMarkHMM CDS 855874 855922 . + . transcript "95" Adh GeneMarkHMM splice5 855922 855923 . + . transcript "95" Adh GeneMarkHMM splice3 855981 855982 . + . transcript "95" Adh GeneMarkHMM CDS 855982 856031 . + . transcript "95" Adh GeneMarkHMM splice5 856031 856032 . + . transcript "95" Adh GeneMarkHMM splice3 856091 856092 . + . transcript "95" Adh GeneMarkHMM CDS 856092 856876 . + . transcript "95" Adh GeneMarkHMM splice5 856876 856877 . + . transcript "95" Adh GeneMarkHMM splice3 856941 856942 . + . transcript "95" Adh GeneMarkHMM CDS 856942 858029 . + . transcript "95" Adh GeneMarkHMM splice5 858029 858030 . + . transcript "95" Adh GeneMarkHMM splice3 858108 858109 . + . transcript "95" Adh GeneMarkHMM CDS 858109 858341 . + . transcript "95" Adh GeneMarkHMM splice5 858341 858342 . + . transcript "95" Adh GeneMarkHMM splice3 858417 858418 . + . transcript "95" Adh GeneMarkHMM CDS 858418 858966 . + . transcript "95" Adh GeneMarkHMM stop_codon 858964 858966 . + . transcript "95" Adh GeneMarkHMM stop_codon 870684 870686 . - . transcript "96" Adh GeneMarkHMM CDS 870684 870869 . - . transcript "96" Adh GeneMarkHMM splice3 870869 870870 . - . transcript "96" Adh GeneMarkHMM splice5 872589 872590 . - . transcript "96" Adh GeneMarkHMM CDS 872590 872818 . - . transcript "96" Adh GeneMarkHMM splice3 872818 872819 . - . transcript "96" Adh GeneMarkHMM splice5 872890 872891 . - . transcript "96" Adh GeneMarkHMM CDS 872891 873131 . - . transcript "96" Adh GeneMarkHMM splice3 873131 873132 . - . transcript "96" Adh GeneMarkHMM splice5 873190 873191 . - . transcript "96" Adh GeneMarkHMM CDS 873191 873321 . - . transcript "96" Adh GeneMarkHMM splice3 873321 873322 . - . transcript "96" Adh GeneMarkHMM splice5 873387 873388 . - . transcript "96" Adh GeneMarkHMM CDS 873388 873527 . - . transcript "96" Adh GeneMarkHMM splice3 873527 873528 . - . transcript "96" Adh GeneMarkHMM splice5 873582 873583 . - . transcript "96" Adh GeneMarkHMM CDS 873583 874124 . - . transcript "96" Adh GeneMarkHMM splice3 874124 874125 . - . transcript "96" Adh GeneMarkHMM splice5 874272 874273 . - . transcript "96" Adh GeneMarkHMM CDS 874273 874541 . - . transcript "96" Adh GeneMarkHMM splice3 874541 874542 . - . transcript "96" Adh GeneMarkHMM splice5 874598 874599 . - . transcript "96" Adh GeneMarkHMM CDS 874599 874870 . - . transcript "96" Adh GeneMarkHMM stop_codon 874868 874870 . - . transcript "96" Adh GeneMarkHMM stop_codon 880859 880861 . - . transcript "97" Adh GeneMarkHMM CDS 880859 881091 . - . transcript "97" Adh GeneMarkHMM splice3 881091 881092 . - . transcript "97" Adh GeneMarkHMM splice5 883001 883002 . - . transcript "97" Adh GeneMarkHMM CDS 883002 883306 . - . transcript "97" Adh GeneMarkHMM splice3 883306 883307 . - . transcript "97" Adh GeneMarkHMM splice5 884916 884917 . - . transcript "97" Adh GeneMarkHMM CDS 884917 885676 . - . transcript "97" Adh GeneMarkHMM splice3 885676 885677 . - . transcript "97" Adh GeneMarkHMM splice5 885966 885967 . - . transcript "97" Adh GeneMarkHMM CDS 885967 886798 . - . transcript "97" Adh GeneMarkHMM splice3 886798 886799 . - . transcript "97" Adh GeneMarkHMM splice5 892141 892142 . - . transcript "97" Adh GeneMarkHMM CDS 892142 892189 . - . transcript "97" Adh GeneMarkHMM stop_codon 892187 892189 . - . transcript "97" Adh GeneMarkHMM stop_codon 909825 909827 . - . transcript "98" Adh GeneMarkHMM CDS 909825 909970 . - . transcript "98" Adh GeneMarkHMM splice3 909970 909971 . - . transcript "98" Adh GeneMarkHMM splice5 910576 910577 . - . transcript "98" Adh GeneMarkHMM CDS 910577 910742 . - . transcript "98" Adh GeneMarkHMM splice3 910742 910743 . - . transcript "98" Adh GeneMarkHMM splice5 910800 910801 . - . transcript "98" Adh GeneMarkHMM CDS 910801 911055 . - . transcript "98" Adh GeneMarkHMM stop_codon 911053 911055 . - . transcript "98" Adh GeneMarkHMM stop_codon 918151 918153 . - . transcript "99" Adh GeneMarkHMM CDS 918151 918795 . - . transcript "99" Adh GeneMarkHMM splice3 918795 918796 . - . transcript "99" Adh GeneMarkHMM splice5 918857 918858 . - . transcript "99" Adh GeneMarkHMM CDS 918858 918869 . - . transcript "99" Adh GeneMarkHMM stop_codon 918867 918869 . - . transcript "99" Adh GeneMarkHMM stop_codon 944218 944220 . - . transcript "100" Adh GeneMarkHMM CDS 944218 944525 . - . transcript "100" Adh GeneMarkHMM splice3 944525 944526 . - . transcript "100" Adh GeneMarkHMM splice5 951617 951618 . - . transcript "100" Adh GeneMarkHMM CDS 951618 951760 . - . transcript "100" Adh GeneMarkHMM splice3 951760 951761 . - . transcript "100" Adh GeneMarkHMM splice5 951812 951813 . - . transcript "100" Adh GeneMarkHMM CDS 951813 951820 . - . transcript "100" Adh GeneMarkHMM stop_codon 951818 951820 . - . transcript "100" Adh GeneMarkHMM start_codon 984981 984983 . + . transcript "101" Adh GeneMarkHMM CDS 984981 985070 . + . transcript "101" Adh GeneMarkHMM splice5 985070 985071 . + . transcript "101" Adh GeneMarkHMM splice3 985372 985373 . + . transcript "101" Adh GeneMarkHMM CDS 985373 986896 . + . transcript "101" Adh GeneMarkHMM stop_codon 986894 986896 . + . transcript "101" Adh GeneMarkHMM start_codon 1004686 1004688 . + . transcript "102" Adh GeneMarkHMM CDS 1004686 1004817 . + . transcript "102" Adh GeneMarkHMM splice5 1004817 1004818 . + . transcript "102" Adh GeneMarkHMM splice3 1004897 1004898 . + . transcript "102" Adh GeneMarkHMM CDS 1004898 1005095 . + . transcript "102" Adh GeneMarkHMM splice5 1005095 1005096 . + . transcript "102" Adh GeneMarkHMM splice3 1005164 1005165 . + . transcript "102" Adh GeneMarkHMM CDS 1005165 1005281 . + . transcript "102" Adh GeneMarkHMM stop_codon 1005279 1005281 . + . transcript "102" Adh GeneMarkHMM start_codon 1034264 1034266 . + . transcript "103" Adh GeneMarkHMM CDS 1034264 1034416 . + . transcript "103" Adh GeneMarkHMM splice5 1034416 1034417 . + . transcript "103" Adh GeneMarkHMM splice3 1035245 1035246 . + . transcript "103" Adh GeneMarkHMM CDS 1035246 1035251 . + . transcript "103" Adh GeneMarkHMM stop_codon 1035249 1035251 . + . transcript "103" Adh GeneMarkHMM stop_codon 1041376 1041378 . - . transcript "104" Adh GeneMarkHMM CDS 1041376 1041530 . - . transcript "104" Adh GeneMarkHMM splice3 1041530 1041531 . - . transcript "104" Adh GeneMarkHMM splice5 1041601 1041602 . - . transcript "104" Adh GeneMarkHMM CDS 1041602 1041989 . - . transcript "104" Adh GeneMarkHMM splice3 1041989 1041990 . - . transcript "104" Adh GeneMarkHMM splice5 1042385 1042386 . - . transcript "104" Adh GeneMarkHMM CDS 1042386 1042688 . - . transcript "104" Adh GeneMarkHMM stop_codon 1042686 1042688 . - . transcript "104" Adh GeneMarkHMM stop_codon 1051748 1051750 . - . transcript "105" Adh GeneMarkHMM CDS 1051748 1051953 . - . transcript "105" Adh GeneMarkHMM splice3 1051953 1051954 . - . transcript "105" Adh GeneMarkHMM splice5 1056914 1056915 . - . transcript "105" Adh GeneMarkHMM CDS 1056915 1057314 . - . transcript "105" Adh GeneMarkHMM stop_codon 1057312 1057314 . - . transcript "105" Adh GeneMarkHMM start_codon 1070893 1070895 . + . transcript "106" Adh GeneMarkHMM CDS 1070893 1070904 . + . transcript "106" Adh GeneMarkHMM splice5 1070904 1070905 . + . transcript "106" Adh GeneMarkHMM splice3 1071568 1071569 . + . transcript "106" Adh GeneMarkHMM CDS 1071569 1071758 . + . transcript "106" Adh GeneMarkHMM splice5 1071758 1071759 . + . transcript "106" Adh GeneMarkHMM splice3 1071979 1071980 . + . transcript "106" Adh GeneMarkHMM CDS 1071980 1072023 . + . transcript "106" Adh GeneMarkHMM stop_codon 1072021 1072023 . + . transcript "106" Adh GeneMarkHMM start_codon 1078485 1078487 . + . transcript "107" Adh GeneMarkHMM CDS 1078485 1078612 . + . transcript "107" Adh GeneMarkHMM splice5 1078612 1078613 . + . transcript "107" Adh GeneMarkHMM splice3 1079893 1079894 . + . transcript "107" Adh GeneMarkHMM CDS 1079894 1080080 . + . transcript "107" Adh GeneMarkHMM stop_codon 1080078 1080080 . + . transcript "107" Adh GeneMarkHMM stop_codon 1080988 1080990 . - . transcript "108" Adh GeneMarkHMM CDS 1080988 1081079 . - . transcript "108" Adh GeneMarkHMM splice3 1081079 1081080 . - . transcript "108" Adh GeneMarkHMM splice5 1081727 1081728 . - . transcript "108" Adh GeneMarkHMM CDS 1081728 1081893 . - . transcript "108" Adh GeneMarkHMM splice3 1081893 1081894 . - . transcript "108" Adh GeneMarkHMM splice5 1081957 1081958 . - . transcript "108" Adh GeneMarkHMM CDS 1081958 1081969 . - . transcript "108" Adh GeneMarkHMM stop_codon 1081967 1081969 . - . transcript "108" Adh GeneMarkHMM stop_codon 1094414 1094416 . - . transcript "109" Adh GeneMarkHMM CDS 1094414 1094610 . - . transcript "109" Adh GeneMarkHMM splice3 1094610 1094611 . - . transcript "109" Adh GeneMarkHMM splice5 1094866 1094867 . - . transcript "109" Adh GeneMarkHMM CDS 1094867 1095215 . - . transcript "109" Adh GeneMarkHMM splice3 1095215 1095216 . - . transcript "109" Adh GeneMarkHMM splice5 1095421 1095422 . - . transcript "109" Adh GeneMarkHMM CDS 1095422 1095533 . - . transcript "109" Adh GeneMarkHMM splice3 1095533 1095534 . - . transcript "109" Adh GeneMarkHMM splice5 1095585 1095586 . - . transcript "109" Adh GeneMarkHMM CDS 1095586 1095735 . - . transcript "109" Adh GeneMarkHMM splice3 1095735 1095736 . - . transcript "109" Adh GeneMarkHMM splice5 1095847 1095848 . - . transcript "109" Adh GeneMarkHMM CDS 1095848 1095987 . - . transcript "109" Adh GeneMarkHMM splice3 1095987 1095988 . - . transcript "109" Adh GeneMarkHMM splice5 1096061 1096062 . - . transcript "109" Adh GeneMarkHMM CDS 1096062 1096196 . - . transcript "109" Adh GeneMarkHMM splice3 1096196 1096197 . - . transcript "109" Adh GeneMarkHMM splice5 1096325 1096326 . - . transcript "109" Adh GeneMarkHMM CDS 1096326 1098979 . - . transcript "109" Adh GeneMarkHMM splice3 1098979 1098980 . - . transcript "109" Adh GeneMarkHMM splice5 1100156 1100157 . - . transcript "109" Adh GeneMarkHMM CDS 1100157 1100179 . - . transcript "109" Adh GeneMarkHMM splice3 1100179 1100180 . - . transcript "109" Adh GeneMarkHMM splice5 1101375 1101376 . - . transcript "109" Adh GeneMarkHMM CDS 1101376 1101526 . - . transcript "109" Adh GeneMarkHMM splice3 1101526 1101527 . - . transcript "109" Adh GeneMarkHMM splice5 1101583 1101584 . - . transcript "109" Adh GeneMarkHMM CDS 1101584 1101748 . - . transcript "109" Adh GeneMarkHMM splice3 1101748 1101749 . - . transcript "109" Adh GeneMarkHMM splice5 1102936 1102937 . - . transcript "109" Adh GeneMarkHMM CDS 1102937 1102996 . - . transcript "109" Adh GeneMarkHMM splice3 1102996 1102997 . - . transcript "109" Adh GeneMarkHMM splice5 1104418 1104419 . - . transcript "109" Adh GeneMarkHMM CDS 1104419 1104995 . - . transcript "109" Adh GeneMarkHMM splice3 1104995 1104996 . - . transcript "109" Adh GeneMarkHMM splice5 1105634 1105635 . - . transcript "109" Adh GeneMarkHMM CDS 1105635 1105637 . - . transcript "109" Adh GeneMarkHMM stop_codon 1105635 1105637 . - . transcript "109" Adh GeneMarkHMM start_codon 1110074 1110076 . + . transcript "110" Adh GeneMarkHMM CDS 1110074 1110172 . + . transcript "110" Adh GeneMarkHMM splice5 1110172 1110173 . + . transcript "110" Adh GeneMarkHMM splice3 1110237 1110238 . + . transcript "110" Adh GeneMarkHMM CDS 1110238 1110642 . + . transcript "110" Adh GeneMarkHMM splice5 1110642 1110643 . + . transcript "110" Adh GeneMarkHMM splice3 1110712 1110713 . + . transcript "110" Adh GeneMarkHMM CDS 1110713 1110979 . + . transcript "110" Adh GeneMarkHMM stop_codon 1110977 1110979 . + . transcript "110" Adh GeneMarkHMM start_codon 1111283 1111285 . + . transcript "111" Adh GeneMarkHMM CDS 1111283 1111378 . + . transcript "111" Adh GeneMarkHMM splice5 1111378 1111379 . + . transcript "111" Adh GeneMarkHMM splice3 1111804 1111805 . + . transcript "111" Adh GeneMarkHMM CDS 1111805 1112209 . + . transcript "111" Adh GeneMarkHMM splice5 1112209 1112210 . + . transcript "111" Adh GeneMarkHMM splice3 1112260 1112261 . + . transcript "111" Adh GeneMarkHMM CDS 1112261 1112578 . + . transcript "111" Adh GeneMarkHMM stop_codon 1112576 1112578 . + . transcript "111" Adh GeneMarkHMM start_codon 1115048 1115050 . + . transcript "112" Adh GeneMarkHMM CDS 1115048 1115296 . + . transcript "112" Adh GeneMarkHMM splice5 1115296 1115297 . + . transcript "112" Adh GeneMarkHMM splice3 1115815 1115816 . + . transcript "112" Adh GeneMarkHMM CDS 1115816 1115885 . + . transcript "112" Adh GeneMarkHMM splice5 1115885 1115886 . + . transcript "112" Adh GeneMarkHMM splice3 1116314 1116315 . + . transcript "112" Adh GeneMarkHMM CDS 1116315 1116461 . + . transcript "112" Adh GeneMarkHMM splice5 1116461 1116462 . + . transcript "112" Adh GeneMarkHMM splice3 1116581 1116582 . + . transcript "112" Adh GeneMarkHMM CDS 1116582 1116646 . + . transcript "112" Adh GeneMarkHMM splice5 1116646 1116647 . + . transcript "112" Adh GeneMarkHMM splice3 1117461 1117462 . + . transcript "112" Adh GeneMarkHMM CDS 1117462 1117608 . + . transcript "112" Adh GeneMarkHMM stop_codon 1117606 1117608 . + . transcript "112" Adh GeneMarkHMM stop_codon 1144299 1144301 . - . transcript "113" Adh GeneMarkHMM CDS 1144299 1144446 . - . transcript "113" Adh GeneMarkHMM splice3 1144446 1144447 . - . transcript "113" Adh GeneMarkHMM splice5 1146892 1146893 . - . transcript "113" Adh GeneMarkHMM CDS 1146893 1146990 . - . transcript "113" Adh GeneMarkHMM stop_codon 1146988 1146990 . - . transcript "113" Adh GeneMarkHMM stop_codon 1182116 1182118 . - . transcript "114" Adh GeneMarkHMM CDS 1182116 1182130 . - . transcript "114" Adh GeneMarkHMM splice3 1182130 1182131 . - . transcript "114" Adh GeneMarkHMM splice5 1182202 1182203 . - . transcript "114" Adh GeneMarkHMM CDS 1182203 1182415 . - . transcript "114" Adh GeneMarkHMM stop_codon 1182413 1182415 . - . transcript "114" Adh GeneMarkHMM start_codon 1206476 1206478 . + . transcript "115" Adh GeneMarkHMM CDS 1206476 1206487 . + . transcript "115" Adh GeneMarkHMM splice5 1206487 1206488 . + . transcript "115" Adh GeneMarkHMM splice3 1206558 1206559 . + . transcript "115" Adh GeneMarkHMM CDS 1206559 1206786 . + . transcript "115" Adh GeneMarkHMM stop_codon 1206784 1206786 . + . transcript "115" Adh GeneMarkHMM start_codon 1207563 1207565 . + . transcript "116" Adh GeneMarkHMM CDS 1207563 1207574 . + . transcript "116" Adh GeneMarkHMM splice5 1207574 1207575 . + . transcript "116" Adh GeneMarkHMM splice3 1207665 1207666 . + . transcript "116" Adh GeneMarkHMM CDS 1207666 1207953 . + . transcript "116" Adh GeneMarkHMM stop_codon 1207951 1207953 . + . transcript "116" Adh GeneMarkHMM stop_codon 1217048 1217050 . - . transcript "117" Adh GeneMarkHMM CDS 1217048 1217096 . - . transcript "117" Adh GeneMarkHMM splice3 1217096 1217097 . - . transcript "117" Adh GeneMarkHMM splice5 1218724 1218725 . - . transcript "117" Adh GeneMarkHMM CDS 1218725 1220115 . - . transcript "117" Adh GeneMarkHMM splice3 1220115 1220116 . - . transcript "117" Adh GeneMarkHMM splice5 1220187 1220188 . - . transcript "117" Adh GeneMarkHMM CDS 1220188 1220253 . - . transcript "117" Adh GeneMarkHMM splice3 1220253 1220254 . - . transcript "117" Adh GeneMarkHMM splice5 1220452 1220453 . - . transcript "117" Adh GeneMarkHMM CDS 1220453 1221762 . - . transcript "117" Adh GeneMarkHMM splice3 1221762 1221763 . - . transcript "117" Adh GeneMarkHMM splice5 1221976 1221977 . - . transcript "117" Adh GeneMarkHMM CDS 1221977 1222023 . - . transcript "117" Adh GeneMarkHMM splice3 1222023 1222024 . - . transcript "117" Adh GeneMarkHMM splice5 1222077 1222078 . - . transcript "117" Adh GeneMarkHMM CDS 1222078 1222190 . - . transcript "117" Adh GeneMarkHMM splice3 1222190 1222191 . - . transcript "117" Adh GeneMarkHMM splice5 1222249 1222250 . - . transcript "117" Adh GeneMarkHMM CDS 1222250 1222395 . - . transcript "117" Adh GeneMarkHMM splice3 1222395 1222396 . - . transcript "117" Adh GeneMarkHMM splice5 1222482 1222483 . - . transcript "117" Adh GeneMarkHMM CDS 1222483 1222579 . - . transcript "117" Adh GeneMarkHMM stop_codon 1222577 1222579 . - . transcript "117" Adh GeneMarkHMM start_codon 1229684 1229686 . + . transcript "118" Adh GeneMarkHMM CDS 1229684 1230733 . + . transcript "118" Adh GeneMarkHMM stop_codon 1230731 1230733 . + . transcript "118" Adh GeneMarkHMM stop_codon 1231127 1231129 . - . transcript "119" Adh GeneMarkHMM CDS 1231127 1231384 . - . transcript "119" Adh GeneMarkHMM splice3 1231384 1231385 . - . transcript "119" Adh GeneMarkHMM splice5 1231451 1231452 . - . transcript "119" Adh GeneMarkHMM CDS 1231452 1231463 . - . transcript "119" Adh GeneMarkHMM stop_codon 1231461 1231463 . - . transcript "119" Adh GeneMarkHMM start_codon 1232958 1232960 . + . transcript "120" Adh GeneMarkHMM CDS 1232958 1232969 . + . transcript "120" Adh GeneMarkHMM splice5 1232969 1232970 . + . transcript "120" Adh GeneMarkHMM splice3 1233043 1233044 . + . transcript "120" Adh GeneMarkHMM CDS 1233044 1233280 . + . transcript "120" Adh GeneMarkHMM stop_codon 1233278 1233280 . + . transcript "120" Adh GeneMarkHMM start_codon 1250663 1250665 . + . transcript "121" Adh GeneMarkHMM CDS 1250663 1251421 . + . transcript "121" Adh GeneMarkHMM stop_codon 1251419 1251421 . + . transcript "121" Adh GeneMarkHMM start_codon 1252523 1252525 . + . transcript "122" Adh GeneMarkHMM CDS 1252523 1253617 . + . transcript "122" Adh GeneMarkHMM stop_codon 1253615 1253617 . + . transcript "122" Adh GeneMarkHMM start_codon 1255669 1255671 . + . transcript "123" Adh GeneMarkHMM CDS 1255669 1256823 . + . transcript "123" Adh GeneMarkHMM stop_codon 1256821 1256823 . + . transcript "123" Adh GeneMarkHMM stop_codon 1271377 1271379 . - . transcript "124" Adh GeneMarkHMM CDS 1271377 1272140 . - . transcript "124" Adh GeneMarkHMM splice3 1272140 1272141 . - . transcript "124" Adh GeneMarkHMM splice5 1272216 1272217 . - . transcript "124" Adh GeneMarkHMM CDS 1272217 1272395 . - . transcript "124" Adh GeneMarkHMM splice3 1272395 1272396 . - . transcript "124" Adh GeneMarkHMM splice5 1273040 1273041 . - . transcript "124" Adh GeneMarkHMM CDS 1273041 1273498 . - . transcript "124" Adh GeneMarkHMM stop_codon 1273496 1273498 . - . transcript "124" Adh GeneMarkHMM stop_codon 1294081 1294083 . - . transcript "125" Adh GeneMarkHMM CDS 1294081 1294458 . - . transcript "125" Adh GeneMarkHMM splice3 1294458 1294459 . - . transcript "125" Adh GeneMarkHMM splice5 1295676 1295677 . - . transcript "125" Adh GeneMarkHMM CDS 1295677 1296587 . - . transcript "125" Adh GeneMarkHMM splice3 1296587 1296588 . - . transcript "125" Adh GeneMarkHMM splice5 1297136 1297137 . - . transcript "125" Adh GeneMarkHMM CDS 1297137 1298310 . - . transcript "125" Adh GeneMarkHMM stop_codon 1298308 1298310 . - . transcript "125" Adh GeneMarkHMM start_codon 1301126 1301128 . + . transcript "126" Adh GeneMarkHMM CDS 1301126 1301581 . + . transcript "126" Adh GeneMarkHMM splice5 1301581 1301582 . + . transcript "126" Adh GeneMarkHMM splice3 1301670 1301671 . + . transcript "126" Adh GeneMarkHMM CDS 1301671 1301676 . + . transcript "126" Adh GeneMarkHMM stop_codon 1301674 1301676 . + . transcript "126" Adh GeneMarkHMM stop_codon 1333719 1333721 . - . transcript "127" Adh GeneMarkHMM CDS 1333719 1333789 . - . transcript "127" Adh GeneMarkHMM splice3 1333789 1333790 . - . transcript "127" Adh GeneMarkHMM splice5 1334784 1334785 . - . transcript "127" Adh GeneMarkHMM CDS 1334785 1335024 . - . transcript "127" Adh GeneMarkHMM splice3 1335024 1335025 . - . transcript "127" Adh GeneMarkHMM splice5 1335079 1335080 . - . transcript "127" Adh GeneMarkHMM CDS 1335080 1335356 . - . transcript "127" Adh GeneMarkHMM splice3 1335356 1335357 . - . transcript "127" Adh GeneMarkHMM splice5 1335415 1335416 . - . transcript "127" Adh GeneMarkHMM CDS 1335416 1336157 . - . transcript "127" Adh GeneMarkHMM splice3 1336157 1336158 . - . transcript "127" Adh GeneMarkHMM splice5 1337667 1337668 . - . transcript "127" Adh GeneMarkHMM CDS 1337668 1337917 . - . transcript "127" Adh GeneMarkHMM splice3 1337917 1337918 . - . transcript "127" Adh GeneMarkHMM splice5 1338336 1338337 . - . transcript "127" Adh GeneMarkHMM CDS 1338337 1338640 . - . transcript "127" Adh GeneMarkHMM splice3 1338640 1338641 . - . transcript "127" Adh GeneMarkHMM splice5 1338701 1338702 . - . transcript "127" Adh GeneMarkHMM CDS 1338702 1338785 . - . transcript "127" Adh GeneMarkHMM stop_codon 1338783 1338785 . - . transcript "127" Adh GeneMarkHMM stop_codon 1364968 1364970 . - . transcript "128" Adh GeneMarkHMM CDS 1364968 1364994 . - . transcript "128" Adh GeneMarkHMM splice3 1364994 1364995 . - . transcript "128" Adh GeneMarkHMM splice5 1365169 1365170 . - . transcript "128" Adh GeneMarkHMM CDS 1365170 1365361 . - . transcript "128" Adh GeneMarkHMM splice3 1365361 1365362 . - . transcript "128" Adh GeneMarkHMM splice5 1365420 1365421 . - . transcript "128" Adh GeneMarkHMM CDS 1365421 1365611 . - . transcript "128" Adh GeneMarkHMM splice3 1365611 1365612 . - . transcript "128" Adh GeneMarkHMM splice5 1365665 1365666 . - . transcript "128" Adh GeneMarkHMM CDS 1365666 1365732 . - . transcript "128" Adh GeneMarkHMM stop_codon 1365730 1365732 . - . transcript "128" Adh GeneMarkHMM stop_codon 1368793 1368795 . - . transcript "129" Adh GeneMarkHMM CDS 1368793 1368852 . - . transcript "129" Adh GeneMarkHMM splice3 1368852 1368853 . - . transcript "129" Adh GeneMarkHMM splice5 1368901 1368902 . - . transcript "129" Adh GeneMarkHMM CDS 1368902 1369282 . - . transcript "129" Adh GeneMarkHMM stop_codon 1369280 1369282 . - . transcript "129" Adh GeneMarkHMM stop_codon 1371868 1371870 . - . transcript "130" Adh GeneMarkHMM CDS 1371868 1371921 . - . transcript "130" Adh GeneMarkHMM splice3 1371921 1371922 . - . transcript "130" Adh GeneMarkHMM splice5 1371970 1371971 . - . transcript "130" Adh GeneMarkHMM CDS 1371971 1372351 . - . transcript "130" Adh GeneMarkHMM stop_codon 1372349 1372351 . - . transcript "130" Adh GeneMarkHMM stop_codon 1398183 1398185 . - . transcript "131" Adh GeneMarkHMM CDS 1398183 1398833 . - . transcript "131" Adh GeneMarkHMM splice3 1398833 1398834 . - . transcript "131" Adh GeneMarkHMM splice5 1401632 1401633 . - . transcript "131" Adh GeneMarkHMM CDS 1401633 1401874 . - . transcript "131" Adh GeneMarkHMM splice3 1401874 1401875 . - . transcript "131" Adh GeneMarkHMM splice5 1402534 1402535 . - . transcript "131" Adh GeneMarkHMM CDS 1402535 1402643 . - . transcript "131" Adh GeneMarkHMM splice3 1402643 1402644 . - . transcript "131" Adh GeneMarkHMM splice5 1402807 1402808 . - . transcript "131" Adh GeneMarkHMM CDS 1402808 1402995 . - . transcript "131" Adh GeneMarkHMM splice3 1402995 1402996 . - . transcript "131" Adh GeneMarkHMM splice5 1403929 1403930 . - . transcript "131" Adh GeneMarkHMM CDS 1403930 1404111 . - . transcript "131" Adh GeneMarkHMM splice3 1404111 1404112 . - . transcript "131" Adh GeneMarkHMM splice5 1405761 1405762 . - . transcript "131" Adh GeneMarkHMM CDS 1405762 1405903 . - . transcript "131" Adh GeneMarkHMM splice3 1405903 1405904 . - . transcript "131" Adh GeneMarkHMM splice5 1406800 1406801 . - . transcript "131" Adh GeneMarkHMM CDS 1406801 1406882 . - . transcript "131" Adh GeneMarkHMM splice3 1406882 1406883 . - . transcript "131" Adh GeneMarkHMM splice5 1407034 1407035 . - . transcript "131" Adh GeneMarkHMM CDS 1407035 1407146 . - . transcript "131" Adh GeneMarkHMM splice3 1407146 1407147 . - . transcript "131" Adh GeneMarkHMM splice5 1408829 1408830 . - . transcript "131" Adh GeneMarkHMM CDS 1408830 1408924 . - . transcript "131" Adh GeneMarkHMM stop_codon 1408922 1408924 . - . transcript "131" Adh GeneMarkHMM stop_codon 1410778 1410780 . - . transcript "132" Adh GeneMarkHMM CDS 1410778 1410893 . - . transcript "132" Adh GeneMarkHMM splice3 1410893 1410894 . - . transcript "132" Adh GeneMarkHMM splice5 1411599 1411600 . - . transcript "132" Adh GeneMarkHMM CDS 1411600 1411759 . - . transcript "132" Adh GeneMarkHMM splice3 1411759 1411760 . - . transcript "132" Adh GeneMarkHMM splice5 1412511 1412512 . - . transcript "132" Adh GeneMarkHMM CDS 1412512 1412741 . - . transcript "132" Adh GeneMarkHMM splice3 1412741 1412742 . - . transcript "132" Adh GeneMarkHMM splice5 1413334 1413335 . - . transcript "132" Adh GeneMarkHMM CDS 1413335 1413415 . - . transcript "132" Adh GeneMarkHMM splice3 1413415 1413416 . - . transcript "132" Adh GeneMarkHMM splice5 1413650 1413651 . - . transcript "132" Adh GeneMarkHMM CDS 1413651 1413732 . - . transcript "132" Adh GeneMarkHMM splice3 1413732 1413733 . - . transcript "132" Adh GeneMarkHMM splice5 1413797 1413798 . - . transcript "132" Adh GeneMarkHMM CDS 1413798 1413866 . - . transcript "132" Adh GeneMarkHMM stop_codon 1413864 1413866 . - . transcript "132" Adh GeneMarkHMM start_codon 1414397 1414399 . + . transcript "133" Adh GeneMarkHMM CDS 1414397 1414719 . + . transcript "133" Adh GeneMarkHMM splice5 1414719 1414720 . + . transcript "133" Adh GeneMarkHMM splice3 1415067 1415068 . + . transcript "133" Adh GeneMarkHMM CDS 1415068 1418081 . + . transcript "133" Adh GeneMarkHMM splice5 1418081 1418082 . + . transcript "133" Adh GeneMarkHMM splice3 1418141 1418142 . + . transcript "133" Adh GeneMarkHMM CDS 1418142 1419321 . + . transcript "133" Adh GeneMarkHMM splice5 1419321 1419322 . + . transcript "133" Adh GeneMarkHMM splice3 1419377 1419378 . + . transcript "133" Adh GeneMarkHMM CDS 1419378 1419918 . + . transcript "133" Adh GeneMarkHMM stop_codon 1419916 1419918 . + . transcript "133" Adh GeneMarkHMM stop_codon 1421921 1421923 . - . transcript "134" Adh GeneMarkHMM CDS 1421921 1422143 . - . transcript "134" Adh GeneMarkHMM splice3 1422143 1422144 . - . transcript "134" Adh GeneMarkHMM splice5 1422195 1422196 . - . transcript "134" Adh GeneMarkHMM CDS 1422196 1422320 . - . transcript "134" Adh GeneMarkHMM splice3 1422320 1422321 . - . transcript "134" Adh GeneMarkHMM splice5 1424530 1424531 . - . transcript "134" Adh GeneMarkHMM CDS 1424531 1424676 . - . transcript "134" Adh GeneMarkHMM splice3 1424676 1424677 . - . transcript "134" Adh GeneMarkHMM splice5 1424906 1424907 . - . transcript "134" Adh GeneMarkHMM CDS 1424907 1425041 . - . transcript "134" Adh GeneMarkHMM splice3 1425041 1425042 . - . transcript "134" Adh GeneMarkHMM splice5 1425548 1425549 . - . transcript "134" Adh GeneMarkHMM CDS 1425549 1425752 . - . transcript "134" Adh GeneMarkHMM splice3 1425752 1425753 . - . transcript "134" Adh GeneMarkHMM splice5 1426167 1426168 . - . transcript "134" Adh GeneMarkHMM CDS 1426168 1426281 . - . transcript "134" Adh GeneMarkHMM splice3 1426281 1426282 . - . transcript "134" Adh GeneMarkHMM splice5 1426392 1426393 . - . transcript "134" Adh GeneMarkHMM CDS 1426393 1426486 . - . transcript "134" Adh GeneMarkHMM splice3 1426486 1426487 . - . transcript "134" Adh GeneMarkHMM splice5 1428572 1428573 . - . transcript "134" Adh GeneMarkHMM CDS 1428573 1428690 . - . transcript "134" Adh GeneMarkHMM splice3 1428690 1428691 . - . transcript "134" Adh GeneMarkHMM splice5 1431179 1431180 . - . transcript "134" Adh GeneMarkHMM CDS 1431180 1431306 . - . transcript "134" Adh GeneMarkHMM splice3 1431306 1431307 . - . transcript "134" Adh GeneMarkHMM splice5 1431587 1431588 . - . transcript "134" Adh GeneMarkHMM CDS 1431588 1431639 . - . transcript "134" Adh GeneMarkHMM stop_codon 1431637 1431639 . - . transcript "134" Adh GeneMarkHMM stop_codon 1452198 1452200 . - . transcript "135" Adh GeneMarkHMM CDS 1452198 1452238 . - . transcript "135" Adh GeneMarkHMM splice3 1452238 1452239 . - . transcript "135" Adh GeneMarkHMM splice5 1452553 1452554 . - . transcript "135" Adh GeneMarkHMM CDS 1452554 1452758 . - . transcript "135" Adh GeneMarkHMM stop_codon 1452756 1452758 . - . transcript "135" Adh GeneMarkHMM stop_codon 1465977 1465979 . - . transcript "136" Adh GeneMarkHMM CDS 1465977 1466019 . - . transcript "136" Adh GeneMarkHMM splice3 1466019 1466020 . - . transcript "136" Adh GeneMarkHMM splice5 1466152 1466153 . - . transcript "136" Adh GeneMarkHMM CDS 1466153 1466744 . - . transcript "136" Adh GeneMarkHMM splice3 1466744 1466745 . - . transcript "136" Adh GeneMarkHMM splice5 1466875 1466876 . - . transcript "136" Adh GeneMarkHMM CDS 1466876 1467307 . - . transcript "136" Adh GeneMarkHMM splice3 1467307 1467308 . - . transcript "136" Adh GeneMarkHMM splice5 1473610 1473611 . - . transcript "136" Adh GeneMarkHMM CDS 1473611 1473791 . - . transcript "136" Adh GeneMarkHMM stop_codon 1473789 1473791 . - . transcript "136" Adh GeneMarkHMM start_codon 1475691 1475693 . + . transcript "137" Adh GeneMarkHMM CDS 1475691 1476341 . + . transcript "137" Adh GeneMarkHMM splice5 1476341 1476342 . + . transcript "137" Adh GeneMarkHMM splice3 1476425 1476426 . + . transcript "137" Adh GeneMarkHMM CDS 1476426 1476471 . + . transcript "137" Adh GeneMarkHMM splice5 1476471 1476472 . + . transcript "137" Adh GeneMarkHMM splice3 1476546 1476547 . + . transcript "137" Adh GeneMarkHMM CDS 1476547 1476936 . + . transcript "137" Adh GeneMarkHMM splice5 1476936 1476937 . + . transcript "137" Adh GeneMarkHMM splice3 1477481 1477482 . + . transcript "137" Adh GeneMarkHMM CDS 1477482 1477532 . + . transcript "137" Adh GeneMarkHMM splice5 1477532 1477533 . + . transcript "137" Adh GeneMarkHMM splice3 1477580 1477581 . + . transcript "137" Adh GeneMarkHMM CDS 1477581 1477984 . + . transcript "137" Adh GeneMarkHMM splice5 1477984 1477985 . + . transcript "137" Adh GeneMarkHMM splice3 1478053 1478054 . + . transcript "137" Adh GeneMarkHMM CDS 1478054 1478243 . + . transcript "137" Adh GeneMarkHMM splice5 1478243 1478244 . + . transcript "137" Adh GeneMarkHMM splice3 1478630 1478631 . + . transcript "137" Adh GeneMarkHMM CDS 1478631 1478916 . + . transcript "137" Adh GeneMarkHMM splice5 1478916 1478917 . + . transcript "137" Adh GeneMarkHMM splice3 1480626 1480627 . + . transcript "137" Adh GeneMarkHMM CDS 1480627 1480916 . + . transcript "137" Adh GeneMarkHMM splice5 1480916 1480917 . + . transcript "137" Adh GeneMarkHMM splice3 1480973 1480974 . + . transcript "137" Adh GeneMarkHMM CDS 1480974 1481086 . + . transcript "137" Adh GeneMarkHMM stop_codon 1481084 1481086 . + . transcript "137" Adh GeneMarkHMM start_codon 1495484 1495486 . + . transcript "138" Adh GeneMarkHMM CDS 1495484 1495522 . + . transcript "138" Adh GeneMarkHMM splice5 1495522 1495523 . + . transcript "138" Adh GeneMarkHMM splice3 1495619 1495620 . + . transcript "138" Adh GeneMarkHMM CDS 1495620 1495919 . + . transcript "138" Adh GeneMarkHMM splice5 1495919 1495920 . + . transcript "138" Adh GeneMarkHMM splice3 1495976 1495977 . + . transcript "138" Adh GeneMarkHMM CDS 1495977 1496198 . + . transcript "138" Adh GeneMarkHMM stop_codon 1496196 1496198 . + . transcript "138" Adh GeneMarkHMM stop_codon 1496304 1496306 . - . transcript "139" Adh GeneMarkHMM CDS 1496304 1496815 . - . transcript "139" Adh GeneMarkHMM splice3 1496815 1496816 . - . transcript "139" Adh GeneMarkHMM splice5 1496864 1496865 . - . transcript "139" Adh GeneMarkHMM CDS 1496865 1497000 . - . transcript "139" Adh GeneMarkHMM stop_codon 1496998 1497000 . - . transcript "139" Adh GeneMarkHMM start_codon 1497576 1497578 . + . transcript "140" Adh GeneMarkHMM CDS 1497576 1498121 . + . transcript "140" Adh GeneMarkHMM stop_codon 1498119 1498121 . + . transcript "140" Adh GeneMarkHMM stop_codon 1498334 1498336 . - . transcript "141" Adh GeneMarkHMM CDS 1498334 1499046 . - . transcript "141" Adh GeneMarkHMM splice3 1499046 1499047 . - . transcript "141" Adh GeneMarkHMM splice5 1499101 1499102 . - . transcript "141" Adh GeneMarkHMM CDS 1499102 1499249 . - . transcript "141" Adh GeneMarkHMM stop_codon 1499247 1499249 . - . transcript "141" Adh GeneMarkHMM start_codon 1499670 1499672 . + . transcript "142" Adh GeneMarkHMM CDS 1499670 1500797 . + . transcript "142" Adh GeneMarkHMM splice5 1500797 1500798 . + . transcript "142" Adh GeneMarkHMM splice3 1502038 1502039 . + . transcript "142" Adh GeneMarkHMM CDS 1502039 1502044 . + . transcript "142" Adh GeneMarkHMM stop_codon 1502042 1502044 . + . transcript "142" Adh GeneMarkHMM start_codon 1510747 1510749 . + . transcript "143" Adh GeneMarkHMM CDS 1510747 1510998 . + . transcript "143" Adh GeneMarkHMM splice5 1510998 1510999 . + . transcript "143" Adh GeneMarkHMM splice3 1515040 1515041 . + . transcript "143" Adh GeneMarkHMM CDS 1515041 1515175 . + . transcript "143" Adh GeneMarkHMM splice5 1515175 1515176 . + . transcript "143" Adh GeneMarkHMM splice3 1515265 1515266 . + . transcript "143" Adh GeneMarkHMM CDS 1515266 1515436 . + . transcript "143" Adh GeneMarkHMM splice5 1515436 1515437 . + . transcript "143" Adh GeneMarkHMM splice3 1515497 1515498 . + . transcript "143" Adh GeneMarkHMM CDS 1515498 1515714 . + . transcript "143" Adh GeneMarkHMM splice5 1515714 1515715 . + . transcript "143" Adh GeneMarkHMM splice3 1515806 1515807 . + . transcript "143" Adh GeneMarkHMM CDS 1515807 1515972 . + . transcript "143" Adh GeneMarkHMM splice5 1515972 1515973 . + . transcript "143" Adh GeneMarkHMM splice3 1516035 1516036 . + . transcript "143" Adh GeneMarkHMM CDS 1516036 1516279 . + . transcript "143" Adh GeneMarkHMM splice5 1516279 1516280 . + . transcript "143" Adh GeneMarkHMM splice3 1516338 1516339 . + . transcript "143" Adh GeneMarkHMM CDS 1516339 1516488 . + . transcript "143" Adh GeneMarkHMM splice5 1516488 1516489 . + . transcript "143" Adh GeneMarkHMM splice3 1517177 1517178 . + . transcript "143" Adh GeneMarkHMM CDS 1517178 1518249 . + . transcript "143" Adh GeneMarkHMM splice5 1518249 1518250 . + . transcript "143" Adh GeneMarkHMM splice3 1518423 1518424 . + . transcript "143" Adh GeneMarkHMM CDS 1518424 1518804 . + . transcript "143" Adh GeneMarkHMM splice5 1518804 1518805 . + . transcript "143" Adh GeneMarkHMM splice3 1518876 1518877 . + . transcript "143" Adh GeneMarkHMM CDS 1518877 1518968 . + . transcript "143" Adh GeneMarkHMM splice5 1518968 1518969 . + . transcript "143" Adh GeneMarkHMM splice3 1519239 1519240 . + . transcript "143" Adh GeneMarkHMM CDS 1519240 1519382 . + . transcript "143" Adh GeneMarkHMM splice5 1519382 1519383 . + . transcript "143" Adh GeneMarkHMM splice3 1519440 1519441 . + . transcript "143" Adh GeneMarkHMM CDS 1519441 1519564 . + . transcript "143" Adh GeneMarkHMM splice5 1519564 1519565 . + . transcript "143" Adh GeneMarkHMM splice3 1519896 1519897 . + . transcript "143" Adh GeneMarkHMM CDS 1519897 1520023 . + . transcript "143" Adh GeneMarkHMM splice5 1520023 1520024 . + . transcript "143" Adh GeneMarkHMM splice3 1520080 1520081 . + . transcript "143" Adh GeneMarkHMM CDS 1520081 1520337 . + . transcript "143" Adh GeneMarkHMM splice5 1520337 1520338 . + . transcript "143" Adh GeneMarkHMM splice3 1520397 1520398 . + . transcript "143" Adh GeneMarkHMM CDS 1520398 1520535 . + . transcript "143" Adh GeneMarkHMM splice5 1520535 1520536 . + . transcript "143" Adh GeneMarkHMM splice3 1521653 1521654 . + . transcript "143" Adh GeneMarkHMM CDS 1521654 1521842 . + . transcript "143" Adh GeneMarkHMM stop_codon 1521840 1521842 . + . transcript "143" Adh GeneMarkHMM start_codon 1525215 1525217 . + . transcript "144" Adh GeneMarkHMM CDS 1525215 1525447 . + . transcript "144" Adh GeneMarkHMM splice5 1525447 1525448 . + . transcript "144" Adh GeneMarkHMM splice3 1526236 1526237 . + . transcript "144" Adh GeneMarkHMM CDS 1526237 1526642 . + . transcript "144" Adh GeneMarkHMM splice5 1526642 1526643 . + . transcript "144" Adh GeneMarkHMM splice3 1526701 1526702 . + . transcript "144" Adh GeneMarkHMM CDS 1526702 1527379 . + . transcript "144" Adh GeneMarkHMM stop_codon 1527377 1527379 . + . transcript "144" Adh GeneMarkHMM stop_codon 1527523 1527525 . - . transcript "145" Adh GeneMarkHMM CDS 1527523 1527636 . - . transcript "145" Adh GeneMarkHMM splice3 1527636 1527637 . - . transcript "145" Adh GeneMarkHMM splice5 1527704 1527705 . - . transcript "145" Adh GeneMarkHMM CDS 1527705 1528201 . - . transcript "145" Adh GeneMarkHMM splice3 1528201 1528202 . - . transcript "145" Adh GeneMarkHMM splice5 1528290 1528291 . - . transcript "145" Adh GeneMarkHMM CDS 1528291 1528426 . - . transcript "145" Adh GeneMarkHMM stop_codon 1528424 1528426 . - . transcript "145" Adh GeneMarkHMM start_codon 1529588 1529590 . + . transcript "146" Adh GeneMarkHMM CDS 1529588 1529971 . + . transcript "146" Adh GeneMarkHMM splice5 1529971 1529972 . + . transcript "146" Adh GeneMarkHMM splice3 1530745 1530746 . + . transcript "146" Adh GeneMarkHMM CDS 1530746 1531626 . + . transcript "146" Adh GeneMarkHMM splice5 1531626 1531627 . + . transcript "146" Adh GeneMarkHMM splice3 1531684 1531685 . + . transcript "146" Adh GeneMarkHMM CDS 1531685 1531892 . + . transcript "146" Adh GeneMarkHMM splice5 1531892 1531893 . + . transcript "146" Adh GeneMarkHMM splice3 1531957 1531958 . + . transcript "146" Adh GeneMarkHMM CDS 1531958 1532269 . + . transcript "146" Adh GeneMarkHMM stop_codon 1532267 1532269 . + . transcript "146" Adh GeneMarkHMM stop_codon 1533935 1533937 . - . transcript "147" Adh GeneMarkHMM CDS 1533935 1534013 . - . transcript "147" Adh GeneMarkHMM splice3 1534013 1534014 . - . transcript "147" Adh GeneMarkHMM splice5 1535065 1535066 . - . transcript "147" Adh GeneMarkHMM CDS 1535066 1535271 . - . transcript "147" Adh GeneMarkHMM splice3 1535271 1535272 . - . transcript "147" Adh GeneMarkHMM splice5 1535340 1535341 . - . transcript "147" Adh GeneMarkHMM CDS 1535341 1535461 . - . transcript "147" Adh GeneMarkHMM splice3 1535461 1535462 . - . transcript "147" Adh GeneMarkHMM splice5 1535529 1535530 . - . transcript "147" Adh GeneMarkHMM CDS 1535530 1535676 . - . transcript "147" Adh GeneMarkHMM splice3 1535676 1535677 . - . transcript "147" Adh GeneMarkHMM splice5 1535738 1535739 . - . transcript "147" Adh GeneMarkHMM CDS 1535739 1536304 . - . transcript "147" Adh GeneMarkHMM splice3 1536304 1536305 . - . transcript "147" Adh GeneMarkHMM splice5 1536363 1536364 . - . transcript "147" Adh GeneMarkHMM CDS 1536364 1537150 . - . transcript "147" Adh GeneMarkHMM splice3 1537150 1537151 . - . transcript "147" Adh GeneMarkHMM splice5 1537211 1537212 . - . transcript "147" Adh GeneMarkHMM CDS 1537212 1538662 . - . transcript "147" Adh GeneMarkHMM splice3 1538662 1538663 . - . transcript "147" Adh GeneMarkHMM splice5 1538718 1538719 . - . transcript "147" Adh GeneMarkHMM CDS 1538719 1541113 . - . transcript "147" Adh GeneMarkHMM splice3 1541113 1541114 . - . transcript "147" Adh GeneMarkHMM splice5 1541177 1541178 . - . transcript "147" Adh GeneMarkHMM CDS 1541178 1541378 . - . transcript "147" Adh GeneMarkHMM splice3 1541378 1541379 . - . transcript "147" Adh GeneMarkHMM splice5 1541444 1541445 . - . transcript "147" Adh GeneMarkHMM CDS 1541445 1541794 . - . transcript "147" Adh GeneMarkHMM splice3 1541794 1541795 . - . transcript "147" Adh GeneMarkHMM splice5 1542124 1542125 . - . transcript "147" Adh GeneMarkHMM CDS 1542125 1542385 . - . transcript "147" Adh GeneMarkHMM splice3 1542385 1542386 . - . transcript "147" Adh GeneMarkHMM splice5 1542860 1542861 . - . transcript "147" Adh GeneMarkHMM CDS 1542861 1542932 . - . transcript "147" Adh GeneMarkHMM stop_codon 1542930 1542932 . - . transcript "147" Adh GeneMarkHMM start_codon 1547954 1547956 . + . transcript "148" Adh GeneMarkHMM CDS 1547954 1548151 . + . transcript "148" Adh GeneMarkHMM splice5 1548151 1548152 . + . transcript "148" Adh GeneMarkHMM splice3 1548214 1548215 . + . transcript "148" Adh GeneMarkHMM CDS 1548215 1548319 . + . transcript "148" Adh GeneMarkHMM splice5 1548319 1548320 . + . transcript "148" Adh GeneMarkHMM splice3 1548382 1548383 . + . transcript "148" Adh GeneMarkHMM CDS 1548383 1548538 . + . transcript "148" Adh GeneMarkHMM stop_codon 1548536 1548538 . + . transcript "148" Adh GeneMarkHMM stop_codon 1549142 1549144 . - . transcript "149" Adh GeneMarkHMM CDS 1549142 1550017 . - . transcript "149" Adh GeneMarkHMM splice3 1550017 1550018 . - . transcript "149" Adh GeneMarkHMM splice5 1550083 1550084 . - . transcript "149" Adh GeneMarkHMM CDS 1550084 1550149 . - . transcript "149" Adh GeneMarkHMM stop_codon 1550147 1550149 . - . transcript "149" Adh GeneMarkHMM stop_codon 1554085 1554087 . - . transcript "150" Adh GeneMarkHMM CDS 1554085 1554599 . - . transcript "150" Adh GeneMarkHMM splice3 1554599 1554600 . - . transcript "150" Adh GeneMarkHMM splice5 1554840 1554841 . - . transcript "150" Adh GeneMarkHMM CDS 1554841 1555107 . - . transcript "150" Adh GeneMarkHMM splice3 1555107 1555108 . - . transcript "150" Adh GeneMarkHMM splice5 1556587 1556588 . - . transcript "150" Adh GeneMarkHMM CDS 1556588 1557278 . - . transcript "150" Adh GeneMarkHMM stop_codon 1557276 1557278 . - . transcript "150" Adh GeneMarkHMM start_codon 1558057 1558059 . + . transcript "151" Adh GeneMarkHMM CDS 1558057 1558080 . + . transcript "151" Adh GeneMarkHMM splice5 1558080 1558081 . + . transcript "151" Adh GeneMarkHMM splice3 1558133 1558134 . + . transcript "151" Adh GeneMarkHMM CDS 1558134 1558521 . + . transcript "151" Adh GeneMarkHMM splice5 1558521 1558522 . + . transcript "151" Adh GeneMarkHMM splice3 1558684 1558685 . + . transcript "151" Adh GeneMarkHMM CDS 1558685 1559747 . + . transcript "151" Adh GeneMarkHMM splice5 1559747 1559748 . + . transcript "151" Adh GeneMarkHMM splice3 1560328 1560329 . + . transcript "151" Adh GeneMarkHMM CDS 1560329 1560435 . + . transcript "151" Adh GeneMarkHMM splice5 1560435 1560436 . + . transcript "151" Adh GeneMarkHMM splice3 1560564 1560565 . + . transcript "151" Adh GeneMarkHMM CDS 1560565 1561671 . + . transcript "151" Adh GeneMarkHMM splice5 1561671 1561672 . + . transcript "151" Adh GeneMarkHMM splice3 1561988 1561989 . + . transcript "151" Adh GeneMarkHMM CDS 1561989 1562278 . + . transcript "151" Adh GeneMarkHMM splice5 1562278 1562279 . + . transcript "151" Adh GeneMarkHMM splice3 1562337 1562338 . + . transcript "151" Adh GeneMarkHMM CDS 1562338 1563081 . + . transcript "151" Adh GeneMarkHMM splice5 1563081 1563082 . + . transcript "151" Adh GeneMarkHMM splice3 1563139 1563140 . + . transcript "151" Adh GeneMarkHMM CDS 1563140 1563353 . + . transcript "151" Adh GeneMarkHMM splice5 1563353 1563354 . + . transcript "151" Adh GeneMarkHMM splice3 1563417 1563418 . + . transcript "151" Adh GeneMarkHMM CDS 1563418 1563689 . + . transcript "151" Adh GeneMarkHMM splice5 1563689 1563690 . + . transcript "151" Adh GeneMarkHMM splice3 1563760 1563761 . + . transcript "151" Adh GeneMarkHMM CDS 1563761 1563814 . + . transcript "151" Adh GeneMarkHMM stop_codon 1563812 1563814 . + . transcript "151" Adh GeneMarkHMM start_codon 1565296 1565298 . + . transcript "152" Adh GeneMarkHMM CDS 1565296 1565530 . + . transcript "152" Adh GeneMarkHMM splice5 1565530 1565531 . + . transcript "152" Adh GeneMarkHMM splice3 1576690 1576691 . + . transcript "152" Adh GeneMarkHMM CDS 1576691 1576943 . + . transcript "152" Adh GeneMarkHMM splice5 1576943 1576944 . + . transcript "152" Adh GeneMarkHMM splice3 1577035 1577036 . + . transcript "152" Adh GeneMarkHMM CDS 1577036 1577406 . + . transcript "152" Adh GeneMarkHMM splice5 1577406 1577407 . + . transcript "152" Adh GeneMarkHMM splice3 1577567 1577568 . + . transcript "152" Adh GeneMarkHMM CDS 1577568 1577860 . + . transcript "152" Adh GeneMarkHMM splice5 1577860 1577861 . + . transcript "152" Adh GeneMarkHMM splice3 1577925 1577926 . + . transcript "152" Adh GeneMarkHMM CDS 1577926 1578009 . + . transcript "152" Adh GeneMarkHMM splice5 1578009 1578010 . + . transcript "152" Adh GeneMarkHMM splice3 1580549 1580550 . + . transcript "152" Adh GeneMarkHMM CDS 1580550 1580685 . + . transcript "152" Adh GeneMarkHMM splice5 1580685 1580686 . + . transcript "152" Adh GeneMarkHMM splice3 1580749 1580750 . + . transcript "152" Adh GeneMarkHMM CDS 1580750 1580810 . + . transcript "152" Adh GeneMarkHMM splice5 1580810 1580811 . + . transcript "152" Adh GeneMarkHMM splice3 1580858 1580859 . + . transcript "152" Adh GeneMarkHMM CDS 1580859 1580880 . + . transcript "152" Adh GeneMarkHMM splice5 1580880 1580881 . + . transcript "152" Adh GeneMarkHMM splice3 1580945 1580946 . + . transcript "152" Adh GeneMarkHMM CDS 1580946 1581227 . + . transcript "152" Adh GeneMarkHMM splice5 1581227 1581228 . + . transcript "152" Adh GeneMarkHMM splice3 1581293 1581294 . + . transcript "152" Adh GeneMarkHMM CDS 1581294 1581623 . + . transcript "152" Adh GeneMarkHMM splice5 1581623 1581624 . + . transcript "152" Adh GeneMarkHMM splice3 1581773 1581774 . + . transcript "152" Adh GeneMarkHMM CDS 1581774 1582136 . + . transcript "152" Adh GeneMarkHMM splice5 1582136 1582137 . + . transcript "152" Adh GeneMarkHMM splice3 1582200 1582201 . + . transcript "152" Adh GeneMarkHMM CDS 1582201 1582292 . + . transcript "152" Adh GeneMarkHMM splice5 1582292 1582293 . + . transcript "152" Adh GeneMarkHMM splice3 1582549 1582550 . + . transcript "152" Adh GeneMarkHMM CDS 1582550 1582687 . + . transcript "152" Adh GeneMarkHMM splice5 1582687 1582688 . + . transcript "152" Adh GeneMarkHMM splice3 1583069 1583070 . + . transcript "152" Adh GeneMarkHMM CDS 1583070 1583334 . + . transcript "152" Adh GeneMarkHMM splice5 1583334 1583335 . + . transcript "152" Adh GeneMarkHMM splice3 1584329 1584330 . + . transcript "152" Adh GeneMarkHMM CDS 1584330 1584828 . + . transcript "152" Adh GeneMarkHMM splice5 1584828 1584829 . + . transcript "152" Adh GeneMarkHMM splice3 1584948 1584949 . + . transcript "152" Adh GeneMarkHMM CDS 1584949 1585094 . + . transcript "152" Adh GeneMarkHMM splice5 1585094 1585095 . + . transcript "152" Adh GeneMarkHMM splice3 1585152 1585153 . + . transcript "152" Adh GeneMarkHMM CDS 1585153 1585380 . + . transcript "152" Adh GeneMarkHMM stop_codon 1585378 1585380 . + . transcript "152" Adh GeneMarkHMM stop_codon 1591829 1591831 . - . transcript "153" Adh GeneMarkHMM CDS 1591829 1592257 . - . transcript "153" Adh GeneMarkHMM splice3 1592257 1592258 . - . transcript "153" Adh GeneMarkHMM splice5 1597192 1597193 . - . transcript "153" Adh GeneMarkHMM CDS 1597193 1597255 . - . transcript "153" Adh GeneMarkHMM stop_codon 1597253 1597255 . - . transcript "153" Adh GeneMarkHMM start_codon 1599218 1599220 . + . transcript "154" Adh GeneMarkHMM CDS 1599218 1600177 . + . transcript "154" Adh GeneMarkHMM splice5 1600177 1600178 . + . transcript "154" Adh GeneMarkHMM splice3 1601743 1601744 . + . transcript "154" Adh GeneMarkHMM CDS 1601744 1602527 . + . transcript "154" Adh GeneMarkHMM splice5 1602527 1602528 . + . transcript "154" Adh GeneMarkHMM splice3 1603292 1603293 . + . transcript "154" Adh GeneMarkHMM CDS 1603293 1603885 . + . transcript "154" Adh GeneMarkHMM splice5 1603885 1603886 . + . transcript "154" Adh GeneMarkHMM splice3 1603962 1603963 . + . transcript "154" Adh GeneMarkHMM CDS 1603963 1605404 . + . transcript "154" Adh GeneMarkHMM splice5 1605404 1605405 . + . transcript "154" Adh GeneMarkHMM splice3 1605650 1605651 . + . transcript "154" Adh GeneMarkHMM CDS 1605651 1606718 . + . transcript "154" Adh GeneMarkHMM splice5 1606718 1606719 . + . transcript "154" Adh GeneMarkHMM splice3 1606790 1606791 . + . transcript "154" Adh GeneMarkHMM CDS 1606791 1607142 . + . transcript "154" Adh GeneMarkHMM splice5 1607142 1607143 . + . transcript "154" Adh GeneMarkHMM splice3 1607204 1607205 . + . transcript "154" Adh GeneMarkHMM CDS 1607205 1607306 . + . transcript "154" Adh GeneMarkHMM stop_codon 1607304 1607306 . + . transcript "154" Adh GeneMarkHMM start_codon 1624429 1624431 . + . transcript "155" Adh GeneMarkHMM CDS 1624429 1624528 . + . transcript "155" Adh GeneMarkHMM splice5 1624528 1624529 . + . transcript "155" Adh GeneMarkHMM splice3 1624599 1624600 . + . transcript "155" Adh GeneMarkHMM CDS 1624600 1624721 . + . transcript "155" Adh GeneMarkHMM stop_codon 1624719 1624721 . + . transcript "155" Adh GeneMarkHMM stop_codon 1634224 1634226 . - . transcript "156" Adh GeneMarkHMM CDS 1634224 1634574 . - . transcript "156" Adh GeneMarkHMM stop_codon 1634572 1634574 . - . transcript "156" Adh GeneMarkHMM stop_codon 1653232 1653234 . - . transcript "157" Adh GeneMarkHMM CDS 1653232 1653414 . - . transcript "157" Adh GeneMarkHMM splice3 1653414 1653415 . - . transcript "157" Adh GeneMarkHMM splice5 1653856 1653857 . - . transcript "157" Adh GeneMarkHMM CDS 1653857 1657133 . - . transcript "157" Adh GeneMarkHMM splice3 1657133 1657134 . - . transcript "157" Adh GeneMarkHMM splice5 1657231 1657232 . - . transcript "157" Adh GeneMarkHMM CDS 1657232 1657342 . - . transcript "157" Adh GeneMarkHMM splice3 1657342 1657343 . - . transcript "157" Adh GeneMarkHMM splice5 1661044 1661045 . - . transcript "157" Adh GeneMarkHMM CDS 1661045 1661189 . - . transcript "157" Adh GeneMarkHMM splice3 1661189 1661190 . - . transcript "157" Adh GeneMarkHMM splice5 1661786 1661787 . - . transcript "157" Adh GeneMarkHMM CDS 1661787 1661932 . - . transcript "157" Adh GeneMarkHMM splice3 1661932 1661933 . - . transcript "157" Adh GeneMarkHMM splice5 1666902 1666903 . - . transcript "157" Adh GeneMarkHMM CDS 1666903 1666996 . - . transcript "157" Adh GeneMarkHMM splice3 1666996 1666997 . - . transcript "157" Adh GeneMarkHMM splice5 1667693 1667694 . - . transcript "157" Adh GeneMarkHMM CDS 1667694 1667970 . - . transcript "157" Adh GeneMarkHMM stop_codon 1667968 1667970 . - . transcript "157" Adh GeneMarkHMM stop_codon 1690411 1690413 . - . transcript "158" Adh GeneMarkHMM CDS 1690411 1690566 . - . transcript "158" Adh GeneMarkHMM splice3 1690566 1690567 . - . transcript "158" Adh GeneMarkHMM splice5 1692481 1692482 . - . transcript "158" Adh GeneMarkHMM CDS 1692482 1692547 . - . transcript "158" Adh GeneMarkHMM stop_codon 1692545 1692547 . - . transcript "158" Adh GeneMarkHMM stop_codon 1696675 1696677 . - . transcript "159" Adh GeneMarkHMM CDS 1696675 1696843 . - . transcript "159" Adh GeneMarkHMM splice3 1696843 1696844 . - . transcript "159" Adh GeneMarkHMM splice5 1696897 1696898 . - . transcript "159" Adh GeneMarkHMM CDS 1696898 1696944 . - . transcript "159" Adh GeneMarkHMM stop_codon 1696942 1696944 . - . transcript "159" Adh GeneMarkHMM start_codon 1715814 1715816 . + . transcript "160" Adh GeneMarkHMM CDS 1715814 1715828 . + . transcript "160" Adh GeneMarkHMM splice5 1715828 1715829 . + . transcript "160" Adh GeneMarkHMM splice3 1717258 1717259 . + . transcript "160" Adh GeneMarkHMM CDS 1717259 1717294 . + . transcript "160" Adh GeneMarkHMM splice5 1717294 1717295 . + . transcript "160" Adh GeneMarkHMM splice3 1717395 1717396 . + . transcript "160" Adh GeneMarkHMM CDS 1717396 1717497 . + . transcript "160" Adh GeneMarkHMM stop_codon 1717495 1717497 . + . transcript "160" Adh GeneMarkHMM stop_codon 1718580 1718582 . - . transcript "161" Adh GeneMarkHMM CDS 1718580 1718725 . - . transcript "161" Adh GeneMarkHMM splice3 1718725 1718726 . - . transcript "161" Adh GeneMarkHMM splice5 1719194 1719195 . - . transcript "161" Adh GeneMarkHMM CDS 1719195 1719342 . - . transcript "161" Adh GeneMarkHMM splice3 1719342 1719343 . - . transcript "161" Adh GeneMar