## gff-version 2 ## source-version tandem repeats finder (TRF) 2.02 ## source-parameters 2 7 7 80 10 50 500 ## conversion-program trf2gff.pl 1.00 ## date Wed Jul 7 11:31:28 1999 ## DNA Adh Adh TRF tandem_repeat 1423 1474 68 . . Period_size 9; Copy Number 5.8; Match_percent 83; Indel_percent 0 Consensus_size 9; Consensus GGTGGTGTC Adh TRF tandem_repeat 10493 10542 84 . . Period_size 23; Copy Number 2.1; Match_percent 92; Indel_percent 3 Consensus_size 24; Consensus TTGGGTTAACATGGGTCAAACACT Adh TRF tandem_repeat 11266 11311 53 . . Period_size 14; Copy Number 3.4; Match_percent 75; Indel_percent 22 Consensus_size 14; Consensus TGCATTTCGCATTT Adh TRF tandem_repeat 28336 28360 50 . . Period_size 2; Copy Number 12.5; Match_percent 100; Indel_percent 0 Consensus_size 2; Consensus TA Adh TRF tandem_repeat 29335 29366 55 . . Period_size 15; Copy Number 2.1; Match_percent 94; Indel_percent 0 Consensus_size 15; Consensus GCTGTGGACGTGGGT Adh TRF tandem_repeat 54212 54236 50 . . Period_size 13; Copy Number 1.9; Match_percent 100; Indel_percent 0 Consensus_size 13; Consensus CAATTGCAATTTG Adh TRF tandem_repeat 66331 66365 61 . . Period_size 16; Copy Number 2.2; Match_percent 94; Indel_percent 0 Consensus_size 16; Consensus CTGAATGGCTGAATGG Adh TRF tandem_repeat 74562 74596 70 . . Period_size 3; Copy Number 11.7; Match_percent 100; Indel_percent 0 Consensus_size 3; Consensus AAT Adh TRF tandem_repeat 82238 82267 51 . . Period_size 6; Copy Number 4.8; Match_percent 95; Indel_percent 4 Consensus_size 6; Consensus TATGTA Adh TRF tandem_repeat 92979 93003 50 . . Period_size 1; Copy Number 25.0; Match_percent 100; Indel_percent 0 Consensus_size 1; Consensus T Adh TRF tandem_repeat 109140 109194 76 . . Period_size 5; Copy Number 10.8; Match_percent 86; Indel_percent 11 Consensus_size 5; Consensus TATAT Adh TRF tandem_repeat 131094 131166 56 . . Period_size 3; Copy Number 24.3; Match_percent 75; Indel_percent 0 Consensus_size 3; Consensus AGC Adh TRF tandem_repeat 135644 135675 55 . . Period_size 12; Copy Number 2.7; Match_percent 90; Indel_percent 0 Consensus_size 12; Consensus TTAAATTATGTA Adh TRF tandem_repeat 172331 172382 59 . . Period_size 18; Copy Number 2.8; Match_percent 76; Indel_percent 2 Consensus_size 18; Consensus CATTGCCACTGCCACTGA Adh TRF tandem_repeat 177054 177078 50 . . Period_size 10; Copy Number 2.5; Match_percent 100; Indel_percent 0 Consensus_size 10; Consensus CGGTTGTTGT Adh TRF tandem_repeat 178716 178746 53 . . Period_size 15; Copy Number 2.1; Match_percent 93; Indel_percent 0 Consensus_size 15; Consensus TTTCGTTCCATTTCG Adh TRF tandem_repeat 189135 189186 59 . . Period_size 19; Copy Number 2.6; Match_percent 81; Indel_percent 6 Consensus_size 19; Consensus AAAGGAGCGAAAGGAGCGA Adh TRF tandem_repeat 200058 200084 54 . . Period_size 3; Copy Number 9.0; Match_percent 100; Indel_percent 0 Consensus_size 3; Consensus ACA Adh TRF tandem_repeat 234430 234470 55 . . Period_size 6; Copy Number 6.8; Match_percent 91; Indel_percent 0 Consensus_size 6; Consensus ATTCAC Adh TRF tandem_repeat 236713 236751 71 . . Period_size 18; Copy Number 2.1; Match_percent 95; Indel_percent 4 Consensus_size 19; Consensus TGGCGCATGATGGGAATGA Adh TRF tandem_repeat 240427 240452 52 . . Period_size 12; Copy Number 2.2; Match_percent 100; Indel_percent 0 Consensus_size 12; Consensus TCGGTCCCGTAG Adh TRF tandem_repeat 254268 254303 54 . . Period_size 10; Copy Number 3.6; Match_percent 84; Indel_percent 0 Consensus_size 10; Consensus GAGTTGAGTT Adh TRF tandem_repeat 254268 254303 54 . . Period_size 15; Copy Number 2.4; Match_percent 90; Indel_percent 0 Consensus_size 15; Consensus GAGTTGAGCTCAGTT Adh TRF tandem_repeat 271285 271309 50 . . Period_size 3; Copy Number 8.3; Match_percent 100; Indel_percent 0 Consensus_size 3; Consensus CTG Adh TRF tandem_repeat 293134 293180 67 . . Period_size 2; Copy Number 23.5; Match_percent 86; Indel_percent 0 Consensus_size 2; Consensus TA Adh TRF tandem_repeat 354397 354431 61 . . Period_size 18; Copy Number 1.9; Match_percent 94; Indel_percent 0 Consensus_size 18; Consensus AGGGTTTGATTTAGGGAC Adh TRF tandem_repeat 354831 354922 94 . . Period_size 12; Copy Number 7.7; Match_percent 83; Indel_percent 0 Consensus_size 12; Consensus TGTTGCTGCTGC Adh TRF tandem_repeat 354837 354922 82 . . Period_size 3; Copy Number 28.7; Match_percent 80; Indel_percent 0 Consensus_size 3; Consensus TGC Adh TRF tandem_repeat 355065 355258 345 . . Period_size 99; Copy Number 2.0; Match_percent 94; Indel_percent 2 Consensus_size 99; Consensus ATTTATGCTCTTATGGCATATACACTGCACTCTATTTATGAGCTGATTTAATGCTATTAGAGCATTTATAAGGCACTTTTGTCAGGCACTTTTTATTTA Adh TRF tandem_repeat 367195 367226 55 . . Period_size 5; Copy Number 6.4; Match_percent 92; Indel_percent 0 Consensus_size 5; Consensus TTCAG Adh TRF tandem_repeat 368001 368026 52 . . Period_size 6; Copy Number 4.3; Match_percent 100; Indel_percent 0 Consensus_size 6; Consensus ATACAG Adh TRF tandem_repeat 368110 368168 82 . . Period_size 6; Copy Number 9.8; Match_percent 84; Indel_percent 0 Consensus_size 6; Consensus ACAGAT Adh TRF tandem_repeat 386164 386197 59 . . Period_size 7; Copy Number 4.9; Match_percent 96; Indel_percent 0 Consensus_size 7; Consensus AAATGCG Adh TRF tandem_repeat 407404 407442 62 . . Period_size 7; Copy Number 5.7; Match_percent 90; Indel_percent 6 Consensus_size 7; Consensus AATAATA Adh TRF tandem_repeat 407402 407451 66 . . Period_size 10; Copy Number 4.8; Match_percent 83; Indel_percent 16 Consensus_size 10; Consensus ATAATAATAA Adh TRF tandem_repeat 415973 416034 88 . . Period_size 24; Copy Number 2.6; Match_percent 89; Indel_percent 0 Consensus_size 24; Consensus GGCACTGGTTTGTCCACATAGTGG Adh TRF tandem_repeat 425533 425570 51 . . Period_size 12; Copy Number 3.1; Match_percent 88; Indel_percent 11 Consensus_size 12; Consensus ATATTATTATTA Adh TRF tandem_repeat 426019 426074 57 . . Period_size 2; Copy Number 30.0; Match_percent 75; Indel_percent 13 Consensus_size 2; Consensus AT Adh TRF tandem_repeat 426015 426074 93 . . Period_size 15; Copy Number 4.0; Match_percent 88; Indel_percent 0 Consensus_size 15; Consensus ATAAATATATAATAT Adh TRF tandem_repeat 426757 426809 61 . . Period_size 15; Copy Number 3.5; Match_percent 84; Indel_percent 2 Consensus_size 15; Consensus GGAGGAGCCGCCGTA Adh TRF tandem_repeat 426810 426853 70 . . Period_size 15; Copy Number 2.9; Match_percent 89; Indel_percent 0 Consensus_size 15; Consensus ATTCCGTGTCCGGAA Adh TRF tandem_repeat 439526 439577 68 . . Period_size 27; Copy Number 1.9; Match_percent 84; Indel_percent 0 Consensus_size 27; Consensus GCGGGACCACTGTGGCCAACGGCGATC Adh TRF tandem_repeat 446338 446371 52 . . Period_size 18; Copy Number 1.9; Match_percent 88; Indel_percent 5 Consensus_size 18; Consensus GCAGCACAATTACAGGCC Adh TRF tandem_repeat 476603 476632 51 . . Period_size 2; Copy Number 15.0; Match_percent 92; Indel_percent 0 Consensus_size 2; Consensus TA Adh TRF tandem_repeat 495027 495079 61 . . Period_size 3; Copy Number 17.7; Match_percent 84; Indel_percent 0 Consensus_size 3; Consensus CAG Adh TRF tandem_repeat 507896 507921 52 . . Period_size 4; Copy Number 6.5; Match_percent 100; Indel_percent 0 Consensus_size 4; Consensus TCCA Adh TRF tandem_repeat 515824 515862 60 . . Period_size 2; Copy Number 19.0; Match_percent 89; Indel_percent 5 Consensus_size 2; Consensus GT Adh TRF tandem_repeat 530227 530254 56 . . Period_size 7; Copy Number 4.0; Match_percent 100; Indel_percent 0 Consensus_size 7; Consensus GAGCATC Adh TRF tandem_repeat 531726 531752 54 . . Period_size 7; Copy Number 3.9; Match_percent 100; Indel_percent 0 Consensus_size 7; Consensus ACTGGAT Adh TRF tandem_repeat 542734 542764 62 . . Period_size 16; Copy Number 1.9; Match_percent 100; Indel_percent 0 Consensus_size 16; Consensus ATTCAATGGTGTTCTA Adh TRF tandem_repeat 543934 543964 53 . . Period_size 2; Copy Number 15.5; Match_percent 93; Indel_percent 0 Consensus_size 2; Consensus TG Adh TRF tandem_repeat 556247 556298 59 . . Period_size 3; Copy Number 17.3; Match_percent 79; Indel_percent 0 Consensus_size 3; Consensus AGC Adh TRF tandem_repeat 581128 581171 54 . . Period_size 6; Copy Number 7.2; Match_percent 82; Indel_percent 12 Consensus_size 6; Consensus CTGTAT Adh TRF tandem_repeat 591168 591192 50 . . Period_size 2; Copy Number 12.5; Match_percent 100; Indel_percent 0 Consensus_size 2; Consensus CA Adh TRF tandem_repeat 599702 599739 51 . . Period_size 12; Copy Number 3.2; Match_percent 81; Indel_percent 11 Consensus_size 12; Consensus TCCCAATCTCAG Adh TRF tandem_repeat 599717 599766 55 . . Period_size 12; Copy Number 4.2; Match_percent 81; Indel_percent 0 Consensus_size 12; Consensus CAATCCCAGTCA Adh TRF tandem_repeat 609695 609731 56 . . Period_size 2; Copy Number 18.5; Match_percent 88; Indel_percent 0 Consensus_size 2; Consensus CA Adh TRF tandem_repeat 627015 627040 52 . . Period_size 5; Copy Number 5.2; Match_percent 100; Indel_percent 0 Consensus_size 5; Consensus CCAAC Adh TRF tandem_repeat 630658 630694 51 . . Period_size 5; Copy Number 7.8; Match_percent 82; Indel_percent 11 Consensus_size 5; Consensus ATTAC Adh TRF tandem_repeat 633557 633599 50 . . Period_size 3; Copy Number 14.3; Match_percent 82; Indel_percent 0 Consensus_size 3; Consensus TGC Adh TRF tandem_repeat 649044 649070 54 . . Period_size 2; Copy Number 13.5; Match_percent 100; Indel_percent 0 Consensus_size 2; Consensus TG Adh TRF tandem_repeat 652588 652639 59 . . Period_size 9; Copy Number 5.8; Match_percent 83; Indel_percent 0 Consensus_size 9; Consensus CAGCAACAA Adh TRF tandem_repeat 652585 652637 79 . . Period_size 12; Copy Number 4.2; Match_percent 86; Indel_percent 13 Consensus_size 12; Consensus CAGCAGCAACAA Adh TRF tandem_repeat 654840 654881 84 . . Period_size 17; Copy Number 2.5; Match_percent 100; Indel_percent 0 Consensus_size 17; Consensus CATTCCATGCTCAAAAT Adh TRF tandem_repeat 655124 655173 66 . . Period_size 21; Copy Number 2.4; Match_percent 83; Indel_percent 6 Consensus_size 21; Consensus GTGGAGGTGGAAGCGGGAAGC Adh TRF tandem_repeat 655735 656675 1634 . . Period_size 225; Copy Number 4.2; Match_percent 95; Indel_percent 0 Consensus_size 225; Consensus GTTATTCCTTCTGTCGTTGTGGGTGCATTTGTGGTGGTCGGTATATTATCAGTGGTAGTAGGAGCAGGTGTGGTTGTTTTCAAGTCTTCAGCTGTTGTAGGAGATGCTGCAGTGGTCGTGATGTCCCTCGTAGTTGTGGAATCAGAGATGGATGTCGTAGTCGTCGTACTTACCAAACATATTGGTAAGTACGGAAAATCTTTACACTGAATTGAGTCCGTTGTA Adh TRF tandem_repeat 669576 669614 60 . . Period_size 3; Copy Number 13.0; Match_percent 88; Indel_percent 0 Consensus_size 3; Consensus GCA Adh TRF tandem_repeat 669816 669847 50 . . Period_size 12; Copy Number 2.6; Match_percent 85; Indel_percent 14 Consensus_size 13; Consensus GCTATTGCCTATT Adh TRF tandem_repeat 704056 704087 55 . . Period_size 5; Copy Number 6.4; Match_percent 92; Indel_percent 0 Consensus_size 5; Consensus TCCAC Adh TRF tandem_repeat 710193 710220 56 . . Period_size 3; Copy Number 9.3; Match_percent 100; Indel_percent 0 Consensus_size 3; Consensus TAT Adh TRF tandem_repeat 711816 711859 61 . . Period_size 6; Copy Number 7.3; Match_percent 84; Indel_percent 0 Consensus_size 6; Consensus TTGTCG Adh TRF tandem_repeat 720535 720575 55 . . Period_size 1; Copy Number 41.0; Match_percent 90; Indel_percent 0 Consensus_size 1; Consensus T Adh TRF tandem_repeat 735327 735355 51 . . Period_size 14; Copy Number 2.0; Match_percent 93; Indel_percent 6 Consensus_size 15; Consensus CGATCGGACGATGGA Adh TRF tandem_repeat 745219 745251 50 . . Period_size 16; Copy Number 2.1; Match_percent 88; Indel_percent 11 Consensus_size 16; Consensus TTTGTAATATTAATAT Adh TRF tandem_repeat 758073 758098 52 . . Period_size 1; Copy Number 26.0; Match_percent 100; Indel_percent 0 Consensus_size 1; Consensus T Adh TRF tandem_repeat 766754 766782 51 . . Period_size 14; Copy Number 2.0; Match_percent 93; Indel_percent 6 Consensus_size 15; Consensus CTTAATTAATGAGCT Adh TRF tandem_repeat 767649 767684 54 . . Period_size 8; Copy Number 4.5; Match_percent 89; Indel_percent 0 Consensus_size 8; Consensus GGATGGTT Adh TRF tandem_repeat 772182 772212 62 . . Period_size 6; Copy Number 5.2; Match_percent 100; Indel_percent 0 Consensus_size 6; Consensus TCGGGA Adh TRF tandem_repeat 773325 773349 50 . . Period_size 6; Copy Number 4.2; Match_percent 100; Indel_percent 0 Consensus_size 6; Consensus AAAGGC Adh TRF tandem_repeat 828833 828882 55 . . Period_size 2; Copy Number 25.0; Match_percent 79; Indel_percent 0 Consensus_size 2; Consensus AC Adh TRF tandem_repeat 833863 833890 56 . . Period_size 13; Copy Number 2.2; Match_percent 100; Indel_percent 0 Consensus_size 13; Consensus ATTCAAATTGAAA Adh TRF tandem_repeat 836531 836555 50 . . Period_size 12; Copy Number 2.1; Match_percent 100; Indel_percent 0 Consensus_size 12; Consensus GCGATCCGGATG Adh TRF tandem_repeat 858058 858090 57 . . Period_size 12; Copy Number 2.7; Match_percent 95; Indel_percent 4 Consensus_size 12; Consensus TTTTTTTTTAAC Adh TRF tandem_repeat 870704 870846 214 . . Period_size 9; Copy Number 15.9; Match_percent 89; Indel_percent 0 Consensus_size 9; Consensus TGTCCGTAA Adh TRF tandem_repeat 875703 875746 79 . . Period_size 18; Copy Number 2.4; Match_percent 96; Indel_percent 0 Consensus_size 18; Consensus TGGTATTGCCAATGGTAT Adh TRF tandem_repeat 877842 877877 63 . . Period_size 6; Copy Number 6.0; Match_percent 93; Indel_percent 0 Consensus_size 6; Consensus TGCAGT Adh TRF tandem_repeat 879111 879147 65 . . Period_size 2; Copy Number 18.5; Match_percent 94; Indel_percent 0 Consensus_size 2; Consensus CT Adh TRF tandem_repeat 883243 883272 51 . . Period_size 7; Copy Number 4.3; Match_percent 91; Indel_percent 0 Consensus_size 7; Consensus GCGGAGG Adh TRF tandem_repeat 883468 883497 60 . . Period_size 12; Copy Number 2.5; Match_percent 100; Indel_percent 0 Consensus_size 12; Consensus TGTGTGCGAGTG Adh TRF tandem_repeat 892148 892187 62 . . Period_size 6; Copy Number 6.7; Match_percent 88; Indel_percent 0 Consensus_size 6; Consensus TTGCTG Adh TRF tandem_repeat 899819 899845 54 . . Period_size 5; Copy Number 5.4; Match_percent 100; Indel_percent 0 Consensus_size 5; Consensus CCAAA Adh TRF tandem_repeat 936152 936184 57 . . Period_size 4; Copy Number 8.2; Match_percent 93; Indel_percent 0 Consensus_size 4; Consensus TATG Adh TRF tandem_repeat 949082 949115 59 . . Period_size 4; Copy Number 8.5; Match_percent 93; Indel_percent 0 Consensus_size 4; Consensus TGGA Adh TRF tandem_repeat 959936 959960 50 . . Period_size 1; Copy Number 25.0; Match_percent 100; Indel_percent 0 Consensus_size 1; Consensus T Adh TRF tandem_repeat 972869 972904 56 . . Period_size 14; Copy Number 2.5; Match_percent 86; Indel_percent 4 Consensus_size 15; Consensus GACCAGTGACCGGTG Adh TRF tandem_repeat 976963 976987 50 . . Period_size 10; Copy Number 2.5; Match_percent 100; Indel_percent 0 Consensus_size 10; Consensus GATGCGATGA Adh TRF tandem_repeat 993381 993447 61 . . Period_size 6; Copy Number 11.7; Match_percent 74; Indel_percent 15 Consensus_size 6; Consensus AGCAAA Adh TRF tandem_repeat 993387 993447 97 . . Period_size 17; Copy Number 3.6; Match_percent 91; Indel_percent 4 Consensus_size 17; Consensus AGCAAAAGCAACAGAAA Adh TRF tandem_repeat 1004719 1004761 50 . . Period_size 9; Copy Number 4.8; Match_percent 82; Indel_percent 0 Consensus_size 9; Consensus CAGCAACAA Adh TRF tandem_repeat 1004895 1004943 62 . . Period_size 3; Copy Number 16.3; Match_percent 82; Indel_percent 0 Consensus_size 3; Consensus CAG Adh TRF tandem_repeat 1008095 1008119 50 . . Period_size 13; Copy Number 1.9; Match_percent 100; Indel_percent 0 Consensus_size 13; Consensus GAGTAGTAGGTCC Adh TRF tandem_repeat 1016065 1016097 57 . . Period_size 15; Copy Number 2.3; Match_percent 94; Indel_percent 5 Consensus_size 14; Consensus AAAAATTGTAAGTA Adh TRF tandem_repeat 1021305 1021365 70 . . Period_size 8; Copy Number 7.6; Match_percent 81; Indel_percent 7 Consensus_size 8; Consensus ACTGAGTG Adh TRF tandem_repeat 1021305 1021365 86 . . Period_size 16; Copy Number 3.8; Match_percent 88; Indel_percent 0 Consensus_size 16; Consensus ACTGAATGACTGAGTG Adh TRF tandem_repeat 1021305 1021365 52 . . Period_size 4; Copy Number 15.2; Match_percent 76; Indel_percent 6 Consensus_size 4; Consensus ACTG Adh TRF tandem_repeat 1022268 1022312 63 . . Period_size 20; Copy Number 2.2; Match_percent 88; Indel_percent 0 Consensus_size 20; Consensus TGACTAACCCACCAACTGAC Adh TRF tandem_repeat 1036671 1036700 51 . . Period_size 7; Copy Number 4.3; Match_percent 91; Indel_percent 0 Consensus_size 7; Consensus TCCTGGC Adh TRF tandem_repeat 1054682 1054708 54 . . Period_size 5; Copy Number 5.4; Match_percent 100; Indel_percent 0 Consensus_size 5; Consensus GAACT Adh TRF tandem_repeat 1064007 1064032 52 . . Period_size 8; Copy Number 3.2; Match_percent 100; Indel_percent 0 Consensus_size 8; Consensus CCATATCG Adh TRF tandem_repeat 1064744 1064778 52 . . Period_size 12; Copy Number 2.9; Match_percent 82; Indel_percent 0 Consensus_size 12; Consensus CAATCAGTCAGT Adh TRF tandem_repeat 1070139 1070168 51 . . Period_size 9; Copy Number 3.2; Match_percent 95; Indel_percent 4 Consensus_size 9; Consensus TTTTTATTC Adh TRF tandem_repeat 1070495 1070528 50 . . Period_size 5; Copy Number 6.8; Match_percent 86; Indel_percent 0 Consensus_size 5; Consensus CGAGT Adh TRF tandem_repeat 1072955 1072985 53 . . Period_size 16; Copy Number 1.9; Match_percent 93; Indel_percent 0 Consensus_size 16; Consensus GGTGGTTCAGTGGTTT Adh TRF tandem_repeat 1079614 1079643 60 . . Period_size 4; Copy Number 7.5; Match_percent 100; Indel_percent 0 Consensus_size 4; Consensus ATGA Adh TRF tandem_repeat 1081006 1081059 72 . . Period_size 12; Copy Number 4.5; Match_percent 85; Indel_percent 0 Consensus_size 12; Consensus CGCGGATGTGTG Adh TRF tandem_repeat 1081006 1081059 90 . . Period_size 24; Copy Number 2.2; Match_percent 93; Indel_percent 0 Consensus_size 24; Consensus CGCGGATGTGTGCGCGGATGGGAG Adh TRF tandem_repeat 1095224 1095260 51 . . Period_size 5; Copy Number 7.6; Match_percent 85; Indel_percent 14 Consensus_size 5; Consensus GTTGT Adh TRF tandem_repeat 1099411 1099459 71 . . Period_size 7; Copy Number 7.0; Match_percent 85; Indel_percent 0 Consensus_size 7; Consensus TGAGGAC Adh TRF tandem_repeat 1099407 1099459 106 . . Period_size 14; Copy Number 3.8; Match_percent 100; Indel_percent 0 Consensus_size 14; Consensus GGATTGAGGACTGA Adh TRF tandem_repeat 1105993 1106033 64 . . Period_size 18; Copy Number 2.3; Match_percent 91; Indel_percent 0 Consensus_size 18; Consensus ATCTGCATCTCTATCTGT Adh TRF tandem_repeat 1106229 1106260 55 . . Period_size 7; Copy Number 4.6; Match_percent 92; Indel_percent 0 Consensus_size 7; Consensus TGCAAGT Adh TRF tandem_repeat 1109743 1109769 54 . . Period_size 6; Copy Number 4.5; Match_percent 100; Indel_percent 0 Consensus_size 6; Consensus ATACTA Adh TRF tandem_repeat 1112646 1112683 76 . . Period_size 1; Copy Number 38.0; Match_percent 100; Indel_percent 0 Consensus_size 1; Consensus T Adh TRF tandem_repeat 1121317 1121349 57 . . Period_size 4; Copy Number 8.2; Match_percent 93; Indel_percent 0 Consensus_size 4; Consensus GACA Adh TRF tandem_repeat 1126403 1126433 53 . . Period_size 16; Copy Number 1.9; Match_percent 93; Indel_percent 0 Consensus_size 16; Consensus GAGACTGCGAGACTGA Adh TRF tandem_repeat 1143879 1143913 61 . . Period_size 18; Copy Number 1.9; Match_percent 94; Indel_percent 0 Consensus_size 18; Consensus AGGGTTTGATTTAGGGAC Adh TRF tandem_repeat 1144313 1144404 94 . . Period_size 12; Copy Number 7.7; Match_percent 83; Indel_percent 0 Consensus_size 12; Consensus TGTTGCTGCTGC Adh TRF tandem_repeat 1144319 1144404 82 . . Period_size 3; Copy Number 28.7; Match_percent 80; Indel_percent 0 Consensus_size 3; Consensus TGC Adh TRF tandem_repeat 1144550 1144743 345 . . Period_size 99; Copy Number 2.0; Match_percent 94; Indel_percent 2 Consensus_size 99; Consensus ATTTATGCTCTTATGGCATATACACTGCACTCTATTTATGAGCTGATTTAATGCTATTAGAGCATTTATAAGGCACTTTTGTCAGGCACTTTTTATTTA Adh TRF tandem_repeat 1172531 1172585 94 . . Period_size 2; Copy Number 27.5; Match_percent 92; Indel_percent 7 Consensus_size 2; Consensus TA Adh TRF tandem_repeat 1178536 1178560 50 . . Period_size 1; Copy Number 25.0; Match_percent 100; Indel_percent 0 Consensus_size 1; Consensus T Adh TRF tandem_repeat 1183224 1183262 53 . . Period_size 17; Copy Number 2.3; Match_percent 82; Indel_percent 8 Consensus_size 17; Consensus ATATGTATTTATACTTC Adh TRF tandem_repeat 1187932 1187970 62 . . Period_size 16; Copy Number 2.5; Match_percent 91; Indel_percent 4 Consensus_size 16; Consensus ATTCTAATAAAAACCC Adh TRF tandem_repeat 1193722 1193759 67 . . Period_size 12; Copy Number 3.2; Match_percent 96; Indel_percent 0 Consensus_size 12; Consensus TTTGGTTTGGTT Adh TRF tandem_repeat 1206620 1206742 129 . . Period_size 48; Copy Number 2.6; Match_percent 78; Indel_percent 0 Consensus_size 48; Consensus GATTCGGTGGATTCGGAGGATTCGGAGAACAACAACAGCAGCAAGAAA Adh TRF tandem_repeat 1231161 1231192 55 . . Period_size 12; Copy Number 2.7; Match_percent 95; Indel_percent 0 Consensus_size 12; Consensus CCGAATCCACCT Adh TRF tandem_repeat 1231173 1231327 175 . . Period_size 45; Copy Number 3.2; Match_percent 74; Indel_percent 15 Consensus_size 45; Consensus CCGAATCCACCTCCAAATCCTCCTTGCTGCTGCTGCTGCTGATCA Adh TRF tandem_repeat 1231139 1231291 249 . . Period_size 57; Copy Number 2.7; Match_percent 92; Indel_percent 3 Consensus_size 57; Consensus TTGCTGCTGCTGCTGCTGATCACCGAATCCACCTCCGAATCCACCGCCAAATCCTCC Adh TRF tandem_repeat 1233125 1233272 197 . . Period_size 30; Copy Number 4.8; Match_percent 86; Indel_percent 4 Consensus_size 30; Consensus CAGCAAGGATTCGGACAAGGTGGACACGGC Adh TRF tandem_repeat 1233493 1233531 55 . . Period_size 5; Copy Number 8.2; Match_percent 83; Indel_percent 11 Consensus_size 5; Consensus TATTA Adh TRF tandem_repeat 1233498 1233537 55 . . Period_size 8; Copy Number 5.1; Match_percent 84; Indel_percent 6 Consensus_size 8; Consensus TATTATAT Adh TRF tandem_repeat 1241220 1241251 64 . . Period_size 14; Copy Number 2.3; Match_percent 100; Indel_percent 0 Consensus_size 14; Consensus TAAAGAATCTCACA Adh TRF tandem_repeat 1249520 1249553 50 . . Period_size 15; Copy Number 2.3; Match_percent 89; Indel_percent 0 Consensus_size 15; Consensus AGAAGAAGTGCTTTA Adh TRF tandem_repeat 1278306 1278348 50 . . Period_size 8; Copy Number 5.1; Match_percent 83; Indel_percent 10 Consensus_size 8; Consensus TATATGTA Adh TRF tandem_repeat 1281321 1281346 52 . . Period_size 13; Copy Number 2.0; Match_percent 100; Indel_percent 0 Consensus_size 13; Consensus AAATTGTTTTATA Adh TRF tandem_repeat 1295917 1296081 118 . . Period_size 36; Copy Number 4.6; Match_percent 70; Indel_percent 10 Consensus_size 35; Consensus TTCCTTACTATCATTCGGGAATTGTATTTGTCGCA Adh TRF tandem_repeat 1295883 1296153 476 . . Period_size 108; Copy Number 2.5; Match_percent 95; Indel_percent 1 Consensus_size 108; Consensus TTTTCCTACTGTCATTCGGAAAATTTTTATTTTCACTTTCCTTACTATCTTTCAGGAATTGTATGTTGTCGCATTCCTTACTCTCATTCGGGAACTCTGTTTGTATTA Adh TRF tandem_repeat 1298339 1298401 99 . . Period_size 26; Copy Number 2.3; Match_percent 91; Indel_percent 5 Consensus_size 26; Consensus ATTTCACAAGAATGTGAAAAAAAGCT Adh TRF tandem_repeat 1301351 1301383 66 . . Period_size 17; Copy Number 1.9; Match_percent 100; Indel_percent 0 Consensus_size 17; Consensus ACAGAAGGTGAAGATCA Adh TRF tandem_repeat 1308935 1308967 57 . . Period_size 11; Copy Number 3.0; Match_percent 95; Indel_percent 0 Consensus_size 11; Consensus TGGGTCGATGG Adh TRF tandem_repeat 1369864 1369893 51 . . Period_size 13; Copy Number 2.3; Match_percent 94; Indel_percent 0 Consensus_size 13; Consensus AAATATTAATTCG Adh TRF tandem_repeat 1370382 1370413 64 . . Period_size 12; Copy Number 2.7; Match_percent 100; Indel_percent 0 Consensus_size 12; Consensus CAGCAGCACAAG Adh TRF tandem_repeat 1383109 1383133 50 . . Period_size 2; Copy Number 12.5; Match_percent 100; Indel_percent 0 Consensus_size 2; Consensus CA Adh TRF tandem_repeat 1388183 1388207 50 . . Period_size 1; Copy Number 25.0; Match_percent 100; Indel_percent 0 Consensus_size 1; Consensus T Adh TRF tandem_repeat 1389000 1389024 50 . . Period_size 13; Copy Number 1.9; Match_percent 100; Indel_percent 0 Consensus_size 13; Consensus TAGAAAACAAAGA Adh TRF tandem_repeat 1397579 1397609 55 . . Period_size 15; Copy Number 2.0; Match_percent 93; Indel_percent 6 Consensus_size 16; Consensus AAAATATTTTAGCTAC Adh TRF tandem_repeat 1398631 1398664 50 . . Period_size 6; Copy Number 5.7; Match_percent 85; Indel_percent 0 Consensus_size 6; Consensus CCCATG Adh TRF tandem_repeat 1416062 1416119 82 . . Period_size 18; Copy Number 3.2; Match_percent 87; Indel_percent 7 Consensus_size 18; Consensus ATTCCTCCACAACCAGCT Adh TRF tandem_repeat 1452268 1452296 51 . . Period_size 12; Copy Number 2.3; Match_percent 94; Indel_percent 5 Consensus_size 13; Consensus TGCCAGGACAACG Adh TRF tandem_repeat 1453157 1453187 53 . . Period_size 2; Copy Number 15.5; Match_percent 93; Indel_percent 0 Consensus_size 2; Consensus TA Adh TRF tandem_repeat 1459631 1459666 54 . . Period_size 14; Copy Number 2.6; Match_percent 90; Indel_percent 0 Consensus_size 14; Consensus TTGTATCTCGACAT Adh TRF tandem_repeat 1463470 1463495 52 . . Period_size 5; Copy Number 5.2; Match_percent 100; Indel_percent 0 Consensus_size 5; Consensus TTCAG Adh TRF tandem_repeat 1473545 1473601 60 . . Period_size 5; Copy Number 11.4; Match_percent 84; Indel_percent 0 Consensus_size 5; Consensus GGATT Adh TRF tandem_repeat 1474088 1474113 52 . . Period_size 2; Copy Number 13.0; Match_percent 100; Indel_percent 0 Consensus_size 2; Consensus TA Adh TRF tandem_repeat 1474112 1474339 420 . . Period_size 113; Copy Number 2.0; Match_percent 96; Indel_percent 0 Consensus_size 113; Consensus TAAGTTAAGAACCCTCTTCTTGCGATCTTCGTCAGGACTCACCAGCGCTCGGCTCTCGTGTTTTCGGGCCCCGTCAGCAGGCGACTCGGGGCCTGTCTAGGAACATGTTCGTG Adh TRF tandem_repeat 1480217 1480252 72 . . Period_size 1; Copy Number 36.0; Match_percent 100; Indel_percent 0 Consensus_size 1; Consensus A Adh TRF tandem_repeat 1480262 1480316 56 . . Period_size 12; Copy Number 4.6; Match_percent 82; Indel_percent 13 Consensus_size 11; Consensus AAATACAAAAA Adh TRF tandem_repeat 1481117 1481342 416 . . Period_size 113; Copy Number 2.0; Match_percent 96; Indel_percent 0 Consensus_size 113; Consensus AGTTAAGAACCCTCTTCTTGCGATCTTCGTCAGGACTCACCAGCGCTCGGCTCTCGTGTTTTCGGGCCCCGTCAGCAGGCGACTCGGGGCCTGTCTAGGAACATGTTCGTGTA Adh TRF tandem_repeat 1486616 1486669 81 . . Period_size 26; Copy Number 2.1; Match_percent 89; Indel_percent 0 Consensus_size 26; Consensus TTTTATTTATATTGCTACAGAGAAAC Adh TRF tandem_repeat 1497094 1497133 71 . . Period_size 19; Copy Number 2.1; Match_percent 95; Indel_percent 0 Consensus_size 19; Consensus ACACTTAAAAAAATACTAA Adh TRF tandem_repeat 1497979 1498010 55 . . Period_size 15; Copy Number 2.1; Match_percent 94; Indel_percent 0 Consensus_size 15; Consensus AGGCACGCGAGGAGC Adh TRF tandem_repeat 1503315 1503343 58 . . Period_size 2; Copy Number 14.5; Match_percent 100; Indel_percent 0 Consensus_size 2; Consensus TC Adh TRF tandem_repeat 1510588 1510627 62 . . Period_size 6; Copy Number 6.7; Match_percent 97; Indel_percent 0 Consensus_size 6; Consensus TATTTG Adh TRF tandem_repeat 1517574 1517605 50 . . Period_size 12; Copy Number 2.6; Match_percent 85; Indel_percent 14 Consensus_size 13; Consensus AATAAAGATGTAA Adh TRF tandem_repeat 1524577 1524613 60 . . Period_size 18; Copy Number 1.9; Match_percent 89; Indel_percent 10 Consensus_size 20; Consensus ACAAATTCGTTTCTTAAAAT Adh TRF tandem_repeat 1558385 1558499 167 . . Period_size 21; Copy Number 5.5; Match_percent 91; Indel_percent 0 Consensus_size 21; Consensus CTTCCGCGGTGGAGAAGGCGG Adh TRF tandem_repeat 1561993 1562077 170 . . Period_size 39; Copy Number 2.2; Match_percent 100; Indel_percent 0 Consensus_size 39; Consensus TGAACGTCGTGGAAGACTAGATCGGGAGGAACGCGGCGG Adh TRF tandem_repeat 1584639 1584707 111 . . Period_size 21; Copy Number 3.3; Match_percent 93; Indel_percent 0 Consensus_size 21; Consensus AAGGAGGAGAAGGAGCGTGCT Adh TRF tandem_repeat 1588215 1588257 59 . . Period_size 3; Copy Number 14.3; Match_percent 85; Indel_percent 0 Consensus_size 3; Consensus GAT Adh TRF tandem_repeat 1604333 1604409 73 . . Period_size 6; Copy Number 12.8; Match_percent 76; Indel_percent 0 Consensus_size 6; Consensus GGGACA Adh TRF tandem_repeat 1604321 1604396 91 . . Period_size 24; Copy Number 3.2; Match_percent 83; Indel_percent 5 Consensus_size 24; Consensus GGGAACGAGACCGGGACAGAGACA Adh TRF tandem_repeat 1604335 1604405 88 . . Period_size 18; Copy Number 3.9; Match_percent 79; Indel_percent 0 Consensus_size 18; Consensus GACCGGGACAGGGACAGA Adh TRF tandem_repeat 1604329 1604409 99 . . Period_size 12; Copy Number 6.8; Match_percent 85; Indel_percent 0 Consensus_size 12; Consensus GACCGGGACAGA Adh TRF tandem_repeat 1614603 1614643 59 . . Period_size 5; Copy Number 8.6; Match_percent 84; Indel_percent 10 Consensus_size 5; Consensus CTGTT Adh TRF tandem_repeat 1614598 1614643 58 . . Period_size 15; Copy Number 3.3; Match_percent 82; Indel_percent 8 Consensus_size 14; Consensus TCTGTCTGTTCTGT Adh TRF tandem_repeat 1617132 1617172 52 . . Period_size 13; Copy Number 3.1; Match_percent 80; Indel_percent 13 Consensus_size 14; Consensus CAACTGTGCAACAC Adh TRF tandem_repeat 1617125 1617193 79 . . Period_size 26; Copy Number 2.7; Match_percent 82; Indel_percent 6 Consensus_size 26; Consensus GCAACAGCAACGTGCAACACCAATGG Adh TRF tandem_repeat 1644249 1644287 51 . . Period_size 7; Copy Number 5.6; Match_percent 84; Indel_percent 0 Consensus_size 7; Consensus GACGCAG Adh TRF tandem_repeat 1683100 1683129 51 . . Period_size 16; Copy Number 1.9; Match_percent 93; Indel_percent 6 Consensus_size 15; Consensus GACGAGGGCACCGAA Adh TRF tandem_repeat 1686677 1687141 930 . . Period_size 231; Copy Number 2.0; Match_percent 100; Indel_percent 0 Consensus_size 231; Consensus TCGGAAAATTATTTTTCCCTCTGTCTGTAATAAAATAATTTTATATGATTACAAGAAATATAAATCCTATTGAAAACATTCGACTCAGGCTTGTATTTCAAAAGGAGCTTGGCCAAAATGGTTTGGCATGCCGGTAGAAATTGACAAGACAAATAATAAAAAAAAGAGAGTCGATTTCCTCGGCTATCTGATACCCTGTACTCAGCGTTAGAGTGGGTAAGATGCACAATC Adh TRF tandem_repeat 1698003 1698064 79 . . Period_size 4; Copy Number 15.5; Match_percent 82; Indel_percent 0 Consensus_size 4; Consensus ACCA Adh TRF tandem_repeat 1698192 1698227 54 . . Period_size 9; Copy Number 4.0; Match_percent 85; Indel_percent 0 Consensus_size 9; Consensus GCAGCACCA Adh TRF tandem_repeat 1705346 1705372 54 . . Period_size 14; Copy Number 1.9; Match_percent 100; Indel_percent 0 Consensus_size 14; Consensus CTCTGGACTTTGGA Adh TRF tandem_repeat 1709366 1709404 51 . . Period_size 6; Copy Number 6.5; Match_percent 87; Indel_percent 0 Consensus_size 6; Consensus ACTCCC Adh TRF tandem_repeat 1711879 1711912 59 . . Period_size 2; Copy Number 17.0; Match_percent 93; Indel_percent 0 Consensus_size 2; Consensus GT Adh TRF tandem_repeat 1715744 1715779 51 . . Period_size 13; Copy Number 2.8; Match_percent 84; Indel_percent 16 Consensus_size 14; Consensus TTGTATTGGCCCTG Adh TRF tandem_repeat 1723551 1723584 68 . . Period_size 17; Copy Number 2.0; Match_percent 100; Indel_percent 0 Consensus_size 17; Consensus ACTACTTTATATAAATT Adh TRF tandem_repeat 1728633 1728685 52 . . Period_size 3; Copy Number 17.0; Match_percent 76; Indel_percent 7 Consensus_size 3; Consensus GCA Adh TRF tandem_repeat 1732811 1732837 54 . . Period_size 9; Copy Number 3.0; Match_percent 100; Indel_percent 0 Consensus_size 9; Consensus CATCCTCCA Adh TRF tandem_repeat 1732930 1732961 55 . . Period_size 6; Copy Number 5.3; Match_percent 92; Indel_percent 0 Consensus_size 6; Consensus GCAACT Adh TRF tandem_repeat 1736761 1736791 53 . . Period_size 14; Copy Number 2.2; Match_percent 94; Indel_percent 0 Consensus_size 14; Consensus GTGCGTGGGTGGGC Adh TRF tandem_repeat 1739991 1740037 85 . . Period_size 22; Copy Number 2.1; Match_percent 96; Indel_percent 0 Consensus_size 22; Consensus AATAAACTAAAAATTAATATTT Adh TRF tandem_repeat 1740127 1740152 52 . . Period_size 10; Copy Number 2.6; Match_percent 100; Indel_percent 0 Consensus_size 10; Consensus CACTTTTTAC Adh TRF tandem_repeat 1744038 1744094 60 . . Period_size 7; Copy Number 8.1; Match_percent 88; Indel_percent 0 Consensus_size 7; Consensus AAAACCA Adh TRF tandem_repeat 1750886 1750922 67 . . Period_size 18; Copy Number 2.0; Match_percent 94; Indel_percent 5 Consensus_size 19; Consensus TTAAAACTAGTTCATTTCA Adh TRF tandem_repeat 1768692 1768743 61 . . Period_size 7; Copy Number 7.6; Match_percent 78; Indel_percent 4 Consensus_size 7; Consensus ACATTCA Adh TRF tandem_repeat 1768693 1768748 69 . . Period_size 14; Copy Number 4.1; Match_percent 83; Indel_percent 2 Consensus_size 14; Consensus CATTCAACATTCAG Adh TRF tandem_repeat 1773901 1773930 51 . . Period_size 6; Copy Number 5.0; Match_percent 95; Indel_percent 0 Consensus_size 6; Consensus CAACTG Adh TRF tandem_repeat 1783205 1783248 63 . . Period_size 6; Copy Number 7.3; Match_percent 85; Indel_percent 10 Consensus_size 6; Consensus CCCAGT Adh TRF tandem_repeat 1787299 1787326 56 . . Period_size 13; Copy Number 2.2; Match_percent 100; Indel_percent 0 Consensus_size 13; Consensus ATCTATATAATCT Adh TRF tandem_repeat 1787855 1787888 50 . . Period_size 12; Copy Number 2.8; Match_percent 90; Indel_percent 0 Consensus_size 12; Consensus CATTACCAACCG Adh TRF tandem_repeat 1819458 1819487 51 . . Period_size 6; Copy Number 5.0; Match_percent 91; Indel_percent 0 Consensus_size 6; Consensus GTCCAT Adh TRF tandem_repeat 1822078 1822107 60 . . Period_size 15; Copy Number 2.0; Match_percent 100; Indel_percent 0 Consensus_size 15; Consensus CAAAGTTTGCTTAAC Adh TRF tandem_repeat 1837031 1837072 68 . . Period_size 7; Copy Number 6.1; Match_percent 88; Indel_percent 5 Consensus_size 7; Consensus GGGTATG Adh TRF tandem_repeat 1837031 1837065 52 . . Period_size 13; Copy Number 2.6; Match_percent 90; Indel_percent 4 Consensus_size 13; Consensus GGGTATGGATATG Adh TRF tandem_repeat 1837034 1837073 80 . . Period_size 20; Copy Number 2.0; Match_percent 100; Indel_percent 0 Consensus_size 20; Consensus TATGGGGTATGGGGTATGGA Adh TRF tandem_repeat 1865544 1865596 65 . . Period_size 13; Copy Number 4.2; Match_percent 79; Indel_percent 13 Consensus_size 13; Consensus TTTGTATATTATA Adh TRF tandem_repeat 1870671 1870699 51 . . Period_size 12; Copy Number 2.3; Match_percent 94; Indel_percent 5 Consensus_size 13; Consensus TAAAAAGTTTGAT Adh TRF tandem_repeat 1872504 1872539 63 . . Period_size 14; Copy Number 2.6; Match_percent 95; Indel_percent 0 Consensus_size 14; Consensus TCCCAGTTCCAAGT Adh TRF tandem_repeat 1883440 1883476 65 . . Period_size 17; Copy Number 2.2; Match_percent 95; Indel_percent 0 Consensus_size 17; Consensus AATTTAATATATAATTT Adh TRF tandem_repeat 1885100 1885139 53 . . Period_size 9; Copy Number 4.4; Match_percent 80; Indel_percent 0 Consensus_size 9; Consensus CGTCGTCGC Adh TRF tandem_repeat 1900736 1900766 53 . . Period_size 6; Copy Number 5.2; Match_percent 92; Indel_percent 0 Consensus_size 6; Consensus AATTGC Adh TRF tandem_repeat 1911264 1911290 54 . . Period_size 12; Copy Number 2.2; Match_percent 100; Indel_percent 0 Consensus_size 12; Consensus AAAAATGCATTT Adh TRF tandem_repeat 1938674 1938710 65 . . Period_size 12; Copy Number 3.1; Match_percent 96; Indel_percent 0 Consensus_size 12; Consensus ATAATTATAACC Adh TRF tandem_repeat 1947505 1947547 50 . . Period_size 6; Copy Number 7.2; Match_percent 83; Indel_percent 0 Consensus_size 6; Consensus CATGTC Adh TRF tandem_repeat 1957527 1957584 55 . . Period_size 6; Copy Number 9.7; Match_percent 79; Indel_percent 5 Consensus_size 6; Consensus CCAAAG Adh TRF tandem_repeat 1957527 1957585 64 . . Period_size 11; Copy Number 5.0; Match_percent 80; Indel_percent 12 Consensus_size 11; Consensus CCAAAGCCAAG Adh TRF tandem_repeat 1977435 1977459 50 . . Period_size 13; Copy Number 1.9; Match_percent 100; Indel_percent 0 Consensus_size 13; Consensus GATCATTGCACCG Adh TRF tandem_repeat 2003999 2004062 119 . . Period_size 31; Copy Number 2.1; Match_percent 96; Indel_percent 0 Consensus_size 31; Consensus CCCGCCCACAGTGAGAAATGTGTACTAATTT Adh TRF tandem_repeat 2006358 2006387 51 . . Period_size 2; Copy Number 15.0; Match_percent 92; Indel_percent 0 Consensus_size 2; Consensus CA Adh TRF tandem_repeat 2023907 2023937 62 . . Period_size 15; Copy Number 2.1; Match_percent 100; Indel_percent 0 Consensus_size 15; Consensus TGGAGTATATATTCG Adh TRF tandem_repeat 2026009 2026033 50 . . Period_size 9; Copy Number 2.8; Match_percent 100; Indel_percent 0 Consensus_size 9; Consensus CACCGAACA Adh TRF tandem_repeat 2033746 2033775 51 . . Period_size 6; Copy Number 5.0; Match_percent 91; Indel_percent 0 Consensus_size 6; Consensus AGCTGG Adh TRF tandem_repeat 2126704 2126735 55 . . Period_size 15; Copy Number 2.2; Match_percent 94; Indel_percent 5 Consensus_size 14; Consensus CGCTCACAAAAGCA Adh TRF tandem_repeat 2146664 2146702 60 . . Period_size 20; Copy Number 1.9; Match_percent 89; Indel_percent 0 Consensus_size 20; Consensus GTGATGCGATGCGATGCAAT Adh TRF tandem_repeat 2147202 2147226 50 . . Period_size 13; Copy Number 1.9; Match_percent 100; Indel_percent 0 Consensus_size 13; Consensus GAATTATCAATGT Adh TRF tandem_repeat 2159937 2159963 54 . . Period_size 2; Copy Number 13.5; Match_percent 100; Indel_percent 0 Consensus_size 2; Consensus CA Adh TRF tandem_repeat 2189123 2189147 50 . . Period_size 13; Copy Number 1.9; Match_percent 100; Indel_percent 0 Consensus_size 13; Consensus AATTAATAGATTA Adh TRF tandem_repeat 2191532 2191557 52 . . Period_size 3; Copy Number 8.7; Match_percent 100; Indel_percent 0 Consensus_size 3; Consensus TGA Adh TRF tandem_repeat 2202160 2202194 54 . . Period_size 17; Copy Number 2.1; Match_percent 89; Indel_percent 5 Consensus_size 17; Consensus GTTTTAAGACTAGTATA Adh TRF tandem_repeat 2214721 2214877 104 . . Period_size 3; Copy Number 53.0; Match_percent 75; Indel_percent 5 Consensus_size 3; Consensus ATA Adh TRF tandem_repeat 2215406 2215454 89 . . Period_size 4; Copy Number 12.2; Match_percent 95; Indel_percent 0 Consensus_size 4; Consensus GATG Adh TRF tandem_repeat 2215825 2215876 77 . . Period_size 3; Copy Number 17.3; Match_percent 87; Indel_percent 0 Consensus_size 3; Consensus TAA Adh TRF tandem_repeat 2227068 2227112 72 . . Period_size 11; Copy Number 4.1; Match_percent 91; Indel_percent 0 Consensus_size 11; Consensus AAGGGGGTAGC Adh TRF tandem_repeat 2227058 2227112 76 . . Period_size 22; Copy Number 2.5; Match_percent 85; Indel_percent 8 Consensus_size 22; Consensus GAGGGTAGCAAGGGGGTAGCAA Adh TRF tandem_repeat 2249721 2249747 54 . . Period_size 14; Copy Number 1.9; Match_percent 100; Indel_percent 0 Consensus_size 14; Consensus TTATATATTAAAGC Adh TRF tandem_repeat 2259275 2259309 54 . . Period_size 17; Copy Number 2.0; Match_percent 88; Indel_percent 5 Consensus_size 18; Consensus TAAATTAAGCCTTGTAAT Adh TRF tandem_repeat 2293699 2293728 53 . . Period_size 13; Copy Number 2.4; Match_percent 94; Indel_percent 5 Consensus_size 13; Consensus ATAGATATGGTTT Adh TRF tandem_repeat 2359376 2359421 56 . . Period_size 11; Copy Number 4.0; Match_percent 81; Indel_percent 10 Consensus_size 11; Consensus TATATATTTTT Adh TRF tandem_repeat 2362340 2362365 52 . . Period_size 9; Copy Number 2.9; Match_percent 100; Indel_percent 0 Consensus_size 9; Consensus AGCAGCACA Adh TRF tandem_repeat 2366112 2366153 50 . . Period_size 6; Copy Number 7.0; Match_percent 78; Indel_percent 10 Consensus_size 6; Consensus TGTCCA Adh TRF tandem_repeat 2375469 2376668 2240 . . Period_size 228; Copy Number 5.3; Match_percent 97; Indel_percent 0 Consensus_size 228; Consensus ATTCCAAATGTAGGCCAAGGAAACAGAGGGAATAGATATGATCCAAATCCGGAAATCGGAGCAGTTCCAGTCGGAAATCCTATTCCGAATGAAGGCAATGCATTTGGCGGTCGTGGATATGATTTAAATGAAATCCAAAAACATAATCAAGGTGGAAGATACATTCCACATGTAGGTCATGGAAATGGTCCCAATGCACCTAAAGAACCTCTTAAAATCGGAGGAAAT Adh TRF tandem_repeat 2405834 2405892 63 . . Period_size 7; Copy Number 8.9; Match_percent 80; Indel_percent 15 Consensus_size 7; Consensus TATTATA Adh TRF tandem_repeat 2410580 2410607 56 . . Period_size 14; Copy Number 2.0; Match_percent 100; Indel_percent 0 Consensus_size 14; Consensus GCCAAAGCGAAAAA Adh TRF tandem_repeat 2424794 2424818 50 . . Period_size 13; Copy Number 1.9; Match_percent 100; Indel_percent 0 Consensus_size 13; Consensus ATAGTGGTTTGAG Adh TRF tandem_repeat 2429836 2429865 53 . . Period_size 14; Copy Number 2.1; Match_percent 93; Indel_percent 6 Consensus_size 15; Consensus TTAATTCAATAATAT Adh TRF tandem_repeat 2435866 2435908 50 . . Period_size 8; Copy Number 5.4; Match_percent 80; Indel_percent 0 Consensus_size 8; Consensus TGACTAGA Adh TRF tandem_repeat 2443547 2443579 57 . . Period_size 10; Copy Number 3.3; Match_percent 91; Indel_percent 0 Consensus_size 10; Consensus AGGATATGCC Adh TRF tandem_repeat 2444339 2444363 50 . . Period_size 2; Copy Number 12.5; Match_percent 100; Indel_percent 0 Consensus_size 2; Consensus GT Adh TRF tandem_repeat 2452513 2452567 58 . . Period_size 12; Copy Number 4.6; Match_percent 81; Indel_percent 4 Consensus_size 12; Consensus ATCCGCCACATG Adh TRF tandem_repeat 2454294 2454323 53 . . Period_size 13; Copy Number 2.2; Match_percent 94; Indel_percent 5 Consensus_size 14; Consensus TTTATAAAATTTTA Adh TRF tandem_repeat 2465248 2465283 54 . . Period_size 18; Copy Number 2.0; Match_percent 88; Indel_percent 0 Consensus_size 18; Consensus CCGCCATCATCATGATCG Adh TRF tandem_repeat 2476796 2476845 68 . . Period_size 13; Copy Number 3.7; Match_percent 84; Indel_percent 7 Consensus_size 14; Consensus ATTATATTTTACTT Adh TRF tandem_repeat 2499015 2499060 69 . . Period_size 19; Copy Number 2.3; Match_percent 88; Indel_percent 7 Consensus_size 21; Consensus AAGCAGTGGGAAGGGGAAACC Adh TRF tandem_repeat 2500796 2500828 57 . . Period_size 3; Copy Number 11.0; Match_percent 93; Indel_percent 0 Consensus_size 3; Consensus GGA Adh TRF tandem_repeat 2512602 2512646 54 . . Period_size 5; Copy Number 9.0; Match_percent 87; Indel_percent 0 Consensus_size 5; Consensus CTGAA Adh TRF tandem_repeat 2564818 2564865 60 . . Period_size 23; Copy Number 2.1; Match_percent 81; Indel_percent 11 Consensus_size 22; Consensus CAAAAACTAAAAGTTATTCAAG Adh TRF tandem_repeat 2566337 2566364 56 . . Period_size 13; Copy Number 2.2; Match_percent 100; Indel_percent 0 Consensus_size 13; Consensus ATGTGCGGTAAAT Adh TRF tandem_repeat 2570414 2570442 58 . . Period_size 2; Copy Number 14.5; Match_percent 100; Indel_percent 0 Consensus_size 2; Consensus AC Adh TRF tandem_repeat 2571737 2571768 55 . . Period_size 7; Copy Number 4.6; Match_percent 96; Indel_percent 0 Consensus_size 7; Consensus GGCGGTG Adh TRF tandem_repeat 2579771 2579797 54 . . Period_size 2; Copy Number 13.5; Match_percent 100; Indel_percent 0 Consensus_size 2; Consensus TA Adh TRF tandem_repeat 2590413 2590442 60 . . Period_size 14; Copy Number 2.1; Match_percent 100; Indel_percent 0 Consensus_size 14; Consensus TCGAAATAAAGCGA Adh TRF tandem_repeat 2593068 2593338 476 . . Period_size 108; Copy Number 2.5; Match_percent 95; Indel_percent 1 Consensus_size 108; Consensus TTCCTGAAAGATAGTAAGGAAAGTGAAAATAAAAATTTTCCGAATGACAGTAGGAAAATAATACAAACAGAATTCCCGAATGAGAGTAAGGAATGCGACAACATACAA Adh TRF tandem_repeat 2593140 2593304 118 . . Period_size 36; Copy Number 4.6; Match_percent 70; Indel_percent 10 Consensus_size 35; Consensus TTCCCGAATGAGAGTAAGGAATGCGACAAATACAA Adh TRF tandem_repeat 2597900 2597932 50 . . Period_size 5; Copy Number 6.8; Match_percent 93; Indel_percent 3 Consensus_size 5; Consensus TTCCG Adh TRF tandem_repeat 2641313 2641337 50 . . Period_size 13; Copy Number 1.9; Match_percent 100; Indel_percent 0 Consensus_size 13; Consensus TACTCTACTATAG Adh TRF tandem_repeat 2651478 2651506 58 . . Period_size 14; Copy Number 2.1; Match_percent 100; Indel_percent 0 Consensus_size 14; Consensus ACTTAATTTCTAGG Adh TRF tandem_repeat 2660130 2660183 51 . . Period_size 5; Copy Number 9.0; Match_percent 82; Indel_percent 13 Consensus_size 6; Consensus TTTTTG Adh TRF tandem_repeat 2666820 2666844 50 . . Period_size 7; Copy Number 3.6; Match_percent 100; Indel_percent 0 Consensus_size 7; Consensus AGTGGAA Adh TRF tandem_repeat 2674186 2674230 63 . . Period_size 13; Copy Number 3.5; Match_percent 84; Indel_percent 0 Consensus_size 13; Consensus GGGACATCTCGGC Adh TRF tandem_repeat 2688917 2688951 52 . . Period_size 12; Copy Number 2.9; Match_percent 91; Indel_percent 0 Consensus_size 12; Consensus CGTCTGTCCGTT Adh TRF tandem_repeat 2689255 2689289 52 . . Period_size 2; Copy Number 17.5; Match_percent 87; Indel_percent 0 Consensus_size 2; Consensus TA Adh TRF tandem_repeat 2703028 2703097 69 . . Period_size 10; Copy Number 7.5; Match_percent 73; Indel_percent 15 Consensus_size 10; Consensus AGATAGATAT Adh TRF tandem_repeat 2703033 2703105 55 . . Period_size 6; Copy Number 12.0; Match_percent 71; Indel_percent 23 Consensus_size 6; Consensus GATATA Adh TRF tandem_repeat 2713665 2713700 51 . . Period_size 5; Copy Number 7.8; Match_percent 87; Indel_percent 12 Consensus_size 5; Consensus TTTTG Adh TRF tandem_repeat 2725501 2725557 105 . . Period_size 2; Copy Number 28.5; Match_percent 96; Indel_percent 0 Consensus_size 2; Consensus TA Adh TRF tandem_repeat 2756438 2756487 57 . . Period_size 15; Copy Number 3.6; Match_percent 78; Indel_percent 7 Consensus_size 14; Consensus AATATTTTACAATA Adh TRF tandem_repeat 2788846 2789016 218 . . Period_size 24; Copy Number 7.1; Match_percent 86; Indel_percent 2 Consensus_size 24; Consensus TCCCGGACCTGGATATCCTCTGGG Adh TRF tandem_repeat 2808709 2808738 60 . . Period_size 14; Copy Number 2.1; Match_percent 100; Indel_percent 0 Consensus_size 14; Consensus TTAGTTGTAATTAG Adh TRF tandem_repeat 2813993 2814020 56 . . Period_size 13; Copy Number 2.2; Match_percent 100; Indel_percent 0 Consensus_size 13; Consensus TTTCTGCCAGCAA Adh TRF tandem_repeat 2856339 2856364 52 . . Period_size 5; Copy Number 5.2; Match_percent 100; Indel_percent 0 Consensus_size 5; Consensus GGTAT Adh TRF tandem_repeat 2881397 2881426 51 . . Period_size 12; Copy Number 2.5; Match_percent 94; Indel_percent 0 Consensus_size 12; Consensus TTGCAAATCAAG Adh TRF tandem_repeat 2885773 2885803 53 . . Period_size 15; Copy Number 2.1; Match_percent 93; Indel_percent 0 Consensus_size 15; Consensus ATTCAATAAAATTCA Adh TRF tandem_repeat 2887597 2887626 51 . . Period_size 2; Copy Number 15.0; Match_percent 92; Indel_percent 0 Consensus_size 2; Consensus AT Adh TRF tandem_repeat 2902098 2902146 89 . . Period_size 14; Copy Number 3.5; Match_percent 97; Indel_percent 0 Consensus_size 14; Consensus ACTTCTCTAAGCCA Adh TRF tandem_repeat 2904963 2904992 51 . . Period_size 15; Copy Number 2.0; Match_percent 93; Indel_percent 0 Consensus_size 15; Consensus GAGAACCTGAGAACT Adh TRF tandem_repeat 2905838 2905867 51 . . Period_size 10; Copy Number 3.0; Match_percent 95; Indel_percent 0 Consensus_size 10; Consensus CATATATATG Adh TRF tandem_repeat 2913004 2913039 54 . . Period_size 8; Copy Number 4.5; Match_percent 85; Indel_percent 0 Consensus_size 8; Consensus AACAGCCA Adh TRF tandem_repeat 2913083 2913122 62 . . Period_size 3; Copy Number 13.3; Match_percent 91; Indel_percent 0 Consensus_size 3; Consensus CAA # # complfy: 1. Calypso entries only Jul 5 (MR) # 2. group field cleaned 5 (MR) # Adh calypso tandemrepeat 1622 1636 . + 1 # 15 x A Adh calypso tandemrepeat 2551 2568 . + 0 # 3 x ACCAGA Adh calypso tandemrepeat 2551 2568 . + 0 # 3 x ACCAGA Adh calypso tandemrepeat 3603 3617 . + 2 # 3 x AACGC Adh calypso tandemrepeat 3603 3617 . + 2 # 3 x AACGC Adh calypso tandemrepeat 10170 10185 . + 2 # 4 x CCTG Adh calypso tandemrepeat 10170 10185 . + 2 # 4 x CCTG Adh calypso tandemrepeat 28336 28359 . + 0 # 12 x TA Adh calypso tandemrepeat 28336 28359 . + 0 # 12 x TA Adh calypso tandemrepeat 29566 29581 . + 0 # 4 x GTAT Adh calypso tandemrepeat 29566 29581 . + 0 # 4 x GTAT Adh calypso tandemrepeat 37867 37881 . + 0 # 3 x CTTGA Adh calypso tandemrepeat 37867 37881 . + 0 # 3 x CTTGA Adh calypso tandemrepeat 39133 39148 . + 0 # 16 x A Adh calypso tandemrepeat 39133 39148 . + 0 # 16 x A Adh calypso tandemrepeat 39991 40005 . + 0 # 15 x A Adh calypso tandemrepeat 39991 40005 . + 0 # 15 x A Adh calypso tandemrepeat 40748 40762 . + 1 # 5 x TGC Adh calypso tandemrepeat 40748 40762 . + 1 # 5 x TGC Adh calypso tandemrepeat 41083 41098 . + 0 # 4 x AATA Adh calypso tandemrepeat 41083 41098 . + 0 # 4 x AATA Adh calypso tandemrepeat 41804 41818 . + 1 # 5 x TTC Adh calypso tandemrepeat 41804 41818 . + 1 # 5 x TTC Adh calypso tandemrepeat 41852 41867 . + 1 # 8 x TG Adh calypso tandemrepeat 41852 41867 . + 1 # 8 x TG Adh calypso tandemrepeat 42651 42670 . + 2 # 10 x TC Adh calypso tandemrepeat 42651 42670 . + 2 # 10 x TC Adh calypso tandemrepeat 46851 46868 . + 2 # 9 x AT Adh calypso tandemrepeat 46851 46868 . + 2 # 9 x AT Adh calypso tandemrepeat 46851 46868 . + 2 # 9 x AT Adh calypso tandemrepeat 46851 46868 . + 2 # 9 x AT Adh calypso tandemrepeat 47082 47097 . + 2 # 16 x T Adh calypso tandemrepeat 47082 47097 . + 2 # 16 x T Adh calypso tandemrepeat 47082 47097 . + 2 # 16 x T Adh calypso tandemrepeat 47082 47097 . + 2 # 16 x T Adh calypso tandemrepeat 53890 53904 . + 0 # 3 x TTTTA Adh calypso tandemrepeat 53890 53904 . + 0 # 3 x TTTTA Adh calypso tandemrepeat 54248 54267 . + 1 # 20 x A Adh calypso tandemrepeat 54248 54267 . + 1 # 20 x A Adh calypso tandemrepeat 58947 58969 . + 2 # 23 x A Adh calypso tandemrepeat 58947 58969 . + 2 # 23 x A Adh calypso tandemrepeat 63281 63295 . + 1 # 3 x AACAG Adh calypso tandemrepeat 63281 63295 . + 1 # 3 x AACAG Adh calypso tandemrepeat 70833 70850 . + 2 # 3 x GATACA Adh calypso tandemrepeat 70833 70850 . + 2 # 3 x GATACA Adh calypso tandemrepeat 72090 72105 . + 2 # 4 x ATAC Adh calypso tandemrepeat 72090 72105 . + 2 # 4 x ATAC Adh calypso tandemrepeat 74562 74594 . + 2 # 11 x AAT Adh calypso tandemrepeat 74562 74594 . + 2 # 11 x AAT Adh calypso tandemrepeat 76467 76486 . + 2 # 4 x CGAAT Adh calypso tandemrepeat 76467 76486 . + 2 # 4 x CGAAT Adh calypso tandemrepeat 77989 78006 . + 0 # 9 x TG Adh calypso tandemrepeat 77989 78006 . + 0 # 9 x TG Adh calypso tandemrepeat 82238 82261 . + 1 # 4 x TATGTA Adh calypso tandemrepeat 82238 82261 . + 1 # 4 x TATGTA Adh calypso tandemrepeat 83275 83290 . + 0 # 4 x CAGA Adh calypso tandemrepeat 83275 83290 . + 0 # 4 x CAGA Adh calypso tandemrepeat 85957 85974 . + 0 # 6 x GCA Adh calypso tandemrepeat 85957 85974 . + 0 # 6 x GCA Adh calypso tandemrepeat 91308 91322 . + 2 # 5 x TCG Adh calypso tandemrepeat 91308 91322 . + 2 # 5 x TCG Adh calypso tandemrepeat 91308 91322 . + 2 # 5 x TCG Adh calypso tandemrepeat 91308 91322 . + 2 # 5 x TCG Adh calypso tandemrepeat 91725 91739 . + 2 # 3 x TGGTT Adh calypso tandemrepeat 91725 91739 . + 2 # 3 x TGGTT Adh calypso tandemrepeat 91725 91739 . + 2 # 3 x TGGTT Adh calypso tandemrepeat 91725 91739 . + 2 # 3 x TGGTT Adh calypso tandemrepeat 92979 93003 . + 2 # 25 x T Adh calypso tandemrepeat 92979 93003 . + 2 # 25 x T Adh calypso tandemrepeat 92979 93003 . + 2 # 25 x T Adh calypso tandemrepeat 92979 93003 . + 2 # 25 x T Adh calypso tandemrepeat 96698 96717 . + 1 # 10 x TG Adh calypso tandemrepeat 96698 96717 . + 1 # 10 x TG Adh calypso tandemrepeat 98583 98601 . + 2 # 19 x T Adh calypso tandemrepeat 98583 98601 . + 2 # 19 x T Adh calypso tandemrepeat 100384 100401 . + 0 # 18 x A Adh calypso tandemrepeat 100384 100401 . + 0 # 18 x A Adh calypso tandemrepeat 101289 101308 . + 2 # 20 x A Adh calypso tandemrepeat 101289 101308 . + 2 # 20 x A Adh calypso tandemrepeat 103257 103271 . + 2 # 3 x CTGGT Adh calypso tandemrepeat 103257 103271 . + 2 # 3 x CTGGT Adh calypso tandemrepeat 104183 104197 . + 1 # 5 x TCG Adh calypso tandemrepeat 104183 104197 . + 1 # 5 x TCG Adh calypso tandemrepeat 108993 109008 . + 2 # 16 x A Adh calypso tandemrepeat 108993 109008 . + 2 # 16 x A Adh calypso tandemrepeat 109140 109174 . + 2 # 7 x TATAT Adh calypso tandemrepeat 109140 109174 . + 2 # 7 x TATAT Adh calypso tandemrepeat 111964 111978 . + 0 # 5 x CAT Adh calypso tandemrepeat 111964 111978 . + 0 # 5 x CAT Adh calypso tandemrepeat 126718 126732 . + 0 # 3 x TGGAT Adh calypso tandemrepeat 126718 126732 . + 0 # 3 x TGGAT Adh calypso tandemrepeat 131119 131136 . + 0 # 6 x GCA Adh calypso tandemrepeat 131119 131136 . + 0 # 6 x GCA Adh calypso tandemrepeat 137480 137497 . + 1 # 18 x T Adh calypso tandemrepeat 137480 137497 . + 1 # 18 x T Adh calypso tandemrepeat 137480 137497 . + 1 # 18 x T Adh calypso tandemrepeat 137480 137497 . + 1 # 18 x T Adh calypso tandemrepeat 137594 137608 . + 1 # 5 x AAC Adh calypso tandemrepeat 137594 137608 . + 1 # 5 x AAC Adh calypso tandemrepeat 137594 137608 . + 1 # 5 x AAC Adh calypso tandemrepeat 137594 137608 . + 1 # 5 x AAC Adh calypso tandemrepeat 137931 137945 . + 2 # 3 x ATTGT Adh calypso tandemrepeat 137931 137945 . + 2 # 3 x ATTGT Adh calypso tandemrepeat 137931 137945 . + 2 # 3 x ATTGT Adh calypso tandemrepeat 137931 137945 . + 2 # 3 x ATTGT Adh calypso tandemrepeat 143823 143842 . + 2 # 10 x AC Adh calypso tandemrepeat 143823 143842 . + 2 # 10 x AC Adh calypso tandemrepeat 152870 152889 . + 1 # 10 x AC Adh calypso tandemrepeat 152870 152889 . + 1 # 10 x AC Adh calypso tandemrepeat 166341 166360 . + 2 # 5 x CAAA Adh calypso tandemrepeat 166341 166360 . + 2 # 5 x CAAA Adh calypso tandemrepeat 167926 167943 . + 0 # 9 x CA Adh calypso tandemrepeat 167926 167943 . + 0 # 9 x CA Adh calypso tandemrepeat 172510 172524 . + 0 # 5 x TGT Adh calypso tandemrepeat 172510 172524 . + 0 # 5 x TGT Adh calypso tandemrepeat 182041 182056 . + 0 # 4 x ACAA Adh calypso tandemrepeat 182041 182056 . + 0 # 4 x ACAA Adh calypso tandemrepeat 182041 182056 . + 0 # 4 x ACAA Adh calypso tandemrepeat 182041 182056 . + 0 # 4 x ACAA Adh calypso tandemrepeat 192791 192808 . + 1 # 3 x AATGGT Adh calypso tandemrepeat 192791 192808 . + 1 # 3 x AATGGT Adh calypso tandemrepeat 200058 200084 . + 2 # 9 x ACA Adh calypso tandemrepeat 200058 200084 . + 2 # 9 x ACA Adh calypso tandemrepeat 200215 200230 . + 0 # 16 x A Adh calypso tandemrepeat 200215 200230 . + 0 # 16 x A Adh calypso tandemrepeat 207660 207675 . + 2 # 4 x TCAA Adh calypso tandemrepeat 207660 207675 . + 2 # 4 x TCAA Adh calypso tandemrepeat 209347 209361 . + 0 # 15 x T Adh calypso tandemrepeat 209347 209361 . + 0 # 15 x T Adh calypso tandemrepeat 212843 212857 . + 1 # 5 x TTA Adh calypso tandemrepeat 212843 212857 . + 1 # 5 x TTA Adh calypso tandemrepeat 214781 214798 . + 1 # 3 x GGGCAT Adh calypso tandemrepeat 214781 214798 . + 1 # 3 x GGGCAT Adh calypso tandemrepeat 224959 224973 . + 0 # 3 x AATTA Adh calypso tandemrepeat 224959 224973 . + 0 # 3 x AATTA Adh calypso tandemrepeat 227156 227170 . + 1 # 5 x GCT Adh calypso tandemrepeat 227156 227170 . + 1 # 5 x GCT Adh calypso tandemrepeat 227156 227170 . + 1 # 5 x GCT Adh calypso tandemrepeat 227156 227170 . + 1 # 5 x GCT Adh calypso tandemrepeat 231257 231274 . + 1 # 3 x TCTTGG Adh calypso tandemrepeat 231257 231274 . + 1 # 3 x TCTTGG Adh calypso tandemrepeat 233834 233848 . + 1 # 5 x TAT Adh calypso tandemrepeat 233834 233848 . + 1 # 5 x TAT Adh calypso tandemrepeat 234017 234031 . + 1 # 3 x GGCGA Adh calypso tandemrepeat 234017 234031 . + 1 # 3 x GGCGA Adh calypso tandemrepeat 234438 234455 . + 2 # 3 x TCACAT Adh calypso tandemrepeat 234438 234455 . + 2 # 3 x TCACAT Adh calypso tandemrepeat 238711 238725 . + 0 # 5 x TGC Adh calypso tandemrepeat 238711 238725 . + 0 # 5 x TGC Adh calypso tandemrepeat 242300 242318 . + 1 # 19 x A Adh calypso tandemrepeat 242300 242318 . + 1 # 19 x A Adh calypso tandemrepeat 242376 242393 . + 2 # 9 x CA Adh calypso tandemrepeat 242376 242393 . + 2 # 9 x CA Adh calypso tandemrepeat 243709 243724 . + 0 # 16 x A Adh calypso tandemrepeat 243709 243724 . + 0 # 16 x A Adh calypso tandemrepeat 248282 248296 . + 1 # 5 x GAT Adh calypso tandemrepeat 248282 248296 . + 1 # 5 x GAT Adh calypso tandemrepeat 251018 251035 . + 1 # 3 x AGATAC Adh calypso tandemrepeat 251018 251035 . + 1 # 3 x AGATAC Adh calypso tandemrepeat 254583 254598 . + 2 # 8 x TA Adh calypso tandemrepeat 254583 254598 . + 2 # 8 x TA Adh calypso tandemrepeat 255611 255633 . + 1 # 23 x T Adh calypso tandemrepeat 255611 255633 . + 1 # 23 x T Adh calypso tandemrepeat 259848 259863 . + 2 # 4 x TATG Adh calypso tandemrepeat 259848 259863 . + 2 # 4 x TATG Adh calypso tandemrepeat 266340 266354 . + 2 # 3 x ATATA Adh calypso tandemrepeat 266340 266354 . + 2 # 3 x ATATA Adh calypso tandemrepeat 270098 270115 . + 1 # 9 x TG Adh calypso tandemrepeat 270098 270115 . + 1 # 9 x TG Adh calypso tandemrepeat 270098 270115 . + 1 # 9 x TG Adh calypso tandemrepeat 270098 270115 . + 1 # 9 x TG Adh calypso tandemrepeat 271285 271308 . + 0 # 8 x CTG Adh calypso tandemrepeat 271285 271308 . + 0 # 8 x CTG Adh calypso tandemrepeat 271285 271308 . + 0 # 8 x CTG Adh calypso tandemrepeat 271285 271308 . + 0 # 8 x CTG Adh calypso tandemrepeat 271412 271426 . + 1 # 3 x GCACA Adh calypso tandemrepeat 271412 271426 . + 1 # 3 x GCACA Adh calypso tandemrepeat 271412 271426 . + 1 # 3 x GCACA Adh calypso tandemrepeat 271412 271426 . + 1 # 3 x GCACA Adh calypso tandemrepeat 284448 284462 . + 2 # 15 x T Adh calypso tandemrepeat 284448 284462 . + 2 # 15 x T Adh calypso tandemrepeat 293149 293168 . + 0 # 10 x AT Adh calypso tandemrepeat 293149 293168 . + 0 # 10 x AT Adh calypso tandemrepeat 297736 297751 . + 0 # 4 x TTGT Adh calypso tandemrepeat 297736 297751 . + 0 # 4 x TTGT Adh calypso tandemrepeat 307350 307367 . + 2 # 3 x TATAAA Adh calypso tandemrepeat 307350 307367 . + 2 # 3 x TATAAA Adh calypso tandemrepeat 312806 312823 . + 1 # 6 x GCA Adh calypso tandemrepeat 312806 312823 . + 1 # 6 x GCA Adh calypso tandemrepeat 313243 313260 . + 0 # 9 x AT Adh calypso tandemrepeat 313243 313260 . + 0 # 9 x AT Adh calypso tandemrepeat 314920 314937 . + 0 # 3 x TTCGGA Adh calypso tandemrepeat 314920 314937 . + 0 # 3 x TTCGGA Adh calypso tandemrepeat 315342 315359 . + 2 # 6 x AAT Adh calypso tandemrepeat 315342 315359 . + 2 # 6 x AAT Adh calypso tandemrepeat 315342 315359 . + 2 # 6 x AAT Adh calypso tandemrepeat 315342 315359 . + 2 # 6 x AAT Adh calypso tandemrepeat 321786 321801 . + 2 # 16 x G Adh calypso tandemrepeat 321786 321801 . + 2 # 16 x G Adh calypso tandemrepeat 331264 331285 . + 0 # 11 x TG Adh calypso tandemrepeat 331264 331285 . + 0 # 11 x TG Adh calypso tandemrepeat 331475 331492 . + 1 # 3 x GGCAGC Adh calypso tandemrepeat 331475 331492 . + 1 # 3 x GGCAGC Adh calypso tandemrepeat 331997 332012 . + 1 # 16 x T Adh calypso tandemrepeat 331997 332012 . + 1 # 16 x T Adh calypso tandemrepeat 332637 332651 . + 2 # 5 x AAC Adh calypso tandemrepeat 332637 332651 . + 2 # 5 x AAC Adh calypso tandemrepeat 354987 355002 . + 2 # 16 x T Adh calypso tandemrepeat 354987 355002 . + 2 # 16 x T Adh calypso tandemrepeat 357348 357362 . + 2 # 3 x CACAC Adh calypso tandemrepeat 357348 357362 . + 2 # 3 x CACAC Adh calypso tandemrepeat 359448 359465 . + 2 # 3 x TCCTCA Adh calypso tandemrepeat 359448 359465 . + 2 # 3 x TCCTCA Adh calypso tandemrepeat 367195 367209 . + 0 # 3 x TTCAG Adh calypso tandemrepeat 367195 367209 . + 0 # 3 x TTCAG Adh calypso tandemrepeat 367673 367687 . + 1 # 3 x AATAT Adh calypso tandemrepeat 367673 367687 . + 1 # 3 x AATAT Adh calypso tandemrepeat 367803 367818 . + 2 # 16 x T Adh calypso tandemrepeat 367803 367818 . + 2 # 16 x T Adh calypso tandemrepeat 368001 368024 . + 2 # 4 x ATACAG Adh calypso tandemrepeat 368001 368024 . + 2 # 4 x ATACAG Adh calypso tandemrepeat 368715 368729 . + 2 # 3 x CTCCA Adh calypso tandemrepeat 368715 368729 . + 2 # 3 x CTCCA Adh calypso tandemrepeat 371089 371103 . + 0 # 5 x GCT Adh calypso tandemrepeat 371089 371103 . + 0 # 5 x GCT Adh calypso tandemrepeat 377546 377561 . + 1 # 4 x CTAT Adh calypso tandemrepeat 377546 377561 . + 1 # 4 x CTAT Adh calypso tandemrepeat 378071 378086 . + 1 # 4 x TATG Adh calypso tandemrepeat 378071 378086 . + 1 # 4 x TATG Adh calypso tandemrepeat 381769 381783 . + 0 # 5 x CCT Adh calypso tandemrepeat 381769 381783 . + 0 # 5 x CCT Adh calypso tandemrepeat 385735 385749 . + 0 # 5 x CAT Adh calypso tandemrepeat 385735 385749 . + 0 # 5 x CAT Adh calypso tandemrepeat 386121 386138 . + 2 # 3 x GCATTT Adh calypso tandemrepeat 386121 386138 . + 2 # 3 x GCATTT Adh calypso tandemrepeat 388289 388304 . + 1 # 8 x TG Adh calypso tandemrepeat 388289 388304 . + 1 # 8 x TG Adh calypso tandemrepeat 388376 388390 . + 1 # 3 x GGAGT Adh calypso tandemrepeat 388376 388390 . + 1 # 3 x GGAGT Adh calypso tandemrepeat 393337 393354 . + 0 # 3 x CAGTTT Adh calypso tandemrepeat 393337 393354 . + 0 # 3 x CAGTTT Adh calypso tandemrepeat 400273 400292 . + 0 # 20 x A Adh calypso tandemrepeat 400273 400292 . + 0 # 20 x A Adh calypso tandemrepeat 411848 411865 . + 1 # 3 x ATATAA Adh calypso tandemrepeat 411848 411865 . + 1 # 3 x ATATAA Adh calypso tandemrepeat 417518 417532 . + 1 # 5 x TGT Adh calypso tandemrepeat 417518 417532 . + 1 # 5 x TGT Adh calypso tandemrepeat 419180 419194 . + 1 # 3 x ACTCC Adh calypso tandemrepeat 419180 419194 . + 1 # 3 x ACTCC Adh calypso tandemrepeat 428234 428249 . + 1 # 8 x AT Adh calypso tandemrepeat 428234 428249 . + 1 # 8 x AT Adh calypso tandemrepeat 429724 429741 . + 0 # 3 x CAGTTG Adh calypso tandemrepeat 429724 429741 . + 0 # 3 x CAGTTG Adh calypso tandemrepeat 433158 433173 . + 2 # 16 x A Adh calypso tandemrepeat 433158 433173 . + 2 # 16 x A Adh calypso tandemrepeat 441893 441907 . + 1 # 15 x A Adh calypso tandemrepeat 441893 441907 . + 1 # 15 x A Adh calypso tandemrepeat 447518 447535 . + 1 # 3 x GTTGCA Adh calypso tandemrepeat 447518 447535 . + 1 # 3 x GTTGCA Adh calypso tandemrepeat 449494 449508 . + 0 # 15 x A Adh calypso tandemrepeat 449494 449508 . + 0 # 15 x A Adh calypso tandemrepeat 463991 464010 . + 1 # 4 x TATTT Adh calypso tandemrepeat 463991 464010 . + 1 # 4 x TATTT Adh calypso tandemrepeat 467074 467089 . + 0 # 4 x TATG Adh calypso tandemrepeat 467074 467089 . + 0 # 4 x TATG Adh calypso tandemrepeat 471909 471924 . + 2 # 16 x T Adh calypso tandemrepeat 471909 471924 . + 2 # 16 x T Adh calypso tandemrepeat 472925 472939 . + 1 # 5 x TAT Adh calypso tandemrepeat 472925 472939 . + 1 # 5 x TAT Adh calypso tandemrepeat 476610 476631 . + 2 # 11 x AT Adh calypso tandemrepeat 476610 476631 . + 2 # 11 x AT Adh calypso tandemrepeat 484358 484372 . + 1 # 15 x T Adh calypso tandemrepeat 484358 484372 . + 1 # 15 x T Adh calypso tandemrepeat 484595 484612 . + 1 # 9 x CA Adh calypso tandemrepeat 484595 484612 . + 1 # 9 x CA Adh calypso tandemrepeat 485890 485905 . + 0 # 4 x TTAT Adh calypso tandemrepeat 485890 485905 . + 0 # 4 x TTAT Adh calypso tandemrepeat 487040 487057 . + 1 # 6 x TGC Adh calypso tandemrepeat 487040 487057 . + 1 # 6 x TGC Adh calypso tandemrepeat 488023 488040 . + 0 # 9 x CA Adh calypso tandemrepeat 488023 488040 . + 0 # 9 x CA Adh calypso tandemrepeat 490320 490336 . + 2 # 17 x T Adh calypso tandemrepeat 490320 490336 . + 2 # 17 x T Adh calypso tandemrepeat 493299 493314 . + 2 # 16 x T Adh calypso tandemrepeat 493299 493314 . + 2 # 16 x T Adh calypso tandemrepeat 494589 494604 . + 2 # 8 x AC Adh calypso tandemrepeat 494589 494604 . + 2 # 8 x AC Adh calypso tandemrepeat 495032 495052 . + 1 # 7 x GCA Adh calypso tandemrepeat 495032 495052 . + 1 # 7 x GCA Adh calypso tandemrepeat 495032 495052 . + 1 # 7 x GCA Adh calypso tandemrepeat 495032 495052 . + 1 # 7 x GCA Adh calypso tandemrepeat 499214 499229 . + 1 # 4 x TAGT Adh calypso tandemrepeat 499214 499229 . + 1 # 4 x TAGT Adh calypso tandemrepeat 499214 499229 . + 1 # 4 x TAGT Adh calypso tandemrepeat 499214 499229 . + 1 # 4 x TAGT Adh calypso tandemrepeat 501325 501339 . + 0 # 15 x A Adh calypso tandemrepeat 501325 501339 . + 0 # 15 x A Adh calypso tandemrepeat 502593 502607 . + 2 # 3 x CAAAA Adh calypso tandemrepeat 502593 502607 . + 2 # 3 x CAAAA Adh calypso tandemrepeat 503810 503825 . + 1 # 16 x A Adh calypso tandemrepeat 503810 503825 . + 1 # 16 x A Adh calypso tandemrepeat 507896 507919 . + 1 # 6 x TCCA Adh calypso tandemrepeat 507896 507919 . + 1 # 6 x TCCA Adh calypso tandemrepeat 515838 515861 . + 2 # 12 x TG Adh calypso tandemrepeat 515838 515861 . + 2 # 12 x TG Adh calypso tandemrepeat 529704 529718 . + 2 # 3 x CATTT Adh calypso tandemrepeat 529704 529718 . + 2 # 3 x CATTT Adh calypso tandemrepeat 533284 533299 . + 0 # 4 x ATTT Adh calypso tandemrepeat 533284 533299 . + 0 # 4 x ATTT Adh calypso tandemrepeat 534250 534267 . + 0 # 9 x GT Adh calypso tandemrepeat 534250 534267 . + 0 # 9 x GT Adh calypso tandemrepeat 534551 534571 . + 1 # 7 x CAT Adh calypso tandemrepeat 534551 534571 . + 1 # 7 x CAT Adh calypso tandemrepeat 538105 538122 . + 0 # 9 x TG Adh calypso tandemrepeat 538105 538122 . + 0 # 9 x TG Adh calypso tandemrepeat 539677 539694 . + 0 # 3 x GATACA Adh calypso tandemrepeat 539677 539694 . + 0 # 3 x GATACA Adh calypso tandemrepeat 539709 539726 . + 2 # 9 x CA Adh calypso tandemrepeat 539709 539726 . + 2 # 9 x CA Adh calypso tandemrepeat 543940 543963 . + 0 # 12 x TG Adh calypso tandemrepeat 543940 543963 . + 0 # 12 x TG Adh calypso tandemrepeat 543940 543963 . + 0 # 12 x TG Adh calypso tandemrepeat 543940 543963 . + 0 # 12 x TG Adh calypso tandemrepeat 544062 544079 . + 2 # 3 x TGCCTT Adh calypso tandemrepeat 544062 544079 . + 2 # 3 x TGCCTT Adh calypso tandemrepeat 544062 544079 . + 2 # 3 x TGCCTT Adh calypso tandemrepeat 544062 544079 . + 2 # 3 x TGCCTT Adh calypso tandemrepeat 545026 545040 . + 0 # 5 x TGC Adh calypso tandemrepeat 545026 545040 . + 0 # 5 x TGC Adh calypso tandemrepeat 546049 546068 . + 0 # 4 x TTTTA Adh calypso tandemrepeat 546049 546068 . + 0 # 4 x TTTTA Adh calypso tandemrepeat 546183 546200 . + 2 # 9 x GT Adh calypso tandemrepeat 546183 546200 . + 2 # 9 x GT Adh calypso tandemrepeat 548133 548154 . + 2 # 11 x CA Adh calypso tandemrepeat 548133 548154 . + 2 # 11 x CA Adh calypso tandemrepeat 559442 559457 . + 1 # 8 x TG Adh calypso tandemrepeat 559442 559457 . + 1 # 8 x TG Adh calypso tandemrepeat 562060 562079 . + 0 # 10 x GT Adh calypso tandemrepeat 562060 562079 . + 0 # 10 x GT Adh calypso tandemrepeat 563160 563177 . + 2 # 9 x CA Adh calypso tandemrepeat 563160 563177 . + 2 # 9 x CA Adh calypso tandemrepeat 563387 563402 . + 1 # 4 x GGTT Adh calypso tandemrepeat 563387 563402 . + 1 # 4 x GGTT Adh calypso tandemrepeat 567593 567609 . + 1 # 17 x T Adh calypso tandemrepeat 567593 567609 . + 1 # 17 x T Adh calypso tandemrepeat 568971 568986 . + 2 # 8 x CA Adh calypso tandemrepeat 568971 568986 . + 2 # 8 x CA Adh calypso tandemrepeat 574093 574107 . + 0 # 5 x CTA Adh calypso tandemrepeat 574093 574107 . + 0 # 5 x CTA Adh calypso tandemrepeat 577165 577180 . + 0 # 8 x AT Adh calypso tandemrepeat 577165 577180 . + 0 # 8 x AT Adh calypso tandemrepeat 577385 577400 . + 1 # 4 x CCAA Adh calypso tandemrepeat 577385 577400 . + 1 # 4 x CCAA Adh calypso tandemrepeat 583460 583477 . + 1 # 9 x AT Adh calypso tandemrepeat 583460 583477 . + 1 # 9 x AT Adh calypso tandemrepeat 589692 589709 . + 2 # 6 x TGT Adh calypso tandemrepeat 589692 589709 . + 2 # 6 x TGT Adh calypso tandemrepeat 589692 589709 . + 2 # 6 x TGT Adh calypso tandemrepeat 589692 589709 . + 2 # 6 x TGT Adh calypso tandemrepeat 591168 591191 . + 2 # 12 x CA Adh calypso tandemrepeat 591168 591191 . + 2 # 12 x CA Adh calypso tandemrepeat 591549 591564 . + 2 # 8 x AC Adh calypso tandemrepeat 591549 591564 . + 2 # 8 x AC Adh calypso tandemrepeat 594324 594339 . + 2 # 8 x TG Adh calypso tandemrepeat 594324 594339 . + 2 # 8 x TG Adh calypso tandemrepeat 599735 599752 . + 1 # 3 x CAGTCA Adh calypso tandemrepeat 599735 599752 . + 1 # 3 x CAGTCA Adh calypso tandemrepeat 601674 601693 . + 2 # 10 x AT Adh calypso tandemrepeat 601674 601693 . + 2 # 10 x AT Adh calypso tandemrepeat 604540 604555 . + 0 # 8 x TA Adh calypso tandemrepeat 604540 604555 . + 0 # 8 x TA Adh calypso tandemrepeat 606257 606272 . + 1 # 8 x TG Adh calypso tandemrepeat 606257 606272 . + 1 # 8 x TG Adh calypso tandemrepeat 607358 607377 . + 1 # 10 x TG Adh calypso tandemrepeat 607358 607377 . + 1 # 10 x TG Adh calypso tandemrepeat 607856 607872 . + 1 # 17 x A Adh calypso tandemrepeat 607856 607872 . + 1 # 17 x A Adh calypso tandemrepeat 609272 609287 . + 1 # 8 x CA Adh calypso tandemrepeat 609272 609287 . + 1 # 8 x CA Adh calypso tandemrepeat 609701 609726 . + 1 # 13 x CA Adh calypso tandemrepeat 609701 609726 . + 1 # 13 x CA Adh calypso tandemrepeat 612948 612965 . + 2 # 9 x GT Adh calypso tandemrepeat 612948 612965 . + 2 # 9 x GT Adh calypso tandemrepeat 617773 617787 . + 0 # 15 x T Adh calypso tandemrepeat 617773 617787 . + 0 # 15 x T Adh calypso tandemrepeat 618402 618419 . + 2 # 9 x GT Adh calypso tandemrepeat 618402 618419 . + 2 # 9 x GT Adh calypso tandemrepeat 618655 618670 . + 0 # 16 x G Adh calypso tandemrepeat 618655 618670 . + 0 # 16 x G Adh calypso tandemrepeat 620005 620022 . + 0 # 9 x TG Adh calypso tandemrepeat 620005 620022 . + 0 # 9 x TG Adh calypso tandemrepeat 622152 622169 . + 2 # 3 x TTGTAG Adh calypso tandemrepeat 622152 622169 . + 2 # 3 x TTGTAG Adh calypso tandemrepeat 622509 622530 . + 2 # 11 x AC Adh calypso tandemrepeat 622509 622530 . + 2 # 11 x AC Adh calypso tandemrepeat 622870 622884 . + 0 # 15 x G Adh calypso tandemrepeat 622870 622884 . + 0 # 15 x G Adh calypso tandemrepeat 622975 622992 . + 0 # 6 x CTG Adh calypso tandemrepeat 622975 622992 . + 0 # 6 x CTG Adh calypso tandemrepeat 624332 624349 . + 1 # 9 x CA Adh calypso tandemrepeat 624332 624349 . + 1 # 9 x CA Adh calypso tandemrepeat 627015 627039 . + 2 # 5 x CCAAC Adh calypso tandemrepeat 627015 627039 . + 2 # 5 x CCAAC Adh calypso tandemrepeat 630667 630681 . + 0 # 3 x ATTAC Adh calypso tandemrepeat 630667 630681 . + 0 # 3 x ATTAC Adh calypso tandemrepeat 630667 630681 . + 0 # 3 x ATTAC Adh calypso tandemrepeat 630667 630681 . + 0 # 3 x ATTAC Adh calypso tandemrepeat 649044 649069 . + 2 # 13 x TG Adh calypso tandemrepeat 649044 649069 . + 2 # 13 x TG Adh calypso tandemrepeat 659049 659069 . + 2 # 7 x GTG Adh calypso tandemrepeat 659049 659069 . + 2 # 7 x GTG Adh calypso tandemrepeat 661041 661055 . + 2 # 5 x CTG Adh calypso tandemrepeat 661041 661055 . + 2 # 5 x CTG Adh calypso tandemrepeat 661129 661146 . + 0 # 6 x TGC Adh calypso tandemrepeat 661129 661146 . + 0 # 6 x TGC Adh calypso tandemrepeat 669576 669602 . + 2 # 9 x GCA Adh calypso tandemrepeat 669576 669602 . + 2 # 9 x GCA Adh calypso tandemrepeat 669827 669844 . + 1 # 3 x TGCTAT Adh calypso tandemrepeat 669827 669844 . + 1 # 3 x TGCTAT Adh calypso tandemrepeat 676949 676966 . + 1 # 3 x GATCAT Adh calypso tandemrepeat 676949 676966 . + 1 # 3 x GATCAT Adh calypso tandemrepeat 676949 676966 . + 1 # 3 x GATCAT Adh calypso tandemrepeat 676949 676966 . + 1 # 3 x GATCAT Adh calypso tandemrepeat 680908 680923 . + 0 # 4 x AAGT Adh calypso tandemrepeat 680908 680923 . + 0 # 4 x AAGT Adh calypso tandemrepeat 687118 687135 . + 0 # 9 x CA Adh calypso tandemrepeat 687118 687135 . + 0 # 9 x CA Adh calypso tandemrepeat 688329 688343 . + 2 # 15 x T Adh calypso tandemrepeat 688329 688343 . + 2 # 15 x T Adh calypso tandemrepeat 690828 690842 . + 2 # 5 x TGT Adh calypso tandemrepeat 690828 690842 . + 2 # 5 x TGT Adh calypso tandemrepeat 691711 691731 . + 0 # 7 x ATA Adh calypso tandemrepeat 691711 691731 . + 0 # 7 x ATA Adh calypso tandemrepeat 697796 697811 . + 1 # 8 x TG Adh calypso tandemrepeat 697796 697811 . + 1 # 8 x TG Adh calypso tandemrepeat 704064 704083 . + 2 # 4 x ACTCC Adh calypso tandemrepeat 704064 704083 . + 2 # 4 x ACTCC Adh calypso tandemrepeat 704275 704290 . + 0 # 4 x ATCT Adh calypso tandemrepeat 704275 704290 . + 0 # 4 x ATCT Adh calypso tandemrepeat 706091 706105 . + 1 # 15 x A Adh calypso tandemrepeat 706091 706105 . + 1 # 15 x A Adh calypso tandemrepeat 710193 710219 . + 2 # 9 x TAT Adh calypso tandemrepeat 710193 710219 . + 2 # 9 x TAT Adh calypso tandemrepeat 710810 710824 . + 1 # 15 x A Adh calypso tandemrepeat 710810 710824 . + 1 # 15 x A Adh calypso tandemrepeat 711842 711859 . + 1 # 3 x GTCGTT Adh calypso tandemrepeat 711842 711859 . + 1 # 3 x GTCGTT Adh calypso tandemrepeat 712971 712988 . + 2 # 9 x GT Adh calypso tandemrepeat 712971 712988 . + 2 # 9 x GT Adh calypso tandemrepeat 717661 717675 . + 0 # 3 x GCCAA Adh calypso tandemrepeat 717661 717675 . + 0 # 3 x GCCAA Adh calypso tandemrepeat 720535 720552 . + 0 # 18 x T Adh calypso tandemrepeat 720535 720552 . + 0 # 18 x T Adh calypso tandemrepeat 720535 720552 . + 0 # 18 x T Adh calypso tandemrepeat 733228 733245 . + 0 # 18 x A Adh calypso tandemrepeat 733228 733245 . + 0 # 18 x A Adh calypso tandemrepeat 735072 735091 . + 2 # 4 x TATTA Adh calypso tandemrepeat 735072 735091 . + 2 # 4 x TATTA Adh calypso tandemrepeat 738596 738611 . + 1 # 4 x ATAA Adh calypso tandemrepeat 738596 738611 . + 1 # 4 x ATAA Adh calypso tandemrepeat 740801 740815 . + 1 # 15 x T Adh calypso tandemrepeat 740801 740815 . + 1 # 15 x T Adh calypso tandemrepeat 741415 741429 . + 0 # 3 x GTAAA Adh calypso tandemrepeat 741415 741429 . + 0 # 3 x GTAAA Adh calypso tandemrepeat 743744 743761 . + 1 # 3 x AAAGCC Adh calypso tandemrepeat 743744 743761 . + 1 # 3 x AAAGCC Adh calypso tandemrepeat 758073 758098 . + 2 # 26 x T Adh calypso tandemrepeat 758073 758098 . + 2 # 26 x T Adh calypso tandemrepeat 759896 759913 . + 1 # 3 x ATACAG Adh calypso tandemrepeat 759896 759913 . + 1 # 3 x ATACAG Adh calypso tandemrepeat 765789 765803 . + 2 # 3 x TCCAT Adh calypso tandemrepeat 765789 765803 . + 2 # 3 x TCCAT Adh calypso tandemrepeat 765789 765803 . + 2 # 3 x TCCAT Adh calypso tandemrepeat 765789 765803 . + 2 # 3 x TCCAT Adh calypso tandemrepeat 767787 767802 . + 2 # 4 x TCTG Adh calypso tandemrepeat 767787 767802 . + 2 # 4 x TCTG Adh calypso tandemrepeat 767787 767802 . + 2 # 4 x TCTG Adh calypso tandemrepeat 767787 767802 . + 2 # 4 x TCTG Adh calypso tandemrepeat 767944 767958 . + 0 # 3 x GGTCT Adh calypso tandemrepeat 767944 767958 . + 0 # 3 x GGTCT Adh calypso tandemrepeat 767944 767958 . + 0 # 3 x GGTCT Adh calypso tandemrepeat 767944 767958 . + 0 # 3 x GGTCT Adh calypso tandemrepeat 772182 772211 . + 2 # 5 x TCGGGA Adh calypso tandemrepeat 772182 772211 . + 2 # 5 x TCGGGA Adh calypso tandemrepeat 773325 773348 . + 2 # 4 x AAAGGC Adh calypso tandemrepeat 773325 773348 . + 2 # 4 x AAAGGC Adh calypso tandemrepeat 781674 781688 . + 2 # 3 x AAATT Adh calypso tandemrepeat 781674 781688 . + 2 # 3 x AAATT Adh calypso tandemrepeat 784148 784162 . + 1 # 5 x AGC Adh calypso tandemrepeat 784148 784162 . + 1 # 5 x AGC Adh calypso tandemrepeat 784264 784278 . + 0 # 3 x CCAAG Adh calypso tandemrepeat 784264 784278 . + 0 # 3 x CCAAG Adh calypso tandemrepeat 784461 784475 . + 2 # 15 x A Adh calypso tandemrepeat 784461 784475 . + 2 # 15 x A Adh calypso tandemrepeat 796709 796728 . + 1 # 4 x TCGCA Adh calypso tandemrepeat 796709 796728 . + 1 # 4 x TCGCA Adh calypso tandemrepeat 797684 797701 . + 1 # 3 x CAAAGT Adh calypso tandemrepeat 797684 797701 . + 1 # 3 x CAAAGT Adh calypso tandemrepeat 802077 802091 . + 2 # 5 x CAG Adh calypso tandemrepeat 802077 802091 . + 2 # 5 x CAG Adh calypso tandemrepeat 802572 802589 . + 2 # 6 x CAG Adh calypso tandemrepeat 802572 802589 . + 2 # 6 x CAG Adh calypso tandemrepeat 808315 808329 . + 0 # 3 x TCGGA Adh calypso tandemrepeat 808315 808329 . + 0 # 3 x TCGGA Adh calypso tandemrepeat 821966 821980 . + 1 # 3 x AATAA Adh calypso tandemrepeat 821966 821980 . + 1 # 3 x AATAA Adh calypso tandemrepeat 828833 828848 . + 1 # 8 x AC Adh calypso tandemrepeat 828833 828848 . + 1 # 8 x AC Adh calypso tandemrepeat 829935 829954 . + 2 # 5 x AATA Adh calypso tandemrepeat 829935 829954 . + 2 # 5 x AATA Adh calypso tandemrepeat 832947 832961 . + 2 # 5 x CAG Adh calypso tandemrepeat 832947 832961 . + 2 # 5 x CAG Adh calypso tandemrepeat 850690 850704 . + 0 # 15 x T Adh calypso tandemrepeat 850690 850704 . + 0 # 15 x T Adh calypso tandemrepeat 851045 851059 . + 1 # 5 x TAA Adh calypso tandemrepeat 851045 851059 . + 1 # 5 x TAA Adh calypso tandemrepeat 852082 852096 . + 0 # 15 x A Adh calypso tandemrepeat 852082 852096 . + 0 # 15 x A Adh calypso tandemrepeat 877842 877859 . + 2 # 3 x TGCAGT Adh calypso tandemrepeat 877842 877859 . + 2 # 3 x TGCAGT Adh calypso tandemrepeat 879111 879140 . + 2 # 15 x CT Adh calypso tandemrepeat 879111 879140 . + 2 # 15 x CT Adh calypso tandemrepeat 881602 881616 . + 0 # 3 x GCATC Adh calypso tandemrepeat 881602 881616 . + 0 # 3 x GCATC Adh calypso tandemrepeat 881685 881699 . + 2 # 3 x ATCAA Adh calypso tandemrepeat 881685 881699 . + 2 # 3 x ATCAA Adh calypso tandemrepeat 886116 886133 . + 2 # 3 x GCCGCT Adh calypso tandemrepeat 886116 886133 . + 2 # 3 x GCCGCT Adh calypso tandemrepeat 886492 886509 . + 0 # 6 x TGC Adh calypso tandemrepeat 886492 886509 . + 0 # 6 x TGC Adh calypso tandemrepeat 889369 889385 . + 0 # 17 x A Adh calypso tandemrepeat 889369 889385 . + 0 # 17 x A Adh calypso tandemrepeat 889677 889691 . + 2 # 3 x TGATT Adh calypso tandemrepeat 889677 889691 . + 2 # 3 x TGATT Adh calypso tandemrepeat 890317 890334 . + 0 # 6 x TTG Adh calypso tandemrepeat 890317 890334 . + 0 # 6 x TTG Adh calypso tandemrepeat 892159 892182 . + 0 # 4 x GTTGCT Adh calypso tandemrepeat 892159 892182 . + 0 # 4 x GTTGCT Adh calypso tandemrepeat 892925 892940 . + 1 # 4 x ATCT Adh calypso tandemrepeat 892925 892940 . + 1 # 4 x ATCT Adh calypso tandemrepeat 893320 893334 . + 0 # 15 x A Adh calypso tandemrepeat 893320 893334 . + 0 # 15 x A Adh calypso tandemrepeat 899819 899843 . + 1 # 5 x CCAAA Adh calypso tandemrepeat 899819 899843 . + 1 # 5 x CCAAA Adh calypso tandemrepeat 900010 900029 . + 0 # 5 x GACT Adh calypso tandemrepeat 900010 900029 . + 0 # 5 x GACT Adh calypso tandemrepeat 900010 900029 . + 0 # 5 x GACT Adh calypso tandemrepeat 900010 900029 . + 0 # 5 x GACT Adh calypso tandemrepeat 901102 901119 . + 0 # 9 x GT Adh calypso tandemrepeat 901102 901119 . + 0 # 9 x GT Adh calypso tandemrepeat 901102 901119 . + 0 # 9 x GT Adh calypso tandemrepeat 901102 901119 . + 0 # 9 x GT Adh calypso tandemrepeat 910341 910355 . + 2 # 3 x TTAAT Adh calypso tandemrepeat 910341 910355 . + 2 # 3 x TTAAT Adh calypso tandemrepeat 914388 914402 . + 2 # 3 x AGTCG Adh calypso tandemrepeat 914388 914402 . + 2 # 3 x AGTCG Adh calypso tandemrepeat 919523 919537 . + 1 # 3 x ATCCC Adh calypso tandemrepeat 919523 919537 . + 1 # 3 x ATCCC Adh calypso tandemrepeat 920663 920680 . + 1 # 6 x CAG Adh calypso tandemrepeat 920663 920680 . + 1 # 6 x CAG Adh calypso tandemrepeat 926131 926151 . + 0 # 7 x GCA Adh calypso tandemrepeat 926131 926151 . + 0 # 7 x GCA Adh calypso tandemrepeat 930584 930607 . + 1 # 4 x CCCATT Adh calypso tandemrepeat 930584 930607 . + 1 # 4 x CCCATT Adh calypso tandemrepeat 931193 931207 . + 1 # 3 x AACGA Adh calypso tandemrepeat 931193 931207 . + 1 # 3 x AACGA Adh calypso tandemrepeat 936152 936179 . + 1 # 7 x TATG Adh calypso tandemrepeat 936152 936179 . + 1 # 7 x TATG Adh calypso tandemrepeat 948020 948034 . + 1 # 3 x TCAGC Adh calypso tandemrepeat 948020 948034 . + 1 # 3 x TCAGC Adh calypso tandemrepeat 948020 948034 . + 1 # 3 x TCAGC Adh calypso tandemrepeat 948020 948034 . + 1 # 3 x TCAGC Adh calypso tandemrepeat 949088 949115 . + 1 # 7 x GATG Adh calypso tandemrepeat 949088 949115 . + 1 # 7 x GATG Adh calypso tandemrepeat 949088 949115 . + 1 # 7 x GATG Adh calypso tandemrepeat 949088 949115 . + 1 # 7 x GATG Adh calypso tandemrepeat 950677 950696 . + 0 # 10 x TG Adh calypso tandemrepeat 950677 950696 . + 0 # 10 x TG Adh calypso tandemrepeat 951654 951668 . + 2 # 5 x TGT Adh calypso tandemrepeat 951654 951668 . + 2 # 5 x TGT Adh calypso tandemrepeat 954660 954675 . + 2 # 16 x A Adh calypso tandemrepeat 954660 954675 . + 2 # 16 x A Adh calypso tandemrepeat 955339 955353 . + 0 # 3 x TGAGC Adh calypso tandemrepeat 955339 955353 . + 0 # 3 x TGAGC Adh calypso tandemrepeat 959024 959038 . + 1 # 15 x T Adh calypso tandemrepeat 959024 959038 . + 1 # 15 x T Adh calypso tandemrepeat 959377 959393 . + 0 # 17 x T Adh calypso tandemrepeat 959377 959393 . + 0 # 17 x T Adh calypso tandemrepeat 959936 959960 . + 1 # 25 x T Adh calypso tandemrepeat 959936 959960 . + 1 # 25 x T Adh calypso tandemrepeat 960528 960542 . + 2 # 5 x TTA Adh calypso tandemrepeat 960528 960542 . + 2 # 5 x TTA Adh calypso tandemrepeat 966188 966207 . + 1 # 10 x CA Adh calypso tandemrepeat 966188 966207 . + 1 # 10 x CA Adh calypso tandemrepeat 968087 968106 . + 1 # 10 x GT Adh calypso tandemrepeat 968087 968106 . + 1 # 10 x GT Adh calypso tandemrepeat 970545 970559 . + 2 # 3 x ATTGG Adh calypso tandemrepeat 970545 970559 . + 2 # 3 x ATTGG Adh calypso tandemrepeat 971138 971155 . + 1 # 3 x CGATAA Adh calypso tandemrepeat 971138 971155 . + 1 # 3 x CGATAA Adh calypso tandemrepeat 985994 986008 . + 1 # 5 x GCA Adh calypso tandemrepeat 985994 986008 . + 1 # 5 x GCA Adh calypso tandemrepeat 996726 996740 . + 2 # 5 x GGC Adh calypso tandemrepeat 996726 996740 . + 2 # 5 x GGC Adh calypso tandemrepeat 1002557 1002571 . + 1 # 3 x AACTC Adh calypso tandemrepeat 1002557 1002571 . + 1 # 3 x AACTC Adh calypso tandemrepeat 1002591 1002605 . + 2 # 3 x GAACT Adh calypso tandemrepeat 1002591 1002605 . + 2 # 3 x GAACT Adh calypso tandemrepeat 1002776 1002793 . + 1 # 9 x AG Adh calypso tandemrepeat 1002776 1002793 . + 1 # 9 x AG Adh calypso tandemrepeat 1005219 1005233 . + 2 # 5 x CAG Adh calypso tandemrepeat 1005219 1005233 . + 2 # 5 x CAG Adh calypso tandemrepeat 1005416 1005432 . + 1 # 17 x T Adh calypso tandemrepeat 1005416 1005432 . + 1 # 17 x T Adh calypso tandemrepeat 1005865 1005880 . + 0 # 4 x CTGA Adh calypso tandemrepeat 1005865 1005880 . + 0 # 4 x CTGA Adh calypso tandemrepeat 1014404 1014418 . + 1 # 3 x CGTTA Adh calypso tandemrepeat 1014404 1014418 . + 1 # 3 x CGTTA Adh calypso tandemrepeat 1015976 1015992 . + 1 # 17 x T Adh calypso tandemrepeat 1015976 1015992 . + 1 # 17 x T Adh calypso tandemrepeat 1020695 1020709 . + 1 # 3 x ATAAT Adh calypso tandemrepeat 1020695 1020709 . + 1 # 3 x ATAAT Adh calypso tandemrepeat 1020710 1020724 . + 1 # 3 x ATATA Adh calypso tandemrepeat 1020710 1020724 . + 1 # 3 x ATATA Adh calypso tandemrepeat 1021501 1021515 . + 0 # 15 x T Adh calypso tandemrepeat 1021501 1021515 . + 0 # 15 x T Adh calypso tandemrepeat 1026809 1026826 . + 1 # 3 x ATTGCG Adh calypso tandemrepeat 1026809 1026826 . + 1 # 3 x ATTGCG Adh calypso tandemrepeat 1027847 1027863 . + 1 # 17 x A Adh calypso tandemrepeat 1027847 1027863 . + 1 # 17 x A Adh calypso tandemrepeat 1038688 1038702 . + 0 # 5 x CTA Adh calypso tandemrepeat 1038688 1038702 . + 0 # 5 x CTA Adh calypso tandemrepeat 1038688 1038702 . + 0 # 5 x CTA Adh calypso tandemrepeat 1038688 1038702 . + 0 # 5 x CTA Adh calypso tandemrepeat 1045156 1045173 . + 0 # 3 x GGTCCA Adh calypso tandemrepeat 1045156 1045173 . + 0 # 3 x GGTCCA Adh calypso tandemrepeat 1054544 1054558 . + 1 # 3 x GCATC Adh calypso tandemrepeat 1054544 1054558 . + 1 # 3 x GCATC Adh calypso tandemrepeat 1054682 1054706 . + 1 # 5 x GAACT Adh calypso tandemrepeat 1054682 1054706 . + 1 # 5 x GAACT Adh calypso tandemrepeat 1062793 1062807 . + 0 # 3 x GTTGG Adh calypso tandemrepeat 1062793 1062807 . + 0 # 3 x GTTGG Adh calypso tandemrepeat 1064755 1064770 . + 0 # 4 x TCAA Adh calypso tandemrepeat 1064755 1064770 . + 0 # 4 x TCAA Adh calypso tandemrepeat 1065563 1065580 . + 1 # 6 x GCA Adh calypso tandemrepeat 1065563 1065580 . + 1 # 6 x GCA Adh calypso tandemrepeat 1070495 1070514 . + 1 # 4 x CGAGT Adh calypso tandemrepeat 1070495 1070514 . + 1 # 4 x CGAGT Adh calypso tandemrepeat 1073168 1073182 . + 1 # 5 x CTT Adh calypso tandemrepeat 1073168 1073182 . + 1 # 5 x CTT Adh calypso tandemrepeat 1079614 1079641 . + 0 # 7 x ATGA Adh calypso tandemrepeat 1079614 1079641 . + 0 # 7 x ATGA Adh calypso tandemrepeat 1086467 1086481 . + 1 # 5 x CAG Adh calypso tandemrepeat 1086467 1086481 . + 1 # 5 x CAG Adh calypso tandemrepeat 1088991 1089005 . + 2 # 5 x TCC Adh calypso tandemrepeat 1088991 1089005 . + 2 # 5 x TCC Adh calypso tandemrepeat 1089936 1089956 . + 2 # 7 x CTG Adh calypso tandemrepeat 1089936 1089956 . + 2 # 7 x CTG Adh calypso tandemrepeat 1094143 1094157 . + 0 # 5 x CAT Adh calypso tandemrepeat 1094143 1094157 . + 0 # 5 x CAT Adh calypso tandemrepeat 1094519 1094533 . + 1 # 5 x TGT Adh calypso tandemrepeat 1094519 1094533 . + 1 # 5 x TGT Adh calypso tandemrepeat 1095234 1095248 . + 2 # 3 x GTTGT Adh calypso tandemrepeat 1095234 1095248 . + 2 # 3 x GTTGT Adh calypso tandemrepeat 1096242 1096257 . + 2 # 4 x TTTA Adh calypso tandemrepeat 1096242 1096257 . + 2 # 4 x TTTA Adh calypso tandemrepeat 1099313 1099328 . + 1 # 4 x TGGC Adh calypso tandemrepeat 1099313 1099328 . + 1 # 4 x TGGC Adh calypso tandemrepeat 1107046 1107063 . + 0 # 3 x GCCACC Adh calypso tandemrepeat 1107046 1107063 . + 0 # 3 x GCCACC Adh calypso tandemrepeat 1109743 1109766 . + 0 # 4 x ATACTA Adh calypso tandemrepeat 1109743 1109766 . + 0 # 4 x ATACTA Adh calypso tandemrepeat 1110994 1111008 . + 0 # 15 x A Adh calypso tandemrepeat 1110994 1111008 . + 0 # 15 x A Adh calypso tandemrepeat 1112646 1112683 . + 2 # 38 x T Adh calypso tandemrepeat 1112646 1112683 . + 2 # 38 x T Adh calypso tandemrepeat 1120256 1120275 . + 1 # 5 x ATGG Adh calypso tandemrepeat 1120256 1120275 . + 1 # 5 x ATGG Adh calypso tandemrepeat 1121325 1121348 . + 2 # 6 x GACA Adh calypso tandemrepeat 1121325 1121348 . + 2 # 6 x GACA Adh calypso tandemrepeat 1123531 1123545 . + 0 # 5 x TTA Adh calypso tandemrepeat 1123531 1123545 . + 0 # 5 x TTA Adh calypso tandemrepeat 1125075 1125095 . + 2 # 7 x GCA Adh calypso tandemrepeat 1125075 1125095 . + 2 # 7 x GCA Adh calypso tandemrepeat 1125075 1125095 . + 2 # 7 x GCA Adh calypso tandemrepeat 1125075 1125095 . + 2 # 7 x GCA Adh calypso tandemrepeat 1131750 1131767 . + 2 # 3 x AGTTGC Adh calypso tandemrepeat 1131750 1131767 . + 2 # 3 x AGTTGC Adh calypso tandemrepeat 1135457 1135472 . + 1 # 8 x AT Adh calypso tandemrepeat 1135457 1135472 . + 1 # 8 x AT Adh calypso tandemrepeat 1144469 1144487 . + 1 # 19 x T Adh calypso tandemrepeat 1144469 1144487 . + 1 # 19 x T Adh calypso tandemrepeat 1145749 1145763 . + 0 # 3 x CCGAT Adh calypso tandemrepeat 1145749 1145763 . + 0 # 3 x CCGAT Adh calypso tandemrepeat 1146320 1146335 . + 1 # 16 x A Adh calypso tandemrepeat 1146320 1146335 . + 1 # 16 x A Adh calypso tandemrepeat 1147126 1147143 . + 0 # 3 x TTATTT Adh calypso tandemrepeat 1147126 1147143 . + 0 # 3 x TTATTT Adh calypso tandemrepeat 1151879 1151897 . + 1 # 19 x A Adh calypso tandemrepeat 1151879 1151897 . + 1 # 19 x A Adh calypso tandemrepeat 1152128 1152145 . + 1 # 3 x ATGCTG Adh calypso tandemrepeat 1152128 1152145 . + 1 # 3 x ATGCTG Adh calypso tandemrepeat 1155339 1155357 . + 2 # 19 x A Adh calypso tandemrepeat 1155339 1155357 . + 2 # 19 x A Adh calypso tandemrepeat 1155686 1155703 . + 1 # 6 x GAT Adh calypso tandemrepeat 1155686 1155703 . + 1 # 6 x GAT Adh calypso tandemrepeat 1157057 1157074 . + 1 # 3 x GCAATT Adh calypso tandemrepeat 1157057 1157074 . + 1 # 3 x GCAATT Adh calypso tandemrepeat 1160948 1160964 . + 1 # 17 x T Adh calypso tandemrepeat 1160948 1160964 . + 1 # 17 x T Adh calypso tandemrepeat 1161184 1161198 . + 0 # 5 x TTG Adh calypso tandemrepeat 1161184 1161198 . + 0 # 5 x TTG Adh calypso tandemrepeat 1162208 1162222 . + 1 # 15 x A Adh calypso tandemrepeat 1162208 1162222 . + 1 # 15 x A Adh calypso tandemrepeat 1168371 1168390 . + 2 # 10 x AC Adh calypso tandemrepeat 1168371 1168390 . + 2 # 10 x AC Adh calypso tandemrepeat 1172531 1172568 . + 1 # 19 x TA Adh calypso tandemrepeat 1172531 1172568 . + 1 # 19 x TA Adh calypso tandemrepeat 1172531 1172568 . + 1 # 19 x TA Adh calypso tandemrepeat 1172531 1172568 . + 1 # 19 x TA Adh calypso tandemrepeat 1176269 1176286 . + 1 # 18 x A Adh calypso tandemrepeat 1176269 1176286 . + 1 # 18 x A Adh calypso tandemrepeat 1178536 1178560 . + 0 # 25 x T Adh calypso tandemrepeat 1178536 1178560 . + 0 # 25 x T Adh calypso tandemrepeat 1190348 1190365 . + 1 # 3 x TGTTGC Adh calypso tandemrepeat 1190348 1190365 . + 1 # 3 x TGTTGC Adh calypso tandemrepeat 1195025 1195039 . + 1 # 15 x T Adh calypso tandemrepeat 1195025 1195039 . + 1 # 15 x T Adh calypso tandemrepeat 1196579 1196596 . + 1 # 3 x GCAACA Adh calypso tandemrepeat 1196579 1196596 . + 1 # 3 x GCAACA Adh calypso tandemrepeat 1206749 1206766 . + 1 # 6 x AGC Adh calypso tandemrepeat 1206749 1206766 . + 1 # 6 x AGC Adh calypso tandemrepeat 1207025 1207039 . + 1 # 3 x ATTAA Adh calypso tandemrepeat 1207025 1207039 . + 1 # 3 x ATTAA Adh calypso tandemrepeat 1227377 1227391 . + 1 # 15 x A Adh calypso tandemrepeat 1227377 1227391 . + 1 # 15 x A Adh calypso tandemrepeat 1231197 1231211 . + 2 # 5 x TGC Adh calypso tandemrepeat 1231197 1231211 . + 2 # 5 x TGC Adh calypso tandemrepeat 1231296 1231310 . + 2 # 5 x TGC Adh calypso tandemrepeat 1231296 1231310 . + 2 # 5 x TGC Adh calypso tandemrepeat 1233493 1233507 . + 0 # 3 x TATTA Adh calypso tandemrepeat 1233493 1233507 . + 0 # 3 x TATTA Adh calypso tandemrepeat 1237958 1237977 . + 1 # 10 x TG Adh calypso tandemrepeat 1237958 1237977 . + 1 # 10 x TG Adh calypso tandemrepeat 1254492 1254506 . + 2 # 3 x ATTCA Adh calypso tandemrepeat 1254492 1254506 . + 2 # 3 x ATTCA Adh calypso tandemrepeat 1278334 1278349 . + 0 # 4 x TATG Adh calypso tandemrepeat 1278334 1278349 . + 0 # 4 x TATG Adh calypso tandemrepeat 1284489 1284503 . + 2 # 15 x T Adh calypso tandemrepeat 1284489 1284503 . + 2 # 15 x T Adh calypso tandemrepeat 1291267 1291284 . + 0 # 3 x CGAGGA Adh calypso tandemrepeat 1291267 1291284 . + 0 # 3 x CGAGGA Adh calypso tandemrepeat 1293629 1293644 . + 1 # 4 x AATA Adh calypso tandemrepeat 1293629 1293644 . + 1 # 4 x AATA Adh calypso tandemrepeat 1298498 1298513 . + 1 # 4 x AATA Adh calypso tandemrepeat 1298498 1298513 . + 1 # 4 x AATA Adh calypso tandemrepeat 1305659 1305674 . + 1 # 4 x TTCA Adh calypso tandemrepeat 1305659 1305674 . + 1 # 4 x TTCA Adh calypso tandemrepeat 1305659 1305674 . + 1 # 4 x TTCA Adh calypso tandemrepeat 1305659 1305674 . + 1 # 4 x TTCA Adh calypso tandemrepeat 1311852 1311868 . + 2 # 17 x T Adh calypso tandemrepeat 1311852 1311868 . + 2 # 17 x T Adh calypso tandemrepeat 1313762 1313777 . + 1 # 8 x GT Adh calypso tandemrepeat 1313762 1313777 . + 1 # 8 x GT Adh calypso tandemrepeat 1316848 1316865 . + 0 # 9 x AG Adh calypso tandemrepeat 1316848 1316865 . + 0 # 9 x AG Adh calypso tandemrepeat 1342013 1342030 . + 1 # 3 x TCTTGG Adh calypso tandemrepeat 1342013 1342030 . + 1 # 3 x TCTTGG Adh calypso tandemrepeat 1348479 1348494 . + 2 # 16 x G Adh calypso tandemrepeat 1348479 1348494 . + 2 # 16 x G Adh calypso tandemrepeat 1354064 1354078 . + 1 # 3 x TACTA Adh calypso tandemrepeat 1354064 1354078 . + 1 # 3 x TACTA Adh calypso tandemrepeat 1354064 1354078 . + 1 # 3 x TACTA Adh calypso tandemrepeat 1354064 1354078 . + 1 # 3 x TACTA Adh calypso tandemrepeat 1360180 1360197 . + 0 # 3 x CAGATA Adh calypso tandemrepeat 1360180 1360197 . + 0 # 3 x CAGATA Adh calypso tandemrepeat 1361643 1361657 . + 2 # 3 x TTATT Adh calypso tandemrepeat 1361643 1361657 . + 2 # 3 x TTATT Adh calypso tandemrepeat 1364975 1364992 . + 1 # 3 x TGCTGT Adh calypso tandemrepeat 1364975 1364992 . + 1 # 3 x TGCTGT Adh calypso tandemrepeat 1367583 1367606 . + 2 # 24 x T Adh calypso tandemrepeat 1367583 1367606 . + 2 # 24 x T Adh calypso tandemrepeat 1379673 1379696 . + 2 # 24 x T Adh calypso tandemrepeat 1379673 1379696 . + 2 # 24 x T Adh calypso tandemrepeat 1383109 1383132 . + 0 # 12 x CA Adh calypso tandemrepeat 1383109 1383132 . + 0 # 12 x CA Adh calypso tandemrepeat 1388183 1388207 . + 1 # 25 x T Adh calypso tandemrepeat 1388183 1388207 . + 1 # 25 x T Adh calypso tandemrepeat 1391263 1391278 . + 0 # 4 x CATA Adh calypso tandemrepeat 1391263 1391278 . + 0 # 4 x CATA Adh calypso tandemrepeat 1391416 1391431 . + 0 # 8 x CA Adh calypso tandemrepeat 1391416 1391431 . + 0 # 8 x CA Adh calypso tandemrepeat 1392437 1392456 . + 1 # 4 x TTTCG Adh calypso tandemrepeat 1392437 1392456 . + 1 # 4 x TTTCG Adh calypso tandemrepeat 1395819 1395837 . + 2 # 19 x C Adh calypso tandemrepeat 1395819 1395837 . + 2 # 19 x C Adh calypso tandemrepeat 1395819 1395837 . + 2 # 19 x C Adh calypso tandemrepeat 1395819 1395837 . + 2 # 19 x C Adh calypso tandemrepeat 1399035 1399051 . + 2 # 17 x T Adh calypso tandemrepeat 1399035 1399051 . + 2 # 17 x T Adh calypso tandemrepeat 1399035 1399051 . + 2 # 17 x T Adh calypso tandemrepeat 1399035 1399051 . + 2 # 17 x T Adh calypso tandemrepeat 1401995 1402009 . + 1 # 3 x GATTG Adh calypso tandemrepeat 1401995 1402009 . + 1 # 3 x GATTG Adh calypso tandemrepeat 1404251 1404268 . + 1 # 9 x GT Adh calypso tandemrepeat 1404251 1404268 . + 1 # 9 x GT Adh calypso tandemrepeat 1406009 1406029 . + 1 # 7 x AGC Adh calypso tandemrepeat 1406009 1406029 . + 1 # 7 x AGC Adh calypso tandemrepeat 1408221 1408235 . + 2 # 3 x ACAAG Adh calypso tandemrepeat 1408221 1408235 . + 2 # 3 x ACAAG Adh calypso tandemrepeat 1410789 1410806 . + 2 # 3 x GCAGTG Adh calypso tandemrepeat 1410789 1410806 . + 2 # 3 x GCAGTG Adh calypso tandemrepeat 1410848 1410865 . + 1 # 6 x TCA Adh calypso tandemrepeat 1410848 1410865 . + 1 # 6 x TCA Adh calypso tandemrepeat 1424247 1424264 . + 2 # 3 x GTTCTG Adh calypso tandemrepeat 1424247 1424264 . + 2 # 3 x GTTCTG Adh calypso tandemrepeat 1424790 1424804 . + 2 # 15 x C Adh calypso tandemrepeat 1424790 1424804 . + 2 # 15 x C Adh calypso tandemrepeat 1425005 1425020 . + 1 # 4 x TGGA Adh calypso tandemrepeat 1425005 1425020 . + 1 # 4 x TGGA Adh calypso tandemrepeat 1426058 1426079 . + 1 # 11 x TG Adh calypso tandemrepeat 1426058 1426079 . + 1 # 11 x TG Adh calypso tandemrepeat 1427823 1427838 . + 2 # 4 x GTAT Adh calypso tandemrepeat 1427823 1427838 . + 2 # 4 x GTAT Adh calypso tandemrepeat 1429907 1429921 . + 1 # 15 x T Adh calypso tandemrepeat 1429907 1429921 . + 1 # 15 x T Adh calypso tandemrepeat 1434683 1434698 . + 1 # 16 x T Adh calypso tandemrepeat 1434683 1434698 . + 1 # 16 x T Adh calypso tandemrepeat 1449707 1449722 . + 1 # 16 x T Adh calypso tandemrepeat 1449707 1449722 . + 1 # 16 x T Adh calypso tandemrepeat 1453167 1453186 . + 2 # 10 x TA Adh calypso tandemrepeat 1453167 1453186 . + 2 # 10 x TA Adh calypso tandemrepeat 1454595 1454609 . + 2 # 5 x ATA Adh calypso tandemrepeat 1454595 1454609 . + 2 # 5 x ATA Adh calypso tandemrepeat 1461482 1461497 . + 1 # 8 x AC Adh calypso tandemrepeat 1461482 1461497 . + 1 # 8 x AC Adh calypso tandemrepeat 1463470 1463494 . + 0 # 5 x TTCAG Adh calypso tandemrepeat 1463470 1463494 . + 0 # 5 x TTCAG Adh calypso tandemrepeat 1463496 1463510 . + 2 # 3 x CAATG Adh calypso tandemrepeat 1463496 1463510 . + 2 # 3 x CAATG Adh calypso tandemrepeat 1463860 1463874 . + 0 # 3 x TATTT Adh calypso tandemrepeat 1463860 1463874 . + 0 # 3 x TATTT Adh calypso tandemrepeat 1472445 1472460 . + 2 # 4 x AGTG Adh calypso tandemrepeat 1472445 1472460 . + 2 # 4 x AGTG Adh calypso tandemrepeat 1474088 1474113 . + 1 # 13 x TA Adh calypso tandemrepeat 1474088 1474113 . + 1 # 13 x TA Adh calypso tandemrepeat 1480217 1480252 . + 1 # 36 x A Adh calypso tandemrepeat 1480217 1480252 . + 1 # 36 x A Adh calypso tandemrepeat 1484215 1484229 . + 0 # 5 x TGC Adh calypso tandemrepeat 1484215 1484229 . + 0 # 5 x TGC Adh calypso tandemrepeat 1484928 1484942 . + 2 # 5 x AAT Adh calypso tandemrepeat 1484928 1484942 . + 2 # 5 x AAT Adh calypso tandemrepeat 1485335 1485356 . + 1 # 11 x TC Adh calypso tandemrepeat 1485335 1485356 . + 1 # 11 x TC Adh calypso tandemrepeat 1485335 1485356 . + 1 # 11 x TC Adh calypso tandemrepeat 1485335 1485356 . + 1 # 11 x TC Adh calypso tandemrepeat 1497539 1497554 . + 1 # 4 x GTTT Adh calypso tandemrepeat 1497539 1497554 . + 1 # 4 x GTTT Adh calypso tandemrepeat 1502345 1502360 . + 1 # 8 x AC Adh calypso tandemrepeat 1502345 1502360 . + 1 # 8 x AC Adh calypso tandemrepeat 1503315 1503342 . + 2 # 14 x TC Adh calypso tandemrepeat 1503315 1503342 . + 2 # 14 x TC Adh calypso tandemrepeat 1503409 1503424 . + 0 # 8 x GT Adh calypso tandemrepeat 1503409 1503424 . + 0 # 8 x GT Adh calypso tandemrepeat 1506742 1506759 . + 0 # 6 x AAC Adh calypso tandemrepeat 1506742 1506759 . + 0 # 6 x AAC Adh calypso tandemrepeat 1506997 1507014 . + 0 # 6 x AAC Adh calypso tandemrepeat 1506997 1507014 . + 0 # 6 x AAC Adh calypso tandemrepeat 1507601 1507615 . + 1 # 3 x AGTGA Adh calypso tandemrepeat 1507601 1507615 . + 1 # 3 x AGTGA Adh calypso tandemrepeat 1510453 1510476 . + 0 # 4 x TTTTGG Adh calypso tandemrepeat 1510453 1510476 . + 0 # 4 x TTTTGG Adh calypso tandemrepeat 1510600 1510623 . + 0 # 4 x TATTTG Adh calypso tandemrepeat 1510600 1510623 . + 0 # 4 x TATTTG Adh calypso tandemrepeat 1511544 1511561 . + 2 # 3 x GGCTGG Adh calypso tandemrepeat 1511544 1511561 . + 2 # 3 x GGCTGG Adh calypso tandemrepeat 1512918 1512937 . + 2 # 4 x TGGTC Adh calypso tandemrepeat 1512918 1512937 . + 2 # 4 x TGGTC Adh calypso tandemrepeat 1512943 1512962 . + 0 # 4 x AGTTC Adh calypso tandemrepeat 1512943 1512962 . + 0 # 4 x AGTTC Adh calypso tandemrepeat 1514284 1514299 . + 0 # 4 x GTAT Adh calypso tandemrepeat 1514284 1514299 . + 0 # 4 x GTAT Adh calypso tandemrepeat 1523467 1523482 . + 0 # 4 x TCAC Adh calypso tandemrepeat 1523467 1523482 . + 0 # 4 x TCAC Adh calypso tandemrepeat 1529451 1529465 . + 2 # 5 x CAA Adh calypso tandemrepeat 1529451 1529465 . + 2 # 5 x CAA Adh calypso tandemrepeat 1529795 1529809 . + 1 # 5 x CAG Adh calypso tandemrepeat 1529795 1529809 . + 1 # 5 x CAG Adh calypso tandemrepeat 1529810 1529827 . + 1 # 6 x CAA Adh calypso tandemrepeat 1529810 1529827 . + 1 # 6 x CAA Adh calypso tandemrepeat 1530718 1530733 . + 0 # 4 x TCTG Adh calypso tandemrepeat 1530718 1530733 . + 0 # 4 x TCTG Adh calypso tandemrepeat 1530718 1530733 . + 0 # 4 x TCTG Adh calypso tandemrepeat 1530718 1530733 . + 0 # 4 x TCTG Adh calypso tandemrepeat 1532513 1532528 . + 1 # 4 x ACAT Adh calypso tandemrepeat 1532513 1532528 . + 1 # 4 x ACAT Adh calypso tandemrepeat 1532513 1532528 . + 1 # 4 x ACAT Adh calypso tandemrepeat 1532513 1532528 . + 1 # 4 x ACAT Adh calypso tandemrepeat 1562132 1562146 . + 1 # 5 x AAT Adh calypso tandemrepeat 1562132 1562146 . + 1 # 5 x AAT Adh calypso tandemrepeat 1575182 1575199 . + 1 # 3 x GATTTG Adh calypso tandemrepeat 1575182 1575199 . + 1 # 3 x GATTTG Adh calypso tandemrepeat 1575182 1575199 . + 1 # 3 x GATTTG Adh calypso tandemrepeat 1575182 1575199 . + 1 # 3 x GATTTG Adh calypso tandemrepeat 1587202 1587216 . + 0 # 3 x TTTTC Adh calypso tandemrepeat 1587202 1587216 . + 0 # 3 x TTTTC Adh calypso tandemrepeat 1587379 1587396 . + 0 # 3 x CGTCAT Adh calypso tandemrepeat 1587379 1587396 . + 0 # 3 x CGTCAT Adh calypso tandemrepeat 1588087 1588102 . + 0 # 16 x A Adh calypso tandemrepeat 1588087 1588102 . + 0 # 16 x A Adh calypso tandemrepeat 1588215 1588229 . + 2 # 5 x GAT Adh calypso tandemrepeat 1588215 1588229 . + 2 # 5 x GAT Adh calypso tandemrepeat 1588231 1588245 . + 0 # 5 x ATG Adh calypso tandemrepeat 1588231 1588245 . + 0 # 5 x ATG Adh calypso tandemrepeat 1590481 1590498 . + 0 # 3 x AACTGC Adh calypso tandemrepeat 1590481 1590498 . + 0 # 3 x AACTGC Adh calypso tandemrepeat 1590793 1590809 . + 0 # 17 x T Adh calypso tandemrepeat 1590793 1590809 . + 0 # 17 x T Adh calypso tandemrepeat 1591791 1591808 . + 2 # 9 x AT Adh calypso tandemrepeat 1591791 1591808 . + 2 # 9 x AT Adh calypso tandemrepeat 1592540 1592554 . + 1 # 3 x ACTTA Adh calypso tandemrepeat 1592540 1592554 . + 1 # 3 x ACTTA Adh calypso tandemrepeat 1597043 1597060 . + 1 # 3 x GGAGAT Adh calypso tandemrepeat 1597043 1597060 . + 1 # 3 x GGAGAT Adh calypso tandemrepeat 1598225 1598239 . + 1 # 3 x CTTTA Adh calypso tandemrepeat 1598225 1598239 . + 1 # 3 x CTTTA Adh calypso tandemrepeat 1609960 1609980 . + 0 # 7 x ACG Adh calypso tandemrepeat 1609960 1609980 . + 0 # 7 x ACG Adh calypso tandemrepeat 1611748 1611763 . + 0 # 4 x GCTA Adh calypso tandemrepeat 1611748 1611763 . + 0 # 4 x GCTA Adh calypso tandemrepeat 1612282 1612299 . + 0 # 3 x TATATG Adh calypso tandemrepeat 1612282 1612299 . + 0 # 3 x TATATG Adh calypso tandemrepeat 1613364 1613381 . + 2 # 18 x A Adh calypso tandemrepeat 1613364 1613381 . + 2 # 18 x A Adh calypso tandemrepeat 1614603 1614627 . + 2 # 5 x CTGTT Adh calypso tandemrepeat 1614603 1614627 . + 2 # 5 x CTGTT Adh calypso tandemrepeat 1626935 1626952 . + 1 # 3 x GAATGA Adh calypso tandemrepeat 1626935 1626952 . + 1 # 3 x GAATGA Adh calypso tandemrepeat 1627854 1627869 . + 2 # 8 x TG Adh calypso tandemrepeat 1627854 1627869 . + 2 # 8 x TG Adh calypso tandemrepeat 1628087 1628104 . + 1 # 9 x GT Adh calypso tandemrepeat 1628087 1628104 . + 1 # 9 x GT Adh calypso tandemrepeat 1632832 1632847 . + 0 # 4 x ATTT Adh calypso tandemrepeat 1632832 1632847 . + 0 # 4 x ATTT Adh calypso tandemrepeat 1637135 1637150 . + 1 # 4 x AGAC Adh calypso tandemrepeat 1637135 1637150 . + 1 # 4 x AGAC Adh calypso tandemrepeat 1638662 1638679 . + 1 # 9 x CA Adh calypso tandemrepeat 1638662 1638679 . + 1 # 9 x CA Adh calypso tandemrepeat 1643978 1643993 . + 1 # 8 x GT Adh calypso tandemrepeat 1643978 1643993 . + 1 # 8 x GT Adh calypso tandemrepeat 1646755 1646772 . + 0 # 3 x GGTTCT Adh calypso tandemrepeat 1646755 1646772 . + 0 # 3 x GGTTCT Adh calypso tandemrepeat 1647252 1647266 . + 2 # 3 x ATATT Adh calypso tandemrepeat 1647252 1647266 . + 2 # 3 x ATATT Adh calypso tandemrepeat 1648409 1648424 . + 1 # 8 x TG Adh calypso tandemrepeat 1648409 1648424 . + 1 # 8 x TG Adh calypso tandemrepeat 1661973 1661993 . + 2 # 21 x A Adh calypso tandemrepeat 1661973 1661993 . + 2 # 21 x A Adh calypso tandemrepeat 1662717 1662731 . + 2 # 3 x TTTTG Adh calypso tandemrepeat 1662717 1662731 . + 2 # 3 x TTTTG Adh calypso tandemrepeat 1666164 1666181 . + 2 # 9 x TA Adh calypso tandemrepeat 1666164 1666181 . + 2 # 9 x TA Adh calypso tandemrepeat 1666164 1666181 . + 2 # 9 x TA Adh calypso tandemrepeat 1666164 1666181 . + 2 # 9 x TA Adh calypso tandemrepeat 1667283 1667297 . + 2 # 3 x AAAAT Adh calypso tandemrepeat 1667283 1667297 . + 2 # 3 x AAAAT Adh calypso tandemrepeat 1667283 1667297 . + 2 # 3 x AAAAT Adh calypso tandemrepeat 1667283 1667297 . + 2 # 3 x AAAAT Adh calypso tandemrepeat 1671293 1671310 . + 1 # 3 x TGCTCC Adh calypso tandemrepeat 1671293 1671310 . + 1 # 3 x TGCTCC Adh calypso tandemrepeat 1676142 1676159 . + 2 # 9 x TA Adh calypso tandemrepeat 1676142 1676159 . + 2 # 9 x TA Adh calypso tandemrepeat 1679001 1679016 . + 2 # 16 x T Adh calypso tandemrepeat 1679001 1679016 . + 2 # 16 x T Adh calypso tandemrepeat 1681584 1681598 . + 2 # 3 x CGAAT Adh calypso tandemrepeat 1681584 1681598 . + 2 # 3 x CGAAT Adh calypso tandemrepeat 1685275 1685294 . + 0 # 10 x GT Adh calypso tandemrepeat 1685275 1685294 . + 0 # 10 x GT Adh calypso tandemrepeat 1691044 1691058 . + 0 # 3 x TTCGT Adh calypso tandemrepeat 1691044 1691058 . + 0 # 3 x TTCGT Adh calypso tandemrepeat 1693348 1693362 . + 0 # 3 x AATAA Adh calypso tandemrepeat 1693348 1693362 . + 0 # 3 x AATAA Adh calypso tandemrepeat 1693841 1693860 . + 1 # 4 x TTATA Adh calypso tandemrepeat 1693841 1693860 . + 1 # 4 x TTATA Adh calypso tandemrepeat 1698019 1698038 . + 0 # 5 x ACCA Adh calypso tandemrepeat 1698019 1698038 . + 0 # 5 x ACCA Adh calypso tandemrepeat 1702142 1702156 . + 1 # 3 x ATGAG Adh calypso tandemrepeat 1702142 1702156 . + 1 # 3 x ATGAG Adh calypso tandemrepeat 1703828 1703843 . + 1 # 4 x TTTG Adh calypso tandemrepeat 1703828 1703843 . + 1 # 4 x TTTG Adh calypso tandemrepeat 1703927 1703948 . + 1 # 11 x CA Adh calypso tandemrepeat 1703927 1703948 . + 1 # 11 x CA Adh calypso tandemrepeat 1709366 1709383 . + 1 # 3 x ACTCCC Adh calypso tandemrepeat 1709366 1709383 . + 1 # 3 x ACTCCC Adh calypso tandemrepeat 1710698 1710717 . + 1 # 5 x TATG Adh calypso tandemrepeat 1710698 1710717 . + 1 # 5 x TATG Adh calypso tandemrepeat 1710698 1710717 . + 1 # 5 x TATG Adh calypso tandemrepeat 1710698 1710717 . + 1 # 5 x TATG Adh calypso tandemrepeat 1711879 1711900 . + 0 # 11 x GT Adh calypso tandemrepeat 1711879 1711900 . + 0 # 11 x GT Adh calypso tandemrepeat 1711879 1711900 . + 0 # 11 x GT Adh calypso tandemrepeat 1711879 1711900 . + 0 # 11 x GT Adh calypso tandemrepeat 1716209 1716223 . + 1 # 15 x A Adh calypso tandemrepeat 1716209 1716223 . + 1 # 15 x A Adh calypso tandemrepeat 1719118 1719132 . + 0 # 3 x TCTGG Adh calypso tandemrepeat 1719118 1719132 . + 0 # 3 x TCTGG Adh calypso tandemrepeat 1720833 1720847 . + 2 # 5 x GCA Adh calypso tandemrepeat 1720833 1720847 . + 2 # 5 x GCA Adh calypso tandemrepeat 1721342 1721361 . + 1 # 5 x ACCG Adh calypso tandemrepeat 1721342 1721361 . + 1 # 5 x ACCG Adh calypso tandemrepeat 1728633 1728653 . + 2 # 7 x GCA Adh calypso tandemrepeat 1728633 1728653 . + 2 # 7 x GCA Adh calypso tandemrepeat 1728651 1728668 . + 2 # 3 x GCAACA Adh calypso tandemrepeat 1728651 1728668 . + 2 # 3 x GCAACA Adh calypso tandemrepeat 1728691 1728708 . + 0 # 3 x AACAGA Adh calypso tandemrepeat 1728691 1728708 . + 0 # 3 x AACAGA Adh calypso tandemrepeat 1731915 1731930 . + 2 # 16 x T Adh calypso tandemrepeat 1731915 1731930 . + 2 # 16 x T Adh calypso tandemrepeat 1732055 1732070 . + 1 # 4 x TGGT Adh calypso tandemrepeat 1732055 1732070 . + 1 # 4 x TGGT Adh calypso tandemrepeat 1732939 1732956 . + 0 # 3 x ACTGCA Adh calypso tandemrepeat 1732939 1732956 . + 0 # 3 x ACTGCA Adh calypso tandemrepeat 1733238 1733257 . + 2 # 20 x G Adh calypso tandemrepeat 1733238 1733257 . + 2 # 20 x G Adh calypso tandemrepeat 1743287 1743301 . + 1 # 3 x GAAAA Adh calypso tandemrepeat 1743287 1743301 . + 1 # 3 x GAAAA Adh calypso tandemrepeat 1744323 1744346 . + 2 # 12 x CA Adh calypso tandemrepeat 1744323 1744346 . + 2 # 12 x CA Adh calypso tandemrepeat 1748374 1748393 . + 0 # 10 x AT Adh calypso tandemrepeat 1748374 1748393 . + 0 # 10 x AT Adh calypso tandemrepeat 1748763 1748780 . + 2 # 6 x GCT Adh calypso tandemrepeat 1748763 1748780 . + 2 # 6 x GCT Adh calypso tandemrepeat 1749219 1749233 . + 2 # 3 x TTTCA Adh calypso tandemrepeat 1749219 1749233 . + 2 # 3 x TTTCA Adh calypso tandemrepeat 1750669 1750684 . + 0 # 8 x AT Adh calypso tandemrepeat 1750669 1750684 . + 0 # 8 x AT Adh calypso tandemrepeat 1759771 1759785 . + 0 # 5 x CTC Adh calypso tandemrepeat 1759771 1759785 . + 0 # 5 x CTC Adh calypso tandemrepeat 1759771 1759785 . + 0 # 5 x CTC Adh calypso tandemrepeat 1759771 1759785 . + 0 # 5 x CTC Adh calypso tandemrepeat 1768537 1768551 . + 0 # 3 x ATTGA Adh calypso tandemrepeat 1768537 1768551 . + 0 # 3 x ATTGA Adh calypso tandemrepeat 1768850 1768864 . + 1 # 3 x GTCCC Adh calypso tandemrepeat 1768850 1768864 . + 1 # 3 x GTCCC Adh calypso tandemrepeat 1771355 1771369 . + 1 # 15 x A Adh calypso tandemrepeat 1771355 1771369 . + 1 # 15 x A Adh calypso tandemrepeat 1773901 1773924 . + 0 # 4 x CAACTG Adh calypso tandemrepeat 1773901 1773924 . + 0 # 4 x CAACTG Adh calypso tandemrepeat 1780460 1780477 . + 1 # 3 x CCTGCT Adh calypso tandemrepeat 1780460 1780477 . + 1 # 3 x CCTGCT Adh calypso tandemrepeat 1782835 1782850 . + 0 # 16 x A Adh calypso tandemrepeat 1782835 1782850 . + 0 # 16 x A Adh calypso tandemrepeat 1783221 1783244 . + 2 # 4 x GTCCCA Adh calypso tandemrepeat 1783221 1783244 . + 2 # 4 x GTCCCA Adh calypso tandemrepeat 1784347 1784361 . + 0 # 3 x ATCCC Adh calypso tandemrepeat 1784347 1784361 . + 0 # 3 x ATCCC Adh calypso tandemrepeat 1789748 1789765 . + 1 # 9 x AT Adh calypso tandemrepeat 1789748 1789765 . + 1 # 9 x AT Adh calypso tandemrepeat 1790342 1790359 . + 1 # 3 x CCCGAT Adh calypso tandemrepeat 1790342 1790359 . + 1 # 3 x CCCGAT Adh calypso tandemrepeat 1792295 1792309 . + 1 # 3 x GGATT Adh calypso tandemrepeat 1792295 1792309 . + 1 # 3 x GGATT Adh calypso tandemrepeat 1795954 1795969 . + 0 # 8 x AT Adh calypso tandemrepeat 1795954 1795969 . + 0 # 8 x AT Adh calypso tandemrepeat 1804501 1804521 . + 0 # 7 x GCA Adh calypso tandemrepeat 1804501 1804521 . + 0 # 7 x GCA Adh calypso tandemrepeat 1804501 1804521 . + 0 # 7 x GCA Adh calypso tandemrepeat 1804501 1804521 . + 0 # 7 x GCA Adh calypso tandemrepeat 1809576 1809591 . + 2 # 8 x AC Adh calypso tandemrepeat 1809576 1809591 . + 2 # 8 x AC Adh calypso tandemrepeat 1810147 1810161 . + 0 # 5 x CAT Adh calypso tandemrepeat 1810147 1810161 . + 0 # 5 x CAT Adh calypso tandemrepeat 1811857 1811871 . + 0 # 5 x GAT Adh calypso tandemrepeat 1811857 1811871 . + 0 # 5 x GAT Adh calypso tandemrepeat 1819458 1819475 . + 2 # 3 x GTCCAT Adh calypso tandemrepeat 1819458 1819475 . + 2 # 3 x GTCCAT Adh calypso tandemrepeat 1819551 1819565 . + 2 # 15 x T Adh calypso tandemrepeat 1819551 1819565 . + 2 # 15 x T Adh calypso tandemrepeat 1826722 1826741 . + 0 # 4 x GAAAC Adh calypso tandemrepeat 1826722 1826741 . + 0 # 4 x GAAAC Adh calypso tandemrepeat 1827715 1827729 . + 0 # 3 x TTATT Adh calypso tandemrepeat 1827715 1827729 . + 0 # 3 x TTATT Adh calypso tandemrepeat 1836335 1836352 . + 1 # 3 x GCCAAT Adh calypso tandemrepeat 1836335 1836352 . + 1 # 3 x GCCAAT Adh calypso tandemrepeat 1836793 1836810 . + 0 # 3 x TGGAGC Adh calypso tandemrepeat 1836793 1836810 . + 0 # 3 x TGGAGC Adh calypso tandemrepeat 1837499 1837513 . + 1 # 3 x ATTCG Adh calypso tandemrepeat 1837499 1837513 . + 1 # 3 x ATTCG Adh calypso tandemrepeat 1838248 1838265 . + 0 # 6 x TCA Adh calypso tandemrepeat 1838248 1838265 . + 0 # 6 x TCA Adh calypso tandemrepeat 1840936 1840956 . + 0 # 7 x GTA Adh calypso tandemrepeat 1840936 1840956 . + 0 # 7 x GTA Adh calypso tandemrepeat 1853377 1853391 . + 0 # 3 x TGAAG Adh calypso tandemrepeat 1853377 1853391 . + 0 # 3 x TGAAG Adh calypso tandemrepeat 1869690 1869707 . + 2 # 6 x ATC Adh calypso tandemrepeat 1869690 1869707 . + 2 # 6 x ATC Adh calypso tandemrepeat 1872408 1872425 . + 2 # 6 x TCA Adh calypso tandemrepeat 1872408 1872425 . + 2 # 6 x TCA Adh calypso tandemrepeat 1875472 1875489 . + 0 # 3 x GTCTCA Adh calypso tandemrepeat 1875472 1875489 . + 0 # 3 x GTCTCA Adh calypso tandemrepeat 1883451 1883465 . + 2 # 3 x TAATT Adh calypso tandemrepeat 1883451 1883465 . + 2 # 3 x TAATT Adh calypso tandemrepeat 1897863 1897877 . + 2 # 5 x ATG Adh calypso tandemrepeat 1897863 1897877 . + 2 # 5 x ATG Adh calypso tandemrepeat 1899801 1899818 . + 2 # 6 x GAT Adh calypso tandemrepeat 1899801 1899818 . + 2 # 6 x GAT Adh calypso tandemrepeat 1900746 1900763 . + 2 # 3 x GCAATT Adh calypso tandemrepeat 1900746 1900763 . + 2 # 3 x GCAATT Adh calypso tandemrepeat 1910604 1910619 . + 2 # 8 x TG Adh calypso tandemrepeat 1910604 1910619 . + 2 # 8 x TG Adh calypso tandemrepeat 1919272 1919295 . + 0 # 8 x GAG Adh calypso tandemrepeat 1919272 1919295 . + 0 # 8 x GAG Adh calypso tandemrepeat 1923052 1923068 . + 0 # 17 x A Adh calypso tandemrepeat 1923052 1923068 . + 0 # 17 x A Adh calypso tandemrepeat 1928694 1928708 . + 2 # 15 x T Adh calypso tandemrepeat 1928694 1928708 . + 2 # 15 x T Adh calypso tandemrepeat 1933624 1933638 . + 0 # 15 x T Adh calypso tandemrepeat 1933624 1933638 . + 0 # 15 x T Adh calypso tandemrepeat 1935928 1935945 . + 0 # 9 x CT Adh calypso tandemrepeat 1935928 1935945 . + 0 # 9 x CT Adh calypso tandemrepeat 1935928 1935945 . + 0 # 9 x CT Adh calypso tandemrepeat 1935928 1935945 . + 0 # 9 x CT Adh calypso tandemrepeat 1942940 1942957 . + 1 # 9 x CT Adh calypso tandemrepeat 1942940 1942957 . + 1 # 9 x CT Adh calypso tandemrepeat 1946191 1946208 . + 0 # 6 x TTA Adh calypso tandemrepeat 1946191 1946208 . + 0 # 6 x TTA Adh calypso tandemrepeat 1949060 1949077 . + 1 # 3 x AGACCC Adh calypso tandemrepeat 1949060 1949077 . + 1 # 3 x AGACCC Adh calypso tandemrepeat 1949721 1949738 . + 2 # 3 x GATACA Adh calypso tandemrepeat 1949721 1949738 . + 2 # 3 x GATACA Adh calypso tandemrepeat 1952050 1952064 . + 0 # 3 x GAGCT Adh calypso tandemrepeat 1952050 1952064 . + 0 # 3 x GAGCT Adh calypso tandemrepeat 1958417 1958431 . + 1 # 5 x CAA Adh calypso tandemrepeat 1958417 1958431 . + 1 # 5 x CAA Adh calypso tandemrepeat 1961718 1961733 . + 2 # 8 x TA Adh calypso tandemrepeat 1961718 1961733 . + 2 # 8 x TA Adh calypso tandemrepeat 1963456 1963470 . + 0 # 3 x ATGCG Adh calypso tandemrepeat 1963456 1963470 . + 0 # 3 x ATGCG Adh calypso tandemrepeat 1963928 1963951 . + 1 # 8 x TCC Adh calypso tandemrepeat 1963928 1963951 . + 1 # 8 x TCC Adh calypso tandemrepeat 1968103 1968120 . + 0 # 9 x CT Adh calypso tandemrepeat 1968103 1968120 . + 0 # 9 x CT Adh calypso tandemrepeat 1971709 1971723 . + 0 # 15 x A Adh calypso tandemrepeat 1971709 1971723 . + 0 # 15 x A Adh calypso tandemrepeat 1978481 1978498 . + 1 # 3 x AATGCA Adh calypso tandemrepeat 1978481 1978498 . + 1 # 3 x AATGCA Adh calypso tandemrepeat 2006358 2006381 . + 2 # 12 x CA Adh calypso tandemrepeat 2006358 2006381 . + 2 # 12 x CA Adh calypso tandemrepeat 2010735 2010749 . + 2 # 15 x A Adh calypso tandemrepeat 2010735 2010749 . + 2 # 15 x A Adh calypso tandemrepeat 2016529 2016545 . + 0 # 17 x A Adh calypso tandemrepeat 2016529 2016545 . + 0 # 17 x A Adh calypso tandemrepeat 2020365 2020384 . + 2 # 20 x T Adh calypso tandemrepeat 2020365 2020384 . + 2 # 20 x T Adh calypso tandemrepeat 2025530 2025544 . + 1 # 3 x CATTT Adh calypso tandemrepeat 2025530 2025544 . + 1 # 3 x CATTT Adh calypso tandemrepeat 2025530 2025544 . + 1 # 3 x CATTT Adh calypso tandemrepeat 2025530 2025544 . + 1 # 3 x CATTT Adh calypso tandemrepeat 2028920 2028937 . + 1 # 9 x AT Adh calypso tandemrepeat 2028920 2028937 . + 1 # 9 x AT Adh calypso tandemrepeat 2028920 2028937 . + 1 # 9 x AT Adh calypso tandemrepeat 2028920 2028937 . + 1 # 9 x AT Adh calypso tandemrepeat 2042609 2042624 . + 1 # 4 x AAAT Adh calypso tandemrepeat 2042609 2042624 . + 1 # 4 x AAAT Adh calypso tandemrepeat 2044384 2044398 . + 0 # 5 x GCA Adh calypso tandemrepeat 2044384 2044398 . + 0 # 5 x GCA Adh calypso tandemrepeat 2057669 2057683 . + 1 # 3 x CGTTT Adh calypso tandemrepeat 2057669 2057683 . + 1 # 3 x CGTTT Adh calypso tandemrepeat 2064384 2064398 . + 2 # 3 x ATATT Adh calypso tandemrepeat 2064384 2064398 . + 2 # 3 x ATATT Adh calypso tandemrepeat 2084139 2084153 . + 2 # 3 x GTATA Adh calypso tandemrepeat 2084139 2084153 . + 2 # 3 x GTATA Adh calypso tandemrepeat 2085093 2085110 . + 2 # 9 x TA Adh calypso tandemrepeat 2085093 2085110 . + 2 # 9 x TA Adh calypso tandemrepeat 2087717 2087731 . + 1 # 15 x T Adh calypso tandemrepeat 2087717 2087731 . + 1 # 15 x T Adh calypso tandemrepeat 2089161 2089175 . + 2 # 3 x CATTT Adh calypso tandemrepeat 2089161 2089175 . + 2 # 3 x CATTT Adh calypso tandemrepeat 2089530 2089547 . + 2 # 3 x CAACAT Adh calypso tandemrepeat 2089530 2089547 . + 2 # 3 x CAACAT Adh calypso tandemrepeat 2097990 2098011 . + 2 # 11 x TG Adh calypso tandemrepeat 2097990 2098011 . + 2 # 11 x TG Adh calypso tandemrepeat 2098669 2098686 . + 0 # 9 x TC Adh calypso tandemrepeat 2098669 2098686 . + 0 # 9 x TC Adh calypso tandemrepeat 2111586 2111601 . + 2 # 8 x CA Adh calypso tandemrepeat 2111586 2111601 . + 2 # 8 x CA Adh calypso tandemrepeat 2118089 2118103 . + 1 # 15 x T Adh calypso tandemrepeat 2118089 2118103 . + 1 # 15 x T Adh calypso tandemrepeat 2118089 2118103 . + 1 # 15 x T Adh calypso tandemrepeat 2123067 2123082 . + 2 # 4 x CTAT Adh calypso tandemrepeat 2123067 2123082 . + 2 # 4 x CTAT Adh calypso tandemrepeat 2128235 2128252 . + 1 # 6 x CAG Adh calypso tandemrepeat 2128235 2128252 . + 1 # 6 x CAG Adh calypso tandemrepeat 2141813 2141827 . + 1 # 3 x ATAAA Adh calypso tandemrepeat 2141813 2141827 . + 1 # 3 x ATAAA Adh calypso tandemrepeat 2144259 2144274 . + 2 # 16 x A Adh calypso tandemrepeat 2144259 2144274 . + 2 # 16 x A Adh calypso tandemrepeat 2144485 2144502 . + 0 # 3 x GTATGG Adh calypso tandemrepeat 2144485 2144502 . + 0 # 3 x GTATGG Adh calypso tandemrepeat 2144514 2144531 . + 2 # 3 x GGTCTG Adh calypso tandemrepeat 2144514 2144531 . + 2 # 3 x GGTCTG Adh calypso tandemrepeat 2146666 2146680 . + 0 # 3 x GATGC Adh calypso tandemrepeat 2146666 2146680 . + 0 # 3 x GATGC Adh calypso tandemrepeat 2146796 2146813 . + 1 # 3 x GCAGGG Adh calypso tandemrepeat 2146796 2146813 . + 1 # 3 x GCAGGG Adh calypso tandemrepeat 2154241 2154261 . + 0 # 7 x CAG Adh calypso tandemrepeat 2154241 2154261 . + 0 # 7 x CAG Adh calypso tandemrepeat 2159937 2159962 . + 2 # 13 x CA Adh calypso tandemrepeat 2159937 2159962 . + 2 # 13 x CA Adh calypso tandemrepeat 2160363 2160377 . + 2 # 3 x ATATT Adh calypso tandemrepeat 2160363 2160377 . + 2 # 3 x ATATT Adh calypso tandemrepeat 2160363 2160377 . + 2 # 3 x ATATT Adh calypso tandemrepeat 2160363 2160377 . + 2 # 3 x ATATT Adh calypso tandemrepeat 2162285 2162300 . + 1 # 4 x TCGC Adh calypso tandemrepeat 2162285 2162300 . + 1 # 4 x TCGC Adh calypso tandemrepeat 2162285 2162300 . + 1 # 4 x TCGC Adh calypso tandemrepeat 2162285 2162300 . + 1 # 4 x TCGC Adh calypso tandemrepeat 2163052 2163069 . + 0 # 9 x AC Adh calypso tandemrepeat 2163052 2163069 . + 0 # 9 x AC Adh calypso tandemrepeat 2163052 2163069 . + 0 # 9 x AC Adh calypso tandemrepeat 2163052 2163069 . + 0 # 9 x AC Adh calypso tandemrepeat 2168181 2168200 . + 2 # 10 x AT Adh calypso tandemrepeat 2168181 2168200 . + 2 # 10 x AT Adh calypso tandemrepeat 2168525 2168542 . + 1 # 3 x CTCGAA Adh calypso tandemrepeat 2168525 2168542 . + 1 # 3 x CTCGAA Adh calypso tandemrepeat 2168789 2168808 . + 1 # 5 x AAGA Adh calypso tandemrepeat 2168789 2168808 . + 1 # 5 x AAGA Adh calypso tandemrepeat 2168860 2168877 . + 0 # 3 x CCCCCT Adh calypso tandemrepeat 2168860 2168877 . + 0 # 3 x CCCCCT Adh calypso tandemrepeat 2169754 2169771 . + 0 # 9 x CA Adh calypso tandemrepeat 2169754 2169771 . + 0 # 9 x CA Adh calypso tandemrepeat 2170312 2170326 . + 0 # 3 x AAAAT Adh calypso tandemrepeat 2170312 2170326 . + 0 # 3 x AAAAT Adh calypso tandemrepeat 2170345 2170360 . + 0 # 8 x CA Adh calypso tandemrepeat 2170345 2170360 . + 0 # 8 x CA Adh calypso tandemrepeat 2170565 2170582 . + 1 # 3 x TGTGAG Adh calypso tandemrepeat 2170565 2170582 . + 1 # 3 x TGTGAG Adh calypso tandemrepeat 2180401 2180416 . + 0 # 8 x TA Adh calypso tandemrepeat 2180401 2180416 . + 0 # 8 x TA Adh calypso tandemrepeat 2183371 2183385 . + 0 # 5 x GTT Adh calypso tandemrepeat 2183371 2183385 . + 0 # 5 x GTT Adh calypso tandemrepeat 2185062 2185076 . + 2 # 15 x T Adh calypso tandemrepeat 2185062 2185076 . + 2 # 15 x T Adh calypso tandemrepeat 2185203 2185220 . + 2 # 3 x AATGAA Adh calypso tandemrepeat 2185203 2185220 . + 2 # 3 x AATGAA Adh calypso tandemrepeat 2190034 2190048 . + 0 # 15 x T Adh calypso tandemrepeat 2190034 2190048 . + 0 # 15 x T Adh calypso tandemrepeat 2190264 2190281 . + 2 # 3 x GGAAAT Adh calypso tandemrepeat 2190264 2190281 . + 2 # 3 x GGAAAT Adh calypso tandemrepeat 2191532 2191555 . + 1 # 8 x TGA Adh calypso tandemrepeat 2191532 2191555 . + 1 # 8 x TGA Adh calypso tandemrepeat 2192530 2192544 . + 0 # 3 x AAATT Adh calypso tandemrepeat 2192530 2192544 . + 0 # 3 x AAATT Adh calypso tandemrepeat 2198374 2198388 . + 0 # 5 x TCG Adh calypso tandemrepeat 2198374 2198388 . + 0 # 5 x TCG Adh calypso tandemrepeat 2214823 2214837 . + 0 # 5 x AAT Adh calypso tandemrepeat 2214823 2214837 . + 0 # 5 x AAT Adh calypso tandemrepeat 2214859 2214876 . + 0 # 6 x AAT Adh calypso tandemrepeat 2214859 2214876 . + 0 # 6 x AAT Adh calypso tandemrepeat 2215406 2215437 . + 1 # 8 x GATG Adh calypso tandemrepeat 2215406 2215437 . + 1 # 8 x GATG Adh calypso tandemrepeat 2215825 2215845 . + 0 # 7 x TAA Adh calypso tandemrepeat 2215825 2215845 . + 0 # 7 x TAA Adh calypso tandemrepeat 2215861 2215875 . + 0 # 5 x TAA Adh calypso tandemrepeat 2215861 2215875 . + 0 # 5 x TAA Adh calypso tandemrepeat 2230139 2230156 . + 1 # 9 x AC Adh calypso tandemrepeat 2230139 2230156 . + 1 # 9 x AC Adh calypso tandemrepeat 2230365 2230382 . + 2 # 9 x GT Adh calypso tandemrepeat 2230365 2230382 . + 2 # 9 x GT Adh calypso tandemrepeat 2231181 2231198 . + 2 # 6 x TCA Adh calypso tandemrepeat 2231181 2231198 . + 2 # 6 x TCA Adh calypso tandemrepeat 2232468 2232482 . + 2 # 3 x ACAAA Adh calypso tandemrepeat 2232468 2232482 . + 2 # 3 x ACAAA Adh calypso tandemrepeat 2234024 2234038 . + 1 # 15 x T Adh calypso tandemrepeat 2234024 2234038 . + 1 # 15 x T Adh calypso tandemrepeat 2242794 2242816 . + 2 # 23 x A Adh calypso tandemrepeat 2242794 2242816 . + 2 # 23 x A Adh calypso tandemrepeat 2248183 2248197 . + 0 # 5 x TGA Adh calypso tandemrepeat 2248183 2248197 . + 0 # 5 x TGA Adh calypso tandemrepeat 2259378 2259392 . + 2 # 5 x TTA Adh calypso tandemrepeat 2259378 2259392 . + 2 # 5 x TTA Adh calypso tandemrepeat 2267417 2267434 . + 1 # 9 x AT Adh calypso tandemrepeat 2267417 2267434 . + 1 # 9 x AT Adh calypso tandemrepeat 2277326 2277340 . + 1 # 5 x AGC Adh calypso tandemrepeat 2277326 2277340 . + 1 # 5 x AGC Adh calypso tandemrepeat 2279921 2279936 . + 1 # 4 x AATA Adh calypso tandemrepeat 2279921 2279936 . + 1 # 4 x AATA Adh calypso tandemrepeat 2280187 2280208 . + 0 # 22 x A Adh calypso tandemrepeat 2280187 2280208 . + 0 # 22 x A Adh calypso tandemrepeat 2298057 2298071 . + 2 # 15 x A Adh calypso tandemrepeat 2298057 2298071 . + 2 # 15 x A Adh calypso tandemrepeat 2298057 2298071 . + 2 # 15 x A Adh calypso tandemrepeat 2298057 2298071 . + 2 # 15 x A Adh calypso tandemrepeat 2301737 2301756 . + 1 # 10 x CA Adh calypso tandemrepeat 2301737 2301756 . + 1 # 10 x CA Adh calypso tandemrepeat 2302523 2302543 . + 1 # 7 x AGC Adh calypso tandemrepeat 2302523 2302543 . + 1 # 7 x AGC Adh calypso tandemrepeat 2321002 2321024 . + 0 # 23 x A Adh calypso tandemrepeat 2321002 2321024 . + 0 # 23 x A Adh calypso tandemrepeat 2324093 2324107 . + 1 # 15 x A Adh calypso tandemrepeat 2324093 2324107 . + 1 # 15 x A Adh calypso tandemrepeat 2348152 2348171 . + 0 # 4 x ATACC Adh calypso tandemrepeat 2348152 2348171 . + 0 # 4 x ATACC Adh calypso tandemrepeat 2348301 2348315 . + 2 # 15 x G Adh calypso tandemrepeat 2348301 2348315 . + 2 # 15 x G Adh calypso tandemrepeat 2356498 2356512 . + 0 # 3 x AACAG Adh calypso tandemrepeat 2356498 2356512 . + 0 # 3 x AACAG Adh calypso tandemrepeat 2363903 2363918 . + 1 # 8 x TA Adh calypso tandemrepeat 2363903 2363918 . + 1 # 8 x TA Adh calypso tandemrepeat 2365560 2365574 . + 2 # 15 x A Adh calypso tandemrepeat 2365560 2365574 . + 2 # 15 x A Adh calypso tandemrepeat 2373664 2373679 . + 0 # 4 x AATA Adh calypso tandemrepeat 2373664 2373679 . + 0 # 4 x AATA Adh calypso tandemrepeat 2379370 2379385 . + 0 # 16 x A Adh calypso tandemrepeat 2379370 2379385 . + 0 # 16 x A Adh calypso tandemrepeat 2382389 2382404 . + 1 # 8 x AC Adh calypso tandemrepeat 2382389 2382404 . + 1 # 8 x AC Adh calypso tandemrepeat 2400669 2400683 . + 2 # 5 x TGT Adh calypso tandemrepeat 2400669 2400683 . + 2 # 5 x TGT Adh calypso tandemrepeat 2401208 2401225 . + 1 # 9 x AT Adh calypso tandemrepeat 2401208 2401225 . + 1 # 9 x AT Adh calypso tandemrepeat 2401610 2401629 . + 1 # 4 x ATAAT Adh calypso tandemrepeat 2401610 2401629 . + 1 # 4 x ATAAT Adh calypso tandemrepeat 2405966 2405981 . + 1 # 8 x AT Adh calypso tandemrepeat 2405966 2405981 . + 1 # 8 x AT Adh calypso tandemrepeat 2414339 2414356 . + 1 # 6 x CAA Adh calypso tandemrepeat 2414339 2414356 . + 1 # 6 x CAA Adh calypso tandemrepeat 2418287 2418302 . + 1 # 4 x GTGC Adh calypso tandemrepeat 2418287 2418302 . + 1 # 4 x GTGC Adh calypso tandemrepeat 2421556 2421570 . + 0 # 5 x TGG Adh calypso tandemrepeat 2421556 2421570 . + 0 # 5 x TGG Adh calypso tandemrepeat 2421891 2421906 . + 2 # 4 x ATAC Adh calypso tandemrepeat 2421891 2421906 . + 2 # 4 x ATAC Adh calypso tandemrepeat 2425056 2425079 . + 2 # 6 x ACTG Adh calypso tandemrepeat 2425056 2425079 . + 2 # 6 x ACTG Adh calypso tandemrepeat 2425105 2425122 . + 0 # 9 x GT Adh calypso tandemrepeat 2425105 2425122 . + 0 # 9 x GT Adh calypso tandemrepeat 2427790 2427807 . + 0 # 9 x TA Adh calypso tandemrepeat 2427790 2427807 . + 0 # 9 x TA Adh calypso tandemrepeat 2435576 2435590 . + 1 # 15 x A Adh calypso tandemrepeat 2435576 2435590 . + 1 # 15 x A Adh calypso tandemrepeat 2439263 2439278 . + 1 # 8 x TG Adh calypso tandemrepeat 2439263 2439278 . + 1 # 8 x TG Adh calypso tandemrepeat 2439509 2439523 . + 1 # 3 x GTAAT Adh calypso tandemrepeat 2439509 2439523 . + 1 # 3 x GTAAT Adh calypso tandemrepeat 2441087 2441104 . + 1 # 3 x ACGCAC Adh calypso tandemrepeat 2441087 2441104 . + 1 # 3 x ACGCAC Adh calypso tandemrepeat 2444339 2444362 . + 1 # 12 x GT Adh calypso tandemrepeat 2444339 2444362 . + 1 # 12 x GT Adh calypso tandemrepeat 2455870 2455885 . + 0 # 16 x A Adh calypso tandemrepeat 2455870 2455885 . + 0 # 16 x A Adh calypso tandemrepeat 2456271 2456288 . + 2 # 3 x CATATA Adh calypso tandemrepeat 2456271 2456288 . + 2 # 3 x CATATA Adh calypso tandemrepeat 2467970 2467987 . + 1 # 3 x AATGCG Adh calypso tandemrepeat 2467970 2467987 . + 1 # 3 x AATGCG Adh calypso tandemrepeat 2475185 2475199 . + 1 # 3 x TAGAA Adh calypso tandemrepeat 2475185 2475199 . + 1 # 3 x TAGAA Adh calypso tandemrepeat 2475185 2475199 . + 1 # 3 x TAGAA Adh calypso tandemrepeat 2475185 2475199 . + 1 # 3 x TAGAA Adh calypso tandemrepeat 2481905 2481922 . + 1 # 3 x TGGATA Adh calypso tandemrepeat 2481905 2481922 . + 1 # 3 x TGGATA Adh calypso tandemrepeat 2483605 2483620 . + 0 # 4 x TACA Adh calypso tandemrepeat 2483605 2483620 . + 0 # 4 x TACA Adh calypso tandemrepeat 2488498 2488512 . + 0 # 5 x TGA Adh calypso tandemrepeat 2488498 2488512 . + 0 # 5 x TGA Adh calypso tandemrepeat 2493288 2493302 . + 2 # 5 x ATC Adh calypso tandemrepeat 2493288 2493302 . + 2 # 5 x ATC Adh calypso tandemrepeat 2499108 2499123 . + 2 # 8 x CT Adh calypso tandemrepeat 2499108 2499123 . + 2 # 8 x CT Adh calypso tandemrepeat 2500796 2500822 . + 1 # 9 x GGA Adh calypso tandemrepeat 2500796 2500822 . + 1 # 9 x GGA Adh calypso tandemrepeat 2503704 2503721 . + 2 # 9 x TG Adh calypso tandemrepeat 2503704 2503721 . + 2 # 9 x TG Adh calypso tandemrepeat 2504989 2505006 . + 0 # 3 x CATCCC Adh calypso tandemrepeat 2504989 2505006 . + 0 # 3 x CATCCC Adh calypso tandemrepeat 2512367 2512389 . + 1 # 23 x T Adh calypso tandemrepeat 2512367 2512389 . + 1 # 23 x T Adh calypso tandemrepeat 2512599 2512613 . + 2 # 3 x GACCT Adh calypso tandemrepeat 2512599 2512613 . + 2 # 3 x GACCT Adh calypso tandemrepeat 2512614 2512633 . + 2 # 4 x GAACT Adh calypso tandemrepeat 2512614 2512633 . + 2 # 4 x GAACT Adh calypso tandemrepeat 2515812 2515828 . + 2 # 17 x T Adh calypso tandemrepeat 2515812 2515828 . + 2 # 17 x T Adh calypso tandemrepeat 2518426 2518441 . + 0 # 8 x AC Adh calypso tandemrepeat 2518426 2518441 . + 0 # 8 x AC Adh calypso tandemrepeat 2528405 2528420 . + 1 # 8 x AC Adh calypso tandemrepeat 2528405 2528420 . + 1 # 8 x AC Adh calypso tandemrepeat 2542285 2542304 . + 0 # 5 x AACA Adh calypso tandemrepeat 2542285 2542304 . + 0 # 5 x AACA Adh calypso tandemrepeat 2561483 2561499 . + 1 # 17 x A Adh calypso tandemrepeat 2561483 2561499 . + 1 # 17 x A Adh calypso tandemrepeat 2562377 2562391 . + 1 # 3 x TGCAC Adh calypso tandemrepeat 2562377 2562391 . + 1 # 3 x TGCAC Adh calypso tandemrepeat 2562544 2562559 . + 0 # 8 x GA Adh calypso tandemrepeat 2562544 2562559 . + 0 # 8 x GA Adh calypso tandemrepeat 2562999 2563013 . + 2 # 3 x TTTGT Adh calypso tandemrepeat 2562999 2563013 . + 2 # 3 x TTTGT Adh calypso tandemrepeat 2564121 2564135 . + 2 # 3 x TTGAC Adh calypso tandemrepeat 2564121 2564135 . + 2 # 3 x TTGAC Adh calypso tandemrepeat 2570414 2570441 . + 1 # 14 x AC Adh calypso tandemrepeat 2570414 2570441 . + 1 # 14 x AC Adh calypso tandemrepeat 2579771 2579796 . + 1 # 13 x TA Adh calypso tandemrepeat 2579771 2579796 . + 1 # 13 x TA Adh calypso tandemrepeat 2581725 2581745 . + 2 # 21 x T Adh calypso tandemrepeat 2581725 2581745 . + 2 # 21 x T Adh calypso tandemrepeat 2582249 2582264 . + 1 # 8 x AC Adh calypso tandemrepeat 2582249 2582264 . + 1 # 8 x AC Adh calypso tandemrepeat 2590705 2590720 . + 0 # 4 x TATT Adh calypso tandemrepeat 2590705 2590720 . + 0 # 4 x TATT Adh calypso tandemrepeat 2595578 2595593 . + 1 # 4 x TATT Adh calypso tandemrepeat 2595578 2595593 . + 1 # 4 x TATT Adh calypso tandemrepeat 2596019 2596036 . + 1 # 3 x TCGTCC Adh calypso tandemrepeat 2596019 2596036 . + 1 # 3 x TCGTCC Adh calypso tandemrepeat 2597900 2597919 . + 1 # 4 x TTCCG Adh calypso tandemrepeat 2597900 2597919 . + 1 # 4 x TTCCG Adh calypso tandemrepeat 2613229 2613243 . + 0 # 3 x AAAAT Adh calypso tandemrepeat 2613229 2613243 . + 0 # 3 x AAAAT Adh calypso tandemrepeat 2613229 2613243 . + 0 # 3 x AAAAT Adh calypso tandemrepeat 2613229 2613243 . + 0 # 3 x AAAAT Adh calypso tandemrepeat 2627807 2627824 . + 1 # 9 x TA Adh calypso tandemrepeat 2627807 2627824 . + 1 # 9 x TA Adh calypso tandemrepeat 2637495 2637509 . + 2 # 3 x CTTTT Adh calypso tandemrepeat 2637495 2637509 . + 2 # 3 x CTTTT Adh calypso tandemrepeat 2640286 2640300 . + 0 # 5 x AGC Adh calypso tandemrepeat 2640286 2640300 . + 0 # 5 x AGC Adh calypso tandemrepeat 2648139 2648156 . + 2 # 18 x T Adh calypso tandemrepeat 2648139 2648156 . + 2 # 18 x T Adh calypso tandemrepeat 2653285 2653300 . + 0 # 8 x CA Adh calypso tandemrepeat 2653285 2653300 . + 0 # 8 x CA Adh calypso tandemrepeat 2658749 2658763 . + 1 # 3 x TTTCA Adh calypso tandemrepeat 2658749 2658763 . + 1 # 3 x TTTCA Adh calypso tandemrepeat 2658749 2658763 . + 1 # 3 x TTTCA Adh calypso tandemrepeat 2658749 2658763 . + 1 # 3 x TTTCA Adh calypso tandemrepeat 2660137 2660156 . + 0 # 20 x T Adh calypso tandemrepeat 2660137 2660156 . + 0 # 20 x T Adh calypso tandemrepeat 2660166 2660183 . + 2 # 3 x TTTTTG Adh calypso tandemrepeat 2660166 2660183 . + 2 # 3 x TTTTTG Adh calypso tandemrepeat 2662362 2662381 . + 2 # 5 x ATTT Adh calypso tandemrepeat 2662362 2662381 . + 2 # 5 x ATTT Adh calypso tandemrepeat 2664163 2664180 . + 0 # 3 x TGGTGA Adh calypso tandemrepeat 2664163 2664180 . + 0 # 3 x TGGTGA Adh calypso tandemrepeat 2664737 2664751 . + 1 # 15 x T Adh calypso tandemrepeat 2664737 2664751 . + 1 # 15 x T Adh calypso tandemrepeat 2665008 2665025 . + 2 # 9 x AC Adh calypso tandemrepeat 2665008 2665025 . + 2 # 9 x AC Adh calypso tandemrepeat 2666920 2666934 . + 0 # 3 x TGTGT Adh calypso tandemrepeat 2666920 2666934 . + 0 # 3 x TGTGT Adh calypso tandemrepeat 2667144 2667163 . + 2 # 4 x TTTCG Adh calypso tandemrepeat 2667144 2667163 . + 2 # 4 x TTTCG Adh calypso tandemrepeat 2671441 2671459 . + 0 # 19 x A Adh calypso tandemrepeat 2671441 2671459 . + 0 # 19 x A Adh calypso tandemrepeat 2674620 2674640 . + 2 # 7 x TGA Adh calypso tandemrepeat 2674620 2674640 . + 2 # 7 x TGA Adh calypso tandemrepeat 2680817 2680834 . + 1 # 9 x CA Adh calypso tandemrepeat 2680817 2680834 . + 1 # 9 x CA Adh calypso tandemrepeat 2681867 2681882 . + 1 # 4 x TTTA Adh calypso tandemrepeat 2681867 2681882 . + 1 # 4 x TTTA Adh calypso tandemrepeat 2683317 2683334 . + 2 # 9 x AT Adh calypso tandemrepeat 2683317 2683334 . + 2 # 9 x AT Adh calypso tandemrepeat 2689260 2689281 . + 2 # 11 x AT Adh calypso tandemrepeat 2689260 2689281 . + 2 # 11 x AT Adh calypso tandemrepeat 2698422 2698439 . + 2 # 3 x ATAAAT Adh calypso tandemrepeat 2698422 2698439 . + 2 # 3 x ATAAAT Adh calypso tandemrepeat 2702531 2702545 . + 1 # 15 x T Adh calypso tandemrepeat 2702531 2702545 . + 1 # 15 x T Adh calypso tandemrepeat 2702531 2702545 . + 1 # 15 x T Adh calypso tandemrepeat 2702531 2702545 . + 1 # 15 x T Adh calypso tandemrepeat 2703085 2703102 . + 0 # 3 x ATAGAT Adh calypso tandemrepeat 2703085 2703102 . + 0 # 3 x ATAGAT Adh calypso tandemrepeat 2703085 2703102 . + 0 # 3 x ATAGAT Adh calypso tandemrepeat 2703085 2703102 . + 0 # 3 x ATAGAT Adh calypso tandemrepeat 2704032 2704048 . + 2 # 17 x A Adh calypso tandemrepeat 2704032 2704048 . + 2 # 17 x A Adh calypso tandemrepeat 2704032 2704048 . + 2 # 17 x A Adh calypso tandemrepeat 2704032 2704048 . + 2 # 17 x A Adh calypso tandemrepeat 2713535 2713554 . + 1 # 10 x AT Adh calypso tandemrepeat 2713535 2713554 . + 1 # 10 x AT Adh calypso tandemrepeat 2713677 2713696 . + 2 # 4 x TTTTG Adh calypso tandemrepeat 2713677 2713696 . + 2 # 4 x TTTTG Adh calypso tandemrepeat 2714256 2714271 . + 2 # 4 x TGTA Adh calypso tandemrepeat 2714256 2714271 . + 2 # 4 x TGTA Adh calypso tandemrepeat 2717410 2717425 . + 0 # 8 x CT Adh calypso tandemrepeat 2717410 2717425 . + 0 # 8 x CT Adh calypso tandemrepeat 2718928 2718945 . + 0 # 9 x CT Adh calypso tandemrepeat 2718928 2718945 . + 0 # 9 x CT Adh calypso tandemrepeat 2725501 2725550 . + 0 # 25 x TA Adh calypso tandemrepeat 2725501 2725550 . + 0 # 25 x TA Adh calypso tandemrepeat 2726451 2726468 . + 2 # 6 x GTT Adh calypso tandemrepeat 2726451 2726468 . + 2 # 6 x GTT Adh calypso tandemrepeat 2733177 2733192 . + 2 # 16 x A Adh calypso tandemrepeat 2733177 2733192 . + 2 # 16 x A Adh calypso tandemrepeat 2733666 2733683 . + 2 # 18 x A Adh calypso tandemrepeat 2733666 2733683 . + 2 # 18 x A Adh calypso tandemrepeat 2736698 2736713 . + 1 # 8 x AG Adh calypso tandemrepeat 2736698 2736713 . + 1 # 8 x AG Adh calypso tandemrepeat 2738053 2738076 . + 0 # 8 x AGG Adh calypso tandemrepeat 2738053 2738076 . + 0 # 8 x AGG Adh calypso tandemrepeat 2738077 2738091 . + 0 # 5 x TGG Adh calypso tandemrepeat 2738077 2738091 . + 0 # 5 x TGG Adh calypso tandemrepeat 2742532 2742546 . + 0 # 5 x CTC Adh calypso tandemrepeat 2742532 2742546 . + 0 # 5 x CTC Adh calypso tandemrepeat 2748916 2748931 . + 0 # 8 x CT Adh calypso tandemrepeat 2748916 2748931 . + 0 # 8 x CT Adh calypso tandemrepeat 2748916 2748931 . + 0 # 8 x CT Adh calypso tandemrepeat 2748916 2748931 . + 0 # 8 x CT Adh calypso tandemrepeat 2750506 2750520 . + 0 # 5 x GAT Adh calypso tandemrepeat 2750506 2750520 . + 0 # 5 x GAT Adh calypso tandemrepeat 2751945 2751962 . + 2 # 3 x AAAAAC Adh calypso tandemrepeat 2751945 2751962 . + 2 # 3 x AAAAAC Adh calypso tandemrepeat 2761103 2761117 . + 1 # 3 x CTTTT Adh calypso tandemrepeat 2761103 2761117 . + 1 # 3 x CTTTT Adh calypso tandemrepeat 2768806 2768823 . + 0 # 6 x CTA Adh calypso tandemrepeat 2768806 2768823 . + 0 # 6 x CTA Adh calypso tandemrepeat 2792876 2792890 . + 1 # 3 x ATTTA Adh calypso tandemrepeat 2792876 2792890 . + 1 # 3 x ATTTA Adh calypso tandemrepeat 2792876 2792890 . + 1 # 3 x ATTTA Adh calypso tandemrepeat 2792876 2792890 . + 1 # 3 x ATTTA Adh calypso tandemrepeat 2808106 2808120 . + 0 # 15 x T Adh calypso tandemrepeat 2808106 2808120 . + 0 # 15 x T Adh calypso tandemrepeat 2809579 2809596 . + 0 # 9 x TG Adh calypso tandemrepeat 2809579 2809596 . + 0 # 9 x TG Adh calypso tandemrepeat 2816555 2816570 . + 1 # 4 x CATA Adh calypso tandemrepeat 2816555 2816570 . + 1 # 4 x CATA Adh calypso tandemrepeat 2820882 2820899 . + 2 # 6 x GTC Adh calypso tandemrepeat 2820882 2820899 . + 2 # 6 x GTC Adh calypso tandemrepeat 2827525 2827540 . + 0 # 8 x AC Adh calypso tandemrepeat 2827525 2827540 . + 0 # 8 x AC Adh calypso tandemrepeat 2835091 2835108 . + 0 # 18 x T Adh calypso tandemrepeat 2835091 2835108 . + 0 # 18 x T Adh calypso tandemrepeat 2835091 2835108 . + 0 # 18 x T Adh calypso tandemrepeat 2835091 2835108 . + 0 # 18 x T Adh calypso tandemrepeat 2837281 2837300 . + 0 # 5 x CAGC Adh calypso tandemrepeat 2837281 2837300 . + 0 # 5 x CAGC Adh calypso tandemrepeat 2837281 2837300 . + 0 # 5 x CAGC Adh calypso tandemrepeat 2837281 2837300 . + 0 # 5 x CAGC Adh calypso tandemrepeat 2850284 2850307 . + 1 # 4 x AGTGCA Adh calypso tandemrepeat 2850284 2850307 . + 1 # 4 x AGTGCA Adh calypso tandemrepeat 2856339 2856363 . + 2 # 5 x GGTAT Adh calypso tandemrepeat 2856339 2856363 . + 2 # 5 x GGTAT Adh calypso tandemrepeat 2862930 2862950 . + 2 # 7 x CAA Adh calypso tandemrepeat 2862930 2862950 . + 2 # 7 x CAA Adh calypso tandemrepeat 2879944 2879958 . + 0 # 3 x TGGGG Adh calypso tandemrepeat 2879944 2879958 . + 0 # 3 x TGGGG Adh calypso tandemrepeat 2880477 2880492 . + 2 # 4 x TATG Adh calypso tandemrepeat 2880477 2880492 . + 2 # 4 x TATG Adh calypso tandemrepeat 2880477 2880492 . + 2 # 4 x TATG Adh calypso tandemrepeat 2880477 2880492 . + 2 # 4 x TATG Adh calypso tandemrepeat 2884248 2884267 . + 2 # 4 x AAGTT Adh calypso tandemrepeat 2884248 2884267 . + 2 # 4 x AAGTT Adh calypso tandemrepeat 2884248 2884267 . + 2 # 4 x AAGTT Adh calypso tandemrepeat 2884248 2884267 . + 2 # 4 x AAGTT Adh calypso tandemrepeat 2887608 2887625 . + 2 # 9 x TA Adh calypso tandemrepeat 2887608 2887625 . + 2 # 9 x TA Adh calypso tandemrepeat 2888564 2888578 . + 1 # 3 x TGAAC Adh calypso tandemrepeat 2888564 2888578 . + 1 # 3 x TGAAC Adh calypso tandemrepeat 2888711 2888726 . + 1 # 8 x GT Adh calypso tandemrepeat 2888711 2888726 . + 1 # 8 x GT Adh calypso tandemrepeat 2892926 2892940 . + 1 # 3 x GTATT Adh calypso tandemrepeat 2892926 2892940 . + 1 # 3 x GTATT Adh calypso tandemrepeat 2907781 2907795 . + 0 # 15 x A Adh calypso tandemrepeat 2907781 2907795 . + 0 # 15 x A Adh calypso tandemrepeat 2913083 2913097 . + 1 # 5 x CAA Adh calypso tandemrepeat 2913083 2913097 . + 1 # 5 x CAA Adh calypso tandemrepeat 2913104 2913121 . + 1 # 6 x CAA Adh calypso tandemrepeat 2913104 2913121 . + 1 # 6 x CAA Adh calypso tandemrepeat 2914705 2914728 . + 0 # 12 x AT ##gff-version 2 ##source-version GH-fudged-GFF 1.0 # Thu Jul 22 11:59:08 1999 # #### # # compfly: 1. exon feature removed Jul 8 (MR) # 2. 5 extra genes removed to 38 genes Jan 19 (MR) # # Adh std1 stop_codon 133458 133460 . - . transcript "LD13077.con" Adh std1 CDS 133458 133548 . - . transcript "LD13077.con" Adh std1 CDS 133612 134233 . - . transcript "LD13077.con" Adh std1 CDS 134862 134967 . - . transcript "LD13077.con" Adh std1 start_codon 134965 134967 . - . transcript "LD13077.con" # #### #### # Adh std1 start_codon 264992 264994 . + . transcript "LD32761" Adh std1 CDS 264992 264997 . + . transcript "LD32761" Adh std1 CDS 265088 266322 . + . transcript "LD32761" Adh std1 CDS 266392 266619 . + . transcript "LD32761" Adh std1 CDS 266684 266867 . + . transcript "LD32761" Adh std1 CDS 266935 267073 . + . transcript "LD32761" Adh std1 CDS 267134 267234 . + . transcript "LD32761" Adh std1 stop_codon 267232 267234 . + . transcript "LD32761" # #### #### # Adh std1 start_codon 327175 327177 . + . transcript "LD09978-ADH.con" Adh std1 CDS 327175 328002 . + . transcript "LD09978-ADH.con" Adh std1 stop_codon 328000 328002 . + . transcript "LD09978-ADH.con" # #### #### # Adh std1 start_codon 341713 341715 . + . transcript "LP05733.con" Adh std1 CDS 341713 341857 . + . transcript "LP05733.con" Adh std1 CDS 342003 342751 . + . transcript "LP05733.con" Adh std1 stop_codon 342749 342751 . + . transcript "LP05733.con" # #### #### # Adh std1 start_codon 373286 373288 . + . transcript "LD11783" Adh std1 CDS 373286 373457 . + . transcript "LD11783" Adh std1 CDS 385051 385283 . + . transcript "LD11783" Adh std1 CDS 388780 388921 . + . transcript "LD11783" Adh std1 CDS 389006 389140 . + . transcript "LD11783" Adh std1 CDS 389208 390491 . + . transcript "LD11783" Adh std1 CDS 390556 390673 . + . transcript "LD11783" Adh std1 CDS 390737 391112 . + . transcript "LD11783" Adh std1 CDS 391177 391500 . + . transcript "LD11783" Adh std1 stop_codon 391498 391500 . + . transcript "LD11783" # #### #### # Adh std1 CDS 393573 393814 . - . transcript "LD02558" Adh std1 stop_codon 393573 393575 . - . transcript "LD02558" Adh std1 CDS 393894 394052 . - . transcript "LD02558" Adh std1 CDS 394383 395732 . - . transcript "LD02558" Adh std1 CDS 395826 397468 . - . transcript "LD02558" Adh std1 CDS 397532 397671 . - . transcript "LD02558" Adh std1 start_codon 397669 397671 . - . transcript "LD02558" # #### #### # Adh std1 stop_codon 438979 438981 . - . transcript "HL02234" Adh std1 CDS 438979 439800 . - . transcript "HL02234" Adh std1 CDS 440839 440850 . - . transcript "HL02234" Adh std1 start_codon 440848 440850 . - . transcript "HL02234" # #### #### # Adh std1 stop_codon 458837 458839 . - . transcript "HL01444" Adh std1 CDS 458837 459146 . - . transcript "HL01444" Adh std1 CDS 459225 459761 . - . transcript "HL01444" Adh std1 CDS 460256 460674 . - . transcript "HL01444" Adh std1 start_codon 460672 460674 . - . transcript "HL01444" # #### #### # Adh std1 stop_codon 462092 462094 . - . transcript "CK00536.con" Adh std1 CDS 462092 462584 . - . transcript "CK00536.con" Adh std1 CDS 462646 463209 . - . transcript "CK00536.con" Adh std1 CDS 463368 463657 . - . transcript "CK00536.con" Adh std1 start_codon 463655 463657 . - . transcript "CK00536.con" # #### #### # Adh std1 CDS 467979 469628 . - . transcript "LP05465" Adh std1 stop_codon 467979 467981 . - . transcript "LP05465" Adh std1 CDS 470226 470438 . - . transcript "LP05465" Adh std1 start_codon 470436 470438 . - . transcript "LP05465" # #### #### # Adh std1 start_codon 509545 509547 . + . transcript "LD10778" Adh std1 CDS 509545 509783 . + . transcript "LD10778" Adh std1 CDS 509881 510226 . + . transcript "LD10778" Adh std1 CDS 510287 510786 . + . transcript "LD10778" Adh std1 CDS 511784 512375 . + . transcript "LD10778" Adh std1 CDS 512435 512758 . + . transcript "LD10778" Adh std1 stop_codon 512756 512758 . + . transcript "LD10778" # #### #### # Adh std1 CDS 601945 602889 . - . transcript "HL03474" Adh std1 stop_codon 601945 601947 . - . transcript "HL03474" Adh std1 CDS 602944 603000 . - . transcript "HL03474" Adh std1 start_codon 602998 603000 . - . transcript "HL03474" # #### #### # Adh std1 stop_codon 846397 846399 . - . transcript "LD09509" Adh std1 CDS 846397 847372 . - . transcript "LD09509" Adh std1 CDS 847433 848154 . - . transcript "LD09509" Adh std1 CDS 848208 848609 . - . transcript "LD09509" Adh std1 CDS 848668 848733 . - . transcript "LD09509" Adh std1 start_codon 848731 848733 . - . transcript "LD09509" # #### #### # Adh std1 start_codon 851085 851087 . + . transcript "LD03340" Adh std1 CDS 851085 851190 . + . transcript "LD03340" Adh std1 CDS 851256 851436 . + . transcript "LD03340" Adh std1 CDS 851491 851673 . + . transcript "LD03340" Adh std1 CDS 851742 851919 . + . transcript "LD03340" Adh std1 stop_codon 851917 851919 . + . transcript "LD03340" # #### #### # Adh std1 start_codon 853116 853118 . + . transcript "LD24449" Adh std1 CDS 853116 855014 . + . transcript "LD24449" Adh std1 stop_codon 855012 855014 . + . transcript "LD24449" # #### #### # Adh std1 CDS 1231127 1231384 . - . transcript "LP03565" Adh std1 stop_codon 1231127 1231129 . - . transcript "LP03565" Adh std1 CDS 1231452 1231463 . - . transcript "LP03565" Adh std1 start_codon 1231461 1231463 . - . transcript "LP03565" # #### #### # Adh std1 CDS 1496304 1496815 . - . transcript "LD17234" Adh std1 stop_codon 1496304 1496306 . - . transcript "LD17234" Adh std1 CDS 1496865 1497000 . - . transcript "LD17234" Adh std1 start_codon 1496998 1497000 . - . transcript "LD17234" # #### #### # Adh std1 start_codon 1499670 1499672 . + . transcript "LD09819" Adh std1 CDS 1499670 1500870 . + . transcript "LD09819" Adh std1 CDS 1500928 1501010 . + . transcript "LD09819" Adh std1 stop_codon 1501008 1501010 . + . transcript "LD09819" # #### #### # Adh std1 stop_codon 1554085 1554087 . - . transcript "LD07162.con" Adh std1 CDS 1554085 1554599 . - . transcript "LD07162.con" Adh std1 CDS 1554841 1555107 . - . transcript "LD07162.con" Adh std1 CDS 1556588 1557278 . - . transcript "LD07162.con" Adh std1 start_codon 1557276 1557278 . - . transcript "LD07162.con" # #### #### # Adh std1 stop_codon 1744620 1744622 . - . transcript "LD09767" Adh std1 CDS 1744620 1745915 . - . transcript "LD09767" Adh std1 start_codon 1745913 1745915 . - . transcript "LD09767" # #### #### # Adh std1 CDS 1752891 1753316 . - . transcript "GH14032" Adh std1 stop_codon 1752891 1752893 . - . transcript "GH14032" Adh std1 CDS 1753422 1753778 . - . transcript "GH14032" Adh std1 start_codon 1753776 1753778 . - . transcript "GH14032" # #### #### # Adh std1 stop_codon 1763921 1763923 . - . transcript "GM01181" Adh std1 CDS 1763921 1764042 . - . transcript "GM01181" Adh std1 CDS 1764272 1764501 . - . transcript "GM01181" Adh std1 CDS 1764574 1764638 . - . transcript "GM01181" Adh std1 start_codon 1764636 1764638 . - . transcript "GM01181" # #### #### # Adh std1 start_codon 1988872 1988874 . + . transcript "LD17449" Adh std1 CDS 1988872 1989075 . + . transcript "LD17449" Adh std1 CDS 1991768 1992877 . + . transcript "LD17449" Adh std1 CDS 1992942 1993204 . + . transcript "LD17449" Adh std1 CDS 1993350 1993566 . + . transcript "LD17449" Adh std1 stop_codon 1993564 1993566 . + . transcript "LD17449" # #### #### # Adh std1 start_codon 2119874 2119876 . + . transcript "LP11031" Adh std1 CDS 2120382 2121269 . + . transcript "LP11031" Adh std1 CDS 2121336 2121745 . + . transcript "LP11031" Adh std1 stop_codon 2121743 2121745 . + . transcript "LP11031" # #### #### # Adh std1 stop_codon 2201422 2201424 . - . transcript "GH01660-ADH.con" Adh std1 CDS 2201426 2201677 . - . transcript "GH01660-ADH.con" Adh std1 CDS 2202376 2202477 . - . transcript "GH01660-ADH.con" Adh std1 CDS 2202548 2202802 . - . transcript "GH01660-ADH.con" Adh std1 start_codon 2202800 2202802 . - . transcript "GH01660-ADH.con" # #### #### # Adh std1 start_codon 2216202 2216204 . + . transcript "LD08227" Adh std1 CDS 2216202 2216447 . + . transcript "LD08227" Adh std1 CDS 2216609 2217034 . + . transcript "LD08227" Adh std1 CDS 2217099 2217403 . + . transcript "LD08227" Adh std1 CDS 2217501 2217537 . + . transcript "LD08227" Adh std1 stop_codon 2217535 2217537 . + . transcript "LD08227" # #### #### # Adh std1 stop_codon 2218461 2218463 . - . transcript "LD02957" Adh std1 CDS 2218461 2218494 . - . transcript "LD02957" Adh std1 CDS 2218559 2218905 . - . transcript "LD02957" Adh std1 CDS 2218966 2219841 . - . transcript "LD02957" Adh std1 start_codon 2219839 2219841 . - . transcript "LD02957" # #### #### # Adh std1 start_codon 2544295 2544297 . + . transcript "GH09478" Adh std1 CDS 2544295 2545201 . + . transcript "GH09478" Adh std1 stop_codon 2545201 2545203 . + . transcript "GH09478" # #### #### # Adh std1 stop_codon 2696335 2696337 . - . transcript "LD12894" Adh std1 CDS 2696335 2696446 . - . transcript "LD12894" Adh std1 CDS 2696513 2696644 . - . transcript "LD12894" Adh std1 CDS 2697862 2698028 . - . transcript "LD12894" Adh std1 CDS 2698091 2698210 . - . transcript "LD12894" Adh std1 start_codon 2698208 2698210 . - . transcript "LD12894" # #### #### # Adh std1 stop_codon 2751337 2751339 . - . transcript "GMF" Adh std1 CDS 2751337 2751465 . - . transcript "GMF" Adh std1 CDS 2751521 2751711 . - . transcript "GMF" Adh std1 CDS 2751778 2751871 . - . transcript "GMF" Adh std1 start_codon 2752031 2752033 . - . transcript "GMF" Adh std1 CDS 2752031 2752033 . - . transcript "GMF" # #### #### # Adh std1 stop_codon 2755219 2755221 . - . transcript "anon-35Fa" Adh std1 CDS 2755219 2755580 . - . transcript "anon-35Fa" Adh std1 CDS 2755775 2755883 . - . transcript "anon-35Fa" Adh std1 CDS 2755954 2756092 . - . transcript "anon-35Fa" Adh std1 CDS 2756201 2756274 . - . transcript "anon-35Fa" Adh std1 start_codon 2756272 2756274 . - . transcript "anon-35Fa" # #### #### # Adh std1 start_codon 2776417 2776419 . + . transcript "anon-35F-36A" Adh std1 CDS 2776417 2777295 . + . transcript "anon-35F-36A" Adh std1 stop_codon 2777293 2777295 . + . transcript "anon-35F-36A" # #### #### # Adh std1 CDS 2777390 2777609 . - . transcript "RPL4.FRAGA" Adh std1 stop_codon 2777390 2777392 . - . transcript "RPL4.FRAGA" Adh std1 CDS 2777672 2778342 . - . transcript "RPL4.FRAGA" Adh std1 start_codon 2778340 2778342 . - . transcript "RPL4.FRAGA" # #### #### # Adh std1 start_codon 2802355 2802357 . + . transcript "LD12474" Adh std1 CDS 2802355 2802394 . + . transcript "LD12474" Adh std1 CDS 2802473 2802813 . + . transcript "LD12474" Adh std1 stop_codon 2802811 2802813 . + . transcript "LD12474" # #### #### # Adh std1 CDS 2804442 2805730 . - . transcript "LD05503" Adh std1 stop_codon 2804442 2804444 . - . transcript "LD05503" Adh std1 CDS 2805800 2805812 . - . transcript "LD05503" Adh std1 start_codon 2805810 2805812 . - . transcript "LD05503" # #### #### # Adh std1 stop_codon 2849759 2849761 . - . transcript "CK01518.con" Adh std1 CDS 2849759 2849784 . - . transcript "CK01518.con" Adh std1 CDS 2853744 2854099 . - . transcript "CK01518.con" Adh std1 CDS 2854197 2854973 . - . transcript "CK01518.con" Adh std1 start_codon 2855180 2855182 . - . transcript "CK01518.con" # #### #### # Adh std1 start_codon 2896655 2896657 . + . transcript "GH12581" Adh std1 CDS 2896655 2896763 . + . transcript "GH12581" Adh std1 CDS 2898444 2899001 . + . transcript "GH12581" Adh std1 CDS 2899061 2899716 . + . transcript "GH12581" Adh std1 stop_codon 2899714 2899716 . + . transcript "GH12581" # #### #### # Adh std1 start_codon 2900448 2900450 . + . transcript "CK00436.con" Adh std1 CDS 2900448 2900565 . + . transcript "CK00436.con" Adh std1 CDS 2900634 2901185 . + . transcript "CK00436.con" Adh std1 CDS 2901452 2902107 . + . transcript "CK00436.con" Adh std1 stop_codon 2902105 2902107 . + . transcript "CK00436.con" # #### ##gff-version 2 ##source-version GH-fudged-GFF 1.0 # Thu Jul 22 11:55:54 1999 # ### # # # compfly: 1. exon feature removed Jul 8 (MR) # # Adh std3 start_codon 2582975 2582977 . + . transcript "BG:DS04095.2" Adh std3 stop_codon 2583545 2583547 . + . transcript "BG:DS04095.2" Adh std3 CDS 2582975 2583547 . + . transcript "BG:DS04095.2" # # ### ### # # Adh std3 start_codon 2544295 2544297 . + . transcript "BG:DS04095.1" Adh std3 stop_codon 2545201 2545203 . + . transcript "BG:DS04095.1" Adh std3 CDS 2544295 2545203 . + . transcript "BG:DS04095.1" # # ### ### # # Adh std3 start_codon 1484701 1484703 . + . transcript "BG:DS00929.16" Adh std3 stop_codon 1489832 1489834 . + . transcript "BG:DS00929.16" Adh std3 CDS 1484701 1484782 . + . transcript "BG:DS00929.16" Adh std3 CDS 1487158 1487326 . + . transcript "BG:DS00929.16" Adh std3 CDS 1488069 1488120 . + . transcript "BG:DS00929.16" Adh std3 CDS 1489262 1489834 . + . transcript "BG:DS00929.16" # # ### ### # # Adh std3 start_codon 1493680 1493682 . + . transcript "BG:DS00929.1" Adh std3 stop_codon 1496196 1496198 . + . transcript "BG:DS00929.1" Adh std3 CDS 1493680 1493718 . + . transcript "BG:DS00929.1" Adh std3 CDS 1495620 1496198 . + . transcript "BG:DS00929.1" # # ### ### # # Adh std3 start_codon 1496998 1497000 . - . transcript "BG:DS00929.2" Adh std3 stop_codon 1496304 1496306 . - . transcript "BG:DS00929.2" Adh std3 CDS 1496304 1496815 . - . transcript "BG:DS00929.2" Adh std3 CDS 1496865 1497000 . - . transcript "BG:DS00929.2" # # ### ### # # Adh std3 start_codon 1497576 1497578 . + . transcript "BG:DS00929.3" Adh std3 stop_codon 1498119 1498121 . + . transcript "BG:DS00929.3" Adh std3 CDS 1497576 1498121 . + . transcript "BG:DS00929.3" # # ### ### # # Adh std3 start_codon 1499247 1499249 . - . transcript "BG:DS00929.4" Adh std3 stop_codon 1498334 1498336 . - . transcript "BG:DS00929.4" Adh std3 CDS 1498334 1499046 . - . transcript "BG:DS00929.4" Adh std3 CDS 1499102 1499249 . - . transcript "BG:DS00929.4" # # ### ### # # Adh std3 start_codon 1499670 1499672 . + . transcript "l.2.35Bd" Adh std3 stop_codon 1501008 1501010 . + . transcript "l.2.35Bd" Adh std3 CDS 1499670 1500870 . + . transcript "l.2.35Bd" Adh std3 CDS 1500928 1501010 . + . transcript "l.2.35Bd" # # ### ### # # Adh std3 start_codon 1506022 1506024 . + . transcript "BG:DS00929.6" Adh std3 stop_codon 1521840 1521842 . + . transcript "BG:DS00929.6" Adh std3 CDS 1506022 1506086 . + . transcript "BG:DS00929.6" Adh std3 CDS 1506161 1506204 . + . transcript "BG:DS00929.6" Adh std3 CDS 1506806 1507048 . + . transcript "BG:DS00929.6" Adh std3 CDS 1508779 1508852 . + . transcript "BG:DS00929.6" Adh std3 CDS 1510744 1510998 . + . transcript "BG:DS00929.6" Adh std3 CDS 1515041 1515175 . + . transcript "BG:DS00929.6" Adh std3 CDS 1515266 1515436 . + . transcript "BG:DS00929.6" Adh std3 CDS 1515498 1515714 . + . transcript "BG:DS00929.6" Adh std3 CDS 1515807 1516279 . + . transcript "BG:DS00929.6" Adh std3 CDS 1516339 1516488 . + . transcript "BG:DS00929.6" Adh std3 CDS 1516560 1519039 . + . transcript "BG:DS00929.6" Adh std3 CDS 1519441 1519564 . + . transcript "BG:DS00929.6" Adh std3 CDS 1519897 1520023 . + . transcript "BG:DS00929.6" Adh std3 CDS 1520081 1520337 . + . transcript "BG:DS00929.6" Adh std3 CDS 1520398 1520535 . + . transcript "BG:DS00929.6" Adh std3 CDS 1521654 1521842 . + . transcript "BG:DS00929.6" # # ### ### # # Adh std3 start_codon 1521369 1521371 . - . transcript "BG:DS00929.7" Adh std3 stop_codon 1520808 1520810 . - . transcript "BG:DS00929.7" Adh std3 CDS 1520808 1521371 . - . transcript "BG:DS00929.7" # # ### ### # # Adh std3 start_codon 1525230 1525232 . + . transcript "BG:DS00929.8" Adh std3 stop_codon 1527377 1527379 . + . transcript "BG:DS00929.8" Adh std3 CDS 1525230 1525447 . + . transcript "BG:DS00929.8" Adh std3 CDS 1526237 1526642 . + . transcript "BG:DS00929.8" Adh std3 CDS 1526702 1527379 . + . transcript "BG:DS00929.8" # # ### ### # # Adh std3 start_codon 1528424 1528426 . - . transcript "l.2.35Bg" Adh std3 stop_codon 1527523 1527525 . - . transcript "l.2.35Bg" Adh std3 CDS 1527523 1527636 . - . transcript "l.2.35Bg" Adh std3 CDS 1527705 1528201 . - . transcript "l.2.35Bg" Adh std3 CDS 1528291 1528426 . - . transcript "l.2.35Bg" # # ### ### # # Adh std3 start_codon 1529588 1529590 . + . transcript "Su.H" Adh std3 stop_codon 1532267 1532269 . + . transcript "Su.H" Adh std3 CDS 1529588 1529971 . + . transcript "Su.H" Adh std3 CDS 1530746 1531626 . + . transcript "Su.H" Adh std3 CDS 1531685 1531892 . + . transcript "Su.H" Adh std3 CDS 1531958 1532269 . + . transcript "Su.H" # # ### ### # # Adh std3 start_codon 1543080 1543082 . - . transcript "ck" Adh std3 stop_codon 1535065 1535067 . - . transcript "ck" Adh std3 CDS 1535065 1535271 . - . transcript "ck" Adh std3 CDS 1535341 1535461 . - . transcript "ck" Adh std3 CDS 1535530 1535676 . - . transcript "ck" Adh std3 CDS 1535739 1536304 . - . transcript "ck" Adh std3 CDS 1536364 1537150 . - . transcript "ck" Adh std3 CDS 1537212 1538662 . - . transcript "ck" Adh std3 CDS 1538719 1541113 . - . transcript "ck" Adh std3 CDS 1541178 1541378 . - . transcript "ck" Adh std3 CDS 1541445 1541794 . - . transcript "ck" Adh std3 CDS 1542125 1542385 . - . transcript "ck" Adh std3 CDS 1543065 1543082 . - . transcript "ck" # # ### ### # # Adh std3 start_codon 1549931 1549933 . - . transcript "TfIIS" Adh std3 stop_codon 1549142 1549144 . - . transcript "TfIIS" Adh std3 CDS 1549142 1549933 . - . transcript "TfIIS" # # ### ### # # Adh std3 start_codon 1557276 1557278 . - . transcript "vig" Adh std3 stop_codon 1554085 1554087 . - . transcript "vig" Adh std3 CDS 1554085 1554599 . - . transcript "vig" Adh std3 CDS 1554841 1555107 . - . transcript "vig" Adh std3 CDS 1556588 1557278 . - . transcript "vig" # # ### ### # # Adh std3 start_codon 1558915 1558917 . + . transcript "BG:DS00929.15" Adh std3 stop_codon 1561692 1561694 . + . transcript "BG:DS00929.15" Adh std3 CDS 1558915 1559747 . + . transcript "BG:DS00929.15" Adh std3 CDS 1560074 1561694 . + . transcript "BG:DS00929.15" # # ### ### # # Adh std3 start_codon 1042686 1042688 . - . transcript "BG:DS04641.8" Adh std3 stop_codon 1041376 1041378 . - . transcript "BG:DS04641.8" Adh std3 CDS 1041376 1041530 . - . transcript "BG:DS04641.8" Adh std3 CDS 1041602 1041989 . - . transcript "BG:DS04641.8" Adh std3 CDS 1042386 1042688 . - . transcript "BG:DS04641.8" # # ### ### # # Adh std3 start_codon 984981 984983 . + . transcript "noc" Adh std3 stop_codon 986894 986896 . + . transcript "noc" Adh std3 CDS 984981 985070 . + . transcript "noc" Adh std3 CDS 985373 986896 . + . transcript "noc" # # ### ### # # Adh std3 start_codon 2619967 2619969 . + . transcript "Ca-alpha1D" Adh std3 stop_codon 2639004 2639006 . + . transcript "Ca-alpha1D" Adh std3 CDS 2619967 2620307 . + . transcript "Ca-alpha1D" Adh std3 CDS 2621231 2622507 . + . transcript "Ca-alpha1D" Adh std3 CDS 2622578 2622803 . + . transcript "Ca-alpha1D" Adh std3 CDS 2622977 2623082 . + . transcript "Ca-alpha1D" Adh std3 CDS 2623316 2623455 . + . transcript "Ca-alpha1D" Adh std3 CDS 2623675 2623781 . + . transcript "Ca-alpha1D" Adh std3 CDS 2624114 2624266 . + . transcript "Ca-alpha1D" Adh std3 CDS 2624694 2624875 . + . transcript "Ca-alpha1D" Adh std3 CDS 2624976 2625495 . + . transcript "Ca-alpha1D" Adh std3 CDS 2625559 2625784 . + . transcript "Ca-alpha1D" Adh std3 CDS 2625851 2626061 . + . transcript "Ca-alpha1D" Adh std3 CDS 2626124 2626333 . + . transcript "Ca-alpha1D" Adh std3 CDS 2626392 2626510 . + . transcript "Ca-alpha1D" Adh std3 CDS 2626595 2626653 . + . transcript "Ca-alpha1D" Adh std3 CDS 2627634 2627751 . + . transcript "Ca-alpha1D" Adh std3 CDS 2628166 2628295 . + . transcript "Ca-alpha1D" Adh std3 CDS 2628460 2628626 . + . transcript "Ca-alpha1D" Adh std3 CDS 2628718 2628805 . + . transcript "Ca-alpha1D" Adh std3 CDS 2629398 2629505 . + . transcript "Ca-alpha1D" Adh std3 CDS 2632038 2632090 . + . transcript "Ca-alpha1D" Adh std3 CDS 2632152 2632298 . + . transcript "Ca-alpha1D" Adh std3 CDS 2632363 2632834 . + . transcript "Ca-alpha1D" Adh std3 CDS 2632889 2632972 . + . transcript "Ca-alpha1D" Adh std3 CDS 2633028 2633093 . + . transcript "Ca-alpha1D" Adh std3 CDS 2633149 2633337 . + . transcript "Ca-alpha1D" Adh std3 CDS 2633397 2633645 . + . transcript "Ca-alpha1D" Adh std3 CDS 2633706 2634365 . + . transcript "Ca-alpha1D" Adh std3 CDS 2634452 2634885 . + . transcript "Ca-alpha1D" Adh std3 CDS 2635370 2635410 . + . transcript "Ca-alpha1D" Adh std3 CDS 2638284 2638414 . + . transcript "Ca-alpha1D" Adh std3 CDS 2638470 2639006 . + . transcript "Ca-alpha1D" # # ### ### # # Adh std3 start_codon 2660848 2660850 . + . transcript "BG:DS02795.3" Adh std3 stop_codon 2662317 2662319 . + . transcript "BG:DS02795.3" Adh std3 CDS 2660848 2661318 . + . transcript "BG:DS02795.3" Adh std3 CDS 2661378 2662319 . + . transcript "BG:DS02795.3" # # ### ### # # Adh std3 start_codon 29477 29479 . - . transcript "BG:BACR48E02.1" Adh std3 stop_codon 29156 29158 . - . transcript "BG:BACR48E02.1" Adh std3 CDS 29156 29479 . - . transcript "BG:BACR48E02.1" # # ### ### # # Adh std3 start_codon 32232 32234 . + . transcript "BG:BACR48E02.2" Adh std3 stop_codon 35769 35771 . + . transcript "BG:BACR48E02.2" Adh std3 CDS 32232 32319 . + . transcript "BG:BACR48E02.2" Adh std3 CDS 34532 34822 . + . transcript "BG:BACR48E02.2" Adh std3 CDS 34857 35107 . + . transcript "BG:BACR48E02.2" Adh std3 CDS 35161 35502 . + . transcript "BG:BACR48E02.2" Adh std3 CDS 35547 35771 . + . transcript "BG:BACR48E02.2" # # ### ### # # Adh std3 start_codon 36410 36412 . + . transcript "BG:BACR48E02.3" Adh std3 stop_codon 37313 37315 . + . transcript "BG:BACR48E02.3" Adh std3 CDS 36410 37315 . + . transcript "BG:BACR48E02.3" # # ### ### # # Adh std3 start_codon 45358 45360 . + . transcript "kuz" Adh std3 stop_codon 130399 130401 . + . transcript "kuz" Adh std3 CDS 45358 45425 . + . transcript "kuz" Adh std3 CDS 103520 103739 . + . transcript "kuz" Adh std3 CDS 103808 104330 . + . transcript "kuz" Adh std3 CDS 124458 124936 . + . transcript "kuz" Adh std3 CDS 127146 127292 . + . transcript "kuz" Adh std3 CDS 127771 127931 . + . transcript "kuz" Adh std3 CDS 127991 128225 . + . transcript "kuz" Adh std3 CDS 128296 129342 . + . transcript "kuz" Adh std3 CDS 129401 129965 . + . transcript "kuz" Adh std3 CDS 130136 130401 . + . transcript "kuz" # # ### ### # # Adh std3 start_codon 90664 90666 . - . transcript "BG:DS07660.1" Adh std3 stop_codon 89305 89307 . - . transcript "BG:DS07660.1" Adh std3 CDS 89305 90666 . - . transcript "BG:DS07660.1" # # ### ### # # Adh std3 start_codon 134965 134967 . - . transcript "BG:BACR48E02.4" Adh std3 stop_codon 133458 133460 . - . transcript "BG:BACR48E02.4" Adh std3 CDS 133458 133548 . - . transcript "BG:BACR48E02.4" Adh std3 CDS 133612 134233 . - . transcript "BG:BACR48E02.4" Adh std3 CDS 134862 134967 . - . transcript "BG:BACR48E02.4" # # ### ### # # Adh std3 start_codon 2101334 2101336 . - . transcript "BG:BACR44L22.1" Adh std3 stop_codon 2100551 2100553 . - . transcript "BG:BACR44L22.1" Adh std3 CDS 2100551 2101336 . - . transcript "BG:BACR44L22.1" # # ### ### # # Adh std3 start_codon 2102975 2102977 . - . transcript "BG:BACR44L22.8" Adh std3 stop_codon 2102169 2102171 . - . transcript "BG:BACR44L22.8" Adh std3 CDS 2102169 2102752 . - . transcript "BG:BACR44L22.8" Adh std3 CDS 2102776 2102977 . - . transcript "BG:BACR44L22.8" # # ### ### # # Adh std3 start_codon 2104440 2104442 . - . transcript "BG:BACR44L22.2" Adh std3 stop_codon 2103622 2103624 . - . transcript "BG:BACR44L22.2" Adh std3 CDS 2103622 2104169 . - . transcript "BG:BACR44L22.2" Adh std3 CDS 2104226 2104442 . - . transcript "BG:BACR44L22.2" # # ### ### # # Adh std3 start_codon 2105982 2105984 . - . transcript "BG:BACR44L22.3" Adh std3 stop_codon 2105170 2105172 . - . transcript "BG:BACR44L22.3" Adh std3 CDS 2105170 2105720 . - . transcript "BG:BACR44L22.3" Adh std3 CDS 2105774 2105984 . - . transcript "BG:BACR44L22.3" # # ### ### # # Adh std3 start_codon 2106653 2106655 . + . transcript "BG:BACR44L22.4" Adh std3 stop_codon 2107443 2107445 . + . transcript "BG:BACR44L22.4" Adh std3 CDS 2106653 2106860 . + . transcript "BG:BACR44L22.4" Adh std3 CDS 2106931 2107445 . + . transcript "BG:BACR44L22.4" # # ### ### # # Adh std3 start_codon 2113207 2113209 . - . transcript "BG:BACR44L22.5" Adh std3 stop_codon 2109315 2109317 . - . transcript "BG:BACR44L22.5" Adh std3 CDS 2109315 2109407 . - . transcript "BG:BACR44L22.5" Adh std3 CDS 2111897 2112079 . - . transcript "BG:BACR44L22.5" Adh std3 CDS 2112328 2113209 . - . transcript "BG:BACR44L22.5" # # ### ### # # Adh std3 start_codon 2118335 2118337 . + . transcript "BG:BACR44L22.6" Adh std3 stop_codon 2119159 2119161 . + . transcript "BG:BACR44L22.6" Adh std3 CDS 2118335 2118551 . + . transcript "BG:BACR44L22.6" Adh std3 CDS 2118614 2119161 . + . transcript "BG:BACR44L22.6" # # ### ### # # Adh std3 start_codon 2119874 2119876 . + . transcript "BG:DS07108.4" Adh std3 stop_codon 2121743 2121745 . + . transcript "BG:DS07108.4" Adh std3 CDS 2119874 2120025 . + . transcript "BG:DS07108.4" Adh std3 CDS 2120092 2120194 . + . transcript "BG:DS07108.4" Adh std3 CDS 2120312 2121269 . + . transcript "BG:DS07108.4" Adh std3 CDS 2121336 2121745 . + . transcript "BG:DS07108.4" # # ### ### # # Adh std3 start_codon 602998 603000 . - . transcript "BG:DS01759.2" Adh std3 stop_codon 601945 601947 . - . transcript "BG:DS01759.2" Adh std3 CDS 601945 602889 . - . transcript "BG:DS01759.2" Adh std3 CDS 602944 603000 . - . transcript "BG:DS01759.2" # # ### ### # # Adh std3 start_codon 598403 598405 . + . transcript "BG:DS01759.1" Adh std3 stop_codon 600431 600433 . + . transcript "BG:DS01759.1" Adh std3 CDS 598403 598796 . + . transcript "BG:DS01759.1" Adh std3 CDS 598857 599119 . + . transcript "BG:DS01759.1" Adh std3 CDS 599219 600433 . + . transcript "BG:DS01759.1" # # ### ### # # Adh std3 start_codon 1823746 1823748 . + . transcript "esg" Adh std3 stop_codon 1825156 1825158 . + . transcript "esg" Adh std3 CDS 1823746 1825158 . + . transcript "esg" # # ### ### # # Adh std3 start_codon 1809556 1809558 . - . transcript "BG:DS07851.6" Adh std3 stop_codon 1807761 1807763 . - . transcript "BG:DS07851.6" Adh std3 CDS 1807761 1808476 . - . transcript "BG:DS07851.6" Adh std3 CDS 1809495 1809558 . - . transcript "BG:DS07851.6" # # ### ### # # Adh std3 start_codon 1787599 1787601 . + . transcript "BG:DS07851.5" Adh std3 stop_codon 1788913 1788915 . + . transcript "BG:DS07851.5" Adh std3 CDS 1787599 1788915 . + . transcript "BG:DS07851.5" # # ### ### # # Adh std3 start_codon 1786407 1786409 . - . transcript "ms.2.35Ci" Adh std3 stop_codon 1782412 1782414 . - . transcript "ms.2.35Ci" Adh std3 CDS 1782412 1782827 . - . transcript "ms.2.35Ci" Adh std3 CDS 1783140 1783286 . - . transcript "ms.2.35Ci" Adh std3 CDS 1783610 1783696 . - . transcript "ms.2.35Ci" Adh std3 CDS 1784926 1785036 . - . transcript "ms.2.35Ci" Adh std3 CDS 1785511 1785654 . - . transcript "ms.2.35Ci" Adh std3 CDS 1786132 1786291 . - . transcript "ms.2.35Ci" Adh std3 CDS 1786326 1786409 . - . transcript "ms.2.35Ci" # # ### ### # # Adh std3 start_codon 1781823 1781825 . - . transcript "BG:DS07851.8" Adh std3 stop_codon 1780341 1780343 . - . transcript "BG:DS07851.8" Adh std3 CDS 1780341 1780496 . - . transcript "BG:DS07851.8" Adh std3 CDS 1781148 1781825 . - . transcript "BG:DS07851.8" # # ### ### # # Adh std3 start_codon 1774679 1774681 . + . transcript "BG:DS07851.4" Adh std3 stop_codon 1775555 1775557 . + . transcript "BG:DS07851.4" Adh std3 CDS 1774679 1775557 . + . transcript "BG:DS07851.4" # # ### ### # # Adh std3 start_codon 1764636 1764638 . - . transcript "BG:DS07851.3" Adh std3 stop_codon 1763921 1763923 . - . transcript "BG:DS07851.3" Adh std3 CDS 1763921 1764042 . - . transcript "BG:DS07851.3" Adh std3 CDS 1764272 1764501 . - . transcript "BG:DS07851.3" Adh std3 CDS 1764574 1764638 . - . transcript "BG:DS07851.3" # # ### ### # # Adh std3 start_codon 1760614 1760616 . - . transcript "gft" Adh std3 stop_codon 1756026 1756028 . - . transcript "gft" Adh std3 CDS 1756026 1756178 . - . transcript "gft" Adh std3 CDS 1756248 1756386 . - . transcript "gft" Adh std3 CDS 1756448 1756671 . - . transcript "gft" Adh std3 CDS 1756797 1756939 . - . transcript "gft" Adh std3 CDS 1757005 1757119 . - . transcript "gft" Adh std3 CDS 1757182 1757352 . - . transcript "gft" Adh std3 CDS 1757415 1757585 . - . transcript "gft" Adh std3 CDS 1757648 1758409 . - . transcript "gft" Adh std3 CDS 1758473 1758856 . - . transcript "gft" Adh std3 CDS 1760557 1760616 . - . transcript "gft" # # ### ### # # Adh std3 start_codon 1753776 1753778 . - . transcript "BG:DS07851.11" Adh std3 stop_codon 1752891 1752893 . - . transcript "BG:DS07851.11" Adh std3 CDS 1752891 1753316 . - . transcript "BG:DS07851.11" Adh std3 CDS 1753422 1753778 . - . transcript "BG:DS07851.11" # # ### ### # # Adh std3 start_codon 1432221 1432223 . - . transcript "BG:DS01219.3" Adh std3 stop_codon 1421921 1421923 . - . transcript "BG:DS01219.3" Adh std3 CDS 1421921 1422143 . - . transcript "BG:DS01219.3" Adh std3 CDS 1422176 1422320 . - . transcript "BG:DS01219.3" Adh std3 CDS 1424531 1424676 . - . transcript "BG:DS01219.3" Adh std3 CDS 1424907 1425003 . - . transcript "BG:DS01219.3" Adh std3 CDS 1425549 1425752 . - . transcript "BG:DS01219.3" Adh std3 CDS 1426168 1426281 . - . transcript "BG:DS01219.3" Adh std3 CDS 1426393 1426486 . - . transcript "BG:DS01219.3" Adh std3 CDS 1428573 1428690 . - . transcript "BG:DS01219.3" Adh std3 CDS 1431180 1431306 . - . transcript "BG:DS01219.3" Adh std3 CDS 1432142 1432223 . - . transcript "BG:DS01219.3" # # ### ### # # Adh std3 start_codon 2182861 2182863 . - . transcript "CycE-type1" Adh std3 stop_codon 2180707 2180709 . - . transcript "CycE-type1" Adh std3 CDS 2180707 2180982 . - . transcript "CycE-type1" Adh std3 CDS 2181100 2181325 . - . transcript "CycE-type1" Adh std3 CDS 2181392 2182662 . - . transcript "CycE-type1" Adh std3 CDS 2182828 2182863 . - . transcript "CycE-type1" # # ### ### # # Adh std3 start_codon 2158476 2158478 . + . transcript "BG:DS07108.5" Adh std3 stop_codon 2159458 2159460 . + . transcript "BG:DS07108.5" Adh std3 CDS 2158476 2158559 . + . transcript "BG:DS07108.5" Adh std3 CDS 2158660 2159460 . + . transcript "BG:DS07108.5" # # ### ### # # Adh std3 start_codon 2149283 2149285 . + . transcript "BG:DS07108.1" Adh std3 stop_codon 2150905 2150907 . + . transcript "BG:DS07108.1" Adh std3 CDS 2149283 2149510 . + . transcript "BG:DS07108.1" Adh std3 CDS 2149741 2150907 . + . transcript "BG:DS07108.1" # # ### ### # # Adh std3 start_codon 2146971 2146973 . - . transcript "BG:DS07108.2" Adh std3 stop_codon 2137486 2137488 . - . transcript "BG:DS07108.2" Adh std3 CDS 2137486 2137679 . - . transcript "BG:DS07108.2" Adh std3 CDS 2137746 2137902 . - . transcript "BG:DS07108.2" Adh std3 CDS 2137961 2138116 . - . transcript "BG:DS07108.2" Adh std3 CDS 2138186 2138671 . - . transcript "BG:DS07108.2" Adh std3 CDS 2138733 2138994 . - . transcript "BG:DS07108.2" Adh std3 CDS 2139065 2139169 . - . transcript "BG:DS07108.2" Adh std3 CDS 2139824 2140056 . - . transcript "BG:DS07108.2" Adh std3 CDS 2140199 2140353 . - . transcript "BG:DS07108.2" Adh std3 CDS 2140417 2140630 . - . transcript "BG:DS07108.2" Adh std3 CDS 2140705 2141412 . - . transcript "BG:DS07108.2" Adh std3 CDS 2141468 2141749 . - . transcript "BG:DS07108.2" Adh std3 CDS 2141998 2142471 . - . transcript "BG:DS07108.2" Adh std3 CDS 2146632 2146973 . - . transcript "BG:DS07108.2" # # ### ### # # Adh std3 start_codon 568986 568988 . + . transcript "BG:DS05899.4" Adh std3 stop_codon 575531 575533 . + . transcript "BG:DS05899.4" Adh std3 CDS 568986 569222 . + . transcript "BG:DS05899.4" Adh std3 CDS 570329 570621 . + . transcript "BG:DS05899.4" Adh std3 CDS 570790 570947 . + . transcript "BG:DS05899.4" Adh std3 CDS 574289 574483 . + . transcript "BG:DS05899.4" Adh std3 CDS 575409 575533 . + . transcript "BG:DS05899.4" # # ### ### # # Adh std3 start_codon 555360 555362 . + . transcript "BG:DS05899.5" Adh std3 stop_codon 556628 556630 . + . transcript "BG:DS05899.5" Adh std3 CDS 555360 555824 . + . transcript "BG:DS05899.5" Adh std3 CDS 555920 556630 . + . transcript "BG:DS05899.5" # # ### ### # # Adh std3 start_codon 541380 541382 . + . transcript "BG:DS05899.3" Adh std3 stop_codon 542511 542513 . + . transcript "BG:DS05899.3" Adh std3 CDS 541380 542513 . + . transcript "BG:DS05899.3" # # ### ### # # Adh std3 start_codon 536911 536913 . - . transcript "BG:DS05899.6" Adh std3 stop_codon 533592 533594 . - . transcript "BG:DS05899.6" Adh std3 CDS 533592 533994 . - . transcript "BG:DS05899.6" Adh std3 CDS 534017 534188 . - . transcript "BG:DS05899.6" Adh std3 CDS 534467 534571 . - . transcript "BG:DS05899.6" Adh std3 CDS 536670 536913 . - . transcript "BG:DS05899.6" # # ### ### # # Adh std3 start_codon 525281 525283 . - . transcript "BG:DS05899.7" Adh std3 stop_codon 523395 523397 . - . transcript "BG:DS05899.7" Adh std3 CDS 523395 523601 . - . transcript "BG:DS05899.7" Adh std3 CDS 523660 524253 . - . transcript "BG:DS05899.7" Adh std3 CDS 524438 525283 . - . transcript "BG:DS05899.7" # # ### ### # # Adh std3 start_codon 520781 520783 . + . transcript "BG:DS05899.1" Adh std3 stop_codon 522986 522988 . + . transcript "BG:DS05899.1" Adh std3 CDS 520781 521850 . + . transcript "BG:DS05899.1" Adh std3 CDS 522013 522988 . + . transcript "BG:DS05899.1" # # ### ### # # Adh std3 start_codon 1628242 1628244 . + . transcript "BG:DS03192.3" Adh std3 stop_codon 1628410 1628412 . + . transcript "BG:DS03192.3" Adh std3 CDS 1628242 1628412 . + . transcript "BG:DS03192.3" # # ### ### # # Adh std3 start_codon 1667968 1667970 . - . transcript "BG:DS03192.2" Adh std3 stop_codon 1653146 1653148 . - . transcript "BG:DS03192.2" Adh std3 CDS 1653146 1653412 . - . transcript "BG:DS03192.2" Adh std3 CDS 1653857 1657133 . - . transcript "BG:DS03192.2" Adh std3 CDS 1657232 1657342 . - . transcript "BG:DS03192.2" Adh std3 CDS 1661045 1661189 . - . transcript "BG:DS03192.2" Adh std3 CDS 1661787 1661932 . - . transcript "BG:DS03192.2" Adh std3 CDS 1665755 1665947 . - . transcript "BG:DS03192.2" Adh std3 CDS 1667694 1667970 . - . transcript "BG:DS03192.2" # # ### ### # # Adh std3 start_codon 1663161 1663163 . - . transcript "BG:DS03192.4" Adh std3 stop_codon 1663026 1663028 . - . transcript "BG:DS03192.4" Adh std3 CDS 1663026 1663163 . - . transcript "BG:DS03192.4" # # ### ### # # Adh std3 start_codon 1737244 1737246 . - . transcript "BG:DS07295.1" Adh std3 stop_codon 1718580 1718582 . - . transcript "BG:DS07295.1" Adh std3 CDS 1718580 1718725 . - . transcript "BG:DS07295.1" Adh std3 CDS 1719195 1719342 . - . transcript "BG:DS07295.1" Adh std3 CDS 1719504 1720005 . - . transcript "BG:DS07295.1" Adh std3 CDS 1726256 1726435 . - . transcript "BG:DS07295.1" Adh std3 CDS 1730116 1730236 . - . transcript "BG:DS07295.1" Adh std3 CDS 1731062 1731172 . - . transcript "BG:DS07295.1" Adh std3 CDS 1735826 1736004 . - . transcript "BG:DS07295.1" Adh std3 CDS 1737215 1737246 . - . transcript "BG:DS07295.1" # # ### ### # # Adh std3 start_codon 1721863 1721865 . + . transcript "BG:DS07295.4" Adh std3 stop_codon 1728734 1728736 . + . transcript "BG:DS07295.4" Adh std3 CDS 1721863 1721967 . + . transcript "BG:DS07295.4" Adh std3 CDS 1722243 1722408 . + . transcript "BG:DS07295.4" Adh std3 CDS 1722493 1722656 . + . transcript "BG:DS07295.4" Adh std3 CDS 1724226 1724372 . + . transcript "BG:DS07295.4" Adh std3 CDS 1725680 1726192 . + . transcript "BG:DS07295.4" Adh std3 CDS 1726279 1726480 . + . transcript "BG:DS07295.4" Adh std3 CDS 1727221 1727390 . + . transcript "BG:DS07295.4" Adh std3 CDS 1728458 1728736 . + . transcript "BG:DS07295.4" # # ### ### # # Adh std3 start_codon 1738791 1738793 . + . transcript "BG:DS07295.2" Adh std3 stop_codon 1743191 1743193 . + . transcript "BG:DS07295.2" Adh std3 CDS 1738791 1739218 . + . transcript "BG:DS07295.2" Adh std3 CDS 1740300 1740540 . + . transcript "BG:DS07295.2" Adh std3 CDS 1740659 1740939 . + . transcript "BG:DS07295.2" Adh std3 CDS 1740995 1742042 . + . transcript "BG:DS07295.2" Adh std3 CDS 1742104 1742446 . + . transcript "BG:DS07295.2" Adh std3 CDS 1742886 1743193 . + . transcript "BG:DS07295.2" # # ### ### # # Adh std3 start_codon 1745913 1745915 . - . transcript "BG:DS07295.3" Adh std3 stop_codon 1744620 1744622 . - . transcript "BG:DS07295.3" Adh std3 CDS 1744620 1745915 . - . transcript "BG:DS07295.3" # # ### ### # # Adh std3 start_codon 1746303 1746305 . + . transcript "BG:DS07295.5" Adh std3 stop_codon 1746840 1746842 . + . transcript "BG:DS07295.5" Adh std3 CDS 1746303 1746349 . + . transcript "BG:DS07295.5" Adh std3 CDS 1746401 1746842 . + . transcript "BG:DS07295.5" # # ### ### # # Adh std3 start_codon 1250633 1250635 . + . transcript "BG:DS06874.1" Adh std3 stop_codon 1251419 1251421 . + . transcript "BG:DS06874.1" Adh std3 CDS 1250633 1251421 . + . transcript "BG:DS06874.1" # # ### ### # # Adh std3 start_codon 1252544 1252546 . + . transcript "BG:DS06874.2" Adh std3 stop_codon 1253615 1253617 . + . transcript "BG:DS06874.2" Adh std3 CDS 1252544 1253617 . + . transcript "BG:DS06874.2" # # ### ### # # Adh std3 start_codon 1255669 1255671 . + . transcript "BG:DS06874.3" Adh std3 stop_codon 1256821 1256823 . + . transcript "BG:DS06874.3" Adh std3 CDS 1255669 1256823 . + . transcript "BG:DS06874.3" # # ### ### # # Adh std3 start_codon 1276357 1276359 . - . transcript "BG:DS06874.4" Adh std3 stop_codon 1271377 1271379 . - . transcript "BG:DS06874.4" Adh std3 CDS 1271377 1272140 . - . transcript "BG:DS06874.4" Adh std3 CDS 1272217 1272395 . - . transcript "BG:DS06874.4" Adh std3 CDS 1273203 1273596 . - . transcript "BG:DS06874.4" Adh std3 CDS 1273652 1273822 . - . transcript "BG:DS06874.4" Adh std3 CDS 1274014 1274154 . - . transcript "BG:DS06874.4" Adh std3 CDS 1276206 1276359 . - . transcript "BG:DS06874.4" # # ### ### # # Adh std3 start_codon 1286197 1286199 . - . transcript "BG:DS06874.6" Adh std3 stop_codon 1285030 1285032 . - . transcript "BG:DS06874.6" Adh std3 CDS 1285030 1285502 . - . transcript "BG:DS06874.6" Adh std3 CDS 1285595 1285746 . - . transcript "BG:DS06874.6" Adh std3 CDS 1285814 1285859 . - . transcript "BG:DS06874.6" Adh std3 CDS 1285971 1286199 . - . transcript "BG:DS06874.6" # # ### ### # # Adh std3 start_codon 1300469 1300471 . + . transcript "BG:DS06874.7" Adh std3 stop_codon 1315920 1315922 . + . transcript "BG:DS06874.7" Adh std3 CDS 1300469 1300474 . + . transcript "BG:DS06874.7" Adh std3 CDS 1300535 1302030 . + . transcript "BG:DS06874.7" Adh std3 CDS 1303048 1303240 . + . transcript "BG:DS06874.7" Adh std3 CDS 1306976 1307130 . + . transcript "BG:DS06874.7" Adh std3 CDS 1312765 1312941 . + . transcript "BG:DS06874.7" Adh std3 CDS 1315829 1315922 . + . transcript "BG:DS06874.7" # # ### ### # # Adh std3 start_codon 264992 264994 . + . transcript "BG:DS00797.1" Adh std3 stop_codon 267232 267234 . + . transcript "BG:DS00797.1" Adh std3 CDS 264992 264997 . + . transcript "BG:DS00797.1" Adh std3 CDS 265088 266322 . + . transcript "BG:DS00797.1" Adh std3 CDS 266392 266619 . + . transcript "BG:DS00797.1" Adh std3 CDS 266684 266867 . + . transcript "BG:DS00797.1" Adh std3 CDS 266935 267073 . + . transcript "BG:DS00797.1" Adh std3 CDS 267134 267234 . + . transcript "BG:DS00797.1" # # ### ### # # Adh std3 start_codon 273481 273483 . - . transcript "BG:DS00797.2" Adh std3 stop_codon 268751 268753 . - . transcript "BG:DS00797.2" Adh std3 CDS 268751 268798 . - . transcript "BG:DS00797.2" Adh std3 CDS 269006 269157 . - . transcript "BG:DS00797.2" Adh std3 CDS 269222 269559 . - . transcript "BG:DS00797.2" Adh std3 CDS 269629 269785 . - . transcript "BG:DS00797.2" Adh std3 CDS 269849 269907 . - . transcript "BG:DS00797.2" Adh std3 CDS 271522 271573 . - . transcript "BG:DS00797.2" Adh std3 CDS 273396 273483 . - . transcript "BG:DS00797.2" # # ### ### # # Adh std3 start_codon 274751 274753 . + . transcript "p38b" Adh std3 stop_codon 275846 275848 . + . transcript "p38b" Adh std3 CDS 274751 275110 . + . transcript "p38b" Adh std3 CDS 275123 275848 . + . transcript "p38b" # # ### ### # # Adh std3 start_codon 277186 277188 . - . transcript "BG:DS00797.4" Adh std3 stop_codon 276361 276363 . - . transcript "BG:DS00797.4" Adh std3 CDS 276361 276696 . - . transcript "BG:DS00797.4" Adh std3 CDS 276748 277188 . - . transcript "BG:DS00797.4" # # ### ### # # Adh std3 start_codon 281649 281651 . + . transcript "BG:DS00797.5" Adh std3 stop_codon 284050 284052 . + . transcript "BG:DS00797.5" Adh std3 CDS 281649 281787 . + . transcript "BG:DS00797.5" Adh std3 CDS 281848 282471 . + . transcript "BG:DS00797.5" Adh std3 CDS 282539 283541 . + . transcript "BG:DS00797.5" Adh std3 CDS 283608 284052 . + . transcript "BG:DS00797.5" # # ### ### # # Adh std3 start_codon 284779 284781 . + . transcript "BG:DS00797.6" Adh std3 stop_codon 286884 286886 . + . transcript "BG:DS00797.6" Adh std3 CDS 284779 284915 . + . transcript "BG:DS00797.6" Adh std3 CDS 284969 285346 . + . transcript "BG:DS00797.6" Adh std3 CDS 285416 286886 . + . transcript "BG:DS00797.6" # # ### ### # # Adh std3 start_codon 287599 287601 . + . transcript "BG:DS00797.7" Adh std3 stop_codon 292894 292896 . + . transcript "BG:DS00797.7" Adh std3 CDS 287599 288374 . + . transcript "BG:DS00797.7" Adh std3 CDS 288642 292689 . + . transcript "BG:DS00797.7" Adh std3 CDS 292759 292896 . + . transcript "BG:DS00797.7" # # ### ### # # Adh std3 start_codon 2505534 2505536 . + . transcript "beat" Adh std3 stop_codon 2530154 2530156 . + . transcript "beat" Adh std3 CDS 2505534 2505597 . + . transcript "beat" Adh std3 CDS 2524357 2524565 . + . transcript "beat" Adh std3 CDS 2525929 2526064 . + . transcript "beat" Adh std3 CDS 2527415 2527548 . + . transcript "beat" Adh std3 CDS 2529073 2529195 . + . transcript "beat" Adh std3 CDS 2529260 2529455 . + . transcript "beat" Adh std3 CDS 2529735 2530156 . + . transcript "beat" # # ### ### # # Adh std3 start_codon 2493314 2493316 . + . transcript "BicC" Adh std3 stop_codon 2497462 2497464 . + . transcript "BicC" Adh std3 CDS 2493314 2493620 . + . transcript "BicC" Adh std3 CDS 2493682 2493731 . + . transcript "BicC" Adh std3 CDS 2494047 2494116 . + . transcript "BicC" Adh std3 CDS 2494180 2494259 . + . transcript "BicC" Adh std3 CDS 2494325 2494651 . + . transcript "BicC" Adh std3 CDS 2495100 2495225 . + . transcript "BicC" Adh std3 CDS 2495286 2495667 . + . transcript "BicC" Adh std3 CDS 2495861 2496988 . + . transcript "BicC" Adh std3 CDS 2497217 2497464 . + . transcript "BicC" # # ### ### # # Adh std3 start_codon 1923109 1923111 . + . transcript "BG:DS03023.2" Adh std3 stop_codon 1924561 1924563 . + . transcript "BG:DS03023.2" Adh std3 CDS 1923109 1924563 . + . transcript "BG:DS03023.2" # # ### ### # # Adh std3 start_codon 1914946 1914948 . - . transcript "wor" Adh std3 stop_codon 1913374 1913376 . - . transcript "wor" Adh std3 CDS 1913374 1914948 . - . transcript "wor" # # ### ### # # Adh std3 start_codon 1895877 1895879 . - . transcript "BG:DS03023.4" Adh std3 stop_codon 1875987 1875989 . - . transcript "BG:DS03023.4" Adh std3 CDS 1875987 1876447 . - . transcript "BG:DS03023.4" Adh std3 CDS 1878988 1879161 . - . transcript "BG:DS03023.4" Adh std3 CDS 1881548 1881779 . - . transcript "BG:DS03023.4" Adh std3 CDS 1883261 1883385 . - . transcript "BG:DS03023.4" Adh std3 CDS 1883560 1883683 . - . transcript "BG:DS03023.4" Adh std3 CDS 1884195 1884559 . - . transcript "BG:DS03023.4" Adh std3 CDS 1885049 1885269 . - . transcript "BG:DS03023.4" Adh std3 CDS 1885421 1885599 . - . transcript "BG:DS03023.4" Adh std3 CDS 1886301 1886582 . - . transcript "BG:DS03023.4" Adh std3 CDS 1889969 1890043 . - . transcript "BG:DS03023.4" Adh std3 CDS 1891514 1891654 . - . transcript "BG:DS03023.4" Adh std3 CDS 1891981 1892047 . - . transcript "BG:DS03023.4" Adh std3 CDS 1893271 1893751 . - . transcript "BG:DS03023.4" Adh std3 CDS 1895585 1895879 . - . transcript "BG:DS03023.4" # # ### ### # # Adh std3 start_codon 343169 343171 . + . transcript "BG:DS00941.15" Adh std3 stop_codon 343982 343984 . + . transcript "BG:DS00941.15" Adh std3 CDS 343169 343368 . + . transcript "BG:DS00941.15" Adh std3 CDS 343432 343984 . + . transcript "BG:DS00941.15" # # ### ### # # Adh std3 start_codon 341713 341715 . + . transcript "BG:DS00941.14" Adh std3 stop_codon 342749 342751 . + . transcript "BG:DS00941.14" Adh std3 CDS 341713 341857 . + . transcript "BG:DS00941.14" Adh std3 CDS 342003 342751 . + . transcript "BG:DS00941.14" # # ### ### # # Adh std3 start_codon 340529 340531 . + . transcript "BG:DS00941.13" Adh std3 stop_codon 341551 341553 . + . transcript "BG:DS00941.13" Adh std3 CDS 340529 340634 . + . transcript "BG:DS00941.13" Adh std3 CDS 340705 340870 . + . transcript "BG:DS00941.13" Adh std3 CDS 340926 341551 . + . transcript "BG:DS00941.13" # # ### ### # # Adh std3 start_codon 339011 339013 . - . transcript "BG:DS00941.12" Adh std3 stop_codon 338167 338169 . - . transcript "BG:DS00941.12" Adh std3 CDS 338167 338879 . - . transcript "BG:DS00941.12" Adh std3 CDS 338944 339013 . - . transcript "BG:DS00941.12" # # ### ### # # Adh std3 start_codon 337455 337457 . - . transcript "BG:DS00941.11" Adh std3 stop_codon 334589 334591 . - . transcript "BG:DS00941.11" Adh std3 CDS 334589 335125 . - . transcript "BG:DS00941.11" Adh std3 CDS 336758 337317 . - . transcript "BG:DS00941.11" Adh std3 CDS 337379 337457 . - . transcript "BG:DS00941.11" # # ### ### # # Adh std3 start_codon 327175 327177 . + . transcript "RpII33" Adh std3 stop_codon 328000 328002 . + . transcript "RpII33" Adh std3 CDS 327175 328002 . + . transcript "RpII33" # # ### ### # # Adh std3 start_codon 326377 326379 . - . transcript "MtPolB" Adh std3 stop_codon 325240 325242 . - . transcript "MtPolB" Adh std3 CDS 325240 325634 . - . transcript "MtPolB" Adh std3 CDS 325689 326379 . - . transcript "MtPolB" # # ### ### # # Adh std3 start_codon 323788 323790 . + . transcript "Orc5" Adh std3 stop_codon 325221 325223 . + . transcript "Orc5" Adh std3 CDS 323788 324885 . + . transcript "Orc5" Adh std3 CDS 324939 325223 . + . transcript "Orc5" # # ### ### # # Adh std3 start_codon 323167 323169 . - . transcript "Sop2" Adh std3 stop_codon 321967 321969 . - . transcript "Sop2" Adh std3 CDS 321967 323027 . - . transcript "Sop2" Adh std3 CDS 323097 323169 . - . transcript "Sop2" # # ### ### # # Adh std3 start_codon 321440 321442 . - . transcript "tamas" Adh std3 stop_codon 317891 317893 . - . transcript "tamas" Adh std3 CDS 317891 318548 . - . transcript "tamas" Adh std3 CDS 318608 319430 . - . transcript "tamas" Adh std3 CDS 319486 321442 . - . transcript "tamas" # # ### ### # # Adh std3 start_codon 315138 315140 . + . transcript "b" Adh std3 stop_codon 317460 317462 . + . transcript "b" Adh std3 CDS 315138 315899 . + . transcript "b" Adh std3 CDS 316433 316800 . + . transcript "b" Adh std3 CDS 316865 317462 . + . transcript "b" # # ### ### # # Adh std3 start_codon 307965 307967 . + . transcript "Sos" Adh std3 stop_codon 313127 313129 . + . transcript "Sos" Adh std3 CDS 307965 309056 . + . transcript "Sos" Adh std3 CDS 309110 309467 . + . transcript "Sos" Adh std3 CDS 309530 310452 . + . transcript "Sos" Adh std3 CDS 310517 311365 . + . transcript "Sos" Adh std3 CDS 311428 312318 . + . transcript "Sos" Adh std3 CDS 312387 313020 . + . transcript "Sos" Adh std3 CDS 313086 313129 . + . transcript "Sos" # # ### ### # # Adh std3 start_codon 305396 305398 . + . transcript "BG:DS00941.3" Adh std3 stop_codon 306383 306385 . + . transcript "BG:DS00941.3" Adh std3 CDS 305396 305516 . + . transcript "BG:DS00941.3" Adh std3 CDS 305577 305737 . + . transcript "BG:DS00941.3" Adh std3 CDS 305803 306108 . + . transcript "BG:DS00941.3" Adh std3 CDS 306230 306385 . + . transcript "BG:DS00941.3" # # ### ### # # Adh std3 start_codon 305199 305201 . - . transcript "BG:DS00941.2" Adh std3 stop_codon 303960 303962 . - . transcript "BG:DS00941.2" Adh std3 CDS 303960 304272 . - . transcript "BG:DS00941.2" Adh std3 CDS 304330 305201 . - . transcript "BG:DS00941.2" # # ### ### # # Adh std3 start_codon 297680 297682 . + . transcript "BG:DS00941.1" Adh std3 stop_codon 303403 303405 . + . transcript "BG:DS00941.1" Adh std3 CDS 297680 297713 . + . transcript "BG:DS00941.1" Adh std3 CDS 302560 302718 . + . transcript "BG:DS00941.1" Adh std3 CDS 302786 303405 . + . transcript "BG:DS00941.1" # # ### ### # # Adh std3 start_codon 1565296 1565298 . + . transcript "BG:DS04929.1" Adh std3 stop_codon 1585378 1585380 . + . transcript "BG:DS04929.1" Adh std3 CDS 1565296 1565530 . + . transcript "BG:DS04929.1" Adh std3 CDS 1576691 1576943 . + . transcript "BG:DS04929.1" Adh std3 CDS 1577036 1577406 . + . transcript "BG:DS04929.1" Adh std3 CDS 1577568 1577860 . + . transcript "BG:DS04929.1" Adh std3 CDS 1577926 1578081 . + . transcript "BG:DS04929.1" Adh std3 CDS 1580550 1580685 . + . transcript "BG:DS04929.1" Adh std3 CDS 1580750 1580880 . + . transcript "BG:DS04929.1" Adh std3 CDS 1580946 1581227 . + . transcript "BG:DS04929.1" Adh std3 CDS 1581294 1581623 . + . transcript "BG:DS04929.1" Adh std3 CDS 1581774 1582136 . + . transcript "BG:DS04929.1" Adh std3 CDS 1582201 1582292 . + . transcript "BG:DS04929.1" Adh std3 CDS 1582550 1582687 . + . transcript "BG:DS04929.1" Adh std3 CDS 1583070 1583334 . + . transcript "BG:DS04929.1" Adh std3 CDS 1583785 1583883 . + . transcript "BG:DS04929.1" Adh std3 CDS 1584330 1584828 . + . transcript "BG:DS04929.1" Adh std3 CDS 1584949 1585094 . + . transcript "BG:DS04929.1" Adh std3 CDS 1585153 1585380 . + . transcript "BG:DS04929.1" # # ### ### # # Adh std3 start_codon 1599236 1599238 . + . transcript "BG:DS04929.3" Adh std3 stop_codon 1602563 1602565 . + . transcript "BG:DS04929.3" Adh std3 CDS 1599236 1600177 . + . transcript "BG:DS04929.3" Adh std3 CDS 1601744 1602565 . + . transcript "BG:DS04929.3" # # ### ### # # Adh std3 start_codon 1603541 1603543 . + . transcript "stc" Adh std3 stop_codon 1607304 1607306 . + . transcript "stc" Adh std3 CDS 1603541 1603885 . + . transcript "stc" Adh std3 CDS 1603951 1605404 . + . transcript "stc" Adh std3 CDS 1605651 1606718 . + . transcript "stc" Adh std3 CDS 1606791 1607142 . + . transcript "stc" Adh std3 CDS 1607205 1607306 . + . transcript "stc" # # ### ### # # Adh std3 start_codon 2040123 2040125 . + . transcript "BG:DS04862.2" Adh std3 stop_codon 2052899 2052901 . + . transcript "BG:DS04862.2" Adh std3 CDS 2040123 2040280 . + . transcript "BG:DS04862.2" Adh std3 CDS 2040432 2040689 . + . transcript "BG:DS04862.2" Adh std3 CDS 2041374 2041494 . + . transcript "BG:DS04862.2" Adh std3 CDS 2044388 2044681 . + . transcript "BG:DS04862.2" Adh std3 CDS 2049236 2049415 . + . transcript "BG:DS04862.2" Adh std3 CDS 2050204 2050341 . + . transcript "BG:DS04862.2" Adh std3 CDS 2052716 2052901 . + . transcript "BG:DS04862.2" # # ### ### # # Adh std3 start_codon 2068604 2068606 . + . transcript "kek3" Adh std3 stop_codon 2072675 2072677 . + . transcript "kek3" Adh std3 CDS 2068604 2070501 . + . transcript "kek3" Adh std3 CDS 2071510 2072677 . + . transcript "kek3" # # ### ### # # Adh std3 start_codon 646068 646070 . + . transcript "BG:DS01523.1" Adh std3 stop_codon 652822 652824 . + . transcript "BG:DS01523.1" Adh std3 CDS 646068 646145 . + . transcript "BG:DS01523.1" Adh std3 CDS 650611 651153 . + . transcript "BG:DS01523.1" Adh std3 CDS 651278 651478 . + . transcript "BG:DS01523.1" Adh std3 CDS 651583 652282 . + . transcript "BG:DS01523.1" Adh std3 CDS 652397 652824 . + . transcript "BG:DS01523.1" # # ### ### # # Adh std3 start_codon 667103 667105 . - . transcript "BG:DS01523.2" Adh std3 stop_codon 654984 654986 . - . transcript "BG:DS01523.2" Adh std3 CDS 654984 656897 . - . transcript "BG:DS01523.2" Adh std3 CDS 656952 657179 . - . transcript "BG:DS01523.2" Adh std3 CDS 657772 658001 . - . transcript "BG:DS01523.2" Adh std3 CDS 658058 658265 . - . transcript "BG:DS01523.2" Adh std3 CDS 658326 658463 . - . transcript "BG:DS01523.2" Adh std3 CDS 658526 660852 . - . transcript "BG:DS01523.2" Adh std3 CDS 660917 661331 . - . transcript "BG:DS01523.2" Adh std3 CDS 662256 662303 . - . transcript "BG:DS01523.2" Adh std3 CDS 665700 665782 . - . transcript "BG:DS01523.2" Adh std3 CDS 667015 667105 . - . transcript "BG:DS01523.2" # # ### ### # # Adh std3 start_codon 2305038 2305040 . + . transcript "BG:DS02252.2" Adh std3 stop_codon 2306949 2306951 . + . transcript "BG:DS02252.2" Adh std3 CDS 2305038 2305397 . + . transcript "BG:DS02252.2" Adh std3 CDS 2305489 2305763 . + . transcript "BG:DS02252.2" Adh std3 CDS 2305829 2306951 . + . transcript "BG:DS02252.2" # # ### ### # # Adh std3 start_codon 2331308 2331310 . - . transcript "BG:DS00365.1" Adh std3 stop_codon 2328290 2328292 . - . transcript "BG:DS00365.1" Adh std3 CDS 2328290 2328403 . - . transcript "BG:DS00365.1" Adh std3 CDS 2328611 2329967 . - . transcript "BG:DS00365.1" Adh std3 CDS 2330026 2330181 . - . transcript "BG:DS00365.1" Adh std3 CDS 2330600 2330652 . - . transcript "BG:DS00365.1" Adh std3 CDS 2331101 2331310 . - . transcript "BG:DS00365.1" # # ### ### # # Adh std3 start_codon 2343907 2343909 . - . transcript "BG:DS00365.2" Adh std3 stop_codon 2339377 2339379 . - . transcript "BG:DS00365.2" Adh std3 CDS 2339377 2340420 . - . transcript "BG:DS00365.2" Adh std3 CDS 2340535 2341630 . - . transcript "BG:DS00365.2" Adh std3 CDS 2341725 2341808 . - . transcript "BG:DS00365.2" Adh std3 CDS 2342156 2342274 . - . transcript "BG:DS00365.2" Adh std3 CDS 2342341 2342602 . - . transcript "BG:DS00365.2" Adh std3 CDS 2342664 2343851 . - . transcript "BG:DS00365.2" Adh std3 CDS 2343893 2343909 . - . transcript "BG:DS00365.2" # # ### ### # # Adh std3 start_codon 2353050 2353052 . - . transcript "BG:DS00365.3" Adh std3 stop_codon 2348982 2348984 . - . transcript "BG:DS00365.3" Adh std3 CDS 2348982 2349115 . - . transcript "BG:DS00365.3" Adh std3 CDS 2349968 2350879 . - . transcript "BG:DS00365.3" Adh std3 CDS 2352080 2353052 . - . transcript "BG:DS00365.3" # # ### ### # # Adh std3 start_codon 2202800 2202802 . - . transcript "BG:DS09217.1" Adh std3 stop_codon 2201422 2201424 . - . transcript "BG:DS09217.1" Adh std3 CDS 2201424 2201677 . - . transcript "BG:DS09217.1" Adh std3 CDS 2202376 2202477 . - . transcript "BG:DS09217.1" Adh std3 CDS 2202548 2202802 . - . transcript "BG:DS09217.1" # # ### ### # # Adh std3 start_codon 2204183 2204185 . + . transcript "l.2.35Df" Adh std3 stop_codon 2207401 2207403 . + . transcript "l.2.35Df" Adh std3 CDS 2204183 2205278 . + . transcript "l.2.35Df" Adh std3 CDS 2205332 2207403 . + . transcript "l.2.35Df" # # ### ### # # Adh std3 start_codon 2212392 2212394 . - . transcript "Gli" Adh std3 stop_codon 2208922 2208924 . - . transcript "Gli" Adh std3 CDS 2208922 2209531 . - . transcript "Gli" Adh std3 CDS 2209593 2209904 . - . transcript "Gli" Adh std3 CDS 2209967 2211186 . - . transcript "Gli" Adh std3 CDS 2211243 2211671 . - . transcript "Gli" Adh std3 CDS 2212036 2212168 . - . transcript "Gli" Adh std3 CDS 2212228 2212394 . - . transcript "Gli" # # ### ### # # Adh std3 start_codon 2216202 2216204 . + . transcript "BG:DS09217.4" Adh std3 stop_codon 2217535 2217537 . + . transcript "BG:DS09217.4" Adh std3 CDS 2216202 2216447 . + . transcript "BG:DS09217.4" Adh std3 CDS 2216609 2217034 . + . transcript "BG:DS09217.4" Adh std3 CDS 2217099 2217403 . + . transcript "BG:DS09217.4" Adh std3 CDS 2217501 2217537 . + . transcript "BG:DS09217.4" # # ### ### # # Adh std3 start_codon 2219839 2219841 . - . transcript "l.2.35Ea" Adh std3 stop_codon 2218461 2218463 . - . transcript "l.2.35Ea" Adh std3 CDS 2218461 2218494 . - . transcript "l.2.35Ea" Adh std3 CDS 2218559 2218905 . - . transcript "l.2.35Ea" Adh std3 CDS 2218966 2219841 . - . transcript "l.2.35Ea" # # ### ### # # Adh std3 start_codon 2224365 2224367 . - . transcript "BG:DS09217.6" Adh std3 stop_codon 2220563 2220565 . - . transcript "BG:DS09217.6" Adh std3 CDS 2220565 2222197 . - . transcript "BG:DS09217.6" Adh std3 CDS 2222257 2222379 . - . transcript "BG:DS09217.6" Adh std3 CDS 2222435 2222667 . - . transcript "BG:DS09217.6" Adh std3 CDS 2222723 2222818 . - . transcript "BG:DS09217.6" Adh std3 CDS 2223403 2223577 . - . transcript "BG:DS09217.6" Adh std3 CDS 2223854 2224229 . - . transcript "BG:DS09217.6" Adh std3 CDS 2224289 2224367 . - . transcript "BG:DS09217.6" # # ### ### # # Adh std3 start_codon 2707374 2707376 . + . transcript "BG:DS07473.2" Adh std3 stop_codon 2708520 2708522 . + . transcript "BG:DS07473.2" Adh std3 CDS 2707374 2707439 . + . transcript "BG:DS07473.2" Adh std3 CDS 2707509 2708522 . + . transcript "BG:DS07473.2" # # ### ### # # Adh std3 start_codon 2698208 2698210 . - . transcript "PRL-1" Adh std3 stop_codon 2696335 2696337 . - . transcript "PRL-1" Adh std3 CDS 2696335 2696446 . - . transcript "PRL-1" Adh std3 CDS 2696513 2696644 . - . transcript "PRL-1" Adh std3 CDS 2697862 2698028 . - . transcript "PRL-1" Adh std3 CDS 2698091 2698210 . - . transcript "PRL-1" # # ### ### # # Adh std3 start_codon 2683427 2683429 . + . transcript "BG:DS07473.1" Adh std3 stop_codon 2694717 2694719 . + . transcript "BG:DS07473.1" Adh std3 CDS 2683427 2683473 . + . transcript "BG:DS07473.1" Adh std3 CDS 2684880 2686209 . + . transcript "BG:DS07473.1" Adh std3 CDS 2686394 2686570 . + . transcript "BG:DS07473.1" Adh std3 CDS 2686628 2686705 . + . transcript "BG:DS07473.1" Adh std3 CDS 2686770 2687146 . + . transcript "BG:DS07473.1" Adh std3 CDS 2687211 2687359 . + . transcript "BG:DS07473.1" Adh std3 CDS 2687415 2687794 . + . transcript "BG:DS07473.1" Adh std3 CDS 2687988 2688204 . + . transcript "BG:DS07473.1" Adh std3 CDS 2688462 2688883 . + . transcript "BG:DS07473.1" Adh std3 CDS 2691203 2694219 . + . transcript "BG:DS07473.1" Adh std3 CDS 2694277 2694414 . + . transcript "BG:DS07473.1" Adh std3 CDS 2694479 2694719 . + . transcript "BG:DS07473.1" # # ### ### # # Adh std3 start_codon 2855180 2855182 . - . transcript "BG:DS02780.1" Adh std3 stop_codon 2849759 2849761 . - . transcript "BG:DS02780.1" Adh std3 CDS 2849759 2849784 . - . transcript "BG:DS02780.1" Adh std3 CDS 2853744 2854099 . - . transcript "BG:DS02780.1" Adh std3 CDS 2854197 2855182 . - . transcript "BG:DS02780.1" # # ### ### # # Adh std3 start_codon 2894587 2894589 . + . transcript "Idgf1" Adh std3 stop_codon 2895975 2895977 . + . transcript "Idgf1" Adh std3 CDS 2894587 2895247 . + . transcript "Idgf1" Adh std3 CDS 2895319 2895977 . + . transcript "Idgf1" # # ### ### # # Adh std3 start_codon 2896655 2896657 . + . transcript "Idgf2" Adh std3 stop_codon 2899714 2899716 . + . transcript "Idgf2" Adh std3 CDS 2896655 2896763 . + . transcript "Idgf2" Adh std3 CDS 2898444 2899001 . + . transcript "Idgf2" Adh std3 CDS 2899061 2899716 . + . transcript "Idgf2" # # ### ### # # Adh std3 start_codon 2900448 2900450 . + . transcript "Idgf3" Adh std3 stop_codon 2902105 2902107 . + . transcript "Idgf3" Adh std3 CDS 2900448 2900565 . + . transcript "Idgf3" Adh std3 CDS 2900634 2901185 . + . transcript "Idgf3" Adh std3 CDS 2901452 2902107 . + . transcript "Idgf3" # # ### ### # # Adh std3 start_codon 1152128 1152130 . + . transcript "BG:DS07721.1" Adh std3 stop_codon 1152383 1152385 . + . transcript "BG:DS07721.1" Adh std3 CDS 1152128 1152385 . + . transcript "BG:DS07721.1" # # ### ### # # Adh std3 start_codon 1205439 1205441 . + . transcript "BG:DS07721.3" Adh std3 stop_codon 1213323 1213325 . + . transcript "BG:DS07721.3" Adh std3 CDS 1205439 1205597 . + . transcript "BG:DS07721.3" Adh std3 CDS 1206614 1206790 . + . transcript "BG:DS07721.3" Adh std3 CDS 1207666 1207906 . + . transcript "BG:DS07721.3" Adh std3 CDS 1209000 1209064 . + . transcript "BG:DS07721.3" Adh std3 CDS 1211030 1211110 . + . transcript "BG:DS07721.3" Adh std3 CDS 1213212 1213325 . + . transcript "BG:DS07721.3" # # ### ### # # Adh std3 start_codon 1225740 1225742 . - . transcript "BG:DS07721.6" Adh std3 stop_codon 1216389 1216391 . - . transcript "BG:DS07721.6" Adh std3 CDS 1216389 1216489 . - . transcript "BG:DS07721.6" Adh std3 CDS 1218654 1220253 . - . transcript "BG:DS07721.6" Adh std3 CDS 1220453 1221762 . - . transcript "BG:DS07721.6" Adh std3 CDS 1222288 1222395 . - . transcript "BG:DS07721.6" Adh std3 CDS 1222483 1223742 . - . transcript "BG:DS07721.6" Adh std3 CDS 1225056 1225291 . - . transcript "BG:DS07721.6" Adh std3 CDS 1225603 1225742 . - . transcript "BG:DS07721.6" # # ### ### # # Adh std3 start_codon 498520 498522 . + . transcript "BG:DS01514.3" Adh std3 stop_codon 507579 507581 . + . transcript "BG:DS01514.3" Adh std3 CDS 498520 498979 . + . transcript "BG:DS01514.3" Adh std3 CDS 499082 499159 . + . transcript "BG:DS01514.3" Adh std3 CDS 499280 499563 . + . transcript "BG:DS01514.3" Adh std3 CDS 507216 507581 . + . transcript "BG:DS01514.3" # # ### ### # # Adh std3 start_codon 473959 473961 . + . transcript "BG:DS00180.14" Adh std3 stop_codon 476387 476389 . + . transcript "BG:DS00180.14" Adh std3 CDS 473959 474023 . + . transcript "BG:DS00180.14" Adh std3 CDS 474365 475283 . + . transcript "BG:DS00180.14" Adh std3 CDS 475427 476389 . + . transcript "BG:DS00180.14" # # ### ### # # Adh std3 start_codon 471109 471111 . + . transcript "BG:DS00180.11" Adh std3 stop_codon 473126 473128 . + . transcript "BG:DS00180.11" Adh std3 CDS 471109 471296 . + . transcript "BG:DS00180.11" Adh std3 CDS 471441 471687 . + . transcript "BG:DS00180.11" Adh std3 CDS 471752 471856 . + . transcript "BG:DS00180.11" Adh std3 CDS 471944 472490 . + . transcript "BG:DS00180.11" Adh std3 CDS 472557 472823 . + . transcript "BG:DS00180.11" Adh std3 CDS 472965 473128 . + . transcript "BG:DS00180.11" # # ### ### # # Adh std3 start_codon 470436 470438 . - . transcript "BG:DS00180.10" Adh std3 stop_codon 467979 467981 . - . transcript "BG:DS00180.10" Adh std3 CDS 467979 469628 . - . transcript "BG:DS00180.10" Adh std3 CDS 470226 470438 . - . transcript "BG:DS00180.10" # # ### ### # # Adh std3 start_codon 464308 464310 . + . transcript "BG:DS00180.9" Adh std3 stop_codon 465432 465434 . + . transcript "BG:DS00180.9" Adh std3 CDS 464308 464615 . + . transcript "BG:DS00180.9" Adh std3 CDS 464888 465434 . + . transcript "BG:DS00180.9" # # ### ### # # Adh std3 start_codon 463655 463657 . - . transcript "BG:DS00180.8" Adh std3 stop_codon 462092 462094 . - . transcript "BG:DS00180.8" Adh std3 CDS 462092 462584 . - . transcript "BG:DS00180.8" Adh std3 CDS 462646 463209 . - . transcript "BG:DS00180.8" Adh std3 CDS 463368 463657 . - . transcript "BG:DS00180.8" # # ### ### # # Adh std3 start_codon 460672 460674 . - . transcript "BG:DS00180.7" Adh std3 stop_codon 458837 458839 . - . transcript "BG:DS00180.7" Adh std3 CDS 458837 459146 . - . transcript "BG:DS00180.7" Adh std3 CDS 459225 459761 . - . transcript "BG:DS00180.7" Adh std3 CDS 460256 460674 . - . transcript "BG:DS00180.7" # # ### ### # # Adh std3 start_codon 457298 457300 . + . transcript "BG:DS00180.12" Adh std3 stop_codon 458800 458802 . + . transcript "BG:DS00180.12" Adh std3 CDS 457298 457488 . + . transcript "BG:DS00180.12" Adh std3 CDS 457649 458206 . + . transcript "BG:DS00180.12" Adh std3 CDS 458285 458488 . + . transcript "BG:DS00180.12" Adh std3 CDS 458547 458802 . + . transcript "BG:DS00180.12" # # ### ### # # Adh std3 start_codon 445189 445191 . + . transcript "BG:DS00180.5" Adh std3 stop_codon 456315 456317 . + . transcript "BG:DS00180.5" Adh std3 CDS 445189 445277 . + . transcript "BG:DS00180.5" Adh std3 CDS 446294 446429 . + . transcript "BG:DS00180.5" Adh std3 CDS 446732 447001 . + . transcript "BG:DS00180.5" Adh std3 CDS 448492 448607 . + . transcript "BG:DS00180.5" Adh std3 CDS 449015 449247 . + . transcript "BG:DS00180.5" Adh std3 CDS 451744 451902 . + . transcript "BG:DS00180.5" Adh std3 CDS 452734 452909 . + . transcript "BG:DS00180.5" Adh std3 CDS 455021 455702 . + . transcript "BG:DS00180.5" Adh std3 CDS 455974 456317 . + . transcript "BG:DS00180.5" # # ### ### # # Adh std3 start_codon 440848 440850 . - . transcript "BG:DS00180.3" Adh std3 stop_codon 438979 438981 . - . transcript "BG:DS00180.3" Adh std3 CDS 438979 439800 . - . transcript "BG:DS00180.3" Adh std3 CDS 440839 440850 . - . transcript "BG:DS00180.3" # # ### ### # # Adh std3 start_codon 417109 417111 . - . transcript "BG:DS00180.2" Adh std3 stop_codon 415576 415578 . - . transcript "BG:DS00180.2" Adh std3 CDS 415576 416211 . - . transcript "BG:DS00180.2" Adh std3 CDS 416276 416749 . - . transcript "BG:DS00180.2" Adh std3 CDS 417100 417111 . - . transcript "BG:DS00180.2" # # ### ### # # Adh std3 start_codon 405952 405954 . + . transcript "Acyp" Adh std3 stop_codon 406312 406314 . + . transcript "Acyp" Adh std3 CDS 405952 406314 . + . transcript "Acyp" # # ### ### # # Adh std3 start_codon 185613 185615 . - . transcript "BG:DS08249.1" Adh std3 stop_codon 172106 172108 . - . transcript "BG:DS08249.1" Adh std3 CDS 172106 172869 . - . transcript "BG:DS08249.1" Adh std3 CDS 177956 178015 . - . transcript "BG:DS08249.1" Adh std3 CDS 178136 178300 . - . transcript "BG:DS08249.1" Adh std3 CDS 179847 179900 . - . transcript "BG:DS08249.1" Adh std3 CDS 181272 181409 . - . transcript "BG:DS08249.1" Adh std3 CDS 183107 183235 . - . transcript "BG:DS08249.1" Adh std3 CDS 183341 183496 . - . transcript "BG:DS08249.1" Adh std3 CDS 183596 183635 . - . transcript "BG:DS08249.1" Adh std3 CDS 183835 184040 . - . transcript "BG:DS08249.1" Adh std3 CDS 184241 184282 . - . transcript "BG:DS08249.1" Adh std3 CDS 185558 185615 . - . transcript "BG:DS08249.1" # # ### ### # # Adh std3 start_codon 159578 159580 . + . transcript "BG:DS01368.1" Adh std3 stop_codon 163525 163527 . + . transcript "BG:DS01368.1" Adh std3 CDS 159578 159874 . + . transcript "BG:DS01368.1" Adh std3 CDS 161727 162105 . + . transcript "BG:DS01368.1" Adh std3 CDS 162442 162557 . + . transcript "BG:DS01368.1" Adh std3 CDS 162616 163137 . + . transcript "BG:DS01368.1" Adh std3 CDS 163297 163527 . + . transcript "BG:DS01368.1" # # ### ### # # Adh std3 start_codon 1233087 1233089 . + . transcript "BG:DS00810.3" Adh std3 stop_codon 1233291 1233293 . + . transcript "BG:DS00810.3" Adh std3 CDS 1233087 1233293 . + . transcript "BG:DS00810.3" # # ### ### # # Adh std3 start_codon 1231461 1231463 . - . transcript "BG:DS00810.2" Adh std3 stop_codon 1231127 1231129 . - . transcript "BG:DS00810.2" Adh std3 CDS 1231127 1231384 . - . transcript "BG:DS00810.2" Adh std3 CDS 1231452 1231463 . - . transcript "BG:DS00810.2" # # ### ### # # Adh std3 start_codon 1229684 1229686 . + . transcript "BG:DS00810.1" Adh std3 stop_codon 1230731 1230733 . + . transcript "BG:DS00810.1" Adh std3 CDS 1229684 1230733 . + . transcript "BG:DS00810.1" # # ### ### # # Adh std3 start_codon 874868 874870 . - . transcript "ppk" Adh std3 stop_codon 872557 872559 . - . transcript "ppk" Adh std3 CDS 872557 872818 . - . transcript "ppk" Adh std3 CDS 872891 873131 . - . transcript "ppk" Adh std3 CDS 873191 873321 . - . transcript "ppk" Adh std3 CDS 873388 873527 . - . transcript "ppk" Adh std3 CDS 873583 874093 . - . transcript "ppk" Adh std3 CDS 874278 874541 . - . transcript "ppk" Adh std3 CDS 874599 874870 . - . transcript "ppk" # # ### ### # # Adh std3 start_codon 901493 901495 . - . transcript "elB" Adh std3 stop_codon 880859 880861 . - . transcript "elB" Adh std3 CDS 880859 881091 . - . transcript "elB" Adh std3 CDS 883002 883191 . - . transcript "elB" Adh std3 CDS 884810 884937 . - . transcript "elB" Adh std3 CDS 885047 885736 . - . transcript "elB" Adh std3 CDS 885967 886798 . - . transcript "elB" Adh std3 CDS 888067 888286 . - . transcript "elB" Adh std3 CDS 901332 901495 . - . transcript "elB" # # ### ### # # Adh std3 start_codon 918867 918869 . - . transcript "BG:DS06238.4" Adh std3 stop_codon 918151 918153 . - . transcript "BG:DS06238.4" Adh std3 CDS 918151 918795 . - . transcript "BG:DS06238.4" Adh std3 CDS 918858 918869 . - . transcript "BG:DS06238.4" # # ### ### # # Adh std3 start_codon 853116 853118 . + . transcript "l.2.35Aa" Adh std3 stop_codon 855012 855014 . + . transcript "l.2.35Aa" Adh std3 CDS 853116 855014 . + . transcript "l.2.35Aa" # # ### ### # # Adh std3 start_codon 851085 851087 . + . transcript "Rab14" Adh std3 stop_codon 851917 851919 . + . transcript "Rab14" Adh std3 CDS 851085 851190 . + . transcript "Rab14" Adh std3 CDS 851256 851436 . + . transcript "Rab14" Adh std3 CDS 851491 851673 . + . transcript "Rab14" Adh std3 CDS 851742 851919 . + . transcript "Rab14" # # ### ### # # Adh std3 start_codon 848731 848733 . - . transcript "BG:DS01068.6" Adh std3 stop_codon 846397 846399 . - . transcript "BG:DS01068.6" Adh std3 CDS 846397 847372 . - . transcript "BG:DS01068.6" Adh std3 CDS 847433 848154 . - . transcript "BG:DS01068.6" Adh std3 CDS 848208 848609 . - . transcript "BG:DS01068.6" Adh std3 CDS 848668 848733 . - . transcript "BG:DS01068.6" # # ### ### # # Adh std3 start_codon 843514 843516 . - . transcript "BG:DS01068.5" Adh std3 stop_codon 842968 842970 . - . transcript "BG:DS01068.5" Adh std3 CDS 842968 843375 . - . transcript "BG:DS01068.5" Adh std3 CDS 843445 843516 . - . transcript "BG:DS01068.5" # # ### ### # # Adh std3 start_codon 842440 842442 . - . transcript "BG:DS01068.4" Adh std3 stop_codon 841091 841093 . - . transcript "BG:DS01068.4" Adh std3 CDS 841091 841333 . - . transcript "BG:DS01068.4" Adh std3 CDS 841389 841969 . - . transcript "BG:DS01068.4" Adh std3 CDS 842034 842442 . - . transcript "BG:DS01068.4" # # ### ### # # Adh std3 start_codon 840388 840390 . - . transcript "BG:DS01068.10" Adh std3 stop_codon 839671 839673 . - . transcript "BG:DS01068.10" Adh std3 CDS 839671 840390 . - . transcript "BG:DS01068.10" # # ### ### # # Adh std3 start_codon 835092 835094 . + . transcript "BG:DS01068.2" Adh std3 stop_codon 839074 839076 . + . transcript "BG:DS01068.2" Adh std3 CDS 835092 835312 . + . transcript "BG:DS01068.2" Adh std3 CDS 836514 837106 . + . transcript "BG:DS01068.2" Adh std3 CDS 837173 837428 . + . transcript "BG:DS01068.2" Adh std3 CDS 837486 837859 . + . transcript "BG:DS01068.2" Adh std3 CDS 837919 838152 . + . transcript "BG:DS01068.2" Adh std3 CDS 838217 839076 . + . transcript "BG:DS01068.2" # # ### ### # # Adh std3 start_codon 828047 828049 . + . transcript "BG:DS01068.11" Adh std3 stop_codon 833670 833672 . + . transcript "BG:DS01068.11" Adh std3 CDS 828047 828306 . + . transcript "BG:DS01068.11" Adh std3 CDS 832073 833672 . + . transcript "BG:DS01068.11" # # ### ### # # Adh std3 start_codon 822205 822207 . + . transcript "BG:DS01068.1" Adh std3 stop_codon 827509 827511 . + . transcript "BG:DS01068.1" Adh std3 CDS 822205 822454 . + . transcript "BG:DS01068.1" Adh std3 CDS 822511 822848 . + . transcript "BG:DS01068.1" Adh std3 CDS 822874 824011 . + . transcript "BG:DS01068.1" Adh std3 CDS 824074 824822 . + . transcript "BG:DS01068.1" Adh std3 CDS 824885 825688 . + . transcript "BG:DS01068.1" Adh std3 CDS 825804 826423 . + . transcript "BG:DS01068.1" Adh std3 CDS 826499 826653 . + . transcript "BG:DS01068.1" Adh std3 CDS 826714 826921 . + . transcript "BG:DS01068.1" Adh std3 CDS 826980 827087 . + . transcript "BG:DS01068.1" Adh std3 CDS 827148 827511 . + . transcript "BG:DS01068.1" # # ### ### # # Adh std3 start_codon 801894 801896 . + . transcript "BG:DS03792.2" Adh std3 stop_codon 804733 804735 . + . transcript "BG:DS03792.2" Adh std3 CDS 801894 802914 . + . transcript "BG:DS03792.2" Adh std3 CDS 803148 803203 . + . transcript "BG:DS03792.2" Adh std3 CDS 804010 804157 . + . transcript "BG:DS03792.2" Adh std3 CDS 804584 804735 . + . transcript "BG:DS03792.2" # # ### ### # # Adh std3 start_codon 202128 202130 . + . transcript "BG:DS08249.2" Adh std3 stop_codon 204197 204199 . + . transcript "BG:DS08249.2" Adh std3 CDS 202128 202646 . + . transcript "BG:DS08249.2" Adh std3 CDS 202700 204199 . + . transcript "BG:DS08249.2" # # ### ### # # Adh std3 start_codon 217186 217188 . - . transcript "BG:DS08249.3" Adh std3 stop_codon 213507 213509 . - . transcript "BG:DS08249.3" Adh std3 CDS 213507 213602 . - . transcript "BG:DS08249.3" Adh std3 CDS 216171 216761 . - . transcript "BG:DS08249.3" Adh std3 CDS 216820 217188 . - . transcript "BG:DS08249.3" # # ### ### # # Adh std3 start_codon 227121 227123 . + . transcript "BG:DS08249.4" Adh std3 stop_codon 230460 230462 . + . transcript "BG:DS08249.4" Adh std3 CDS 227121 227312 . + . transcript "BG:DS08249.4" Adh std3 CDS 227793 227992 . + . transcript "BG:DS08249.4" Adh std3 CDS 229661 230462 . + . transcript "BG:DS08249.4" # # ### ### # # Adh std3 start_codon 240150 240152 . - . transcript "BG:DS08249.5" Adh std3 stop_codon 230985 230987 . - . transcript "BG:DS08249.5" Adh std3 CDS 230985 231322 . - . transcript "BG:DS08249.5" Adh std3 CDS 231417 231549 . - . transcript "BG:DS08249.5" Adh std3 CDS 234442 234563 . - . transcript "BG:DS08249.5" Adh std3 CDS 235723 235990 . - . transcript "BG:DS08249.5" Adh std3 CDS 236859 236980 . - . transcript "BG:DS08249.5" Adh std3 CDS 237092 237123 . - . transcript "BG:DS08249.5" Adh std3 CDS 239944 240152 . - . transcript "BG:DS08249.5" # # ### ### # # Adh std3 start_codon 514048 514050 . - . transcript "l.2.34Fa" Adh std3 stop_codon 513238 513240 . - . transcript "l.2.34Fa" Adh std3 CDS 513238 514050 . - . transcript "l.2.34Fa" # # ### ### # # Adh std3 start_codon 944596 944598 . - . transcript "BG:DS08340.1" Adh std3 stop_codon 941115 941117 . - . transcript "BG:DS08340.1" Adh std3 CDS 941115 941176 . - . transcript "BG:DS08340.1" Adh std3 CDS 941646 941731 . - . transcript "BG:DS08340.1" Adh std3 CDS 942328 942612 . - . transcript "BG:DS08340.1" Adh std3 CDS 943030 943151 . - . transcript "BG:DS08340.1" Adh std3 CDS 944233 944598 . - . transcript "BG:DS08340.1" # # ### ### # # Adh std3 start_codon 1752778 1752780 . - . transcript "BG:DS05639.1" Adh std3 stop_codon 1747063 1747065 . - . transcript "BG:DS05639.1" Adh std3 CDS 1747065 1747238 . - . transcript "BG:DS05639.1" Adh std3 CDS 1747451 1747757 . - . transcript "BG:DS05639.1" Adh std3 CDS 1747825 1748093 . - . transcript "BG:DS05639.1" Adh std3 CDS 1748156 1748361 . - . transcript "BG:DS05639.1" Adh std3 CDS 1748434 1748590 . - . transcript "BG:DS05639.1" Adh std3 CDS 1748671 1748943 . - . transcript "BG:DS05639.1" Adh std3 CDS 1751370 1751492 . - . transcript "BG:DS05639.1" Adh std3 CDS 1751564 1751664 . - . transcript "BG:DS05639.1" Adh std3 CDS 1751722 1751956 . - . transcript "BG:DS05639.1" Adh std3 CDS 1752027 1752278 . - . transcript "BG:DS05639.1" Adh std3 CDS 1752622 1752780 . - . transcript "BG:DS05639.1" # # ### ### # # Adh std3 start_codon 2815178 2815180 . + . transcript "BG:DS09218.5" Adh std3 stop_codon 2820924 2820926 . + . transcript "BG:DS09218.5" Adh std3 CDS 2815178 2815829 . + . transcript "BG:DS09218.5" Adh std3 CDS 2815894 2816001 . + . transcript "BG:DS09218.5" Adh std3 CDS 2820072 2820194 . + . transcript "BG:DS09218.5" Adh std3 CDS 2820862 2820926 . + . transcript "BG:DS09218.5" # # ### ### # # Adh std3 start_codon 2805810 2805812 . - . transcript "BG:DS09218.4" Adh std3 stop_codon 2804442 2804444 . - . transcript "BG:DS09218.4" Adh std3 CDS 2804442 2805730 . - . transcript "BG:DS09218.4" Adh std3 CDS 2805800 2805812 . - . transcript "BG:DS09218.4" # # ### ### # # Adh std3 start_codon 2802355 2802357 . + . transcript "BG:DS09218.3" Adh std3 stop_codon 2802811 2802813 . + . transcript "BG:DS09218.3" Adh std3 CDS 2802355 2802394 . + . transcript "BG:DS09218.3" Adh std3 CDS 2802473 2802813 . + . transcript "BG:DS09218.3" # # ### ### # # Adh std3 start_codon 2798711 2798713 . - . transcript "chif" Adh std3 stop_codon 2793626 2793628 . - . transcript "chif" Adh std3 CDS 2793626 2798713 . - . transcript "chif" # # ### ### # # Adh std3 start_codon 2792599 2792601 . - . transcript "BG:DS09218.1" Adh std3 stop_codon 2791866 2791868 . - . transcript "BG:DS09218.1" Adh std3 CDS 2791866 2792011 . - . transcript "BG:DS09218.1" Adh std3 CDS 2792082 2792601 . - . transcript "BG:DS09218.1" # # ### ### # # Adh std3 start_codon 2791501 2791503 . - . transcript "BG:DS02740.19" Adh std3 stop_codon 2787421 2787423 . - . transcript "BG:DS02740.19" Adh std3 CDS 2787421 2787885 . - . transcript "BG:DS02740.19" Adh std3 CDS 2787948 2788316 . - . transcript "BG:DS02740.19" Adh std3 CDS 2788569 2788684 . - . transcript "BG:DS02740.19" Adh std3 CDS 2788808 2789082 . - . transcript "BG:DS02740.19" Adh std3 CDS 2789143 2789471 . - . transcript "BG:DS02740.19" Adh std3 CDS 2789812 2791503 . - . transcript "BG:DS02740.19" # # ### ### # # Adh std3 start_codon 2787065 2787067 . - . transcript "BG:DS02740.18" Adh std3 stop_codon 2779883 2779885 . - . transcript "BG:DS02740.18" Adh std3 CDS 2779883 2785491 . - . transcript "BG:DS02740.18" Adh std3 CDS 2785552 2786722 . - . transcript "BG:DS02740.18" Adh std3 CDS 2786999 2787067 . - . transcript "BG:DS02740.18" # # ### ### # # Adh std3 start_codon 2778340 2778342 . - . transcript "l.2.35Fe" Adh std3 stop_codon 2777390 2777392 . - . transcript "l.2.35Fe" Adh std3 CDS 2777390 2777609 . - . transcript "l.2.35Fe" Adh std3 CDS 2777672 2778342 . - . transcript "l.2.35Fe" # # ### ### # # Adh std3 start_codon 2776417 2776419 . + . transcript "anon-35F.36A" Adh std3 stop_codon 2777293 2777295 . + . transcript "anon-35F.36A" Adh std3 CDS 2776417 2777295 . + . transcript "anon-35F.36A" # # ### ### # # Adh std3 start_codon 2774285 2774287 . - . transcript "cact" Adh std3 stop_codon 2762639 2762641 . - . transcript "cact" Adh std3 CDS 2762639 2762710 . - . transcript "cact" Adh std3 CDS 2763711 2763968 . - . transcript "cact" Adh std3 CDS 2764030 2764118 . - . transcript "cact" Adh std3 CDS 2772220 2772430 . - . transcript "cact" Adh std3 CDS 2772600 2772777 . - . transcript "cact" Adh std3 CDS 2773593 2774287 . - . transcript "cact" # # ### ### # # Adh std3 start_codon 2760361 2760363 . + . transcript "fzy" Adh std3 stop_codon 2762085 2762087 . + . transcript "fzy" Adh std3 CDS 2760361 2760672 . + . transcript "fzy" Adh std3 CDS 2760766 2761087 . + . transcript "fzy" Adh std3 CDS 2761141 2762087 . + . transcript "fzy" # # ### ### # # Adh std3 start_codon 2759848 2759850 . - . transcript "cni" Adh std3 stop_codon 2759163 2759165 . - . transcript "cni" Adh std3 CDS 2759163 2759190 . - . transcript "cni" Adh std3 CDS 2759260 2759403 . - . transcript "cni" Adh std3 CDS 2759527 2759639 . - . transcript "cni" Adh std3 CDS 2759701 2759850 . - . transcript "cni" # # ### ### # # Adh std3 start_codon 2757391 2757393 . + . transcript "Sed5" Adh std3 stop_codon 2758388 2758390 . + . transcript "Sed5" Adh std3 CDS 2757391 2757589 . + . transcript "Sed5" Adh std3 CDS 2757658 2758388 . + . transcript "Sed5" # # ### ### # # Adh std3 start_codon 2756272 2756274 . - . transcript "anon-35Fa" Adh std3 stop_codon 2755219 2755221 . - . transcript "anon-35Fa" Adh std3 CDS 2755219 2755580 . - . transcript "anon-35Fa" Adh std3 CDS 2755775 2755883 . - . transcript "anon-35Fa" Adh std3 CDS 2755954 2756092 . - . transcript "anon-35Fa" Adh std3 CDS 2756201 2756274 . - . transcript "anon-35Fa" # # ### ### # # Adh std3 start_codon 2752612 2752614 . + . transcript "BG:DS02740.10" Adh std3 stop_codon 2754737 2754739 . + . transcript "BG:DS02740.10" Adh std3 CDS 2752612 2752742 . + . transcript "BG:DS02740.10" Adh std3 CDS 2752822 2752985 . + . transcript "BG:DS02740.10" Adh std3 CDS 2753042 2753322 . + . transcript "BG:DS02740.10" Adh std3 CDS 2753382 2753565 . + . transcript "BG:DS02740.10" Adh std3 CDS 2753620 2753995 . + . transcript "BG:DS02740.10" Adh std3 CDS 2754057 2754364 . + . transcript "BG:DS02740.10" Adh std3 CDS 2754423 2754557 . + . transcript "BG:DS02740.10" Adh std3 CDS 2754615 2754739 . + . transcript "BG:DS02740.10" # # ### ### # # Adh std3 start_codon 2752031 2752033 . - . transcript "BG:DS02740.9" Adh std3 stop_codon 2751337 2751339 . - . transcript "BG:DS02740.9" Adh std3 CDS 2751337 2751465 . - . transcript "BG:DS02740.9" Adh std3 CDS 2751521 2751711 . - . transcript "BG:DS02740.9" Adh std3 CDS 2751778 2751871 . - . transcript "BG:DS02740.9" Adh std3 CDS 2752031 2752033 . - . transcript "BG:DS02740.9" # # ### ### # # Adh std3 start_codon 2749571 2749573 . + . transcript "BG:DS02740.8" Adh std3 stop_codon 2750866 2750868 . + . transcript "BG:DS02740.8" Adh std3 CDS 2749571 2749699 . + . transcript "BG:DS02740.8" Adh std3 CDS 2749753 2750868 . + . transcript "BG:DS02740.8" # # ### ### # # Adh std3 start_codon 2748570 2748572 . - . transcript "heix" Adh std3 stop_codon 2746815 2746817 . - . transcript "heix" Adh std3 CDS 2746815 2747453 . - . transcript "heix" Adh std3 CDS 2748132 2748572 . - . transcript "heix" # # ### ### # # Adh std3 start_codon 2743611 2743613 . + . transcript "l.2.35Fb" Adh std3 stop_codon 2745120 2745122 . + . transcript "l.2.35Fb" Adh std3 CDS 2743611 2745122 . + . transcript "l.2.35Fb" # # ### ### # # Adh std3 start_codon 2740542 2740544 . + . transcript "BG:DS02740.5" Adh std3 stop_codon 2741088 2741090 . + . transcript "BG:DS02740.5" Adh std3 CDS 2740542 2741090 . + . transcript "BG:DS02740.5" # # ### ### # # Adh std3 start_codon 2737704 2737706 . + . transcript "BG:DS02740.4" Adh std3 stop_codon 2740037 2740039 . + . transcript "BG:DS02740.4" Adh std3 CDS 2737704 2737731 . + . transcript "BG:DS02740.4" Adh std3 CDS 2737860 2738132 . + . transcript "BG:DS02740.4" Adh std3 CDS 2738403 2739461 . + . transcript "BG:DS02740.4" Adh std3 CDS 2739531 2740039 . + . transcript "BG:DS02740.4" # # ### ### # # Adh std3 start_codon 2736447 2736449 . - . transcript "crp" Adh std3 stop_codon 2714362 2714364 . - . transcript "crp" Adh std3 CDS 2714362 2714383 . - . transcript "crp" Adh std3 CDS 2714899 2716277 . - . transcript "crp" Adh std3 CDS 2728123 2728429 . - . transcript "crp" Adh std3 CDS 2736358 2736449 . - . transcript "crp" # # ### ### # # Adh std3 start_codon 2711460 2711462 . + . transcript "BG:DS02740.2" Adh std3 stop_codon 2712644 2712646 . + . transcript "BG:DS02740.2" Adh std3 CDS 2711460 2711538 . + . transcript "BG:DS02740.2" Adh std3 CDS 2711599 2711717 . + . transcript "BG:DS02740.2" Adh std3 CDS 2711781 2711853 . + . transcript "BG:DS02740.2" Adh std3 CDS 2711910 2712440 . + . transcript "BG:DS02740.2" Adh std3 CDS 2712522 2712646 . + . transcript "BG:DS02740.2" # # ### ### # # Adh std3 start_codon 2710763 2710765 . - . transcript "twe" Adh std3 stop_codon 2709485 2709487 . - . transcript "twe" Adh std3 CDS 2709485 2710765 . - . transcript "twe" # # ### ### # # Adh std3 start_codon 397669 397671 . - . transcript "anon-34Ea" Adh std3 stop_codon 393573 393575 . - . transcript "anon-34Ea" Adh std3 CDS 393573 393814 . - . transcript "anon-34Ea" Adh std3 CDS 393894 394052 . - . transcript "anon-34Ea" Adh std3 CDS 394383 395732 . - . transcript "anon-34Ea" Adh std3 CDS 395826 397468 . - . transcript "anon-34Ea" Adh std3 CDS 397532 397671 . - . transcript "anon-34Ea" # # ### ### # # Adh std3 start_codon 1988872 1988874 . + . transcript "lace" Adh std3 stop_codon 1993564 1993566 . + . transcript "lace" Adh std3 CDS 1988872 1989075 . + . transcript "lace" Adh std3 CDS 1991768 1992877 . + . transcript "lace" Adh std3 CDS 1992942 1993204 . + . transcript "lace" Adh std3 CDS 1993350 1993566 . + . transcript "lace" # # ### ### # # Adh std3 start_codon 1974488 1974490 . + . transcript "Tim17" Adh std3 stop_codon 1983853 1983855 . + . transcript "Tim17" Adh std3 CDS 1974488 1974989 . + . transcript "Tim17" Adh std3 CDS 1975874 1976154 . + . transcript "Tim17" Adh std3 CDS 1980350 1980517 . + . transcript "Tim17" Adh std3 CDS 1983142 1983399 . + . transcript "Tim17" Adh std3 CDS 1983628 1983855 . + . transcript "Tim17" # # ### ### # # Adh std3 start_codon 1967756 1967758 . - . transcript "sna" Adh std3 stop_codon 1966586 1966588 . - . transcript "sna" Adh std3 CDS 1966586 1967758 . - . transcript "sna" # # ### ### # # Adh std3 start_codon 2236081 2236083 . + . transcript "BG:DS02252.3" Adh std3 stop_codon 2241874 2241876 . + . transcript "BG:DS02252.3" Adh std3 CDS 2236081 2241876 . + . transcript "BG:DS02252.3" # # ### ### # # Adh std3 start_codon 2287431 2287433 . - . transcript "BG:DS02252.4" Adh std3 stop_codon 2286435 2286437 . - . transcript "BG:DS02252.4" Adh std3 CDS 2286435 2287433 . - . transcript "BG:DS02252.4" # # ### ### # # Adh std3 start_codon 2303448 2303450 . + . transcript "BG:DS02252.1" Adh std3 stop_codon 2304639 2304641 . + . transcript "BG:DS02252.1" Adh std3 CDS 2303448 2304641 . + . transcript "BG:DS02252.1" # # ### ### # # Adh std3 start_codon 1149062 1149064 . - . transcript "BG:DS09219.1" Adh std3 stop_codon 1146799 1146801 . - . transcript "BG:DS09219.1" Adh std3 CDS 1146799 1147106 . - . transcript "BG:DS09219.1" Adh std3 CDS 1147866 1148064 . - . transcript "BG:DS09219.1" Adh std3 CDS 1148478 1148530 . - . transcript "BG:DS09219.1" Adh std3 CDS 1148830 1149064 . - . transcript "BG:DS09219.1" # # ### ### # # Adh std3 start_codon 1414397 1414399 . + . transcript "BG:DS03323.1" Adh std3 stop_codon 1419916 1419918 . + . transcript "BG:DS03323.1" Adh std3 CDS 1414397 1418081 . + . transcript "BG:DS03323.1" Adh std3 CDS 1418142 1419321 . + . transcript "BG:DS03323.1" Adh std3 CDS 1419378 1419918 . + . transcript "BG:DS03323.1" # # ### ### # # Adh std3 start_codon 2428833 2428835 . + . transcript "BG:DS07486.2" Adh std3 stop_codon 2429379 2429381 . + . transcript "BG:DS07486.2" Adh std3 CDS 2428833 2429381 . + . transcript "BG:DS07486.2" # # ### ### # # Adh std3 start_codon 2398367 2398369 . + . transcript "BG:DS07486.5" Adh std3 stop_codon 2410392 2410394 . + . transcript "BG:DS07486.5" Adh std3 CDS 2398367 2398380 . + . transcript "BG:DS07486.5" Adh std3 CDS 2406425 2406634 . + . transcript "BG:DS07486.5" Adh std3 CDS 2407447 2407845 . + . transcript "BG:DS07486.5" Adh std3 CDS 2407960 2408288 . + . transcript "BG:DS07486.5" Adh std3 CDS 2410246 2410394 . + . transcript "BG:DS07486.5" # # ### ### # # Adh std3 start_codon 2392181 2392183 . + . transcript "BG:DS07486.4" Adh std3 stop_codon 2395321 2395323 . + . transcript "BG:DS07486.4" Adh std3 CDS 2392181 2392737 . + . transcript "BG:DS07486.4" Adh std3 CDS 2392800 2393095 . + . transcript "BG:DS07486.4" Adh std3 CDS 2393155 2393333 . + . transcript "BG:DS07486.4" Adh std3 CDS 2395174 2395323 . + . transcript "BG:DS07486.4" # # ### ### # # Adh std3 start_codon 2374085 2374087 . + . transcript "BG:DS07486.3" Adh std3 stop_codon 2376715 2376717 . + . transcript "BG:DS07486.3" Adh std3 CDS 2374085 2374294 . + . transcript "BG:DS07486.3" Adh std3 CDS 2374356 2376450 . + . transcript "BG:DS07486.3" Adh std3 CDS 2376677 2376717 . + . transcript "BG:DS07486.3" # # ### ### # # Adh std3 start_codon 1338783 1338785 . - . transcript "BG:DS03431.1" Adh std3 stop_codon 1334780 1334782 . - . transcript "BG:DS03431.1" Adh std3 CDS 1334780 1335024 . - . transcript "BG:DS03431.1" Adh std3 CDS 1335080 1335356 . - . transcript "BG:DS03431.1" Adh std3 CDS 1335416 1336157 . - . transcript "BG:DS03431.1" Adh std3 CDS 1336453 1336680 . - . transcript "BG:DS03431.1" Adh std3 CDS 1337668 1338007 . - . transcript "BG:DS03431.1" Adh std3 CDS 1338337 1338640 . - . transcript "BG:DS03431.1" Adh std3 CDS 1338702 1338785 . - . transcript "BG:DS03431.1" # # ### ### # # Adh std3 start_codon 1369280 1369282 . - . transcript "Mst35Ba" Adh std3 stop_codon 1368793 1368795 . - . transcript "Mst35Ba" Adh std3 CDS 1368793 1368852 . - . transcript "Mst35Ba" Adh std3 CDS 1368902 1369282 . - . transcript "Mst35Ba" # # ### ### # # Adh std3 start_codon 1372349 1372351 . - . transcript "Mst35Bb" Adh std3 stop_codon 1371813 1371815 . - . transcript "Mst35Bb" Adh std3 CDS 1371813 1371921 . - . transcript "Mst35Bb" Adh std3 CDS 1372020 1372351 . - . transcript "Mst35Bb" # # ### ### # # Adh std3 start_codon 1413065 1413067 . - . transcript "BG:DS03144.1" Adh std3 stop_codon 1398183 1398185 . - . transcript "BG:DS03144.1" Adh std3 CDS 1398183 1398833 . - . transcript "BG:DS03144.1" Adh std3 CDS 1401633 1401874 . - . transcript "BG:DS03144.1" Adh std3 CDS 1402535 1402643 . - . transcript "BG:DS03144.1" Adh std3 CDS 1402808 1402995 . - . transcript "BG:DS03144.1" Adh std3 CDS 1403930 1404111 . - . transcript "BG:DS03144.1" Adh std3 CDS 1405762 1405903 . - . transcript "BG:DS03144.1" Adh std3 CDS 1406801 1406882 . - . transcript "BG:DS03144.1" Adh std3 CDS 1407035 1407146 . - . transcript "BG:DS03144.1" Adh std3 CDS 1408830 1408932 . - . transcript "BG:DS03144.1" Adh std3 CDS 1411600 1411759 . - . transcript "BG:DS03144.1" Adh std3 CDS 1412611 1412741 . - . transcript "BG:DS03144.1" Adh std3 CDS 1413022 1413067 . - . transcript "BG:DS03144.1" # # ### ### # # Adh std3 start_codon 1111283 1111285 . + . transcript "Adhr" Adh std3 stop_codon 1112575 1112577 . + . transcript "Adhr" Adh std3 CDS 1111283 1111378 . + . transcript "Adhr" Adh std3 CDS 1111805 1112209 . + . transcript "Adhr" Adh std3 CDS 1112231 1112575 . + . transcript "Adhr" # # ### ### # # Adh std3 start_codon 1110074 1110076 . + . transcript "Adh" Adh std3 stop_codon 1110976 1110978 . + . transcript "Adh" Adh std3 CDS 1110074 1110172 . + . transcript "Adh" Adh std3 CDS 1110241 1110642 . + . transcript "Adh" Adh std3 CDS 1110713 1110976 . + . transcript "Adh" # # ### ### # # Adh std3 start_codon 1098516 1098518 . - . transcript "osp-LD14119" Adh std3 stop_codon 1094605 1094607 . - . transcript "osp-LD14119" Adh std3 CDS 1094605 1094610 . - . transcript "osp-LD14119" Adh std3 CDS 1095422 1095533 . - . transcript "osp-LD14119" Adh std3 CDS 1095586 1095735 . - . transcript "osp-LD14119" Adh std3 CDS 1095848 1095987 . - . transcript "osp-LD14119" Adh std3 CDS 1096062 1096196 . - . transcript "osp-LD14119" Adh std3 CDS 1096326 1098518 . - . transcript "osp-LD14119" # # ### ### # # Adh std3 start_codon 1057312 1057314 . - . transcript "BG:DS01486.1" Adh std3 stop_codon 1051748 1051750 . - . transcript "BG:DS01486.1" Adh std3 CDS 1051748 1051953 . - . transcript "BG:DS01486.1" Adh std3 CDS 1056915 1057314 . - . transcript "BG:DS01486.1" # # ### ### # # Adh std3 start_codon 855885 855887 . + . transcript "spel1" Adh std3 stop_codon 858964 858966 . + . transcript "spel1" Adh std3 CDS 855885 855923 . + . transcript "spel1" Adh std3 CDS 855983 855997 . + . transcript "spel1" Adh std3 CDS 855999 856031 . + . transcript "spel1" Adh std3 CDS 856092 856876 . + . transcript "spel1" Adh std3 CDS 856942 858028 . + . transcript "spel1" Adh std3 CDS 858108 858341 . + . transcript "spel1" Adh std3 CDS 858346 858966 . + . transcript "spel1" # # ### ### # # Adh std3 start_codon 2199762 2199764 . - . transcript "CycE-type2" Adh std3 stop_codon 2182498 2182500 . - . transcript "CycE-type2" Adh std3 CDS 2182500 2182662 . - . transcript "CycE-type2" Adh std3 CDS 2189454 2189790 . - . transcript "CycE-type2" Adh std3 CDS 2192599 2192735 . - . transcript "CycE-type2" Adh std3 CDS 2199660 2199764 . - . transcript "CycE-type2" # # ### ### # # Adh std3 start_codon 2918518 2918520 . - . transcript "dac-3prime" Adh std3 stop_codon 2916879 2916881 . - . transcript "dac-3prime" Adh std3 CDS 2916879 2917012 . - . transcript "dac-3prime" Adh std3 CDS 2917311 2917504 . - . transcript "dac-3prime" Adh std3 CDS 2917751 2917988 . - . transcript "dac-3prime" Adh std3 CDS 2918253 2918520 . - . transcript "dac-3prime" # # ### ### # # Adh std3 start_codon 1558057 1558059 . + . transcript "vas" Adh std3 stop_codon 1563812 1563814 . + . transcript "vas" Adh std3 CDS 1558057 1558080 . + . transcript "vas" Adh std3 CDS 1558134 1558526 . + . transcript "vas" Adh std3 CDS 1561988 1562050 . + . transcript "vas" Adh std3 CDS 1562027 1562278 . + . transcript "vas" Adh std3 CDS 1562338 1563081 . + . transcript "vas" Adh std3 CDS 1563140 1563353 . + . transcript "vas" Adh std3 CDS 1563418 1563689 . + . transcript "vas" Adh std3 CDS 1563761 1563814 . + . transcript "vas" # # ### ### # # Adh std3 start_codon 2390106 2390108 . - . transcript "beat-B" Adh std3 stop_codon 2356352 2356354 . - . transcript "beat-B" Adh std3 CDS 2356352 2356488 . - . transcript "beat-B" Adh std3 CDS 2356993 2357164 . - . transcript "beat-B" Adh std3 CDS 2357224 2357480 . - . transcript "beat-B" Adh std3 CDS 2357539 2357674 . - . transcript "beat-B" Adh std3 CDS 2358742 2358950 . - . transcript "beat-B" Adh std3 CDS 2390039 2390108 . - . transcript "beat-B" # # ### ### # # Adh std3 start_codon 2463394 2463396 . + . transcript "beat-C" Adh std3 stop_codon 2488787 2488789 . + . transcript "beat-C" Adh std3 CDS 2463394 2463547 . + . transcript "beat-C" Adh std3 CDS 2481639 2481850 . + . transcript "beat-C" Adh std3 CDS 2483447 2483582 . + . transcript "beat-C" Adh std3 CDS 2483839 2483972 . + . transcript "beat-C" Adh std3 CDS 2486400 2486522 . + . transcript "beat-C" Adh std3 CDS 2486596 2486785 . + . transcript "beat-C" Adh std3 CDS 2488134 2488789 . + . transcript "beat-C" # # ### ### # # Adh std3 start_codon 1182413 1182415 . - . transcript "osp" Adh std3 stop_codon 1094414 1094416 . - . transcript "osp" Adh std3 CDS 1094414 1094610 . - . transcript "osp" Adh std3 CDS 1094867 1095215 . - . transcript "osp" Adh std3 CDS 1095422 1095533 . - . transcript "osp" Adh std3 CDS 1095586 1095735 . - . transcript "osp" Adh std3 CDS 1095848 1095987 . - . transcript "osp" Adh std3 CDS 1096062 1096196 . - . transcript "osp" Adh std3 CDS 1096326 1098979 . - . transcript "osp" Adh std3 CDS 1104419 1104995 . - . transcript "osp" Adh std3 CDS 1105586 1105651 . - . transcript "osp" Adh std3 CDS 1129815 1129900 . - . transcript "osp" Adh std3 CDS 1182202 1182415 . - . transcript "osp" # # ### ### # # Adh std3 start_codon 691414 691416 . - . transcript "smi35A" Adh std3 stop_codon 679874 679876 . - . transcript "smi35A" Adh std3 CDS 679874 680889 . - . transcript "smi35A" Adh std3 CDS 682600 682771 . - . transcript "smi35A" Adh std3 CDS 682831 682969 . - . transcript "smi35A" Adh std3 CDS 689469 689746 . - . transcript "smi35A" Adh std3 CDS 689811 689983 . - . transcript "smi35A" Adh std3 CDS 690663 691029 . - . transcript "smi35A" Adh std3 CDS 691393 691416 . - . transcript "smi35A" # # ### ### # # Adh std3 start_codon 373286 373288 . + . transcript "BG:DS08220.1" Adh std3 stop_codon 391498 391500 . + . transcript "BG:DS08220.1" Adh std3 CDS 373286 373457 . + . transcript "BG:DS08220.1" Adh std3 CDS 385048 385283 . + . transcript "BG:DS08220.1" Adh std3 CDS 388780 388921 . + . transcript "BG:DS08220.1" Adh std3 CDS 389006 389140 . + . transcript "BG:DS08220.1" Adh std3 CDS 389208 390491 . + . transcript "BG:DS08220.1" Adh std3 CDS 390556 390673 . + . transcript "BG:DS08220.1" Adh std3 CDS 390737 391112 . + . transcript "BG:DS08220.1" Adh std3 CDS 391177 391500 . + . transcript "BG:DS08220.1" # # ### ### # # Adh std3 start_codon 509545 509547 . + . transcript "BG:DS01514.2" Adh std3 stop_codon 512756 512758 . + . transcript "BG:DS01514.2" Adh std3 CDS 509545 509783 . + . transcript "BG:DS01514.2" Adh std3 CDS 509881 510226 . + . transcript "BG:DS01514.2" Adh std3 CDS 510287 510786 . + . transcript "BG:DS01514.2" Adh std3 CDS 511784 512375 . + . transcript "BG:DS01514.2" Adh std3 CDS 512435 512758 . + . transcript "BG:DS01514.2" # # ### ### # # Adh std3 start_codon 1473633 1473635 . - . transcript "BG:DS01219.1" Adh std3 stop_codon 1465977 1465979 . - . transcript "BG:DS01219.1" Adh std3 CDS 1465977 1466019 . - . transcript "BG:DS01219.1" Adh std3 CDS 1466153 1466744 . - . transcript "BG:DS01219.1" Adh std3 CDS 1466876 1467307 . - . transcript "BG:DS01219.1" Adh std3 CDS 1473611 1473635 . - . transcript "BG:DS01219.1" # # ### ### # # Adh std3 start_codon 400338 400340 . + . transcript "Ance" Adh std3 stop_codon 402858 402860 . + . transcript "Ance" Adh std3 CDS 400338 400922 . + . transcript "Ance" Adh std3 CDS 401343 401713 . + . transcript "Ance" Adh std3 CDS 401775 402341 . + . transcript "Ance" Adh std3 CDS 402399 402539 . + . transcript "Ance" Adh std3 CDS 402607 402779 . + . transcript "Ance" Adh std3 CDS 402844 402860 . + . transcript "Ance" # # ### ### # # Adh std3 start_codon 7016 7018 . - . transcript "B4-5prime" Adh std3 stop_codon -1 1 . - . transcript "B4-5prime" Adh std3 CDS 1 441 . - . transcript "B4-5prime" Adh std3 CDS 2379 2862 . - . transcript "B4-5prime" Adh std3 CDS 3225 3550 . - . transcript "B4-5prime" Adh std3 CDS 6718 7018 . - . transcript "B4-5prime" # # ### ### # # Adh std3 start_codon 757457 757459 . + . transcript "wb" Adh std3 stop_codon 821485 821487 . + . transcript "wb" Adh std3 CDS 757457 757859 . + . transcript "wb" Adh std3 CDS 771955 772295 . + . transcript "wb" Adh std3 CDS 779692 781583 . + . transcript "wb" Adh std3 CDS 781886 782694 . + . transcript "wb" Adh std3 CDS 813291 814650 . + . transcript "wb" Adh std3 CDS 814726 814981 . + . transcript "wb" Adh std3 CDS 815046 815442 . + . transcript "wb" Adh std3 CDS 815528 817215 . + . transcript "wb" Adh std3 CDS 817273 818025 . + . transcript "wb" Adh std3 CDS 818086 818367 . + . transcript "wb" Adh std3 CDS 818447 818574 . + . transcript "wb" Adh std3 CDS 818633 819290 . + . transcript "wb" Adh std3 CDS 820171 820789 . + . transcript "wb" Adh std3 CDS 820846 820979 . + . transcript "wb" Adh std3 CDS 821037 821265 . + . transcript "wb" Adh std3 CDS 821333 821487 . + . transcript "wb" # # ### ### # # Adh std3 start_codon 487234 487236 . - . transcript "rk" Adh std3 stop_codon 477171 477173 . - . transcript "rk" Adh std3 CDS 477171 477490 . - . transcript "rk" Adh std3 CDS 477548 479329 . - . transcript "rk" Adh std3 CDS 479386 479783 . - . transcript "rk" Adh std3 CDS 479815 479958 . - . transcript "rk" Adh std3 CDS 480147 480287 . - . transcript "rk" Adh std3 CDS 480343 480480 . - . transcript "rk" Adh std3 CDS 481570 481638 . - . transcript "rk" Adh std3 CDS 483386 483457 . - . transcript "rk" Adh std3 CDS 484195 484338 . - . transcript "rk" Adh std3 CDS 484664 484806 . - . transcript "rk" Adh std3 CDS 486685 487236 . - . transcript "rk" # # ### # # compfly: 1. Only grailexp CDSes extracted Jul 5 (MR) # 2. grailexp "exons" renamed to "CDS" Jul 5 (MR) # Adh grailexp CDS 2 441 0.97 - 2 transcript "286" Adh grailexp CDS 2379 2862 0.99 - 0 transcript "286" Adh grailexp CDS 3225 3550 0.99 - 2 transcript "286" Adh grailexp CDS 6718 7051 0.10 - 0 transcript "286" Adh grailexp CDS 10137 10220 0.24 - 2 transcript "285" Adh grailexp CDS 12308 12333 0.14 - 2 transcript "285" Adh grailexp CDS 28665 28784 1.00 - 0 transcript "285" Adh grailexp CDS 40669 40919 1.00 - 0 transcript "285" Adh grailexp CDS 41509 41534 0.88 - 1 transcript "285" Adh grailexp CDS 43919 44175 0.93 + 1 transcript "1" Adh grailexp CDS 50851 50863 0.23 + 0 transcript "2" Adh grailexp CDS 52555 52587 0.92 + 0 transcript "2" Adh grailexp CDS 103543 103739 1.00 + 2 transcript "2" Adh grailexp CDS 103808 104330 0.99 + 0 transcript "2" Adh grailexp CDS 124458 124936 0.96 + 2 transcript "2" Adh grailexp CDS 127146 127292 0.99 + 2 transcript "2" Adh grailexp CDS 127771 127931 0.94 + 1 transcript "2" Adh grailexp CDS 127991 128225 0.98 + 2 transcript "2" Adh grailexp CDS 128296 129342 1.08 + 2 transcript "2" Adh grailexp CDS 129401 129965 0.95 + 0 transcript "2" Adh grailexp CDS 130136 130595 0.99 + 1 transcript "2" Adh grailexp CDS 130996 131248 0.25 + 2 transcript "2" Adh grailexp CDS 133608 134233 0.96 - 2 transcript "284" Adh grailexp CDS 134862 134967 0.90 - 0 transcript "284" Adh grailexp CDS 144038 144192 0.44 - 0 transcript "283" Adh grailexp CDS 152142 152293 0.11 - 1 transcript "283" Adh grailexp CDS 159578 160063 0.39 + 2 transcript "3" Adh grailexp CDS 161881 162105 0.45 + 2 transcript "4" Adh grailexp CDS 162442 162557 0.47 + 2 transcript "4" Adh grailexp CDS 162616 163137 0.91 + 2 transcript "4" Adh grailexp CDS 164190 164417 0.84 + 2 transcript "4" Adh grailexp CDS 165423 165438 0.27 + 0 transcript "5" Adh grailexp CDS 172385 172503 0.01 + 2 transcript "5" Adh grailexp CDS 177956 178015 0.46 - 0 transcript "282" Adh grailexp CDS 178136 178300 0.09 - 0 transcript "282" Adh grailexp CDS 181272 181409 0.47 - 0 transcript "282" Adh grailexp CDS 182855 182865 0.39 - 1 transcript "282" Adh grailexp CDS 183099 183496 0.15 - 2 transcript "281" Adh grailexp CDS 183596 183635 0.47 - 0 transcript "281" Adh grailexp CDS 183699 183764 0.47 - 2 transcript "281" Adh grailexp CDS 183835 184040 0.47 - 2 transcript "281" Adh grailexp CDS 184241 184282 0.47 - 0 transcript "281" Adh grailexp CDS 197142 197159 0.00 + 2 transcript "6" Adh grailexp CDS 198043 198089 0.00 + 1 transcript "6" Adh grailexp CDS 199993 200101 0.14 + 2 transcript "6" Adh grailexp CDS 202128 202655 0.40 + 2 transcript "7" Adh grailexp CDS 203783 204199 0.18 + 2 transcript "8" Adh grailexp CDS 207689 207889 0.23 - 2 transcript "280" Adh grailexp CDS 216144 216781 0.35 - 2 transcript "279" Adh grailexp CDS 216896 217226 0.98 - 0 transcript "279" Adh grailexp CDS 224554 224563 0.42 + 0 transcript "9" Adh grailexp CDS 228521 228608 0.01 + 1 transcript "9" Adh grailexp CDS 229799 230462 0.41 + 2 transcript "9" Adh grailexp CDS 233922 233943 0.04 + 0 transcript "10" Adh grailexp CDS 235893 235948 0.40 + 2 transcript "10" Adh grailexp CDS 236671 236983 0.38 + 0 transcript "11" Adh grailexp CDS 240124 240236 0.13 + 2 transcript "11" Adh grailexp CDS 260540 260687 0.27 + 0 transcript "12" Adh grailexp CDS 264891 264997 0.98 + 2 transcript "12" Adh grailexp CDS 265088 265825 0.93 + 2 transcript "12" Adh grailexp CDS 265946 266322 0.93 + 1 transcript "13" Adh grailexp CDS 266392 266619 0.93 + 1 transcript "13" Adh grailexp CDS 266684 266876 0.01 + 2 transcript "13" Adh grailexp CDS 267633 267650 0.21 + 2 transcript "14" Adh grailexp CDS 274487 274515 0.90 + 1 transcript "14" Adh grailexp CDS 274618 275276 0.98 + 0 transcript "14" Adh grailexp CDS 276806 276954 0.17 + 2 transcript "14" Adh grailexp CDS 277921 278103 0.14 + 2 transcript "15" Adh grailexp CDS 278222 278345 0.40 + 0 transcript "15" Adh grailexp CDS 278537 278737 0.46 + 0 transcript "15" Adh grailexp CDS 278802 279280 0.00 + 2 transcript "15" Adh grailexp CDS 280043 280339 0.34 + 2 transcript "16" Adh grailexp CDS 280420 280610 0.10 + 1 transcript "17" Adh grailexp CDS 280674 280986 0.47 + 2 transcript "17" Adh grailexp CDS 281550 281787 0.46 + 0 transcript "17" Adh grailexp CDS 281848 282471 0.90 + 0 transcript "17" Adh grailexp CDS 282539 283030 0.88 + 0 transcript "17" Adh grailexp CDS 283112 283545 0.21 + 2 transcript "17" Adh grailexp CDS 283609 284052 0.43 + 2 transcript "18" Adh grailexp CDS 285426 286886 1.28 + 2 transcript "19" Adh grailexp CDS 287629 288379 0.81 + 0 transcript "20" Adh grailexp CDS 288647 292689 1.47 + 2 transcript "20" Adh grailexp CDS 292759 292896 0.20 + 2 transcript "20" Adh grailexp CDS 302782 303519 0.85 - 2 transcript "278" Adh grailexp CDS 304326 305201 1.26 - 2 transcript "277" Adh grailexp CDS 305782 306108 0.41 + 2 transcript "21" Adh grailexp CDS 306230 306385 0.40 + 2 transcript "21" Adh grailexp CDS 307965 309056 0.98 + 2 transcript "22" Adh grailexp CDS 309110 309467 0.98 + 0 transcript "22" Adh grailexp CDS 309530 310452 1.19 + 2 transcript "22" Adh grailexp CDS 310517 311365 1.19 + 2 transcript "22" Adh grailexp CDS 311428 312318 1.19 + 2 transcript "22" Adh grailexp CDS 312387 313020 0.98 + 0 transcript "22" Adh grailexp CDS 313086 313533 0.99 + 1 transcript "22" Adh grailexp CDS 315138 315899 1.14 + 2 transcript "23" Adh grailexp CDS 316433 316800 1.00 + 1 transcript "23" Adh grailexp CDS 316865 317645 0.99 + 2 transcript "23" Adh grailexp CDS 317891 318548 0.40 - 2 transcript "276" Adh grailexp CDS 318608 319430 1.46 - 1 transcript "276" Adh grailexp CDS 319486 321442 1.41 - 0 transcript "276" Adh grailexp CDS 321967 323027 1.09 - 2 transcript "275" Adh grailexp CDS 323097 323169 0.85 - 0 transcript "275" Adh grailexp CDS 323788 324885 1.19 + 2 transcript "24" Adh grailexp CDS 324939 325181 0.97 + 2 transcript "24" Adh grailexp CDS 325801 326007 0.01 + 2 transcript "24" Adh grailexp CDS 327175 328002 1.46 + 2 transcript "25" Adh grailexp CDS 328076 328279 0.34 + 2 transcript "26" Adh grailexp CDS 328788 328808 0.15 + 2 transcript "27" Adh grailexp CDS 329781 330245 0.34 + 2 transcript "27" Adh grailexp CDS 334589 334786 0.96 - 2 transcript "274" Adh grailexp CDS 334847 335125 0.94 - 2 transcript "274" Adh grailexp CDS 335195 335261 0.94 - 2 transcript "274" Adh grailexp CDS 336668 337323 0.41 - 2 transcript "273" Adh grailexp CDS 337379 337457 0.35 - 0 transcript "273" Adh grailexp CDS 338167 338879 0.94 - 2 transcript "272" Adh grailexp CDS 338944 339013 0.83 - 0 transcript "272" Adh grailexp CDS 340529 340634 0.97 + 0 transcript "28" Adh grailexp CDS 340705 340870 0.99 + 1 transcript "28" Adh grailexp CDS 340926 341235 0.99 + 2 transcript "28" Adh grailexp CDS 341311 341517 0.01 + 2 transcript "29" Adh grailexp CDS 341713 341857 0.96 + 0 transcript "30" Adh grailexp CDS 342003 342751 0.94 + 2 transcript "30" Adh grailexp CDS 343169 343368 0.97 + 1 transcript "31" Adh grailexp CDS 343432 343984 0.91 + 2 transcript "31" Adh grailexp CDS 360105 360259 0.29 - 2 transcript "271" Adh grailexp CDS 366840 366849 0.27 - 0 transcript "271" Adh grailexp CDS 373286 373501 0.25 + 2 transcript "32" Adh grailexp CDS 379118 379228 0.43 + 2 transcript "33" Adh grailexp CDS 384164 384285 0.00 + 1 transcript "33" Adh grailexp CDS 385067 385283 0.42 + 2 transcript "33" Adh grailexp CDS 388780 388921 0.47 + 0 transcript "33" Adh grailexp CDS 389006 389140 0.42 + 0 transcript "33" Adh grailexp CDS 389208 390491 1.44 + 0 transcript "33" Adh grailexp CDS 390556 390673 0.47 + 1 transcript "33" Adh grailexp CDS 390737 391112 0.94 + 2 transcript "33" Adh grailexp CDS 391177 391500 0.97 + 2 transcript "33" Adh grailexp CDS 393573 393814 0.26 - 2 transcript "270" Adh grailexp CDS 393894 394052 0.47 - 0 transcript "270" Adh grailexp CDS 394383 395732 1.47 - 0 transcript "270" Adh grailexp CDS 396240 397468 0.88 - 0 transcript "270" Adh grailexp CDS 397532 397682 0.99 - 1 transcript "270" Adh grailexp CDS 398149 398170 0.86 - 0 transcript "270" Adh grailexp CDS 399405 399469 0.94 + 2 transcript "34" Adh grailexp CDS 400317 400923 1.00 + 0 transcript "34" Adh grailexp CDS 401350 401713 0.98 + 1 transcript "34" Adh grailexp CDS 401775 402341 0.98 + 1 transcript "34" Adh grailexp CDS 402399 402539 0.98 + 1 transcript "34" Adh grailexp CDS 402607 402779 0.99 + 0 transcript "34" Adh grailexp CDS 402844 402923 0.96 + 2 transcript "34" Adh grailexp CDS 403468 404414 1.45 + 1 transcript "35" Adh grailexp CDS 404467 405027 0.45 + 1 transcript "35" Adh grailexp CDS 405085 405391 0.41 + 2 transcript "35" Adh grailexp CDS 405952 406314 0.38 + 2 transcript "36" Adh grailexp CDS 408759 409001 0.17 + 2 transcript "37" Adh grailexp CDS 409150 409656 0.20 + 2 transcript "37" Adh grailexp CDS 410157 410315 0.47 + 2 transcript "37" Adh grailexp CDS 410372 410612 0.46 + 0 transcript "37" Adh grailexp CDS 410677 411479 0.24 + 2 transcript "37" Adh grailexp CDS 415576 416211 0.41 - 2 transcript "269" Adh grailexp CDS 416276 416749 0.44 - 2 transcript "269" Adh grailexp CDS 417100 417111 0.39 - 2 transcript "269" Adh grailexp CDS 426746 427525 1.52 - 2 transcript "268" Adh grailexp CDS 438979 439790 1.10 - 2 transcript "267" Adh grailexp CDS 440839 440877 0.93 - 0 transcript "267" Adh grailexp CDS 441148 441210 0.94 - 0 transcript "267" Adh grailexp CDS 448467 448607 0.46 + 1 transcript "38" Adh grailexp CDS 449015 449330 0.41 + 2 transcript "38" Adh grailexp CDS 451600 451902 0.43 + 2 transcript "39" Adh grailexp CDS 454581 454771 0.15 + 1 transcript "39" Adh grailexp CDS 454999 455702 0.46 + 0 transcript "39" Adh grailexp CDS 455870 456267 0.40 + 2 transcript "39" Adh grailexp CDS 457298 457488 0.97 + 1 transcript "40" Adh grailexp CDS 457649 458210 0.94 + 2 transcript "40" Adh grailexp CDS 458837 459146 0.94 - 2 transcript "266" Adh grailexp CDS 459225 459761 0.97 - 1 transcript "266" Adh grailexp CDS 460256 460674 0.96 - 1 transcript "266" Adh grailexp CDS 462092 462584 0.41 - 2 transcript "265" Adh grailexp CDS 462646 463209 0.87 - 1 transcript "265" Adh grailexp CDS 463368 463710 0.99 - 1 transcript "265" Adh grailexp CDS 464878 465028 0.02 - 0 transcript "265" Adh grailexp CDS 466308 466360 0.40 - 2 transcript "264" Adh grailexp CDS 467993 469610 1.40 - 0 transcript "264" Adh grailexp CDS 471217 471296 0.95 + 1 transcript "41" Adh grailexp CDS 471441 471687 1.00 + 2 transcript "41" Adh grailexp CDS 471752 471856 0.98 + 2 transcript "41" Adh grailexp CDS 471944 472072 0.93 + 2 transcript "41" Adh grailexp CDS 472557 472823 0.47 + 0 transcript "41" Adh grailexp CDS 472965 473128 0.41 + 2 transcript "41" Adh grailexp CDS 474097 474189 0.43 + 2 transcript "42" Adh grailexp CDS 474251 474306 0.42 + 1 transcript "42" Adh grailexp CDS 474365 475283 1.44 + 2 transcript "42" Adh grailexp CDS 475427 476389 1.41 + 2 transcript "42" Adh grailexp CDS 477516 479329 1.25 - 2 transcript "263" Adh grailexp CDS 479386 479753 0.43 - 0 transcript "263" Adh grailexp CDS 479815 479958 0.47 - 1 transcript "263" Adh grailexp CDS 480147 480287 0.23 - 1 transcript "263" Adh grailexp CDS 480343 480480 0.20 - 1 transcript "263" Adh grailexp CDS 481570 481638 0.47 - 1 transcript "263" Adh grailexp CDS 484191 484338 0.40 - 2 transcript "262" Adh grailexp CDS 484664 484807 0.07 - 1 transcript "262" Adh grailexp CDS 485391 485462 0.43 - 1 transcript "262" Adh grailexp CDS 486686 487236 0.43 - 1 transcript "262" Adh grailexp CDS 497485 497503 0.12 + 0 transcript "43" Adh grailexp CDS 498635 499041 0.20 + 2 transcript "43" Adh grailexp CDS 510550 510756 0.11 - 2 transcript "261" Adh grailexp CDS 511962 512174 0.35 - 2 transcript "260" Adh grailexp CDS 513238 514050 1.44 - 2 transcript "259" Adh grailexp CDS 520781 521854 1.43 + 2 transcript "44" Adh grailexp CDS 522083 522988 1.46 + 2 transcript "45" Adh grailexp CDS 523495 523560 0.01 + 2 transcript "46" Adh grailexp CDS 528139 528231 0.14 + 2 transcript "46" Adh grailexp CDS 533735 533935 0.32 - 2 transcript "258" Adh grailexp CDS 541380 542513 0.68 + 2 transcript "47" Adh grailexp CDS 550841 550865 0.10 + 0 transcript "48" Adh grailexp CDS 555313 555854 0.33 + 2 transcript "48" Adh grailexp CDS 555938 556001 0.85 + 1 transcript "49" Adh grailexp CDS 558033 558061 0.82 + 0 transcript "49" Adh grailexp CDS 562333 562460 0.01 + 2 transcript "49" Adh grailexp CDS 566659 566706 0.10 + 2 transcript "50" Adh grailexp CDS 570329 570745 0.81 + 2 transcript "50" Adh grailexp CDS 574810 574871 0.45 + 1 transcript "51" Adh grailexp CDS 575409 575495 0.46 + 0 transcript "51" Adh grailexp CDS 593768 594158 0.17 + 1 transcript "51" Adh grailexp CDS 596802 596826 0.20 + 2 transcript "51" Adh grailexp CDS 598466 598796 0.17 + 0 transcript "51" Adh grailexp CDS 598857 599119 0.07 + 2 transcript "51" Adh grailexp CDS 599219 600433 1.26 + 2 transcript "51" Adh grailexp CDS 602240 602541 0.99 - 1 transcript "257" Adh grailexp CDS 602686 602889 1.00 - 2 transcript "257" Adh grailexp CDS 602944 603000 0.80 - 2 transcript "257" Adh grailexp CDS 603442 604269 0.26 - 2 transcript "256" Adh grailexp CDS 607042 607320 0.10 - 2 transcript "256" Adh grailexp CDS 615930 615946 0.14 + 1 transcript "52" Adh grailexp CDS 618724 618820 0.29 + 2 transcript "52" Adh grailexp CDS 635696 636034 0.35 - 2 transcript "255" Adh grailexp CDS 639175 639609 0.35 + 2 transcript "53" Adh grailexp CDS 650611 651153 0.47 + 2 transcript "54" Adh grailexp CDS 651278 651478 0.46 + 2 transcript "54" Adh grailexp CDS 651583 652290 0.41 + 2 transcript "54" Adh grailexp CDS 652417 652824 0.46 + 2 transcript "55" Adh grailexp CDS 657691 658001 0.41 - 2 transcript "254" Adh grailexp CDS 658058 658265 0.47 - 0 transcript "254" Adh grailexp CDS 658326 658463 0.47 - 2 transcript "254" Adh grailexp CDS 658526 660852 1.47 - 2 transcript "254" Adh grailexp CDS 660917 661331 0.18 - 0 transcript "254" Adh grailexp CDS 679874 680889 1.40 - 2 transcript "253" Adh grailexp CDS 682600 682771 0.89 - 0 transcript "253" Adh grailexp CDS 682831 682969 0.99 - 2 transcript "253" Adh grailexp CDS 689469 689746 0.98 - 1 transcript "253" Adh grailexp CDS 689811 689983 0.47 - 2 transcript "253" Adh grailexp CDS 690663 691029 0.12 - 0 transcript "253" Adh grailexp CDS 692030 692155 0.36 - 2 transcript "253" Adh grailexp CDS 704015 704227 0.35 - 2 transcript "252" Adh grailexp CDS 753588 753630 0.00 + 0 transcript "56" Adh grailexp CDS 754035 754129 0.17 + 2 transcript "56" Adh grailexp CDS 756663 756872 0.25 + 2 transcript "56" Adh grailexp CDS 757457 757873 0.45 + 2 transcript "57" Adh grailexp CDS 761650 761710 0.15 + 0 transcript "58" Adh grailexp CDS 771955 772295 0.47 + 2 transcript "58" Adh grailexp CDS 779692 781583 1.47 + 1 transcript "58" Adh grailexp CDS 781886 782694 1.47 + 0 transcript "58" Adh grailexp CDS 784197 784313 0.17 + 2 transcript "58" Adh grailexp CDS 788837 788917 0.24 - 2 transcript "251" Adh grailexp CDS 793158 793275 0.01 - 2 transcript "251" Adh grailexp CDS 796518 796758 0.12 - 0 transcript "251" Adh grailexp CDS 801924 802961 1.42 + 2 transcript "59" Adh grailexp CDS 813257 814650 1.41 + 1 transcript "60" Adh grailexp CDS 814726 814981 0.17 + 2 transcript "60" Adh grailexp CDS 815046 815442 0.43 + 0 transcript "60" Adh grailexp CDS 815528 817215 1.47 + 2 transcript "60" Adh grailexp CDS 817273 818025 0.47 + 2 transcript "60" Adh grailexp CDS 818086 818367 0.47 + 2 transcript "60" Adh grailexp CDS 818424 818574 0.47 + 1 transcript "60" Adh grailexp CDS 818633 819290 0.47 + 2 transcript "60" Adh grailexp CDS 820237 820789 0.17 + 0 transcript "60" Adh grailexp CDS 820846 820979 0.47 + 2 transcript "60" Adh grailexp CDS 821037 821265 0.43 + 0 transcript "60" Adh grailexp CDS 821333 821487 0.33 + 2 transcript "60" Adh grailexp CDS 822205 822454 0.17 + 0 transcript "61" Adh grailexp CDS 822511 822848 0.47 + 2 transcript "61" Adh grailexp CDS 822907 824011 1.15 + 0 transcript "61" Adh grailexp CDS 824074 824822 1.29 + 2 transcript "61" Adh grailexp CDS 824885 825688 0.35 + 2 transcript "61" Adh grailexp CDS 825804 826427 0.40 + 2 transcript "61" Adh grailexp CDS 826905 826921 0.13 + 1 transcript "62" Adh grailexp CDS 827148 827511 0.40 + 2 transcript "62" Adh grailexp CDS 828047 828306 0.45 + 1 transcript "63" Adh grailexp CDS 832925 832961 0.76 + 2 transcript "63" Adh grailexp CDS 833184 833672 0.09 + 2 transcript "63" Adh grailexp CDS 835107 835316 0.04 + 2 transcript "64" Adh grailexp CDS 836389 837106 0.43 + 0 transcript "65" Adh grailexp CDS 837173 837428 0.45 + 1 transcript "65" Adh grailexp CDS 837486 837859 0.98 + 0 transcript "65" Adh grailexp CDS 837919 838152 0.99 + 0 transcript "65" Adh grailexp CDS 838217 839076 1.15 + 2 transcript "65" Adh grailexp CDS 842968 843225 0.09 - 2 transcript "250" Adh grailexp CDS 843445 843518 0.45 - 2 transcript "250" Adh grailexp CDS 843799 843808 0.43 - 0 transcript "250" Adh grailexp CDS 846397 847365 1.46 - 2 transcript "249" Adh grailexp CDS 847429 848154 0.41 - 2 transcript "248" Adh grailexp CDS 848208 848609 0.99 - 2 transcript "248" Adh grailexp CDS 848668 848733 0.83 - 2 transcript "248" Adh grailexp CDS 848914 849209 0.99 + 0 transcript "66" Adh grailexp CDS 851077 851190 0.98 + 0 transcript "66" Adh grailexp CDS 851256 851436 0.98 + 1 transcript "66" Adh grailexp CDS 851491 851673 0.98 + 1 transcript "66" Adh grailexp CDS 851742 851919 0.91 + 2 transcript "66" Adh grailexp CDS 853119 855014 1.46 + 2 transcript "67" Adh grailexp CDS 855874 855922 0.86 + 0 transcript "68" Adh grailexp CDS 855982 856031 0.93 + 2 transcript "68" Adh grailexp CDS 856092 856876 0.99 + 1 transcript "68" Adh grailexp CDS 856942 858029 1.19 + 0 transcript "68" Adh grailexp CDS 858109 858395 0.84 + 2 transcript "68" Adh grailexp CDS 872557 872818 1.00 - 2 transcript "247" Adh grailexp CDS 872891 873131 0.99 - 1 transcript "247" Adh grailexp CDS 873191 873321 0.97 - 0 transcript "247" Adh grailexp CDS 873388 873527 0.93 - 1 transcript "247" Adh grailexp CDS 873583 874093 0.98 - 2 transcript "247" Adh grailexp CDS 874278 874541 1.00 - 1 transcript "247" Adh grailexp CDS 875601 875650 0.40 - 1 transcript "247" Adh grailexp CDS 884916 885806 1.20 - 2 transcript "246" Adh grailexp CDS 885881 886798 1.31 - 2 transcript "245" Adh grailexp CDS 905992 906071 0.35 - 1 transcript "245" Adh grailexp CDS 910874 911134 0.36 + 2 transcript "69" Adh grailexp CDS 918151 918795 0.41 - 2 transcript "244" Adh grailexp CDS 924200 924223 0.16 - 2 transcript "244" Adh grailexp CDS 934224 934243 0.00 + 1 transcript "70" Adh grailexp CDS 939589 939736 0.23 + 2 transcript "70" Adh grailexp CDS 944218 944493 0.80 - 2 transcript "243" Adh grailexp CDS 977804 978046 0.18 - 2 transcript "242" Adh grailexp CDS 984981 985070 0.82 + 2 transcript "71" Adh grailexp CDS 985373 986896 1.11 + 2 transcript "71" Adh grailexp CDS 1002359 1002471 0.28 - 2 transcript "241" Adh grailexp CDS 1003293 1003371 0.38 - 0 transcript "241" Adh grailexp CDS 1008067 1008249 0.10 - 2 transcript "240" Adh grailexp CDS 1015766 1015937 0.43 - 0 transcript "240" Adh grailexp CDS 1027037 1027195 0.14 - 2 transcript "239" Adh grailexp CDS 1029588 1029621 0.44 - 0 transcript "239" Adh grailexp CDS 1037169 1037252 0.15 - 2 transcript "238" Adh grailexp CDS 1041564 1041989 0.46 - 2 transcript "238" Adh grailexp CDS 1042386 1042688 0.45 - 2 transcript "238" Adh grailexp CDS 1043593 1043695 0.34 - 2 transcript "237" Adh grailexp CDS 1050773 1050821 0.01 - 0 transcript "237" Adh grailexp CDS 1056874 1057139 0.43 + 1 transcript "72" Adh grailexp CDS 1063610 1063766 0.04 + 2 transcript "72" Adh grailexp CDS 1075064 1075169 0.26 + 0 transcript "73" Adh grailexp CDS 1075573 1075695 0.02 + 0 transcript "73" Adh grailexp CDS 1078475 1078592 0.34 + 1 transcript "73" Adh grailexp CDS 1081755 1081896 0.06 + 2 transcript "73" Adh grailexp CDS 1088388 1088588 0.12 + 2 transcript "73" Adh grailexp CDS 1090024 1090389 0.27 + 2 transcript "73" Adh grailexp CDS 1095422 1095533 0.47 - 2 transcript "236" Adh grailexp CDS 1095586 1095735 0.43 - 1 transcript "236" Adh grailexp CDS 1095848 1095987 0.47 - 1 transcript "236" Adh grailexp CDS 1096326 1098971 1.47 - 2 transcript "236" Adh grailexp CDS 1101376 1101526 0.41 - 1 transcript "236" Adh grailexp CDS 1104419 1104995 0.46 - 0 transcript "236" Adh grailexp CDS 1105586 1105651 0.47 - 2 transcript "236" Adh grailexp CDS 1109286 1109378 0.98 + 2 transcript "74" Adh grailexp CDS 1110038 1110172 0.99 + 2 transcript "74" Adh grailexp CDS 1110238 1110642 0.99 + 2 transcript "74" Adh grailexp CDS 1110713 1110979 0.41 + 2 transcript "74" Adh grailexp CDS 1111805 1112209 0.97 + 2 transcript "75" Adh grailexp CDS 1112261 1112578 0.95 + 2 transcript "75" Adh grailexp CDS 1128664 1128863 0.25 - 2 transcript "235" Adh grailexp CDS 1129815 1129895 0.46 - 2 transcript "235" Adh grailexp CDS 1145411 1145429 0.45 + 0 transcript "76" Adh grailexp CDS 1145597 1145940 0.19 + 2 transcript "76" Adh grailexp CDS 1154838 1154848 0.41 + 1 transcript "77" Adh grailexp CDS 1168731 1168947 0.23 + 2 transcript "77" Adh grailexp CDS 1182164 1182430 0.01 - 2 transcript "234" Adh grailexp CDS 1185401 1185439 0.12 - 2 transcript "234" Adh grailexp CDS 1191250 1191269 0.36 + 1 transcript "78" Adh grailexp CDS 1207666 1207953 0.41 + 2 transcript "78" Adh grailexp CDS 1220426 1221762 1.41 - 2 transcript "233" Adh grailexp CDS 1222288 1222395 0.07 - 0 transcript "233" Adh grailexp CDS 1229684 1230733 1.41 + 2 transcript "79" Adh grailexp CDS 1231115 1231348 0.86 + 2 transcript "80" Adh grailexp CDS 1232958 1232969 0.81 + 2 transcript "81" Adh grailexp CDS 1233044 1233280 0.95 + 2 transcript "81" Adh grailexp CDS 1241714 1241776 0.38 - 2 transcript "232" Adh grailexp CDS 1244068 1244083 0.29 - 0 transcript "232" Adh grailexp CDS 1250633 1251421 0.88 + 2 transcript "82" Adh grailexp CDS 1252523 1253617 1.42 + 2 transcript "83" Adh grailexp CDS 1255669 1256823 1.43 + 2 transcript "84" Adh grailexp CDS 1271377 1272140 0.18 - 2 transcript "231" Adh grailexp CDS 1272217 1272395 0.46 - 0 transcript "231" Adh grailexp CDS 1273008 1273498 0.14 - 1 transcript "231" Adh grailexp CDS 1286168 1286225 0.26 + 0 transcript "85" Adh grailexp CDS 1291182 1291348 0.10 + 2 transcript "85" Adh grailexp CDS 1293718 1294187 0.98 - 1 transcript "230" Adh grailexp CDS 1297137 1297250 0.98 - 2 transcript "230" Adh grailexp CDS 1297317 1297352 0.90 - 2 transcript "230" Adh grailexp CDS 1308376 1308414 0.22 - 2 transcript "230" Adh grailexp CDS 1334780 1335024 0.92 - 2 transcript "229" Adh grailexp CDS 1335080 1335356 0.37 - 0 transcript "229" Adh grailexp CDS 1335416 1336157 0.45 - 2 transcript "229" Adh grailexp CDS 1336482 1336720 0.99 - 2 transcript "229" Adh grailexp CDS 1338337 1338640 0.93 - 0 transcript "229" Adh grailexp CDS 1338702 1338804 0.96 - 2 transcript "229" Adh grailexp CDS 1361484 1361548 0.12 - 1 transcript "229" Adh grailexp CDS 1365101 1365361 0.06 - 2 transcript "228" Adh grailexp CDS 1365421 1365611 0.26 - 2 transcript "228" Adh grailexp CDS 1365666 1365762 0.46 - 0 transcript "228" Adh grailexp CDS 1368707 1369303 0.94 - 2 transcript "228" Adh grailexp CDS 1371200 1371270 0.91 - 2 transcript "228" Adh grailexp CDS 1371783 1372372 0.98 - 0 transcript "228" Adh grailexp CDS 1373266 1373367 0.98 - 1 transcript "228" Adh grailexp CDS 1376588 1376598 0.39 - 1 transcript "228" Adh grailexp CDS 1379912 1380009 0.74 + 2 transcript "86" Adh grailexp CDS 1398183 1398911 0.42 - 2 transcript "227" Adh grailexp CDS 1401594 1401874 0.02 - 2 transcript "226" Adh grailexp CDS 1402451 1402460 0.40 - 0 transcript "226" Adh grailexp CDS 1402512 1402643 0.32 - 2 transcript "225" Adh grailexp CDS 1402808 1402995 0.06 - 2 transcript "225" Adh grailexp CDS 1406801 1406882 0.46 - 0 transcript "225" Adh grailexp CDS 1407035 1407146 0.01 - 2 transcript "225" Adh grailexp CDS 1408830 1408924 0.40 - 1 transcript "225" Adh grailexp CDS 1414397 1418081 1.41 + 0 transcript "87" Adh grailexp CDS 1418142 1419321 1.46 + 1 transcript "87" Adh grailexp CDS 1419378 1419918 0.39 + 2 transcript "87" Adh grailexp CDS 1424156 1424376 0.16 - 1 transcript "224" Adh grailexp CDS 1424531 1424676 0.47 - 2 transcript "224" Adh grailexp CDS 1425549 1425752 0.36 - 0 transcript "224" Adh grailexp CDS 1426168 1426281 0.42 - 0 transcript "224" Adh grailexp CDS 1428573 1428690 0.37 - 2 transcript "224" Adh grailexp CDS 1431180 1431306 0.37 - 1 transcript "224" Adh grailexp CDS 1439418 1439478 0.43 - 0 transcript "224" Adh grailexp CDS 1445532 1445710 0.46 + 2 transcript "88" Adh grailexp CDS 1448592 1448623 0.18 + 0 transcript "88" Adh grailexp CDS 1450916 1451020 0.45 + 0 transcript "88" Adh grailexp CDS 1465981 1466019 0.47 - 1 transcript "223" Adh grailexp CDS 1466153 1466744 0.91 - 1 transcript "223" Adh grailexp CDS 1466876 1467307 0.91 - 0 transcript "223" Adh grailexp CDS 1469347 1469359 0.39 - 0 transcript "223" Adh grailexp CDS 1470304 1470339 0.10 - 1 transcript "222" Adh grailexp CDS 1473611 1473745 0.99 - 1 transcript "222" Adh grailexp CDS 1473857 1473914 0.94 - 1 transcript "222" Adh grailexp CDS 1483558 1483694 0.99 - 0 transcript "222" Adh grailexp CDS 1487171 1487198 0.90 - 1 transcript "222" Adh grailexp CDS 1495402 1495535 1.00 + 2 transcript "89" Adh grailexp CDS 1495620 1495919 0.99 + 2 transcript "89" Adh grailexp CDS 1495977 1496171 0.46 + 2 transcript "89" Adh grailexp CDS 1497570 1498121 0.93 + 2 transcript "89" Adh grailexp CDS 1499670 1500914 1.12 + 2 transcript "90" Adh grailexp CDS 1510747 1510998 0.43 + 2 transcript "91" Adh grailexp CDS 1515041 1515175 0.46 + 2 transcript "91" Adh grailexp CDS 1515266 1515436 0.38 + 2 transcript "91" Adh grailexp CDS 1515498 1515714 0.20 + 0 transcript "91" Adh grailexp CDS 1515807 1515972 0.47 + 1 transcript "91" Adh grailexp CDS 1516036 1516279 0.32 + 2 transcript "91" Adh grailexp CDS 1516339 1516527 0.29 + 2 transcript "91" Adh grailexp CDS 1518399 1518939 0.14 + 0 transcript "92" Adh grailexp CDS 1520081 1520337 0.30 + 2 transcript "92" Adh grailexp CDS 1520398 1520535 0.47 + 2 transcript "92" Adh grailexp CDS 1521654 1521834 0.47 + 0 transcript "92" Adh grailexp CDS 1525228 1525447 0.98 + 1 transcript "92" Adh grailexp CDS 1526237 1526669 0.95 + 2 transcript "92" Adh grailexp CDS 1527062 1527379 0.03 + 2 transcript "93" Adh grailexp CDS 1529846 1529971 0.91 + 2 transcript "94" Adh grailexp CDS 1530746 1531626 0.93 + 1 transcript "94" Adh grailexp CDS 1531685 1531910 0.85 + 2 transcript "94" Adh grailexp CDS 1535341 1535461 0.40 - 2 transcript "221" Adh grailexp CDS 1535530 1535642 0.32 - 1 transcript "221" Adh grailexp CDS 1536067 1537150 1.35 - 2 transcript "220" Adh grailexp CDS 1537212 1538662 1.46 - 1 transcript "220" Adh grailexp CDS 1538719 1541113 1.47 - 2 transcript "220" Adh grailexp CDS 1541178 1541378 0.47 - 1 transcript "220" Adh grailexp CDS 1541445 1541794 0.89 - 1 transcript "220" Adh grailexp CDS 1542125 1542385 0.98 - 2 transcript "220" Adh grailexp CDS 1543067 1543173 0.98 - 2 transcript "220" Adh grailexp CDS 1547319 1547461 0.98 - 0 transcript "220" Adh grailexp CDS 1547681 1547715 0.40 - 1 transcript "220" Adh grailexp CDS 1549142 1550017 1.15 - 2 transcript "219" Adh grailexp CDS 1550084 1550149 0.76 - 2 transcript "219" Adh grailexp CDS 1551361 1551433 0.94 + 1 transcript "95" Adh grailexp CDS 1558033 1558080 0.94 + 1 transcript "95" Adh grailexp CDS 1558134 1558572 0.90 + 2 transcript "95" Adh grailexp CDS 1558642 1559747 1.37 + 1 transcript "96" Adh grailexp CDS 1561989 1562278 0.93 + 2 transcript "96" Adh grailexp CDS 1562338 1563081 0.94 + 2 transcript "96" Adh grailexp CDS 1563140 1563353 0.99 + 0 transcript "96" Adh grailexp CDS 1563418 1563689 0.98 + 2 transcript "96" Adh grailexp CDS 1565272 1565547 0.33 + 2 transcript "97" Adh grailexp CDS 1566588 1566621 0.33 + 0 transcript "98" Adh grailexp CDS 1576691 1576943 0.47 + 1 transcript "98" Adh grailexp CDS 1577036 1577406 0.47 + 0 transcript "98" Adh grailexp CDS 1580846 1580880 0.15 + 2 transcript "98" Adh grailexp CDS 1580946 1581227 0.20 + 2 transcript "98" Adh grailexp CDS 1581294 1581623 0.26 + 2 transcript "98" Adh grailexp CDS 1581774 1582136 0.46 + 2 transcript "98" Adh grailexp CDS 1582201 1582292 0.47 + 1 transcript "98" Adh grailexp CDS 1584621 1584828 0.43 + 0 transcript "98" Adh grailexp CDS 1584949 1585094 0.47 + 2 transcript "98" Adh grailexp CDS 1585153 1585380 0.40 + 2 transcript "98" Adh grailexp CDS 1599218 1600177 1.45 + 2 transcript "99" Adh grailexp CDS 1601744 1602565 1.35 + 2 transcript "99" Adh grailexp CDS 1603706 1603885 0.82 + 2 transcript "100" Adh grailexp CDS 1603951 1604326 1.00 + 0 transcript "100" Adh grailexp CDS 1605059 1605404 0.15 + 1 transcript "100" Adh grailexp CDS 1605651 1606718 1.19 + 1 transcript "100" Adh grailexp CDS 1606791 1607142 0.98 + 2 transcript "100" Adh grailexp CDS 1607205 1607306 0.86 + 2 transcript "100" Adh grailexp CDS 1624417 1624528 0.43 + 0 transcript "101" Adh grailexp CDS 1626928 1626998 0.26 + 2 transcript "101" Adh grailexp CDS 1627913 1627973 0.00 - 2 transcript "218" Adh grailexp CDS 1630351 1630487 0.43 - 1 transcript "218" Adh grailexp CDS 1634224 1634411 0.01 - 2 transcript "217" Adh grailexp CDS 1634782 1634821 0.43 - 0 transcript "217" Adh grailexp CDS 1641652 1641718 0.42 + 1 transcript "102" Adh grailexp CDS 1644188 1644362 0.31 + 2 transcript "102" Adh grailexp CDS 1651072 1651167 0.40 - 2 transcript "216" Adh grailexp CDS 1651337 1651403 0.41 - 2 transcript "216" Adh grailexp CDS 1653232 1653414 0.40 - 2 transcript "215" Adh grailexp CDS 1653857 1657133 1.47 - 2 transcript "215" Adh grailexp CDS 1657232 1657441 0.47 - 1 transcript "215" Adh grailexp CDS 1661045 1661184 0.32 - 1 transcript "215" Adh grailexp CDS 1667548 1667970 0.45 - 2 transcript "214" Adh grailexp CDS 1700818 1701162 0.09 - 2 transcript "213" Adh grailexp CDS 1717339 1717472 0.01 - 2 transcript "212" Adh grailexp CDS 1719195 1719342 0.47 - 0 transcript "212" Adh grailexp CDS 1719504 1720005 0.46 - 2 transcript "212" Adh grailexp CDS 1726256 1726435 0.92 - 1 transcript "212" Adh grailexp CDS 1730116 1730236 0.92 - 1 transcript "212" Adh grailexp CDS 1731062 1731172 0.99 - 0 transcript "212" Adh grailexp CDS 1735826 1736004 0.99 - 0 transcript "212" Adh grailexp CDS 1737215 1737294 0.95 - 1 transcript "212" Adh grailexp CDS 1738791 1739218 0.92 + 1 transcript "103" Adh grailexp CDS 1740300 1740540 0.46 + 2 transcript "103" Adh grailexp CDS 1740659 1740939 0.47 + 1 transcript "103" Adh grailexp CDS 1740995 1742042 1.47 + 2 transcript "103" Adh grailexp CDS 1742104 1742487 0.36 + 2 transcript "103" Adh grailexp CDS 1744620 1745915 1.46 - 2 transcript "211" Adh grailexp CDS 1746561 1746743 0.01 - 2 transcript "210" Adh grailexp CDS 1747451 1747777 0.45 - 2 transcript "210" Adh grailexp CDS 1748111 1748361 0.36 - 2 transcript "209" Adh grailexp CDS 1748434 1748590 0.00 - 0 transcript "209" Adh grailexp CDS 1751370 1751492 0.45 - 2 transcript "209" Adh grailexp CDS 1751564 1751652 0.18 - 2 transcript "209" Adh grailexp CDS 1752053 1752278 0.10 - 0 transcript "209" Adh grailexp CDS 1752622 1752780 0.47 - 2 transcript "209" Adh grailexp CDS 1752984 1753054 0.00 - 2 transcript "209" Adh grailexp CDS 1753136 1753316 0.85 - 0 transcript "209" Adh grailexp CDS 1753422 1753778 0.95 - 2 transcript "209" Adh grailexp CDS 1756026 1756178 0.41 - 2 transcript "208" Adh grailexp CDS 1756248 1756386 0.47 - 2 transcript "208" Adh grailexp CDS 1756448 1756671 0.21 - 1 transcript "208" Adh grailexp CDS 1756788 1756939 0.05 - 2 transcript "207" Adh grailexp CDS 1757005 1757119 0.46 - 0 transcript "207" Adh grailexp CDS 1757182 1757352 0.46 - 2 transcript "207" Adh grailexp CDS 1757415 1757585 0.47 - 2 transcript "207" Adh grailexp CDS 1757648 1758409 1.00 - 2 transcript "207" Adh grailexp CDS 1758473 1758856 0.99 - 2 transcript "207" Adh grailexp CDS 1760557 1760795 0.99 - 2 transcript "207" Adh grailexp CDS 1763921 1764042 0.94 - 2 transcript "206" Adh grailexp CDS 1764272 1764501 0.97 - 0 transcript "206" Adh grailexp CDS 1764574 1764638 0.82 - 1 transcript "206" Adh grailexp CDS 1774679 1775557 1.40 + 2 transcript "104" Adh grailexp CDS 1780341 1780544 0.10 - 2 transcript "205" Adh grailexp CDS 1781148 1781825 0.39 - 2 transcript "205" Adh grailexp CDS 1787599 1788915 1.40 + 2 transcript "105" Adh grailexp CDS 1790433 1790449 0.38 + 1 transcript "106" Adh grailexp CDS 1792246 1792331 0.10 + 0 transcript "106" Adh grailexp CDS 1792606 1792631 0.43 + 1 transcript "107" Adh grailexp CDS 1798592 1798702 0.35 + 2 transcript "107" Adh grailexp CDS 1807761 1808498 0.44 - 2 transcript "204" Adh grailexp CDS 1823746 1825158 1.45 + 2 transcript "108" Adh grailexp CDS 1826351 1826373 0.13 + 1 transcript "109" Adh grailexp CDS 1833915 1834002 0.12 + 2 transcript "109" Adh grailexp CDS 1850930 1851241 0.06 + 2 transcript "110" Adh grailexp CDS 1852974 1853126 0.01 + 2 transcript "110" Adh grailexp CDS 1884141 1884464 0.03 - 2 transcript "203" Adh grailexp CDS 1885049 1885144 0.43 - 2 transcript "203" Adh grailexp CDS 1886301 1886571 0.19 - 2 transcript "203" Adh grailexp CDS 1891981 1892003 0.45 - 1 transcript "203" Adh grailexp CDS 1908356 1908441 0.24 - 2 transcript "202" Adh grailexp CDS 1909292 1909323 0.02 - 0 transcript "202" Adh grailexp CDS 1912285 1912316 0.38 - 1 transcript "202" Adh grailexp CDS 1913374 1914932 1.02 - 2 transcript "201" Adh grailexp CDS 1914995 1915082 0.43 - 0 transcript "201" Adh grailexp CDS 1921206 1921230 0.42 + 0 transcript "111" Adh grailexp CDS 1922996 1924563 1.15 + 2 transcript "111" Adh grailexp CDS 1936726 1937031 0.35 + 2 transcript "112" Adh grailexp CDS 1938049 1938118 0.77 + 0 transcript "113" Adh grailexp CDS 1950791 1951201 0.32 - 2 transcript "200" Adh grailexp CDS 1951455 1951541 0.12 - 2 transcript "200" Adh grailexp CDS 1961881 1961901 0.32 + 2 transcript "114" Adh grailexp CDS 1962476 1962516 0.41 + 2 transcript "114" Adh grailexp CDS 1963364 1963651 0.31 + 2 transcript "115" Adh grailexp CDS 1966586 1967758 1.40 - 2 transcript "199" Adh grailexp CDS 1970601 1970641 0.30 + 1 transcript "116" Adh grailexp CDS 1974454 1975018 0.34 + 2 transcript "116" Adh grailexp CDS 1988872 1989075 0.87 + 2 transcript "117" Adh grailexp CDS 1991768 1992688 0.92 + 2 transcript "117" Adh grailexp CDS 1992942 1993204 0.22 + 1 transcript "117" Adh grailexp CDS 1993350 1993566 0.41 + 2 transcript "117" Adh grailexp CDS 2008029 2008162 0.14 - 2 transcript "198" Adh grailexp CDS 2010059 2010091 0.33 - 2 transcript "198" Adh grailexp CDS 2038745 2038806 0.17 + 1 transcript "118" Adh grailexp CDS 2040432 2040693 0.14 + 2 transcript "118" Adh grailexp CDS 2068604 2070501 1.45 + 1 transcript "119" Adh grailexp CDS 2071510 2072677 1.41 + 2 transcript "119" Adh grailexp CDS 2074630 2074665 0.38 + 2 transcript "120" Adh grailexp CDS 2074911 2075113 0.01 + 2 transcript "120" Adh grailexp CDS 2076918 2077326 0.85 + 0 transcript "121" Adh grailexp CDS 2091428 2091590 0.38 + 0 transcript "121" Adh grailexp CDS 2100551 2101336 0.42 - 2 transcript "197" Adh grailexp CDS 2102169 2102647 0.15 - 2 transcript "196" Adh grailexp CDS 2102776 2102797 0.10 - 0 transcript "196" Adh grailexp CDS 2103622 2104169 0.39 - 2 transcript "195" Adh grailexp CDS 2104226 2104442 0.20 - 0 transcript "195" Adh grailexp CDS 2105170 2105720 0.41 - 2 transcript "194" Adh grailexp CDS 2109817 2109901 0.26 - 0 transcript "194" Adh grailexp CDS 2118483 2118551 0.43 + 2 transcript "122" Adh grailexp CDS 2118614 2119161 0.41 + 2 transcript "122" Adh grailexp CDS 2119844 2120025 0.19 + 1 transcript "123" Adh grailexp CDS 2120092 2120194 0.47 + 2 transcript "123" Adh grailexp CDS 2120312 2121269 1.47 + 0 transcript "123" Adh grailexp CDS 2121336 2121745 0.41 + 2 transcript "123" Adh grailexp CDS 2137486 2137679 0.39 - 2 transcript "193" Adh grailexp CDS 2137746 2137902 0.47 - 0 transcript "193" Adh grailexp CDS 2137961 2138116 0.17 - 2 transcript "193" Adh grailexp CDS 2138186 2138671 0.42 - 2 transcript "193" Adh grailexp CDS 2138733 2138994 0.35 - 2 transcript "193" Adh grailexp CDS 2139065 2139169 0.47 - 1 transcript "193" Adh grailexp CDS 2139824 2140056 0.06 - 1 transcript "193" Adh grailexp CDS 2140148 2140353 0.15 - 2 transcript "193" Adh grailexp CDS 2140417 2140630 0.43 - 0 transcript "193" Adh grailexp CDS 2140705 2141412 0.41 - 2 transcript "192" Adh grailexp CDS 2141468 2141749 0.43 - 2 transcript "192" Adh grailexp CDS 2141998 2142465 0.41 - 2 transcript "192" Adh grailexp CDS 2145807 2145957 0.12 + 0 transcript "124" Adh grailexp CDS 2148796 2148854 0.17 + 2 transcript "124" Adh grailexp CDS 2149292 2149510 0.13 + 2 transcript "125" Adh grailexp CDS 2149741 2150907 1.41 + 2 transcript "125" Adh grailexp CDS 2161195 2161276 0.00 - 2 transcript "191" Adh grailexp CDS 2167365 2167477 0.38 - 1 transcript "191" Adh grailexp CDS 2180707 2180982 0.41 - 2 transcript "190" Adh grailexp CDS 2181100 2181325 0.98 - 2 transcript "190" Adh grailexp CDS 2181392 2182662 1.19 - 1 transcript "190" Adh grailexp CDS 2182828 2183604 0.97 - 2 transcript "190" Adh grailexp CDS 2189454 2189790 0.92 - 2 transcript "190" Adh grailexp CDS 2192598 2192725 0.99 - 1 transcript "190" Adh grailexp CDS 2199659 2199945 0.97 - 2 transcript "190" Adh grailexp CDS 2204183 2205278 1.37 + 0 transcript "126" Adh grailexp CDS 2205332 2207403 1.28 + 2 transcript "126" Adh grailexp CDS 2208830 2209531 0.99 - 1 transcript "189" Adh grailexp CDS 2209593 2209904 0.98 - 1 transcript "189" Adh grailexp CDS 2209967 2211186 1.19 - 1 transcript "189" Adh grailexp CDS 2211243 2211671 0.98 - 2 transcript "189" Adh grailexp CDS 2212036 2212168 0.94 - 2 transcript "189" Adh grailexp CDS 2212228 2212400 1.00 - 1 transcript "189" Adh grailexp CDS 2214395 2214568 0.97 - 2 transcript "189" Adh grailexp CDS 2216396 2217064 0.46 - 2 transcript "188" Adh grailexp CDS 2218461 2218494 0.40 - 2 transcript "187" Adh grailexp CDS 2218559 2218905 0.47 - 1 transcript "187" Adh grailexp CDS 2218966 2219871 0.98 - 2 transcript "187" Adh grailexp CDS 2219932 2220057 0.89 - 2 transcript "187" Adh grailexp CDS 2220565 2221536 1.44 - 2 transcript "186" Adh grailexp CDS 2222253 2222379 0.34 - 2 transcript "185" Adh grailexp CDS 2222435 2222667 0.21 - 1 transcript "185" Adh grailexp CDS 2222723 2222818 0.43 - 2 transcript "185" Adh grailexp CDS 2223403 2223577 0.46 - 2 transcript "185" Adh grailexp CDS 2223854 2224248 0.43 - 1 transcript "185" Adh grailexp CDS 2229177 2229218 0.44 - 2 transcript "185" Adh grailexp CDS 2231491 2231742 0.35 - 2 transcript "184" Adh grailexp CDS 2288700 2288778 0.23 - 2 transcript "183" Adh grailexp CDS 2295145 2295194 0.41 - 1 transcript "183" Adh grailexp CDS 2301891 2301939 0.15 + 0 transcript "127" Adh grailexp CDS 2303428 2304641 1.32 + 2 transcript "127" Adh grailexp CDS 2305038 2305397 0.95 + 2 transcript "128" Adh grailexp CDS 2305489 2305763 0.92 + 1 transcript "128" Adh grailexp CDS 2305829 2306951 1.41 + 2 transcript "128" Adh grailexp CDS 2315767 2315925 0.22 - 2 transcript "182" Adh grailexp CDS 2315991 2316098 0.07 - 2 transcript "182" Adh grailexp CDS 2327989 2328098 0.40 - 2 transcript "181" Adh grailexp CDS 2328611 2329261 0.20 - 2 transcript "181" Adh grailexp CDS 2329400 2329967 0.01 - 2 transcript "181" Adh grailexp CDS 2330026 2330181 0.21 - 1 transcript "181" Adh grailexp CDS 2333741 2333787 0.01 - 1 transcript "181" Adh grailexp CDS 2339377 2340420 1.41 - 2 transcript "180" Adh grailexp CDS 2340535 2341630 1.38 - 2 transcript "180" Adh grailexp CDS 2342664 2343851 1.41 - 1 transcript "180" Adh grailexp CDS 2348069 2348214 0.26 - 1 transcript "180" Adh grailexp CDS 2351716 2352026 0.36 - 2 transcript "179" Adh grailexp CDS 2352080 2353052 1.45 - 0 transcript "179" Adh grailexp CDS 2356272 2356488 0.30 - 2 transcript "178" Adh grailexp CDS 2357535 2357674 0.44 - 1 transcript "178" Adh grailexp CDS 2358742 2358953 0.46 - 2 transcript "178" Adh grailexp CDS 2365992 2366304 0.30 - 0 transcript "178" Adh grailexp CDS 2374085 2374294 0.99 + 2 transcript "129" Adh grailexp CDS 2374356 2375075 0.84 + 2 transcript "129" Adh grailexp CDS 2391780 2391944 0.04 + 2 transcript "129" Adh grailexp CDS 2392181 2392737 0.41 + 1 transcript "130" Adh grailexp CDS 2392800 2393095 0.21 + 0 transcript "130" Adh grailexp CDS 2408036 2408288 0.34 + 0 transcript "131" Adh grailexp CDS 2420842 2420985 0.28 + 2 transcript "131" Adh grailexp CDS 2428833 2429381 0.45 + 2 transcript "132" Adh grailexp CDS 2441963 2441976 0.40 + 1 transcript "133" Adh grailexp CDS 2443533 2443755 0.38 + 2 transcript "133" Adh grailexp CDS 2444164 2444213 0.43 + 1 transcript "134" Adh grailexp CDS 2445792 2445848 0.47 + 1 transcript "134" Adh grailexp CDS 2465772 2465965 0.43 + 1 transcript "135" Adh grailexp CDS 2481639 2481850 0.47 + 2 transcript "135" Adh grailexp CDS 2483447 2483582 0.46 + 0 transcript "135" Adh grailexp CDS 2483839 2483972 0.17 + 2 transcript "135" Adh grailexp CDS 2484693 2484860 0.14 + 2 transcript "135" Adh grailexp CDS 2486400 2486522 0.43 + 2 transcript "135" Adh grailexp CDS 2486596 2486808 0.36 + 2 transcript "135" Adh grailexp CDS 2493314 2493620 0.44 + 0 transcript "136" Adh grailexp CDS 2493682 2493731 0.46 + 2 transcript "136" Adh grailexp CDS 2494047 2494116 0.23 + 0 transcript "136" Adh grailexp CDS 2494568 2494651 0.82 + 2 transcript "137" Adh grailexp CDS 2495100 2495225 0.99 + 2 transcript "137" Adh grailexp CDS 2495286 2495667 0.99 + 0 transcript "137" Adh grailexp CDS 2495783 2496988 1.23 + 0 transcript "137" Adh grailexp CDS 2497217 2497464 0.41 + 2 transcript "137" Adh grailexp CDS 2505511 2505601 0.97 + 0 transcript "138" Adh grailexp CDS 2524357 2524565 0.96 + 2 transcript "138" Adh grailexp CDS 2525929 2526064 1.00 + 0 transcript "138" Adh grailexp CDS 2527415 2527548 0.97 + 2 transcript "138" Adh grailexp CDS 2529073 2529195 0.99 + 2 transcript "138" Adh grailexp CDS 2529260 2529455 0.97 + 0 transcript "138" Adh grailexp CDS 2539877 2540172 0.02 + 2 transcript "138" Adh grailexp CDS 2544295 2545203 1.16 + 2 transcript "139" Adh grailexp CDS 2554306 2554403 0.36 + 1 transcript "140" Adh grailexp CDS 2591868 2591903 0.90 + 1 transcript "140" Adh grailexp CDS 2591970 2592084 0.98 + 2 transcript "140" Adh grailexp CDS 2595035 2595504 0.97 + 1 transcript "140" Adh grailexp CDS 2596999 2597040 0.26 + 2 transcript "141" Adh grailexp CDS 2597544 2597725 0.10 + 2 transcript "141" Adh grailexp CDS 2599727 2599883 0.18 + 0 transcript "142" Adh grailexp CDS 2601492 2601517 0.46 + 2 transcript "142" Adh grailexp CDS 2619911 2620307 0.99 + 1 transcript "142" Adh grailexp CDS 2621231 2622507 1.19 + 0 transcript "142" Adh grailexp CDS 2622578 2622803 0.99 + 1 transcript "142" Adh grailexp CDS 2622977 2623082 0.99 + 2 transcript "142" Adh grailexp CDS 2623316 2623455 0.98 + 1 transcript "142" Adh grailexp CDS 2623675 2623781 0.91 + 0 transcript "142" Adh grailexp CDS 2624114 2624266 0.95 + 0 transcript "142" Adh grailexp CDS 2624694 2624875 1.00 + 2 transcript "142" Adh grailexp CDS 2624976 2625495 0.98 + 0 transcript "142" Adh grailexp CDS 2625559 2625784 0.98 + 1 transcript "142" Adh grailexp CDS 2625851 2626065 0.99 + 0 transcript "142" Adh grailexp CDS 2626124 2626333 0.99 + 2 transcript "142" Adh grailexp CDS 2626392 2626510 0.93 + 1 transcript "142" Adh grailexp CDS 2626595 2626653 0.89 + 0 transcript "142" Adh grailexp CDS 2627634 2627751 1.00 + 1 transcript "142" Adh grailexp CDS 2628166 2628295 0.90 + 2 transcript "142" Adh grailexp CDS 2628460 2628626 0.99 + 1 transcript "142" Adh grailexp CDS 2628718 2628805 0.97 + 2 transcript "142" Adh grailexp CDS 2629398 2629505 1.00 + 2 transcript "142" Adh grailexp CDS 2632038 2632090 0.94 + 1 transcript "142" Adh grailexp CDS 2632152 2632298 0.99 + 1 transcript "142" Adh grailexp CDS 2632363 2632834 0.99 + 2 transcript "142" Adh grailexp CDS 2632889 2632972 0.97 + 2 transcript "142" Adh grailexp CDS 2633028 2633337 0.98 + 0 transcript "142" Adh grailexp CDS 2633397 2633645 0.98 + 2 transcript "142" Adh grailexp CDS 2633706 2634365 0.98 + 2 transcript "142" Adh grailexp CDS 2634452 2634885 0.98 + 1 transcript "142" Adh grailexp CDS 2635370 2635410 0.93 + 0 transcript "142" Adh grailexp CDS 2638284 2638414 0.99 + 2 transcript "142" Adh grailexp CDS 2638470 2639006 0.92 + 2 transcript "142" Adh grailexp CDS 2660848 2661318 0.43 + 2 transcript "143" Adh grailexp CDS 2661378 2662319 1.41 + 2 transcript "143" Adh grailexp CDS 2671764 2671896 0.20 + 0 transcript "144" Adh grailexp CDS 2675909 2676030 0.06 + 2 transcript "144" Adh grailexp CDS 2681334 2681494 0.33 + 1 transcript "145" Adh grailexp CDS 2684880 2686209 1.47 + 2 transcript "145" Adh grailexp CDS 2686394 2686570 0.42 + 2 transcript "145" Adh grailexp CDS 2686628 2686705 0.01 + 2 transcript "145" Adh grailexp CDS 2686770 2687146 0.47 + 1 transcript "145" Adh grailexp CDS 2687211 2687359 0.10 + 0 transcript "145" Adh grailexp CDS 2687415 2687920 0.33 + 2 transcript "145" Adh grailexp CDS 2687988 2688296 0.17 + 2 transcript "145" Adh grailexp CDS 2688464 2688913 0.39 + 2 transcript "146" Adh grailexp CDS 2696335 2696446 1.00 - 2 transcript "177" Adh grailexp CDS 2696513 2696644 0.98 - 1 transcript "177" Adh grailexp CDS 2697858 2698028 0.88 - 2 transcript "177" Adh grailexp CDS 2707300 2707439 1.00 + 2 transcript "147" Adh grailexp CDS 2707509 2708522 1.10 + 2 transcript "147" Adh grailexp CDS 2709485 2710765 1.12 - 2 transcript "176" Adh grailexp CDS 2710851 2710951 0.98 - 2 transcript "176" Adh grailexp CDS 2714781 2716277 1.41 - 2 transcript "175" Adh grailexp CDS 2723585 2723607 0.27 - 1 transcript "175" Adh grailexp CDS 2728054 2728418 0.30 - 2 transcript "174" Adh grailexp CDS 2728802 2728830 0.38 - 0 transcript "174" Adh grailexp CDS 2736358 2736953 0.98 - 1 transcript "174" Adh grailexp CDS 2737860 2738132 0.99 + 0 transcript "148" Adh grailexp CDS 2738403 2739055 0.88 + 2 transcript "148" Adh grailexp CDS 2739266 2739461 0.03 + 0 transcript "148" Adh grailexp CDS 2739531 2740039 0.41 + 2 transcript "148" Adh grailexp CDS 2740542 2741090 0.45 + 2 transcript "149" Adh grailexp CDS 2741907 2742007 0.39 + 1 transcript "150" Adh grailexp CDS 2742269 2742500 0.21 + 2 transcript "150" Adh grailexp CDS 2744187 2745122 1.46 + 2 transcript "151" Adh grailexp CDS 2751337 2751465 0.83 - 2 transcript "173" Adh grailexp CDS 2751521 2751711 0.99 - 2 transcript "173" Adh grailexp CDS 2752612 2752742 0.93 + 1 transcript "152" Adh grailexp CDS 2752822 2752985 1.00 + 0 transcript "152" Adh grailexp CDS 2753042 2753322 0.85 + 2 transcript "152" Adh grailexp CDS 2754205 2754364 0.00 + 0 transcript "152" Adh grailexp CDS 2757391 2757589 0.91 + 0 transcript "153" Adh grailexp CDS 2757658 2758391 0.98 + 2 transcript "153" Adh grailexp CDS 2759770 2759892 0.00 + 2 transcript "154" Adh grailexp CDS 2760394 2760672 0.87 + 2 transcript "154" Adh grailexp CDS 2760766 2761087 0.98 + 0 transcript "154" Adh grailexp CDS 2761141 2762087 1.41 + 2 transcript "154" Adh grailexp CDS 2762287 2762710 0.99 - 0 transcript "172" Adh grailexp CDS 2763711 2763968 0.99 - 2 transcript "172" Adh grailexp CDS 2764030 2764118 0.97 - 2 transcript "172" Adh grailexp CDS 2772220 2772430 0.99 - 0 transcript "172" Adh grailexp CDS 2772600 2772777 0.99 - 2 transcript "172" Adh grailexp CDS 2773593 2774314 1.00 - 1 transcript "172" Adh grailexp CDS 2774754 2774927 0.99 - 2 transcript "172" Adh grailexp CDS 2776641 2777045 0.37 - 2 transcript "171" Adh grailexp CDS 2777390 2777609 0.41 - 2 transcript "170" Adh grailexp CDS 2777672 2778309 0.94 - 1 transcript "170" Adh grailexp CDS 2783806 2783886 0.28 - 2 transcript "170" Adh grailexp CDS 2786756 2787069 0.20 - 2 transcript "169" Adh grailexp CDS 2788407 2788454 0.12 - 0 transcript "169" Adh grailexp CDS 2788808 2789066 0.40 - 0 transcript "169" Adh grailexp CDS 2789139 2789567 0.38 - 2 transcript "168" Adh grailexp CDS 2792074 2792601 0.18 - 2 transcript "167" Adh grailexp CDS 2793626 2798713 1.37 - 2 transcript "166" Adh grailexp CDS 2804442 2805730 1.08 - 2 transcript "165" Adh grailexp CDS 2805800 2805903 0.98 - 0 transcript "165" Adh grailexp CDS 2815178 2815845 0.41 + 1 transcript "155" Adh grailexp CDS 2819863 2819929 0.40 + 2 transcript "155" Adh grailexp CDS 2849428 2849790 0.96 + 1 transcript "156" Adh grailexp CDS 2853764 2853994 0.97 + 1 transcript "156" Adh grailexp CDS 2854193 2855213 1.29 - 2 transcript "164" Adh grailexp CDS 2857635 2857663 0.17 - 1 transcript "164" Adh grailexp CDS 2860250 2860510 0.14 - 2 transcript "163" Adh grailexp CDS 2865306 2865339 0.32 - 0 transcript "163" Adh grailexp CDS 2871295 2871404 0.38 + 1 transcript "157" Adh grailexp CDS 2874237 2874469 0.18 + 0 transcript "157" Adh grailexp CDS 2884684 2884926 0.36 - 2 transcript "162" Adh grailexp CDS 2890670 2890686 0.45 + 1 transcript "158" Adh grailexp CDS 2894625 2895247 0.93 + 0 transcript "158" Adh grailexp CDS 2895319 2895977 0.92 + 2 transcript "158" Adh grailexp CDS 2896655 2896763 0.92 + 0 transcript "158" Adh grailexp CDS 2898444 2899001 0.98 + 0 transcript "158" Adh grailexp CDS 2899061 2899716 0.96 + 2 transcript "158" Adh grailexp CDS 2900448 2900565 0.94 + 0 transcript "159" Adh grailexp CDS 2900634 2901185 0.97 + 0 transcript "159" Adh grailexp CDS 2901452 2902107 0.93 + 2 transcript "159" Adh grailexp CDS 2910098 2910173 0.04 - 0 transcript "161" Adh grailexp CDS 2911759 2911898 0.45 - 2 transcript "161" Adh grailexp CDS 2914999 2915119 0.43 - 0 transcript "161" Adh grailexp CDS 2916879 2917012 0.41 - 2 transcript "160" Adh grailexp CDS 2917311 2917504 0.47 - 0 transcript "160" Adh grailexp CDS 2917751 2917988 0.98 - 1 transcript "160" Adh grailexp CDS 2918253 2918513 0.98 - 0 transcript "160" Adh grailexp CDS 2918684 2918711 0.33 - 0 transcript "160" # GeneMarkHMM Adh GeneMarkHMM CDS 54 441 . - . transcript "1" Adh GeneMarkHMM CDS 2379 2862 . - . transcript "1" Adh GeneMarkHMM CDS 3225 3550 . - . transcript "1" Adh GeneMarkHMM CDS 6718 7051 . - . transcript "1" Adh GeneMarkHMM stop_codon 7049 7051 . - . transcript "1" Adh GeneMarkHMM start_codon 21599 21601 . + . transcript "2" Adh GeneMarkHMM CDS 21599 21979 . + . transcript "2" Adh GeneMarkHMM CDS 22140 22295 . + . transcript "2" Adh GeneMarkHMM stop_codon 22293 22295 . + . transcript "2" Adh GeneMarkHMM stop_codon 29156 29158 . - . transcript "3" Adh GeneMarkHMM CDS 29156 29479 . - . transcript "3" Adh GeneMarkHMM stop_codon 29477 29479 . - . transcript "3" Adh GeneMarkHMM start_codon 34558 34560 . + . transcript "4" Adh GeneMarkHMM CDS 34558 34822 . + . transcript "4" Adh GeneMarkHMM CDS 34884 35332 . + . transcript "4" Adh GeneMarkHMM stop_codon 35330 35332 . + . transcript "4" Adh GeneMarkHMM stop_codon 35433 35435 . - . transcript "5" Adh GeneMarkHMM CDS 35433 35749 . - . transcript "5" Adh GeneMarkHMM CDS 35938 36226 . - . transcript "5" Adh GeneMarkHMM stop_codon 36224 36226 . - . transcript "5" Adh GeneMarkHMM start_codon 36410 36412 . + . transcript "6" Adh GeneMarkHMM CDS 36410 37315 . + . transcript "6" Adh GeneMarkHMM stop_codon 37313 37315 . + . transcript "6" Adh GeneMarkHMM start_codon 54448 54450 . + . transcript "7" Adh GeneMarkHMM CDS 54448 54572 . + . transcript "7" Adh GeneMarkHMM CDS 55155 55365 . + . transcript "7" Adh GeneMarkHMM CDS 55990 56083 . + . transcript "7" Adh GeneMarkHMM CDS 56155 56456 . + . transcript "7" Adh GeneMarkHMM CDS 56515 56520 . + . transcript "7" Adh GeneMarkHMM stop_codon 56518 56520 . + . transcript "7" Adh GeneMarkHMM stop_codon 89305 89307 . - . transcript "8" Adh GeneMarkHMM CDS 89305 90750 . - . transcript "8" Adh GeneMarkHMM stop_codon 90748 90750 . - . transcript "8" Adh GeneMarkHMM stop_codon 93123 93125 . - . transcript "9" Adh GeneMarkHMM CDS 93123 93999 . - . transcript "9" Adh GeneMarkHMM CDS 94266 94333 . - . transcript "9" Adh GeneMarkHMM stop_codon 94331 94333 . - . transcript "9" Adh GeneMarkHMM start_codon 103746 103748 . + . transcript "10" Adh GeneMarkHMM CDS 103746 103769 . + . transcript "10" Adh GeneMarkHMM CDS 103808 104330 . + . transcript "10" Adh GeneMarkHMM CDS 117406 117527 . + . transcript "10" Adh GeneMarkHMM stop_codon 117525 117527 . + . transcript "10" Adh GeneMarkHMM start_codon 124325 124327 . + . transcript "11" Adh GeneMarkHMM CDS 124325 124936 . + . transcript "11" Adh GeneMarkHMM CDS 127146 127292 . + . transcript "11" Adh GeneMarkHMM CDS 127771 127931 . + . transcript "11" Adh GeneMarkHMM CDS 127991 128225 . + . transcript "11" Adh GeneMarkHMM CDS 128296 129342 . + . transcript "11" Adh GeneMarkHMM CDS 129401 129965 . + . transcript "11" Adh GeneMarkHMM CDS 130136 130285 . + . transcript "11" Adh GeneMarkHMM CDS 131040 131248 . + . transcript "11" Adh GeneMarkHMM stop_codon 131246 131248 . + . transcript "11" Adh GeneMarkHMM stop_codon 133608 133610 . - . transcript "12" Adh GeneMarkHMM CDS 133608 134233 . - . transcript "12" Adh GeneMarkHMM CDS 134862 134967 . - . transcript "12" Adh GeneMarkHMM stop_codon 134965 134967 . - . transcript "12" Adh GeneMarkHMM start_codon 159578 159580 . + . transcript "13" Adh GeneMarkHMM CDS 159578 159799 . + . transcript "13" Adh GeneMarkHMM CDS 161727 162105 . + . transcript "13" Adh GeneMarkHMM CDS 162442 162557 . + . transcript "13" Adh GeneMarkHMM CDS 162616 163137 . + . transcript "13" Adh GeneMarkHMM CDS 163297 163527 . + . transcript "13" Adh GeneMarkHMM stop_codon 163525 163527 . + . transcript "13" Adh GeneMarkHMM start_codon 164127 164129 . + . transcript "14" Adh GeneMarkHMM CDS 164127 164381 . + . transcript "14" Adh GeneMarkHMM CDS 164602 164607 . + . transcript "14" Adh GeneMarkHMM stop_codon 164605 164607 . + . transcript "14" Adh GeneMarkHMM start_codon 168293 168295 . + . transcript "15" Adh GeneMarkHMM CDS 168293 168344 . + . transcript "15" Adh GeneMarkHMM CDS 168413 168503 . + . transcript "15" Adh GeneMarkHMM CDS 168559 168634 . + . transcript "15" Adh GeneMarkHMM stop_codon 168632 168634 . + . transcript "15" Adh GeneMarkHMM stop_codon 171963 171965 . - . transcript "16" Adh GeneMarkHMM CDS 171963 172056 . - . transcript "16" Adh GeneMarkHMM CDS 172369 172562 . - . transcript "16" Adh GeneMarkHMM stop_codon 172560 172562 . - . transcript "16" Adh GeneMarkHMM stop_codon 172620 172622 . - . transcript "17" Adh GeneMarkHMM CDS 172620 172706 . - . transcript "17" Adh GeneMarkHMM CDS 172829 172869 . - . transcript "17" Adh GeneMarkHMM CDS 177956 178015 . - . transcript "17" Adh GeneMarkHMM CDS 178136 178300 . - . transcript "17" Adh GeneMarkHMM CDS 181272 181409 . - . transcript "17" Adh GeneMarkHMM CDS 183107 183496 . - . transcript "17" Adh GeneMarkHMM CDS 183596 183635 . - . transcript "17" Adh GeneMarkHMM CDS 183699 183764 . - . transcript "17" Adh GeneMarkHMM CDS 183835 184040 . - . transcript "17" Adh GeneMarkHMM CDS 184241 184282 . - . transcript "17" Adh GeneMarkHMM CDS 185558 185615 . - . transcript "17" Adh GeneMarkHMM stop_codon 185613 185615 . - . transcript "17" Adh GeneMarkHMM start_codon 202128 202130 . + . transcript "18" Adh GeneMarkHMM CDS 202128 202349 . + . transcript "18" Adh GeneMarkHMM CDS 202410 202646 . + . transcript "18" Adh GeneMarkHMM CDS 202700 204199 . + . transcript "18" Adh GeneMarkHMM stop_codon 204197 204199 . + . transcript "18" Adh GeneMarkHMM stop_codon 214878 214880 . - . transcript "19" Adh GeneMarkHMM CDS 214878 214978 . - . transcript "19" Adh GeneMarkHMM CDS 216182 216761 . - . transcript "19" Adh GeneMarkHMM CDS 216820 217188 . - . transcript "19" Adh GeneMarkHMM stop_codon 217186 217188 . - . transcript "19" Adh GeneMarkHMM start_codon 223587 223589 . + . transcript "20" Adh GeneMarkHMM CDS 223587 223680 . + . transcript "20" Adh GeneMarkHMM CDS 227770 227992 . + . transcript "20" Adh GeneMarkHMM CDS 229841 230462 . + . transcript "20" Adh GeneMarkHMM stop_codon 230460 230462 . + . transcript "20" Adh GeneMarkHMM stop_codon 230999 231001 . - . transcript "21" Adh GeneMarkHMM CDS 230999 231160 . - . transcript "21" Adh GeneMarkHMM CDS 231210 231322 . - . transcript "21" Adh GeneMarkHMM CDS 231417 231549 . - . transcript "21" Adh GeneMarkHMM CDS 234442 234534 . - . transcript "21" Adh GeneMarkHMM CDS 235723 235785 . - . transcript "21" Adh GeneMarkHMM CDS 236646 236810 . - . transcript "21" Adh GeneMarkHMM stop_codon 236808 236810 . - . transcript "21" Adh GeneMarkHMM stop_codon 248109 248111 . - . transcript "22" Adh GeneMarkHMM CDS 248109 248276 . - . transcript "22" Adh GeneMarkHMM CDS 248697 248849 . - . transcript "22" Adh GeneMarkHMM stop_codon 248847 248849 . - . transcript "22" Adh GeneMarkHMM start_codon 264992 264994 . + . transcript "23" Adh GeneMarkHMM CDS 264992 264997 . + . transcript "23" Adh GeneMarkHMM CDS 265088 266322 . + . transcript "23" Adh GeneMarkHMM CDS 266392 266619 . + . transcript "23" Adh GeneMarkHMM CDS 266684 266795 . + . transcript "23" Adh GeneMarkHMM CDS 266856 266867 . + . transcript "23" Adh GeneMarkHMM CDS 266935 266945 . + . transcript "23" Adh GeneMarkHMM CDS 267003 267073 . + . transcript "23" Adh GeneMarkHMM CDS 267134 267234 . + . transcript "23" Adh GeneMarkHMM stop_codon 267232 267234 . + . transcript "23" Adh GeneMarkHMM stop_codon 268751 268753 . - . transcript "24" Adh GeneMarkHMM CDS 268751 268798 . - . transcript "24" Adh GeneMarkHMM CDS 268994 269157 . - . transcript "24" Adh GeneMarkHMM CDS 269222 269559 . - . transcript "24" Adh GeneMarkHMM CDS 269629 269907 . - . transcript "24" Adh GeneMarkHMM CDS 271522 271573 . - . transcript "24" Adh GeneMarkHMM CDS 273396 273483 . - . transcript "24" Adh GeneMarkHMM stop_codon 273481 273483 . - . transcript "24" Adh GeneMarkHMM start_codon 274763 274765 . + . transcript "25" Adh GeneMarkHMM CDS 274763 275848 . + . transcript "25" Adh GeneMarkHMM stop_codon 275846 275848 . + . transcript "25" Adh GeneMarkHMM stop_codon 276361 276363 . - . transcript "26" Adh GeneMarkHMM CDS 276361 276696 . - . transcript "26" Adh GeneMarkHMM CDS 276748 277188 . - . transcript "26" Adh GeneMarkHMM stop_codon 277186 277188 . - . transcript "26" Adh GeneMarkHMM start_codon 277921 277923 . + . transcript "27" Adh GeneMarkHMM CDS 277921 278103 . + . transcript "27" Adh GeneMarkHMM CDS 278222 278345 . + . transcript "27" Adh GeneMarkHMM CDS 278537 278737 . + . transcript "27" Adh GeneMarkHMM CDS 278802 279272 . + . transcript "27" Adh GeneMarkHMM CDS 279548 279726 . + . transcript "27" Adh GeneMarkHMM CDS 280031 280247 . + . transcript "27" Adh GeneMarkHMM CDS 280310 280610 . + . transcript "27" Adh GeneMarkHMM CDS 280674 280986 . + . transcript "27" Adh GeneMarkHMM CDS 281051 281202 . + . transcript "27" Adh GeneMarkHMM CDS 281264 281390 . + . transcript "27" Adh GeneMarkHMM CDS 281550 281787 . + . transcript "27" Adh GeneMarkHMM CDS 281848 282471 . + . transcript "27" Adh GeneMarkHMM CDS 282539 283541 . + . transcript "27" Adh GeneMarkHMM CDS 283608 284052 . + . transcript "27" Adh GeneMarkHMM stop_codon 284050 284052 . + . transcript "27" Adh GeneMarkHMM start_codon 284779 284781 . + . transcript "28" Adh GeneMarkHMM CDS 284779 284915 . + . transcript "28" Adh GeneMarkHMM CDS 284969 285346 . + . transcript "28" Adh GeneMarkHMM CDS 285416 286886 . + . transcript "28" Adh GeneMarkHMM stop_codon 286884 286886 . + . transcript "28" Adh GeneMarkHMM start_codon 287599 287601 . + . transcript "29" Adh GeneMarkHMM CDS 287599 288379 . + . transcript "29" Adh GeneMarkHMM CDS 288647 292689 . + . transcript "29" Adh GeneMarkHMM CDS 292759 292896 . + . transcript "29" Adh GeneMarkHMM stop_codon 292894 292896 . + . transcript "29" Adh GeneMarkHMM start_codon 297680 297682 . + . transcript "30" Adh GeneMarkHMM CDS 297680 297713 . + . transcript "30" Adh GeneMarkHMM CDS 302560 302718 . + . transcript "30" Adh GeneMarkHMM CDS 302786 303405 . + . transcript "30" Adh GeneMarkHMM stop_codon 303403 303405 . + . transcript "30" Adh GeneMarkHMM stop_codon 303960 303962 . - . transcript "31" Adh GeneMarkHMM CDS 303960 304272 . - . transcript "31" Adh GeneMarkHMM CDS 304330 305201 . - . transcript "31" Adh GeneMarkHMM stop_codon 305199 305201 . - . transcript "31" Adh GeneMarkHMM start_codon 305396 305398 . + . transcript "32" Adh GeneMarkHMM CDS 305396 305516 . + . transcript "32" Adh GeneMarkHMM CDS 305577 305737 . + . transcript "32" Adh GeneMarkHMM CDS 305803 306108 . + . transcript "32" Adh GeneMarkHMM CDS 306230 306385 . + . transcript "32" Adh GeneMarkHMM stop_codon 306383 306385 . + . transcript "32" Adh GeneMarkHMM stop_codon 306476 306478 . - . transcript "33" Adh GeneMarkHMM CDS 306476 306985 . - . transcript "33" Adh GeneMarkHMM stop_codon 306983 306985 . - . transcript "33" Adh GeneMarkHMM start_codon 307774 307776 . + . transcript "34" Adh GeneMarkHMM CDS 307774 307790 . + . transcript "34" Adh GeneMarkHMM CDS 307841 309056 . + . transcript "34" Adh GeneMarkHMM CDS 309110 309467 . + . transcript "34" Adh GeneMarkHMM CDS 309530 310452 . + . transcript "34" Adh GeneMarkHMM CDS 310517 311365 . + . transcript "34" Adh GeneMarkHMM CDS 311428 312318 . + . transcript "34" Adh GeneMarkHMM CDS 312387 313020 . + . transcript "34" Adh GeneMarkHMM CDS 313086 313091 . + . transcript "34" Adh GeneMarkHMM CDS 314121 314181 . + . transcript "34" Adh GeneMarkHMM CDS 315200 315899 . + . transcript "34" Adh GeneMarkHMM CDS 316433 316800 . + . transcript "34" Adh GeneMarkHMM CDS 316865 317462 . + . transcript "34" Adh GeneMarkHMM stop_codon 317460 317462 . + . transcript "34" Adh GeneMarkHMM stop_codon 317803 317805 . - . transcript "35" Adh GeneMarkHMM CDS 317803 317843 . - . transcript "35" Adh GeneMarkHMM CDS 317896 318548 . - . transcript "35" Adh GeneMarkHMM CDS 318608 319430 . - . transcript "35" Adh GeneMarkHMM CDS 319486 321443 . - . transcript "35" Adh GeneMarkHMM CDS 321968 323027 . - . transcript "35" Adh GeneMarkHMM CDS 323097 323169 . - . transcript "35" Adh GeneMarkHMM stop_codon 323167 323169 . - . transcript "35" Adh GeneMarkHMM start_codon 323788 323790 . + . transcript "36" Adh GeneMarkHMM CDS 323788 324885 . + . transcript "36" Adh GeneMarkHMM CDS 324939 325223 . + . transcript "36" Adh GeneMarkHMM stop_codon 325221 325223 . + . transcript "36" Adh GeneMarkHMM stop_codon 325240 325242 . - . transcript "37" Adh GeneMarkHMM CDS 325240 325634 . - . transcript "37" Adh GeneMarkHMM CDS 325689 326352 . - . transcript "37" Adh GeneMarkHMM CDS 326433 326822 . - . transcript "37" Adh GeneMarkHMM stop_codon 326820 326822 . - . transcript "37" Adh GeneMarkHMM start_codon 327175 327177 . + . transcript "38" Adh GeneMarkHMM CDS 327175 328002 . + . transcript "38" Adh GeneMarkHMM stop_codon 328000 328002 . + . transcript "38" Adh GeneMarkHMM stop_codon 328048 328050 . - . transcript "39" Adh GeneMarkHMM CDS 328048 328411 . - . transcript "39" Adh GeneMarkHMM CDS 328473 328634 . - . transcript "39" Adh GeneMarkHMM CDS 328690 328733 . - . transcript "39" Adh GeneMarkHMM stop_codon 328731 328733 . - . transcript "39" Adh GeneMarkHMM start_codon 329808 329810 . + . transcript "40" Adh GeneMarkHMM CDS 329808 330183 . + . transcript "40" Adh GeneMarkHMM CDS 330239 330252 . + . transcript "40" Adh GeneMarkHMM stop_codon 330250 330252 . + . transcript "40" Adh GeneMarkHMM stop_codon 331099 331101 . - . transcript "41" Adh GeneMarkHMM CDS 331099 331197 . - . transcript "41" Adh GeneMarkHMM CDS 334622 334786 . - . transcript "41" Adh GeneMarkHMM CDS 334847 335125 . - . transcript "41" Adh GeneMarkHMM CDS 335195 335202 . - . transcript "41" Adh GeneMarkHMM CDS 336703 337323 . - . transcript "41" Adh GeneMarkHMM CDS 337379 337457 . - . transcript "41" Adh GeneMarkHMM stop_codon 337455 337457 . - . transcript "41" Adh GeneMarkHMM stop_codon 338167 338169 . - . transcript "42" Adh GeneMarkHMM CDS 338167 338879 . - . transcript "42" Adh GeneMarkHMM CDS 338944 339013 . - . transcript "42" Adh GeneMarkHMM stop_codon 339011 339013 . - . transcript "42" Adh GeneMarkHMM start_codon 340529 340531 . + . transcript "43" Adh GeneMarkHMM CDS 340529 340634 . + . transcript "43" Adh GeneMarkHMM CDS 340705 340870 . + . transcript "43" Adh GeneMarkHMM CDS 340926 341517 . + . transcript "43" Adh GeneMarkHMM stop_codon 341515 341517 . + . transcript "43" Adh GeneMarkHMM start_codon 341713 341715 . + . transcript "44" Adh GeneMarkHMM CDS 341713 341857 . + . transcript "44" Adh GeneMarkHMM CDS 342003 342751 . + . transcript "44" Adh GeneMarkHMM stop_codon 342749 342751 . + . transcript "44" Adh GeneMarkHMM start_codon 343169 343171 . + . transcript "45" Adh GeneMarkHMM CDS 343169 343368 . + . transcript "45" Adh GeneMarkHMM CDS 343432 343984 . + . transcript "45" Adh GeneMarkHMM stop_codon 343982 343984 . + . transcript "45" Adh GeneMarkHMM stop_codon 354817 354819 . - . transcript "46" Adh GeneMarkHMM CDS 354817 354964 . - . transcript "46" Adh GeneMarkHMM CDS 359448 359547 . - . transcript "46" Adh GeneMarkHMM CDS 360189 360259 . - . transcript "46" Adh GeneMarkHMM CDS 360322 360383 . - . transcript "46" Adh GeneMarkHMM stop_codon 360381 360383 . - . transcript "46" Adh GeneMarkHMM start_codon 373286 373288 . + . transcript "47" Adh GeneMarkHMM CDS 373286 373457 . + . transcript "47" Adh GeneMarkHMM CDS 385051 385283 . + . transcript "47" Adh GeneMarkHMM CDS 388780 388921 . + . transcript "47" Adh GeneMarkHMM CDS 389006 389140 . + . transcript "47" Adh GeneMarkHMM CDS 389208 390491 . + . transcript "47" Adh GeneMarkHMM CDS 390556 390673 . + . transcript "47" Adh GeneMarkHMM CDS 390737 391112 . + . transcript "47" Adh GeneMarkHMM CDS 391177 391500 . + . transcript "47" Adh GeneMarkHMM stop_codon 391498 391500 . + . transcript "47" Adh GeneMarkHMM stop_codon 393573 393575 . - . transcript "48" Adh GeneMarkHMM CDS 393573 393814 . - . transcript "48" Adh GeneMarkHMM CDS 393894 394052 . - . transcript "48" Adh GeneMarkHMM CDS 394383 395732 . - . transcript "48" Adh GeneMarkHMM CDS 395826 397468 . - . transcript "48" Adh GeneMarkHMM CDS 397532 397671 . - . transcript "48" Adh GeneMarkHMM stop_codon 397669 397671 . - . transcript "48" Adh GeneMarkHMM start_codon 400338 400340 . + . transcript "49" Adh GeneMarkHMM CDS 400338 400923 . + . transcript "49" Adh GeneMarkHMM CDS 401350 401713 . + . transcript "49" Adh GeneMarkHMM CDS 401775 402341 . + . transcript "49" Adh GeneMarkHMM CDS 402399 402539 . + . transcript "49" Adh GeneMarkHMM CDS 402607 402779 . + . transcript "49" Adh GeneMarkHMM CDS 403234 403277 . + . transcript "49" Adh GeneMarkHMM CDS 403468 404414 . + . transcript "49" Adh GeneMarkHMM CDS 404467 405027 . + . transcript "49" Adh GeneMarkHMM CDS 405085 405391 . + . transcript "49" Adh GeneMarkHMM stop_codon 405389 405391 . + . transcript "49" Adh GeneMarkHMM start_codon 405952 405954 . + . transcript "50" Adh GeneMarkHMM CDS 405952 406314 . + . transcript "50" Adh GeneMarkHMM stop_codon 406312 406314 . + . transcript "50" Adh GeneMarkHMM start_codon 408759 408761 . + . transcript "51" Adh GeneMarkHMM CDS 408759 409001 . + . transcript "51" Adh GeneMarkHMM CDS 409150 409656 . + . transcript "51" Adh GeneMarkHMM CDS 410172 410315 . + . transcript "51" Adh GeneMarkHMM CDS 410372 410612 . + . transcript "51" Adh GeneMarkHMM CDS 410677 411401 . + . transcript "51" Adh GeneMarkHMM CDS 411728 411831 . + . transcript "51" Adh GeneMarkHMM CDS 411898 412000 . + . transcript "51" Adh GeneMarkHMM stop_codon 411998 412000 . + . transcript "51" Adh GeneMarkHMM stop_codon 414755 414757 . - . transcript "52" Adh GeneMarkHMM CDS 414755 414778 . - . transcript "52" Adh GeneMarkHMM CDS 414843 415055 . - . transcript "52" Adh GeneMarkHMM CDS 415401 415519 . - . transcript "52" Adh GeneMarkHMM CDS 415584 416211 . - . transcript "52" Adh GeneMarkHMM CDS 416276 416749 . - . transcript "52" Adh GeneMarkHMM CDS 417100 417111 . - . transcript "52" Adh GeneMarkHMM stop_codon 417109 417111 . - . transcript "52" Adh GeneMarkHMM stop_codon 426746 426748 . - . transcript "53" Adh GeneMarkHMM CDS 426746 427525 . - . transcript "53" Adh GeneMarkHMM stop_codon 427523 427525 . - . transcript "53" Adh GeneMarkHMM stop_codon 438979 438981 . - . transcript "54" Adh GeneMarkHMM CDS 438979 439800 . - . transcript "54" Adh GeneMarkHMM CDS 442718 442849 . - . transcript "54" Adh GeneMarkHMM stop_codon 442847 442849 . - . transcript "54" Adh GeneMarkHMM start_codon 448386 448388 . + . transcript "55" Adh GeneMarkHMM CDS 448386 448426 . + . transcript "55" Adh GeneMarkHMM CDS 448467 448607 . + . transcript "55" Adh GeneMarkHMM CDS 449015 449247 . + . transcript "55" Adh GeneMarkHMM CDS 451667 451902 . + . transcript "55" Adh GeneMarkHMM CDS 451945 452184 . + . transcript "55" Adh GeneMarkHMM stop_codon 452182 452184 . + . transcript "55" Adh GeneMarkHMM start_codon 454209 454211 . + . transcript "56" Adh GeneMarkHMM CDS 454209 454325 . + . transcript "56" Adh GeneMarkHMM CDS 454581 454755 . + . transcript "56" Adh GeneMarkHMM CDS 454814 454931 . + . transcript "56" Adh GeneMarkHMM CDS 454999 455702 . + . transcript "56" Adh GeneMarkHMM CDS 455870 456267 . + . transcript "56" Adh GeneMarkHMM stop_codon 456265 456267 . + . transcript "56" Adh GeneMarkHMM start_codon 457298 457300 . + . transcript "57" Adh GeneMarkHMM CDS 457298 457488 . + . transcript "57" Adh GeneMarkHMM CDS 457649 458206 . + . transcript "57" Adh GeneMarkHMM CDS 458285 458488 . + . transcript "57" Adh GeneMarkHMM CDS 458547 458802 . + . transcript "57" Adh GeneMarkHMM stop_codon 458800 458802 . + . transcript "57" Adh GeneMarkHMM stop_codon 458837 458839 . - . transcript "58" Adh GeneMarkHMM CDS 458837 459146 . - . transcript "58" Adh GeneMarkHMM CDS 459225 459761 . - . transcript "58" Adh GeneMarkHMM CDS 460256 460669 . - . transcript "58" Adh GeneMarkHMM CDS 461291 461443 . - . transcript "58" Adh GeneMarkHMM CDS 461500 461675 . - . transcript "58" Adh GeneMarkHMM CDS 462096 462110 . - . transcript "58" Adh GeneMarkHMM CDS 462179 462584 . - . transcript "58" Adh GeneMarkHMM CDS 462646 463209 . - . transcript "58" Adh GeneMarkHMM CDS 463368 463657 . - . transcript "58" Adh GeneMarkHMM stop_codon 463655 463657 . - . transcript "58" Adh GeneMarkHMM start_codon 464308 464310 . + . transcript "59" Adh GeneMarkHMM CDS 464308 464456 . + . transcript "59" Adh GeneMarkHMM CDS 464888 465434 . + . transcript "59" Adh GeneMarkHMM stop_codon 465432 465434 . + . transcript "59" Adh GeneMarkHMM stop_codon 466308 466310 . - . transcript "60" Adh GeneMarkHMM CDS 466308 466360 . - . transcript "60" Adh GeneMarkHMM CDS 467993 469610 . - . transcript "60" Adh GeneMarkHMM stop_codon 469608 469610 . - . transcript "60" Adh GeneMarkHMM start_codon 471109 471111 . + . transcript "61" Adh GeneMarkHMM CDS 471109 471296 . + . transcript "61" Adh GeneMarkHMM CDS 471441 471687 . + . transcript "61" Adh GeneMarkHMM CDS 471752 471856 . + . transcript "61" Adh GeneMarkHMM CDS 471944 472490 . + . transcript "61" Adh GeneMarkHMM CDS 472557 472823 . + . transcript "61" Adh GeneMarkHMM CDS 472965 473128 . + . transcript "61" Adh GeneMarkHMM stop_codon 473126 473128 . + . transcript "61" Adh GeneMarkHMM start_codon 474097 474099 . + . transcript "62" Adh GeneMarkHMM CDS 474097 474189 . + . transcript "62" Adh GeneMarkHMM CDS 474251 474306 . + . transcript "62" Adh GeneMarkHMM CDS 474365 475283 . + . transcript "62" Adh GeneMarkHMM CDS 475427 476389 . + . transcript "62" Adh GeneMarkHMM stop_codon 476387 476389 . + . transcript "62" Adh GeneMarkHMM stop_codon 477171 477173 . - . transcript "63" Adh GeneMarkHMM CDS 477171 477490 . - . transcript "63" Adh GeneMarkHMM CDS 477548 479329 . - . transcript "63" Adh GeneMarkHMM CDS 479386 479753 . - . transcript "63" Adh GeneMarkHMM CDS 479815 479958 . - . transcript "63" Adh GeneMarkHMM CDS 480016 480081 . - . transcript "63" Adh GeneMarkHMM CDS 480147 480287 . - . transcript "63" Adh GeneMarkHMM CDS 480343 480480 . - . transcript "63" Adh GeneMarkHMM CDS 481570 481638 . - . transcript "63" Adh GeneMarkHMM CDS 484195 484338 . - . transcript "63" Adh GeneMarkHMM CDS 484664 484807 . - . transcript "63" Adh GeneMarkHMM CDS 485391 485462 . - . transcript "63" Adh GeneMarkHMM CDS 486686 487143 . - . transcript "63" Adh GeneMarkHMM stop_codon 487141 487143 . - . transcript "63" Adh GeneMarkHMM start_codon 509545 509547 . + . transcript "64" Adh GeneMarkHMM CDS 509545 509783 . + . transcript "64" Adh GeneMarkHMM CDS 509881 510226 . + . transcript "64" Adh GeneMarkHMM CDS 510287 510786 . + . transcript "64" Adh GeneMarkHMM CDS 511784 512375 . + . transcript "64" Adh GeneMarkHMM CDS 512435 512758 . + . transcript "64" Adh GeneMarkHMM stop_codon 512756 512758 . + . transcript "64" Adh GeneMarkHMM stop_codon 513238 513240 . - . transcript "65" Adh GeneMarkHMM CDS 513238 513921 . - . transcript "65" Adh GeneMarkHMM stop_codon 513919 513921 . - . transcript "65" Adh GeneMarkHMM start_codon 520781 520783 . + . transcript "66" Adh GeneMarkHMM CDS 520781 521850 . + . transcript "66" Adh GeneMarkHMM CDS 522013 522988 . + . transcript "66" Adh GeneMarkHMM stop_codon 522986 522988 . + . transcript "66" Adh GeneMarkHMM stop_codon 523149 523151 . - . transcript "67" Adh GeneMarkHMM CDS 523149 523205 . - . transcript "67" Adh GeneMarkHMM CDS 523404 523601 . - . transcript "67" Adh GeneMarkHMM CDS 523660 524253 . - . transcript "67" Adh GeneMarkHMM CDS 524438 525283 . - . transcript "67" Adh GeneMarkHMM stop_codon 525281 525283 . - . transcript "67" Adh GeneMarkHMM start_codon 527046 527048 . + . transcript "68" Adh GeneMarkHMM CDS 527046 527116 . + . transcript "68" Adh GeneMarkHMM CDS 528099 528231 . + . transcript "68" Adh GeneMarkHMM stop_codon 528229 528231 . + . transcript "68" Adh GeneMarkHMM stop_codon 532974 532976 . - . transcript "69" Adh GeneMarkHMM CDS 532974 533068 . - . transcript "69" Adh GeneMarkHMM CDS 536670 536913 . - . transcript "69" Adh GeneMarkHMM stop_codon 536911 536913 . - . transcript "69" Adh GeneMarkHMM start_codon 541380 541382 . + . transcript "70" Adh GeneMarkHMM CDS 541380 542513 . + . transcript "70" Adh GeneMarkHMM stop_codon 542511 542513 . + . transcript "70" Adh GeneMarkHMM stop_codon 544950 544952 . - . transcript "71" Adh GeneMarkHMM CDS 544950 545051 . - . transcript "71" Adh GeneMarkHMM CDS 553888 554016 . - . transcript "71" Adh GeneMarkHMM stop_codon 554014 554016 . - . transcript "71" Adh GeneMarkHMM start_codon 555360 555362 . + . transcript "72" Adh GeneMarkHMM CDS 555360 555824 . + . transcript "72" Adh GeneMarkHMM CDS 555920 556168 . + . transcript "72" Adh GeneMarkHMM CDS 556228 556260 . + . transcript "72" Adh GeneMarkHMM stop_codon 556258 556260 . + . transcript "72" Adh GeneMarkHMM start_codon 570015 570017 . + . transcript "73" Adh GeneMarkHMM CDS 570015 570098 . + . transcript "73" Adh GeneMarkHMM CDS 570329 570703 . + . transcript "73" Adh GeneMarkHMM CDS 570872 570947 . + . transcript "73" Adh GeneMarkHMM CDS 574289 574465 . + . transcript "73" Adh GeneMarkHMM CDS 575409 575533 . + . transcript "73" Adh GeneMarkHMM stop_codon 575531 575533 . + . transcript "73" Adh GeneMarkHMM stop_codon 581722 581724 . - . transcript "74" Adh GeneMarkHMM CDS 581722 581866 . - . transcript "74" Adh GeneMarkHMM CDS 589628 589720 . - . transcript "74" Adh GeneMarkHMM CDS 590105 590169 . - . transcript "74" Adh GeneMarkHMM stop_codon 590167 590169 . - . transcript "74" Adh GeneMarkHMM start_codon 598403 598405 . + . transcript "75" Adh GeneMarkHMM CDS 598403 598796 . + . transcript "75" Adh GeneMarkHMM CDS 598857 599119 . + . transcript "75" Adh GeneMarkHMM CDS 599219 600433 . + . transcript "75" Adh GeneMarkHMM stop_codon 600431 600433 . + . transcript "75" Adh GeneMarkHMM stop_codon 601945 601947 . - . transcript "76" Adh GeneMarkHMM CDS 601945 602889 . - . transcript "76" Adh GeneMarkHMM CDS 602944 603029 . - . transcript "76" Adh GeneMarkHMM CDS 603477 604158 . - . transcript "76" Adh GeneMarkHMM stop_codon 604156 604158 . - . transcript "76" Adh GeneMarkHMM stop_codon 620744 620746 . - . transcript "77" Adh GeneMarkHMM CDS 620744 620960 . - . transcript "77" Adh GeneMarkHMM CDS 622933 623026 . - . transcript "77" Adh GeneMarkHMM CDS 623090 623174 . - . transcript "77" Adh GeneMarkHMM stop_codon 623172 623174 . - . transcript "77" Adh GeneMarkHMM start_codon 647744 647746 . + . transcript "78" Adh GeneMarkHMM CDS 647744 647830 . + . transcript "78" Adh GeneMarkHMM CDS 650611 651153 . + . transcript "78" Adh GeneMarkHMM CDS 651278 651478 . + . transcript "78" Adh GeneMarkHMM CDS 651583 652282 . + . transcript "78" Adh GeneMarkHMM CDS 652397 652824 . + . transcript "78" Adh GeneMarkHMM stop_codon 652822 652824 . + . transcript "78" Adh GeneMarkHMM stop_codon 654984 654986 . - . transcript "79" Adh GeneMarkHMM CDS 654984 656089 . - . transcript "79" Adh GeneMarkHMM CDS 656165 656741 . - . transcript "79" Adh GeneMarkHMM CDS 657724 658001 . - . transcript "79" Adh GeneMarkHMM CDS 658058 658265 . - . transcript "79" Adh GeneMarkHMM CDS 658326 658463 . - . transcript "79" Adh GeneMarkHMM CDS 658526 660852 . - . transcript "79" Adh GeneMarkHMM CDS 660917 661331 . - . transcript "79" Adh GeneMarkHMM CDS 662947 662971 . - . transcript "79" Adh GeneMarkHMM CDS 664035 664204 . - . transcript "79" Adh GeneMarkHMM stop_codon 664202 664204 . - . transcript "79" Adh GeneMarkHMM start_codon 672131 672133 . + . transcript "80" Adh GeneMarkHMM CDS 672131 672241 . + . transcript "80" Adh GeneMarkHMM CDS 672515 672520 . + . transcript "80" Adh GeneMarkHMM stop_codon 672518 672520 . + . transcript "80" Adh GeneMarkHMM stop_codon 679874 679876 . - . transcript "81" Adh GeneMarkHMM CDS 679874 680889 . - . transcript "81" Adh GeneMarkHMM CDS 681905 682015 . - . transcript "81" Adh GeneMarkHMM CDS 682600 682750 . - . transcript "81" Adh GeneMarkHMM CDS 682831 682969 . - . transcript "81" Adh GeneMarkHMM CDS 689469 689746 . - . transcript "81" Adh GeneMarkHMM CDS 689811 689983 . - . transcript "81" Adh GeneMarkHMM CDS 690663 691029 . - . transcript "81" Adh GeneMarkHMM CDS 691393 691416 . - . transcript "81" Adh GeneMarkHMM stop_codon 691414 691416 . - . transcript "81" Adh GeneMarkHMM start_codon 720335 720337 . + . transcript "82" Adh GeneMarkHMM CDS 720335 720408 . + . transcript "82" Adh GeneMarkHMM CDS 720479 720493 . + . transcript "82" Adh GeneMarkHMM CDS 720757 720823 . + . transcript "82" Adh GeneMarkHMM stop_codon 720821 720823 . + . transcript "82" Adh GeneMarkHMM start_codon 757457 757459 . + . transcript "83" Adh GeneMarkHMM CDS 757457 757859 . + . transcript "83" Adh GeneMarkHMM CDS 758124 758188 . + . transcript "83" Adh GeneMarkHMM stop_codon 758186 758188 . + . transcript "83" Adh GeneMarkHMM stop_codon 763773 763775 . - . transcript "84" Adh GeneMarkHMM CDS 763773 763859 . - . transcript "84" Adh GeneMarkHMM CDS 767649 767787 . - . transcript "84" Adh GeneMarkHMM CDS 767844 768100 . - . transcript "84" Adh GeneMarkHMM stop_codon 768098 768100 . - . transcript "84" Adh GeneMarkHMM start_codon 771216 771218 . + . transcript "85" Adh GeneMarkHMM CDS 771216 771615 . + . transcript "85" Adh GeneMarkHMM CDS 771955 772295 . + . transcript "85" Adh GeneMarkHMM CDS 779692 781583 . + . transcript "85" Adh GeneMarkHMM CDS 781886 782726 . + . transcript "85" Adh GeneMarkHMM stop_codon 782724 782726 . + . transcript "85" Adh GeneMarkHMM start_codon 801999 802001 . + . transcript "86" Adh GeneMarkHMM CDS 801999 802914 . + . transcript "86" Adh GeneMarkHMM CDS 813291 814650 . + . transcript "86" Adh GeneMarkHMM CDS 814726 814981 . + . transcript "86" Adh GeneMarkHMM CDS 815046 815442 . + . transcript "86" Adh GeneMarkHMM CDS 815528 817215 . + . transcript "86" Adh GeneMarkHMM CDS 817273 818025 . + . transcript "86" Adh GeneMarkHMM CDS 818086 818367 . + . transcript "86" Adh GeneMarkHMM CDS 818447 818574 . + . transcript "86" Adh GeneMarkHMM CDS 818633 819290 . + . transcript "86" Adh GeneMarkHMM CDS 820171 820789 . + . transcript "86" Adh GeneMarkHMM CDS 820846 820979 . + . transcript "86" Adh GeneMarkHMM CDS 821037 821265 . + . transcript "86" Adh GeneMarkHMM CDS 821333 821487 . + . transcript "86" Adh GeneMarkHMM stop_codon 821485 821487 . + . transcript "86" Adh GeneMarkHMM start_codon 822205 822207 . + . transcript "87" Adh GeneMarkHMM CDS 822205 822454 . + . transcript "87" Adh GeneMarkHMM CDS 822511 822848 . + . transcript "87" Adh GeneMarkHMM CDS 822907 824011 . + . transcript "87" Adh GeneMarkHMM CDS 824074 824822 . + . transcript "87" Adh GeneMarkHMM CDS 824885 825688 . + . transcript "87" Adh GeneMarkHMM CDS 825804 826423 . + . transcript "87" Adh GeneMarkHMM CDS 826499 826533 . + . transcript "87" Adh GeneMarkHMM CDS 826922 827087 . + . transcript "87" Adh GeneMarkHMM CDS 827148 827511 . + . transcript "87" Adh GeneMarkHMM stop_codon 827509 827511 . + . transcript "87" Adh GeneMarkHMM start_codon 828047 828049 . + . transcript "88" Adh GeneMarkHMM CDS 828047 828289 . + . transcript "88" Adh GeneMarkHMM CDS 828734 828739 . + . transcript "88" Adh GeneMarkHMM stop_codon 828737 828739 . + . transcript "88" Adh GeneMarkHMM start_codon 832137 832139 . + . transcript "89" Adh GeneMarkHMM CDS 832137 833668 . + . transcript "89" Adh GeneMarkHMM CDS 835043 835312 . + . transcript "89" Adh GeneMarkHMM CDS 836514 837106 . + . transcript "89" Adh GeneMarkHMM CDS 837173 837428 . + . transcript "89" Adh GeneMarkHMM CDS 837486 837859 . + . transcript "89" Adh GeneMarkHMM CDS 837919 838152 . + . transcript "89" Adh GeneMarkHMM CDS 838217 839076 . + . transcript "89" Adh GeneMarkHMM stop_codon 839074 839076 . + . transcript "89" Adh GeneMarkHMM stop_codon 839723 839725 . - . transcript "90" Adh GeneMarkHMM CDS 839723 839740 . - . transcript "90" Adh GeneMarkHMM CDS 839797 840448 . - . transcript "90" Adh GeneMarkHMM CDS 841061 841127 . - . transcript "90" Adh GeneMarkHMM CDS 841204 841333 . - . transcript "90" Adh GeneMarkHMM CDS 841389 841969 . - . transcript "90" Adh GeneMarkHMM CDS 842034 842419 . - . transcript "90" Adh GeneMarkHMM CDS 842972 843375 . - . transcript "90" Adh GeneMarkHMM CDS 843445 843516 . - . transcript "90" Adh GeneMarkHMM stop_codon 843514 843516 . - . transcript "90" Adh GeneMarkHMM start_codon 845892 845894 . + . transcript "91" Adh GeneMarkHMM CDS 845892 846081 . + . transcript "91" Adh GeneMarkHMM CDS 846134 846339 . + . transcript "91" Adh GeneMarkHMM stop_codon 846337 846339 . + . transcript "91" Adh GeneMarkHMM stop_codon 846397 846399 . - . transcript "92" Adh GeneMarkHMM CDS 846397 847372 . - . transcript "92" Adh GeneMarkHMM CDS 847433 848154 . - . transcript "92" Adh GeneMarkHMM CDS 848208 848609 . - . transcript "92" Adh GeneMarkHMM CDS 848668 848733 . - . transcript "92" Adh GeneMarkHMM stop_codon 848731 848733 . - . transcript "92" Adh GeneMarkHMM start_codon 850944 850946 . + . transcript "93" Adh GeneMarkHMM CDS 850944 851007 . + . transcript "93" Adh GeneMarkHMM CDS 851077 851190 . + . transcript "93" Adh GeneMarkHMM CDS 851256 851436 . + . transcript "93" Adh GeneMarkHMM CDS 851491 851673 . + . transcript "93" Adh GeneMarkHMM CDS 851742 851919 . + . transcript "93" Adh GeneMarkHMM stop_codon 851917 851919 . + . transcript "93" Adh GeneMarkHMM start_codon 853119 853121 . + . transcript "94" Adh GeneMarkHMM CDS 853119 855014 . + . transcript "94" Adh GeneMarkHMM stop_codon 855012 855014 . + . transcript "94" Adh GeneMarkHMM start_codon 855874 855876 . + . transcript "95" Adh GeneMarkHMM CDS 855874 855922 . + . transcript "95" Adh GeneMarkHMM CDS 855982 856031 . + . transcript "95" Adh GeneMarkHMM CDS 856092 856876 . + . transcript "95" Adh GeneMarkHMM CDS 856942 858029 . + . transcript "95" Adh GeneMarkHMM CDS 858109 858341 . + . transcript "95" Adh GeneMarkHMM CDS 858418 858966 . + . transcript "95" Adh GeneMarkHMM stop_codon 858964 858966 . + . transcript "95" Adh GeneMarkHMM stop_codon 870684 870686 . - . transcript "96" Adh GeneMarkHMM CDS 870684 870869 . - . transcript "96" Adh GeneMarkHMM CDS 872590 872818 . - . transcript "96" Adh GeneMarkHMM CDS 872891 873131 . - . transcript "96" Adh GeneMarkHMM CDS 873191 873321 . - . transcript "96" Adh GeneMarkHMM CDS 873388 873527 . - . transcript "96" Adh GeneMarkHMM CDS 873583 874124 . - . transcript "96" Adh GeneMarkHMM CDS 874273 874541 . - . transcript "96" Adh GeneMarkHMM CDS 874599 874870 . - . transcript "96" Adh GeneMarkHMM stop_codon 874868 874870 . - . transcript "96" Adh GeneMarkHMM stop_codon 880859 880861 . - . transcript "97" Adh GeneMarkHMM CDS 880859 881091 . - . transcript "97" Adh GeneMarkHMM CDS 883002 883306 . - . transcript "97" Adh GeneMarkHMM CDS 884917 885676 . - . transcript "97" Adh GeneMarkHMM CDS 885967 886798 . - . transcript "97" Adh GeneMarkHMM CDS 892142 892189 . - . transcript "97" Adh GeneMarkHMM stop_codon 892187 892189 . - . transcript "97" Adh GeneMarkHMM stop_codon 909825 909827 . - . transcript "98" Adh GeneMarkHMM CDS 909825 909970 . - . transcript "98" Adh GeneMarkHMM CDS 910577 910742 . - . transcript "98" Adh GeneMarkHMM CDS 910801 911055 . - . transcript "98" Adh GeneMarkHMM stop_codon 911053 911055 . - . transcript "98" Adh GeneMarkHMM stop_codon 918151 918153 . - . transcript "99" Adh GeneMarkHMM CDS 918151 918795 . - . transcript "99" Adh GeneMarkHMM CDS 918858 918869 . - . transcript "99" Adh GeneMarkHMM stop_codon 918867 918869 . - . transcript "99" Adh GeneMarkHMM stop_codon 944218 944220 . - . transcript "100" Adh GeneMarkHMM CDS 944218 944525 . - . transcript "100" Adh GeneMarkHMM CDS 951618 951760 . - . transcript "100" Adh GeneMarkHMM CDS 951813 951820 . - . transcript "100" Adh GeneMarkHMM stop_codon 951818 951820 . - . transcript "100" Adh GeneMarkHMM start_codon 984981 984983 . + . transcript "101" Adh GeneMarkHMM CDS 984981 985070 . + . transcript "101" Adh GeneMarkHMM CDS 985373 986896 . + . transcript "101" Adh GeneMarkHMM stop_codon 986894 986896 . + . transcript "101" Adh GeneMarkHMM start_codon 1004686 1004688 . + . transcript "102" Adh GeneMarkHMM CDS 1004686 1004817 . + . transcript "102" Adh GeneMarkHMM CDS 1004898 1005095 . + . transcript "102" Adh GeneMarkHMM CDS 1005165 1005281 . + . transcript "102" Adh GeneMarkHMM stop_codon 1005279 1005281 . + . transcript "102" Adh GeneMarkHMM start_codon 1034264 1034266 . + . transcript "103" Adh GeneMarkHMM CDS 1034264 1034416 . + . transcript "103" Adh GeneMarkHMM CDS 1035246 1035251 . + . transcript "103" Adh GeneMarkHMM stop_codon 1035249 1035251 . + . transcript "103" Adh GeneMarkHMM stop_codon 1041376 1041378 . - . transcript "104" Adh GeneMarkHMM CDS 1041376 1041530 . - . transcript "104" Adh GeneMarkHMM CDS 1041602 1041989 . - . transcript "104" Adh GeneMarkHMM CDS 1042386 1042688 . - . transcript "104" Adh GeneMarkHMM stop_codon 1042686 1042688 . - . transcript "104" Adh GeneMarkHMM stop_codon 1051748 1051750 . - . transcript "105" Adh GeneMarkHMM CDS 1051748 1051953 . - . transcript "105" Adh GeneMarkHMM CDS 1056915 1057314 . - . transcript "105" Adh GeneMarkHMM stop_codon 1057312 1057314 . - . transcript "105" Adh GeneMarkHMM start_codon 1070893 1070895 . + . transcript "106" Adh GeneMarkHMM CDS 1070893 1070904 . + . transcript "106" Adh GeneMarkHMM CDS 1071569 1071758 . + . transcript "106" Adh GeneMarkHMM CDS 1071980 1072023 . + . transcript "106" Adh GeneMarkHMM stop_codon 1072021 1072023 . + . transcript "106" Adh GeneMarkHMM start_codon 1078485 1078487 . + . transcript "107" Adh GeneMarkHMM CDS 1078485 1078612 . + . transcript "107" Adh GeneMarkHMM CDS 1079894 1080080 . + . transcript "107" Adh GeneMarkHMM stop_codon 1080078 1080080 . + . transcript "107" Adh GeneMarkHMM stop_codon 1080988 1080990 . - . transcript "108" Adh GeneMarkHMM CDS 1080988 1081079 . - . transcript "108" Adh GeneMarkHMM CDS 1081728 1081893 . - . transcript "108" Adh GeneMarkHMM CDS 1081958 1081969 . - . transcript "108" Adh GeneMarkHMM stop_codon 1081967 1081969 . - . transcript "108" Adh GeneMarkHMM stop_codon 1094414 1094416 . - . transcript "109" Adh GeneMarkHMM CDS 1094414 1094610 . - . transcript "109" Adh GeneMarkHMM CDS 1094867 1095215 . - . transcript "109" Adh GeneMarkHMM CDS 1095422 1095533 . - . transcript "109" Adh GeneMarkHMM CDS 1095586 1095735 . - . transcript "109" Adh GeneMarkHMM CDS 1095848 1095987 . - . transcript "109" Adh GeneMarkHMM CDS 1096062 1096196 . - . transcript "109" Adh GeneMarkHMM CDS 1096326 1098979 . - . transcript "109" Adh GeneMarkHMM CDS 1100157 1100179 . - . transcript "109" Adh GeneMarkHMM CDS 1101376 1101526 . - . transcript "109" Adh GeneMarkHMM CDS 1101584 1101748 . - . transcript "109" Adh GeneMarkHMM CDS 1102937 1102996 . - . transcript "109" Adh GeneMarkHMM CDS 1104419 1104995 . - . transcript "109" Adh GeneMarkHMM CDS 1105635 1105637 . - . transcript "109" Adh GeneMarkHMM stop_codon 1105635 1105637 . - . transcript "109" Adh GeneMarkHMM start_codon 1110074 1110076 . + . transcript "110" Adh GeneMarkHMM CDS 1110074 1110172 . + . transcript "110" Adh GeneMarkHMM CDS 1110238 1110642 . + . transcript "110" Adh GeneMarkHMM CDS 1110713 1110979 . + . transcript "110" Adh GeneMarkHMM stop_codon 1110977 1110979 . + . transcript "110" Adh GeneMarkHMM start_codon 1111283 1111285 . + . transcript "111" Adh GeneMarkHMM CDS 1111283 1111378 . + . transcript "111" Adh GeneMarkHMM CDS 1111805 1112209 . + . transcript "111" Adh GeneMarkHMM CDS 1112261 1112578 . + . transcript "111" Adh GeneMarkHMM stop_codon 1112576 1112578 . + . transcript "111" Adh GeneMarkHMM start_codon 1115048 1115050 . + . transcript "112" Adh GeneMarkHMM CDS 1115048 1115296 . + . transcript "112" Adh GeneMarkHMM CDS 1115816 1115885 . + . transcript "112" Adh GeneMarkHMM CDS 1116315 1116461 . + . transcript "112" Adh GeneMarkHMM CDS 1116582 1116646 . + . transcript "112" Adh GeneMarkHMM CDS 1117462 1117608 . + . transcript "112" Adh GeneMarkHMM stop_codon 1117606 1117608 . + . transcript "112" Adh GeneMarkHMM stop_codon 1144299 1144301 . - . transcript "113" Adh GeneMarkHMM CDS 1144299 1144446 . - . transcript "113" Adh GeneMarkHMM CDS 1146893 1146990 . - . transcript "113" Adh GeneMarkHMM stop_codon 1146988 1146990 . - . transcript "113" Adh GeneMarkHMM stop_codon 1182116 1182118 . - . transcript "114" Adh GeneMarkHMM CDS 1182116 1182130 . - . transcript "114" Adh GeneMarkHMM CDS 1182203 1182415 . - . transcript "114" Adh GeneMarkHMM stop_codon 1182413 1182415 . - . transcript "114" Adh GeneMarkHMM start_codon 1206476 1206478 . + . transcript "115" Adh GeneMarkHMM CDS 1206476 1206487 . + . transcript "115" Adh GeneMarkHMM CDS 1206559 1206786 . + . transcript "115" Adh GeneMarkHMM stop_codon 1206784 1206786 . + . transcript "115" Adh GeneMarkHMM start_codon 1207563 1207565 . + . transcript "116" Adh GeneMarkHMM CDS 1207563 1207574 . + . transcript "116" Adh GeneMarkHMM CDS 1207666 1207953 . + . transcript "116" Adh GeneMarkHMM stop_codon 1207951 1207953 . + . transcript "116" Adh GeneMarkHMM stop_codon 1217048 1217050 . - . transcript "117" Adh GeneMarkHMM CDS 1217048 1217096 . - . transcript "117" Adh GeneMarkHMM CDS 1218725 1220115 . - . transcript "117" Adh GeneMarkHMM CDS 1220188 1220253 . - . transcript "117" Adh GeneMarkHMM CDS 1220453 1221762 . - . transcript "117" Adh GeneMarkHMM CDS 1221977 1222023 . - . transcript "117" Adh GeneMarkHMM CDS 1222078 1222190 . - . transcript "117" Adh GeneMarkHMM CDS 1222250 1222395 . - . transcript "117" Adh GeneMarkHMM CDS 1222483 1222579 . - . transcript "117" Adh GeneMarkHMM stop_codon 1222577 1222579 . - . transcript "117" Adh GeneMarkHMM start_codon 1229684 1229686 . + . transcript "118" Adh GeneMarkHMM CDS 1229684 1230733 . + . transcript "118" Adh GeneMarkHMM stop_codon 1230731 1230733 . + . transcript "118" Adh GeneMarkHMM stop_codon 1231127 1231129 . - . transcript "119" Adh GeneMarkHMM CDS 1231127 1231384 . - . transcript "119" Adh GeneMarkHMM CDS 1231452 1231463 . - . transcript "119" Adh GeneMarkHMM stop_codon 1231461 1231463 . - . transcript "119" Adh GeneMarkHMM start_codon 1232958 1232960 . + . transcript "120" Adh GeneMarkHMM CDS 1232958 1232969 . + . transcript "120" Adh GeneMarkHMM CDS 1233044 1233280 . + . transcript "120" Adh GeneMarkHMM stop_codon 1233278 1233280 . + . transcript "120" Adh GeneMarkHMM start_codon 1250663 1250665 . + . transcript "121" Adh GeneMarkHMM CDS 1250663 1251421 . + . transcript "121" Adh GeneMarkHMM stop_codon 1251419 1251421 . + . transcript "121" Adh GeneMarkHMM start_codon 1252523 1252525 . + . transcript "122" Adh GeneMarkHMM CDS 1252523 1253617 . + . transcript "122" Adh GeneMarkHMM stop_codon 1253615 1253617 . + . transcript "122" Adh GeneMarkHMM start_codon 1255669 1255671 . + . transcript "123" Adh GeneMarkHMM CDS 1255669 1256823 . + . transcript "123" Adh GeneMarkHMM stop_codon 1256821 1256823 . + . transcript "123" Adh GeneMarkHMM stop_codon 1271377 1271379 . - . transcript "124" Adh GeneMarkHMM CDS 1271377 1272140 . - . transcript "124" Adh GeneMarkHMM CDS 1272217 1272395 . - . transcript "124" Adh GeneMarkHMM CDS 1273041 1273498 . - . transcript "124" Adh GeneMarkHMM stop_codon 1273496 1273498 . - . transcript "124" Adh GeneMarkHMM stop_codon 1294081 1294083 . - . transcript "125" Adh GeneMarkHMM CDS 1294081 1294458 . - . transcript "125" Adh GeneMarkHMM CDS 1295677 1296587 . - . transcript "125" Adh GeneMarkHMM CDS 1297137 1298310 . - . transcript "125" Adh GeneMarkHMM stop_codon 1298308 1298310 . - . transcript "125" Adh GeneMarkHMM start_codon 1301126 1301128 . + . transcript "126" Adh GeneMarkHMM CDS 1301126 1301581 . + . transcript "126" Adh GeneMarkHMM CDS 1301671 1301676 . + . transcript "126" Adh GeneMarkHMM stop_codon 1301674 1301676 . + . transcript "126" Adh GeneMarkHMM stop_codon 1333719 1333721 . - . transcript "127" Adh GeneMarkHMM CDS 1333719 1333789 . - . transcript "127" Adh GeneMarkHMM CDS 1334785 1335024 . - . transcript "127" Adh GeneMarkHMM CDS 1335080 1335356 . - . transcript "127" Adh GeneMarkHMM CDS 1335416 1336157 . - . transcript "127" Adh GeneMarkHMM CDS 1337668 1337917 . - . transcript "127" Adh GeneMarkHMM CDS 1338337 1338640 . - . transcript "127" Adh GeneMarkHMM CDS 1338702 1338785 . - . transcript "127" Adh GeneMarkHMM stop_codon 1338783 1338785 . - . transcript "127" Adh GeneMarkHMM stop_codon 1364968 1364970 . - . transcript "128" Adh GeneMarkHMM CDS 1364968 1364994 . - . transcript "128" Adh GeneMarkHMM CDS 1365170 1365361 . - . transcript "128" Adh GeneMarkHMM CDS 1365421 1365611 . - . transcript "128" Adh GeneMarkHMM CDS 1365666 1365732 . - . transcript "128" Adh GeneMarkHMM stop_codon 1365730 1365732 . - . transcript "128" Adh GeneMarkHMM stop_codon 1368793 1368795 . - . transcript "129" Adh GeneMarkHMM CDS 1368793 1368852 . - . transcript "129" Adh GeneMarkHMM CDS 1368902 1369282 . - . transcript "129" Adh GeneMarkHMM stop_codon 1369280 1369282 . - . transcript "129" Adh GeneMarkHMM stop_codon 1371868 1371870 . - . transcript "130" Adh GeneMarkHMM CDS 1371868 1371921 . - . transcript "130" Adh GeneMarkHMM CDS 1371971 1372351 . - . transcript "130" Adh GeneMarkHMM stop_codon 1372349 1372351 . - . transcript "130" Adh GeneMarkHMM stop_codon 1398183 1398185 . - . transcript "131" Adh GeneMarkHMM CDS 1398183 1398833 . - . transcript "131" Adh GeneMarkHMM CDS 1401633 1401874 . - . transcript "131" Adh GeneMarkHMM CDS 1402535 1402643 . - . transcript "131" Adh GeneMarkHMM CDS 1402808 1402995 . - . transcript "131" Adh GeneMarkHMM CDS 1403930 1404111 . - . transcript "131" Adh GeneMarkHMM CDS 1405762 1405903 . - . transcript "131" Adh GeneMarkHMM CDS 1406801 1406882 . - . transcript "131" Adh GeneMarkHMM CDS 1407035 1407146 . - . transcript "131" Adh GeneMarkHMM CDS 1408830 1408924 . - . transcript "131" Adh GeneMarkHMM stop_codon 1408922 1408924 . - . transcript "131" Adh GeneMarkHMM stop_codon 1410778 1410780 . - . transcript "132" Adh GeneMarkHMM CDS 1410778 1410893 . - . transcript "132" Adh GeneMarkHMM CDS 1411600 1411759 . - . transcript "132" Adh GeneMarkHMM CDS 1412512 1412741 . - . transcript "132" Adh GeneMarkHMM CDS 1413335 1413415 . - . transcript "132" Adh GeneMarkHMM CDS 1413651 1413732 . - . transcript "132" Adh GeneMarkHMM CDS 1413798 1413866 . - . transcript "132" Adh GeneMarkHMM stop_codon 1413864 1413866 . - . transcript "132" Adh GeneMarkHMM start_codon 1414397 1414399 . + . transcript "133" Adh GeneMarkHMM CDS 1414397 1414719 . + . transcript "133" Adh GeneMarkHMM CDS 1415068 1418081 . + . transcript "133" Adh GeneMarkHMM CDS 1418142 1419321 . + . transcript "133" Adh GeneMarkHMM CDS 1419378 1419918 . + . transcript "133" Adh GeneMarkHMM stop_codon 1419916 1419918 . + . transcript "133" Adh GeneMarkHMM stop_codon 1421921 1421923 . - . transcript "134" Adh GeneMarkHMM CDS 1421921 1422143 . - . transcript "134" Adh GeneMarkHMM CDS 1422196 1422320 . - . transcript "134" Adh GeneMarkHMM CDS 1424531 1424676 . - . transcript "134" Adh GeneMarkHMM CDS 1424907 1425041 . - . transcript "134" Adh GeneMarkHMM CDS 1425549 1425752 . - . transcript "134" Adh GeneMarkHMM CDS 1426168 1426281 . - . transcript "134" Adh GeneMarkHMM CDS 1426393 1426486 . - . transcript "134" Adh GeneMarkHMM CDS 1428573 1428690 . - . transcript "134" Adh GeneMarkHMM CDS 1431180 1431306 . - . transcript "134" Adh GeneMarkHMM CDS 1431588 1431639 . - . transcript "134" Adh GeneMarkHMM stop_codon 1431637 1431639 . - . transcript "134" Adh GeneMarkHMM stop_codon 1452198 1452200 . - . transcript "135" Adh GeneMarkHMM CDS 1452198 1452238 . - . transcript "135" Adh GeneMarkHMM CDS 1452554 1452758 . - . transcript "135" Adh GeneMarkHMM stop_codon 1452756 1452758 . - . transcript "135" Adh GeneMarkHMM stop_codon 1465977 1465979 . - . transcript "136" Adh GeneMarkHMM CDS 1465977 1466019 . - . transcript "136" Adh GeneMarkHMM CDS 1466153 1466744 . - . transcript "136" Adh GeneMarkHMM CDS 1466876 1467307 . - . transcript "136" Adh GeneMarkHMM CDS 1473611 1473791 . - . transcript "136" Adh GeneMarkHMM stop_codon 1473789 1473791 . - . transcript "136" Adh GeneMarkHMM start_codon 1475691 1475693 . + . transcript "137" Adh GeneMarkHMM CDS 1475691 1476341 . + . transcript "137" Adh GeneMarkHMM CDS 1476426 1476471 . + . transcript "137" Adh GeneMarkHMM CDS 1476547 1476936 . + . transcript "137" Adh GeneMarkHMM CDS 1477482 1477532 . + . transcript "137" Adh GeneMarkHMM CDS 1477581 1477984 . + . transcript "137" Adh GeneMarkHMM CDS 1478054 1478243 . + . transcript "137" Adh GeneMarkHMM CDS 1478631 1478916 . + . transcript "137" Adh GeneMarkHMM CDS 1480627 1480916 . + . transcript "137" Adh GeneMarkHMM CDS 1480974 1481086 . + . transcript "137" Adh GeneMarkHMM stop_codon 1481084 1481086 . + . transcript "137" Adh GeneMarkHMM start_codon 1495484 1495486 . + . transcript "138" Adh GeneMarkHMM CDS 1495484 1495522 . + . transcript "138" Adh GeneMarkHMM CDS 1495620 1495919 . + . transcript "138" Adh GeneMarkHMM CDS 1495977 1496198 . + . transcript "138" Adh GeneMarkHMM stop_codon 1496196 1496198 . + . transcript "138" Adh GeneMarkHMM stop_codon 1496304 1496306 . - . transcript "139" Adh GeneMarkHMM CDS 1496304 1496815 . - . transcript "139" Adh GeneMarkHMM CDS 1496865 1497000 . - . transcript "139" Adh GeneMarkHMM stop_codon 1496998 1497000 . - . transcript "139" Adh GeneMarkHMM start_codon 1497576 1497578 . + . transcript "140" Adh GeneMarkHMM CDS 1497576 1498121 . + . transcript "140" Adh GeneMarkHMM stop_codon 1498119 1498121 . + . transcript "140" Adh GeneMarkHMM stop_codon 1498334 1498336 . - . transcript "141" Adh GeneMarkHMM CDS 1498334 1499046 . - . transcript "141" Adh GeneMarkHMM CDS 1499102 1499249 . - . transcript "141" Adh GeneMarkHMM stop_codon 1499247 1499249 . - . transcript "141" Adh GeneMarkHMM start_codon 1499670 1499672 . + . transcript "142" Adh GeneMarkHMM CDS 1499670 1500797 . + . transcript "142" Adh GeneMarkHMM CDS 1502039 1502044 . + . transcript "142" Adh GeneMarkHMM stop_codon 1502042 1502044 . + . transcript "142" Adh GeneMarkHMM start_codon 1510747 1510749 . + . transcript "143" Adh GeneMarkHMM CDS 1510747 1510998 . + . transcript "143" Adh GeneMarkHMM CDS 1515041 1515175 . + . transcript "143" Adh GeneMarkHMM CDS 1515266 1515436 . + . transcript "143" Adh GeneMarkHMM CDS 1515498 1515714 . + . transcript "143" Adh GeneMarkHMM CDS 1515807 1515972 . + . transcript "143" Adh GeneMarkHMM CDS 1516036 1516279 . + . transcript "143" Adh GeneMarkHMM CDS 1516339 1516488 . + . transcript "143" Adh GeneMarkHMM CDS 1517178 1518249 . + . transcript "143" Adh GeneMarkHMM CDS 1518424 1518804 . + . transcript "143" Adh GeneMarkHMM CDS 1518877 1518968 . + . transcript "143" Adh GeneMarkHMM CDS 1519240 1519382 . + . transcript "143" Adh GeneMarkHMM CDS 1519441 1519564 . + . transcript "143" Adh GeneMarkHMM CDS 1519897 1520023 . + . transcript "143" Adh GeneMarkHMM CDS 1520081 1520337 . + . transcript "143" Adh GeneMarkHMM CDS 1520398 1520535 . + . transcript "143" Adh GeneMarkHMM CDS 1521654 1521842 . + . transcript "143" Adh GeneMarkHMM stop_codon 1521840 1521842 . + . transcript "143" Adh GeneMarkHMM start_codon 1525215 1525217 . + . transcript "144" Adh GeneMarkHMM CDS 1525215 1525447 . + . transcript "144" Adh GeneMarkHMM CDS 1526237 1526642 . + . transcript "144" Adh GeneMarkHMM CDS 1526702 1527379 . + . transcript "144" Adh GeneMarkHMM stop_codon 1527377 1527379 . + . transcript "144" Adh GeneMarkHMM stop_codon 1527523 1527525 . - . transcript "145" Adh GeneMarkHMM CDS 1527523 1527636 . - . transcript "145" Adh GeneMarkHMM CDS 1527705 1528201 . - . transcript "145" Adh GeneMarkHMM CDS 1528291 1528426 . - . transcript "145" Adh GeneMarkHMM stop_codon 1528424 1528426 . - . transcript "145" Adh GeneMarkHMM start_codon 1529588 1529590 . + . transcript "146" Adh GeneMarkHMM CDS 1529588 1529971 . + . transcript "146" Adh GeneMarkHMM CDS 1530746 1531626 . + . transcript "146" Adh GeneMarkHMM CDS 1531685 1531892 . + . transcript "146" Adh GeneMarkHMM CDS 1531958 1532269 . + . transcript "146" Adh GeneMarkHMM stop_codon 1532267 1532269 . + . transcript "146" Adh GeneMarkHMM stop_codon 1533935 1533937 . - . transcript "147" Adh GeneMarkHMM CDS 1533935 1534013 . - . transcript "147" Adh GeneMarkHMM CDS 1535066 1535271 . - . transcript "147" Adh GeneMarkHMM CDS 1535341 1535461 . - . transcript "147" Adh GeneMarkHMM CDS 1535530 1535676 . - . transcript "147" Adh GeneMarkHMM CDS 1535739 1536304 . - . transcript "147" Adh GeneMarkHMM CDS 1536364 1537150 . - . transcript "147" Adh GeneMarkHMM CDS 1537212 1538662 . - . transcript "147" Adh GeneMarkHMM CDS 1538719 1541113 . - . transcript "147" Adh GeneMarkHMM CDS 1541178 1541378 . - . transcript "147" Adh GeneMarkHMM CDS 1541445 1541794 . - . transcript "147" Adh GeneMarkHMM CDS 1542125 1542385 . - . transcript "147" Adh GeneMarkHMM CDS 1542861 1542932 . - . transcript "147" Adh GeneMarkHMM stop_codon 1542930 1542932 . - . transcript "147" Adh GeneMarkHMM start_codon 1547954 1547956 . + . transcript "148" Adh GeneMarkHMM CDS 1547954 1548151 . + . transcript "148" Adh GeneMarkHMM CDS 1548215 1548319 . + . transcript "148" Adh GeneMarkHMM CDS 1548383 1548538 . + . transcript "148" Adh GeneMarkHMM stop_codon 1548536 1548538 . + . transcript "148" Adh GeneMarkHMM stop_codon 1549142 1549144 . - . transcript "149" Adh GeneMarkHMM CDS 1549142 1550017 . - . transcript "149" Adh GeneMarkHMM CDS 1550084 1550149 . - . transcript "149" Adh GeneMarkHMM stop_codon 1550147 1550149 . - . transcript "149" Adh GeneMarkHMM stop_codon 1554085 1554087 . - . transcript "150" Adh GeneMarkHMM CDS 1554085 1554599 . - . transcript "150" Adh GeneMarkHMM CDS 1554841 1555107 . - . transcript "150" Adh GeneMarkHMM CDS 1556588 1557278 . - . transcript "150" Adh GeneMarkHMM stop_codon 1557276 1557278 . - . transcript "150" Adh GeneMarkHMM start_codon 1558057 1558059 . + . transcript "151" Adh GeneMarkHMM CDS 1558057 1558080 . + . transcript "151" Adh GeneMarkHMM CDS 1558134 1558521 . + . transcript "151" Adh GeneMarkHMM CDS 1558685 1559747 . + . transcript "151" Adh GeneMarkHMM CDS 1560329 1560435 . + . transcript "151" Adh GeneMarkHMM CDS 1560565 1561671 . + . transcript "151" Adh GeneMarkHMM CDS 1561989 1562278 . + . transcript "151" Adh GeneMarkHMM CDS 1562338 1563081 . + . transcript "151" Adh GeneMarkHMM CDS 1563140 1563353 . + . transcript "151" Adh GeneMarkHMM CDS 1563418 1563689 . + . transcript "151" Adh GeneMarkHMM CDS 1563761 1563814 . + . transcript "151" Adh GeneMarkHMM stop_codon 1563812 1563814 . + . transcript "151" Adh GeneMarkHMM start_codon 1565296 1565298 . + . transcript "152" Adh GeneMarkHMM CDS 1565296 1565530 . + . transcript "152" Adh GeneMarkHMM CDS 1576691 1576943 . + . transcript "152" Adh GeneMarkHMM CDS 1577036 1577406 . + . transcript "152" Adh GeneMarkHMM CDS 1577568 1577860 . + . transcript "152" Adh GeneMarkHMM CDS 1577926 1578009 . + . transcript "152" Adh GeneMarkHMM CDS 1580550 1580685 . + . transcript "152" Adh GeneMarkHMM CDS 1580750 1580810 . + . transcript "152" Adh GeneMarkHMM CDS 1580859 1580880 . + . transcript "152" Adh GeneMarkHMM CDS 1580946 1581227 . + . transcript "152" Adh GeneMarkHMM CDS 1581294 1581623 . + . transcript "152" Adh GeneMarkHMM CDS 1581774 1582136 . + . transcript "152" Adh GeneMarkHMM CDS 1582201 1582292 . + . transcript "152" Adh GeneMarkHMM CDS 1582550 1582687 . + . transcript "152" Adh GeneMarkHMM CDS 1583070 1583334 . + . transcript "152" Adh GeneMarkHMM CDS 1584330 1584828 . + . transcript "152" Adh GeneMarkHMM CDS 1584949 1585094 . + . transcript "152" Adh GeneMarkHMM CDS 1585153 1585380 . + . transcript "152" Adh GeneMarkHMM stop_codon 1585378 1585380 . + . transcript "152" Adh GeneMarkHMM stop_codon 1591829 1591831 . - . transcript "153" Adh GeneMarkHMM CDS 1591829 1592257 . - . transcript "153" Adh GeneMarkHMM CDS 1597193 1597255 . - . transcript "153" Adh GeneMarkHMM stop_codon 1597253 1597255 . - . transcript "153" Adh GeneMarkHMM start_codon 1599218 1599220 . + . transcript "154" Adh GeneMarkHMM CDS 1599218 1600177 . + . transcript "154" Adh GeneMarkHMM CDS 1601744 1602527 . + . transcript "154" Adh GeneMarkHMM CDS 1603293 1603885 . + . transcript "154" Adh GeneMarkHMM CDS 1603963 1605404 . + . transcript "154" Adh GeneMarkHMM CDS 1605651 1606718 . + . transcript "154" Adh GeneMarkHMM CDS 1606791 1607142 . + . transcript "154" Adh GeneMarkHMM CDS 1607205 1607306 . + . transcript "154" Adh GeneMarkHMM stop_codon 1607304 1607306 . + . transcript "154" Adh GeneMarkHMM start_codon 1624429 1624431 . + . transcript "155" Adh GeneMarkHMM CDS 1624429 1624528 . + . transcript "155" Adh GeneMarkHMM CDS 1624600 1624721 . + . transcript "155" Adh GeneMarkHMM stop_codon 1624719 1624721 . + . transcript "155" Adh GeneMarkHMM stop_codon 1634224 1634226 . - . transcript "156" Adh GeneMarkHMM CDS 1634224 1634574 . - . transcript "156" Adh GeneMarkHMM stop_codon 1634572 1634574 . - . transcript "156" Adh GeneMarkHMM stop_codon 1653232 1653234 . - . transcript "157" Adh GeneMarkHMM CDS 1653232 1653414 . - . transcript "157" Adh GeneMarkHMM CDS 1653857 1657133 . - . transcript "157" Adh GeneMarkHMM CDS 1657232 1657342 . - . transcript "157" Adh GeneMarkHMM CDS 1661045 1661189 . - . transcript "157" Adh GeneMarkHMM CDS 1661787 1661932 . - . transcript "157" Adh GeneMarkHMM CDS 1666903 1666996 . - . transcript "157" Adh GeneMarkHMM CDS 1667694 1667970 . - . transcript "157" Adh GeneMarkHMM stop_codon 1667968 1667970 . - . transcript "157" Adh GeneMarkHMM stop_codon 1690411 1690413 . - . transcript "158" Adh GeneMarkHMM CDS 1690411 1690566 . - . transcript "158" Adh GeneMarkHMM CDS 1692482 1692547 . - . transcript "158" Adh GeneMarkHMM stop_codon 1692545 1692547 . - . transcript "158" Adh GeneMarkHMM stop_codon 1696675 1696677 . - . transcript "159" Adh GeneMarkHMM CDS 1696675 1696843 . - . transcript "159" Adh GeneMarkHMM CDS 1696898 1696944 . - . transcript "159" Adh GeneMarkHMM stop_codon 1696942 1696944 . - . transcript "159" Adh GeneMarkHMM start_codon 1715814 1715816 . + . transcript "160" Adh GeneMarkHMM CDS 1715814 1715828 . + . transcript "160" Adh GeneMarkHMM CDS 1717259 1717294 . + . transcript "160" Adh GeneMarkHMM CDS 1717396 1717497 . + . transcript "160" Adh GeneMarkHMM stop_codon 1717495 1717497 . + . transcript "160" Adh GeneMarkHMM stop_codon 1718580 1718582 . - . transcript "161" Adh GeneMarkHMM CDS 1718580 1718725 . - . transcript "161" Adh GeneMarkHMM CDS 1719195 1719342 . - . transcript "161" Adh GeneMarkHMM CDS 1719504 1720004 . - . transcript "161" Adh GeneMarkHMM stop_codon 1720002 1720004 . - . transcript "161" Adh GeneMarkHMM stop_codon 1726091 1726093 . - . transcript "162" Adh GeneMarkHMM CDS 1726091 1726220 . - . transcript "162" Adh GeneMarkHMM CDS 1726256 1726435 . - . transcript "162" Adh GeneMarkHMM CDS 1730116 1730236 . - . transcript "162" Adh GeneMarkHMM CDS 1731062 1731172 . - . transcript "162" Adh GeneMarkHMM CDS 1732202 1732302 . - . transcript "162" Adh GeneMarkHMM CDS 1732714 1732838 . - . transcript "162" Adh GeneMarkHMM stop_codon 1732836 1732838 . - . transcript "162" Adh GeneMarkHMM stop_codon 1735037 1735039 . - . transcript "163" Adh GeneMarkHMM CDS 1735037 1735179 . - . transcript "163" Adh GeneMarkHMM CDS 1735826 1736004 . - . transcript "163" Adh GeneMarkHMM CDS 1737215 1737246 . - . transcript "163" Adh GeneMarkHMM stop_codon 1737244 1737246 . - . transcript "163" Adh GeneMarkHMM start_codon 1738791 1738793 . + . transcript "164" Adh GeneMarkHMM CDS 1738791 1739218 . + . transcript "164" Adh GeneMarkHMM CDS 1740300 1740540 . + . transcript "164" Adh GeneMarkHMM CDS 1740659 1740939 . + . transcript "164" Adh GeneMarkHMM CDS 1740995 1742042 . + . transcript "164" Adh GeneMarkHMM CDS 1742104 1742446 . + . transcript "164" Adh GeneMarkHMM CDS 1742886 1743193 . + . transcript "164" Adh GeneMarkHMM stop_codon 1743191 1743193 . + . transcript "164" Adh GeneMarkHMM stop_codon 1744620 1744622 . - . transcript "165" Adh GeneMarkHMM CDS 1744620 1745915 . - . transcript "165" Adh GeneMarkHMM stop_codon 1745913 1745915 . - . transcript "165" Adh GeneMarkHMM start_codon 1746303 1746305 . + . transcript "166" Adh GeneMarkHMM CDS 1746303 1746349 . + . transcript "166" Adh GeneMarkHMM CDS 1746401 1746842 . + . transcript "166" Adh GeneMarkHMM stop_codon 1746840 1746842 . + . transcript "166" Adh GeneMarkHMM stop_codon 1746966 1746968 . - . transcript "167" Adh GeneMarkHMM CDS 1746966 1747064 . - . transcript "167" Adh GeneMarkHMM CDS 1747116 1747238 . - . transcript "167" Adh GeneMarkHMM CDS 1747451 1747757 . - . transcript "167" Adh GeneMarkHMM CDS 1747825 1748093 . - . transcript "167" Adh GeneMarkHMM CDS 1748156 1748361 . - . transcript "167" Adh GeneMarkHMM CDS 1748434 1748590 . - . transcript "167" Adh GeneMarkHMM CDS 1748671 1748943 . - . transcript "167" Adh GeneMarkHMM CDS 1749003 1749033 . - . transcript "167" Adh GeneMarkHMM CDS 1751117 1751289 . - . transcript "167" Adh GeneMarkHMM CDS 1751370 1751492 . - . transcript "167" Adh GeneMarkHMM CDS 1751564 1751664 . - . transcript "167" Adh GeneMarkHMM CDS 1751722 1751956 . - . transcript "167" Adh GeneMarkHMM CDS 1752027 1752278 . - . transcript "167" Adh GeneMarkHMM CDS 1752622 1752780 . - . transcript "167" Adh GeneMarkHMM CDS 1752984 1753316 . - . transcript "167" Adh GeneMarkHMM CDS 1753422 1753778 . - . transcript "167" Adh GeneMarkHMM stop_codon 1753776 1753778 . - . transcript "167" Adh GeneMarkHMM stop_codon 1756026 1756028 . - . transcript "168" Adh GeneMarkHMM CDS 1756026 1756178 . - . transcript "168" Adh GeneMarkHMM CDS 1756248 1756386 . - . transcript "168" Adh GeneMarkHMM CDS 1756448 1756671 . - . transcript "168" Adh GeneMarkHMM CDS 1756797 1756939 . - . transcript "168" Adh GeneMarkHMM CDS 1757005 1757119 . - . transcript "168" Adh GeneMarkHMM CDS 1757182 1757352 . - . transcript "168" Adh GeneMarkHMM CDS 1757415 1757585 . - . transcript "168" Adh GeneMarkHMM CDS 1757648 1758409 . - . transcript "168" Adh GeneMarkHMM CDS 1758473 1758856 . - . transcript "168" Adh GeneMarkHMM CDS 1759026 1759682 . - . transcript "168" Adh GeneMarkHMM CDS 1760557 1760678 . - . transcript "168" Adh GeneMarkHMM CDS 1763528 1763582 . - . transcript "168" Adh GeneMarkHMM CDS 1763930 1764042 . - . transcript "168" Adh GeneMarkHMM CDS 1764272 1764501 . - . transcript "168" Adh GeneMarkHMM CDS 1764574 1764638 . - . transcript "168" Adh GeneMarkHMM stop_codon 1764636 1764638 . - . transcript "168" Adh GeneMarkHMM start_codon 1766105 1766107 . + . transcript "169" Adh GeneMarkHMM CDS 1766105 1766345 . + . transcript "169" Adh GeneMarkHMM CDS 1766667 1766778 . + . transcript "169" Adh GeneMarkHMM CDS 1766912 1767026 . + . transcript "169" Adh GeneMarkHMM CDS 1768563 1768793 . + . transcript "169" Adh GeneMarkHMM CDS 1768949 1768993 . + . transcript "169" Adh GeneMarkHMM stop_codon 1768991 1768993 . + . transcript "169" Adh GeneMarkHMM start_codon 1774781 1774783 . + . transcript "170" Adh GeneMarkHMM CDS 1774781 1775557 . + . transcript "170" Adh GeneMarkHMM stop_codon 1775555 1775557 . + . transcript "170" Adh GeneMarkHMM stop_codon 1780341 1780343 . - . transcript "171" Adh GeneMarkHMM CDS 1780341 1780496 . - . transcript "171" Adh GeneMarkHMM CDS 1781148 1781825 . - . transcript "171" Adh GeneMarkHMM stop_codon 1781823 1781825 . - . transcript "171" Adh GeneMarkHMM start_codon 1785433 1785435 . + . transcript "172" Adh GeneMarkHMM CDS 1785433 1785489 . + . transcript "172" Adh GeneMarkHMM CDS 1787638 1788915 . + . transcript "172" Adh GeneMarkHMM stop_codon 1788913 1788915 . + . transcript "172" Adh GeneMarkHMM stop_codon 1807761 1807763 . - . transcript "173" Adh GeneMarkHMM CDS 1807761 1808498 . - . transcript "173" Adh GeneMarkHMM stop_codon 1808496 1808498 . - . transcript "173" Adh GeneMarkHMM start_codon 1811839 1811841 . + . transcript "174" Adh GeneMarkHMM CDS 1811839 1811953 . + . transcript "174" Adh GeneMarkHMM CDS 1812956 1813017 . + . transcript "174" Adh GeneMarkHMM stop_codon 1813015 1813017 . + . transcript "174" Adh GeneMarkHMM start_codon 1817956 1817958 . + . transcript "175" Adh GeneMarkHMM CDS 1817956 1818034 . + . transcript "175" Adh GeneMarkHMM CDS 1818085 1818200 . + . transcript "175" Adh GeneMarkHMM CDS 1819380 1819519 . + . transcript "175" Adh GeneMarkHMM CDS 1819571 1819593 . + . transcript "175" Adh GeneMarkHMM CDS 1820550 1820647 . + . transcript "175" Adh GeneMarkHMM stop_codon 1820645 1820647 . + . transcript "175" Adh GeneMarkHMM start_codon 1823764 1823766 . + . transcript "176" Adh GeneMarkHMM CDS 1823764 1825158 . + . transcript "176" Adh GeneMarkHMM stop_codon 1825156 1825158 . + . transcript "176" Adh GeneMarkHMM stop_codon 1850650 1850652 . - . transcript "177" Adh GeneMarkHMM CDS 1850650 1851240 . - . transcript "177" Adh GeneMarkHMM stop_codon 1851238 1851240 . - . transcript "177" Adh GeneMarkHMM stop_codon 1879961 1879963 . - . transcript "178" Adh GeneMarkHMM CDS 1879961 1879999 . - . transcript "178" Adh GeneMarkHMM CDS 1884195 1884437 . - . transcript "178" Adh GeneMarkHMM stop_codon 1884435 1884437 . - . transcript "178" Adh GeneMarkHMM stop_codon 1913374 1913376 . - . transcript "179" Adh GeneMarkHMM CDS 1913374 1914932 . - . transcript "179" Adh GeneMarkHMM CDS 1914995 1915082 . - . transcript "179" Adh GeneMarkHMM stop_codon 1915080 1915082 . - . transcript "179" Adh GeneMarkHMM start_codon 1917420 1917422 . + . transcript "180" Adh GeneMarkHMM CDS 1917420 1917537 . + . transcript "180" Adh GeneMarkHMM CDS 1917607 1917914 . + . transcript "180" Adh GeneMarkHMM stop_codon 1917912 1917914 . + . transcript "180" Adh GeneMarkHMM start_codon 1923109 1923111 . + . transcript "181" Adh GeneMarkHMM CDS 1923109 1924563 . + . transcript "181" Adh GeneMarkHMM stop_codon 1924561 1924563 . + . transcript "181" Adh GeneMarkHMM stop_codon 1962833 1962835 . - . transcript "182" Adh GeneMarkHMM CDS 1962833 1962987 . - . transcript "182" Adh GeneMarkHMM CDS 1963924 1964018 . - . transcript "182" Adh GeneMarkHMM CDS 1964837 1964925 . - . transcript "182" Adh GeneMarkHMM stop_codon 1964923 1964925 . - . transcript "182" Adh GeneMarkHMM stop_codon 1966586 1966588 . - . transcript "183" Adh GeneMarkHMM CDS 1966586 1967758 . - . transcript "183" Adh GeneMarkHMM stop_codon 1967756 1967758 . - . transcript "183" Adh GeneMarkHMM start_codon 1974488 1974490 . + . transcript "184" Adh GeneMarkHMM CDS 1974488 1975018 . + . transcript "184" Adh GeneMarkHMM stop_codon 1975016 1975018 . + . transcript "184" Adh GeneMarkHMM start_codon 1988872 1988874 . + . transcript "185" Adh GeneMarkHMM CDS 1988872 1989075 . + . transcript "185" Adh GeneMarkHMM CDS 1991768 1992877 . + . transcript "185" Adh GeneMarkHMM CDS 1992942 1993204 . + . transcript "185" Adh GeneMarkHMM CDS 1993350 1993566 . + . transcript "185" Adh GeneMarkHMM stop_codon 1993564 1993566 . + . transcript "185" Adh GeneMarkHMM stop_codon 1999194 1999196 . - . transcript "186" Adh GeneMarkHMM CDS 1999194 1999256 . - . transcript "186" Adh GeneMarkHMM CDS 1999307 1999333 . - . transcript "186" Adh GeneMarkHMM CDS 1999393 1999539 . - . transcript "186" Adh GeneMarkHMM stop_codon 1999537 1999539 . - . transcript "186" Adh GeneMarkHMM start_codon 2035641 2035643 . + . transcript "187" Adh GeneMarkHMM CDS 2035641 2035774 . + . transcript "187" Adh GeneMarkHMM CDS 2037369 2037672 . + . transcript "187" Adh GeneMarkHMM stop_codon 2037670 2037672 . + . transcript "187" Adh GeneMarkHMM start_codon 2040123 2040125 . + . transcript "188" Adh GeneMarkHMM CDS 2040123 2040280 . + . transcript "188" Adh GeneMarkHMM CDS 2040432 2040693 . + . transcript "188" Adh GeneMarkHMM stop_codon 2040691 2040693 . + . transcript "188" Adh GeneMarkHMM start_codon 2068604 2068606 . + . transcript "189" Adh GeneMarkHMM CDS 2068604 2070501 . + . transcript "189" Adh GeneMarkHMM CDS 2071510 2072677 . + . transcript "189" Adh GeneMarkHMM stop_codon 2072675 2072677 . + . transcript "189" Adh GeneMarkHMM stop_codon 2100551 2100553 . - . transcript "190" Adh GeneMarkHMM CDS 2100551 2101352 . - . transcript "190" Adh GeneMarkHMM CDS 2102194 2102722 . - . transcript "190" Adh GeneMarkHMM CDS 2102776 2102911 . - . transcript "190" Adh GeneMarkHMM CDS 2103628 2104169 . - . transcript "190" Adh GeneMarkHMM CDS 2104226 2104442 . - . transcript "190" Adh GeneMarkHMM stop_codon 2104440 2104442 . - . transcript "190" Adh GeneMarkHMM stop_codon 2105170 2105172 . - . transcript "191" Adh GeneMarkHMM CDS 2105170 2105463 . - . transcript "191" Adh GeneMarkHMM CDS 2105530 2105720 . - . transcript "191" Adh GeneMarkHMM CDS 2105774 2105984 . - . transcript "191" Adh GeneMarkHMM stop_codon 2105982 2105984 . - . transcript "191" Adh GeneMarkHMM stop_codon 2111779 2111781 . - . transcript "192" Adh GeneMarkHMM CDS 2111779 2111847 . - . transcript "192" Adh GeneMarkHMM CDS 2111897 2112079 . - . transcript "192" Adh GeneMarkHMM CDS 2112328 2112336 . - . transcript "192" Adh GeneMarkHMM CDS 2112397 2112489 . - . transcript "192" Adh GeneMarkHMM stop_codon 2112487 2112489 . - . transcript "192" Adh GeneMarkHMM start_codon 2118335 2118337 . + . transcript "193" Adh GeneMarkHMM CDS 2118335 2118551 . + . transcript "193" Adh GeneMarkHMM CDS 2118614 2119144 . + . transcript "193" Adh GeneMarkHMM CDS 2119911 2120025 . + . transcript "193" Adh GeneMarkHMM CDS 2120092 2120194 . + . transcript "193" Adh GeneMarkHMM CDS 2120312 2121269 . + . transcript "193" Adh GeneMarkHMM CDS 2121336 2121745 . + . transcript "193" Adh GeneMarkHMM stop_codon 2121743 2121745 . + . transcript "193" Adh GeneMarkHMM stop_codon 2137486 2137488 . - . transcript "194" Adh GeneMarkHMM CDS 2137486 2137679 . - . transcript "194" Adh GeneMarkHMM CDS 2137746 2137902 . - . transcript "194" Adh GeneMarkHMM CDS 2137961 2138116 . - . transcript "194" Adh GeneMarkHMM CDS 2138186 2138671 . - . transcript "194" Adh GeneMarkHMM CDS 2138733 2138994 . - . transcript "194" Adh GeneMarkHMM CDS 2139065 2139169 . - . transcript "194" Adh GeneMarkHMM CDS 2139824 2140056 . - . transcript "194" Adh GeneMarkHMM CDS 2140148 2140353 . - . transcript "194" Adh GeneMarkHMM CDS 2140417 2140630 . - . transcript "194" Adh GeneMarkHMM CDS 2140705 2141412 . - . transcript "194" Adh GeneMarkHMM CDS 2141468 2141749 . - . transcript "194" Adh GeneMarkHMM CDS 2141998 2142471 . - . transcript "194" Adh GeneMarkHMM CDS 2146632 2146874 . - . transcript "194" Adh GeneMarkHMM stop_codon 2146872 2146874 . - . transcript "194" Adh GeneMarkHMM start_codon 2149292 2149294 . + . transcript "195" Adh GeneMarkHMM CDS 2149292 2149510 . + . transcript "195" Adh GeneMarkHMM CDS 2149741 2150589 . + . transcript "195" Adh GeneMarkHMM CDS 2150672 2150738 . + . transcript "195" Adh GeneMarkHMM CDS 2151060 2151169 . + . transcript "195" Adh GeneMarkHMM stop_codon 2151167 2151169 . + . transcript "195" Adh GeneMarkHMM stop_codon 2151764 2151766 . - . transcript "196" Adh GeneMarkHMM CDS 2151764 2151931 . - . transcript "196" Adh GeneMarkHMM CDS 2157849 2157893 . - . transcript "196" Adh GeneMarkHMM stop_codon 2157891 2157893 . - . transcript "196" Adh GeneMarkHMM stop_codon 2163892 2163894 . - . transcript "197" Adh GeneMarkHMM CDS 2163892 2164224 . - . transcript "197" Adh GeneMarkHMM stop_codon 2164222 2164224 . - . transcript "197" Adh GeneMarkHMM stop_codon 2165490 2165492 . - . transcript "198" Adh GeneMarkHMM CDS 2165490 2165568 . - . transcript "198" Adh GeneMarkHMM CDS 2167365 2167477 . - . transcript "198" Adh GeneMarkHMM stop_codon 2167475 2167477 . - . transcript "198" Adh GeneMarkHMM stop_codon 2180707 2180709 . - . transcript "199" Adh GeneMarkHMM CDS 2180707 2180982 . - . transcript "199" Adh GeneMarkHMM CDS 2181100 2181325 . - . transcript "199" Adh GeneMarkHMM CDS 2181392 2182662 . - . transcript "199" Adh GeneMarkHMM CDS 2187860 2187994 . - . transcript "199" Adh GeneMarkHMM CDS 2189454 2189772 . - . transcript "199" Adh GeneMarkHMM CDS 2192598 2192617 . - . transcript "199" Adh GeneMarkHMM stop_codon 2192615 2192617 . - . transcript "199" Adh GeneMarkHMM stop_codon 2201531 2201533 . - . transcript "200" Adh GeneMarkHMM CDS 2201531 2201677 . - . transcript "200" Adh GeneMarkHMM CDS 2202376 2202477 . - . transcript "200" Adh GeneMarkHMM CDS 2202548 2202802 . - . transcript "200" Adh GeneMarkHMM stop_codon 2202800 2202802 . - . transcript "200" Adh GeneMarkHMM start_codon 2204183 2204185 . + . transcript "201" Adh GeneMarkHMM CDS 2204183 2205278 . + . transcript "201" Adh GeneMarkHMM CDS 2205332 2207403 . + . transcript "201" Adh GeneMarkHMM stop_codon 2207401 2207403 . + . transcript "201" Adh GeneMarkHMM stop_codon 2208922 2208924 . - . transcript "202" Adh GeneMarkHMM CDS 2208922 2209531 . - . transcript "202" Adh GeneMarkHMM CDS 2209593 2209904 . - . transcript "202" Adh GeneMarkHMM CDS 2209967 2211186 . - . transcript "202" Adh GeneMarkHMM CDS 2211243 2211671 . - . transcript "202" Adh GeneMarkHMM CDS 2212036 2212168 . - . transcript "202" Adh GeneMarkHMM CDS 2212228 2212394 . - . transcript "202" Adh GeneMarkHMM stop_codon 2212392 2212394 . - . transcript "202" Adh GeneMarkHMM start_codon 2216202 2216204 . + . transcript "203" Adh GeneMarkHMM CDS 2216202 2216561 . + . transcript "203" Adh GeneMarkHMM CDS 2216630 2217034 . + . transcript "203" Adh GeneMarkHMM CDS 2217099 2217403 . + . transcript "203" Adh GeneMarkHMM CDS 2217501 2217537 . + . transcript "203" Adh GeneMarkHMM stop_codon 2217535 2217537 . + . transcript "203" Adh GeneMarkHMM stop_codon 2218461 2218463 . - . transcript "204" Adh GeneMarkHMM CDS 2218461 2218494 . - . transcript "204" Adh GeneMarkHMM CDS 2218559 2218905 . - . transcript "204" Adh GeneMarkHMM CDS 2218966 2219871 . - . transcript "204" Adh GeneMarkHMM CDS 2219932 2220065 . - . transcript "204" Adh GeneMarkHMM CDS 2220600 2222197 . - . transcript "204" Adh GeneMarkHMM CDS 2222257 2222379 . - . transcript "204" Adh GeneMarkHMM CDS 2222435 2222667 . - . transcript "204" Adh GeneMarkHMM CDS 2222723 2222818 . - . transcript "204" Adh GeneMarkHMM CDS 2222876 2222890 . - . transcript "204" Adh GeneMarkHMM stop_codon 2222888 2222890 . - . transcript "204" Adh GeneMarkHMM stop_codon 2223170 2223172 . - . transcript "205" Adh GeneMarkHMM CDS 2223170 2223346 . - . transcript "205" Adh GeneMarkHMM CDS 2223403 2223556 . - . transcript "205" Adh GeneMarkHMM CDS 2223854 2224229 . - . transcript "205" Adh GeneMarkHMM CDS 2224289 2224367 . - . transcript "205" Adh GeneMarkHMM stop_codon 2224365 2224367 . - . transcript "205" Adh GeneMarkHMM start_codon 2239954 2239956 . + . transcript "206" Adh GeneMarkHMM CDS 2239954 2240240 . + . transcript "206" Adh GeneMarkHMM CDS 2241396 2241563 . + . transcript "206" Adh GeneMarkHMM CDS 2241630 2241876 . + . transcript "206" Adh GeneMarkHMM stop_codon 2241874 2241876 . + . transcript "206" Adh GeneMarkHMM start_codon 2280718 2280720 . + . transcript "207" Adh GeneMarkHMM CDS 2280718 2280873 . + . transcript "207" Adh GeneMarkHMM CDS 2282154 2282159 . + . transcript "207" Adh GeneMarkHMM stop_codon 2282157 2282159 . + . transcript "207" Adh GeneMarkHMM start_codon 2283252 2283254 . + . transcript "208" Adh GeneMarkHMM CDS 2283252 2283263 . + . transcript "208" Adh GeneMarkHMM CDS 2283322 2283384 . + . transcript "208" Adh GeneMarkHMM stop_codon 2283382 2283384 . + . transcript "208" Adh GeneMarkHMM stop_codon 2288700 2288702 . - . transcript "209" Adh GeneMarkHMM CDS 2288700 2288778 . - . transcript "209" Adh GeneMarkHMM CDS 2288849 2289034 . - . transcript "209" Adh GeneMarkHMM CDS 2291657 2291847 . - . transcript "209" Adh GeneMarkHMM stop_codon 2291845 2291847 . - . transcript "209" Adh GeneMarkHMM start_codon 2303372 2303374 . + . transcript "210" Adh GeneMarkHMM CDS 2303372 2303375 . + . transcript "210" Adh GeneMarkHMM CDS 2303428 2304641 . + . transcript "210" Adh GeneMarkHMM stop_codon 2304639 2304641 . + . transcript "210" Adh GeneMarkHMM start_codon 2305038 2305040 . + . transcript "211" Adh GeneMarkHMM CDS 2305038 2305397 . + . transcript "211" Adh GeneMarkHMM CDS 2305489 2305763 . + . transcript "211" Adh GeneMarkHMM CDS 2305829 2306951 . + . transcript "211" Adh GeneMarkHMM stop_codon 2306949 2306951 . + . transcript "211" Adh GeneMarkHMM stop_codon 2327989 2327991 . - . transcript "212" Adh GeneMarkHMM CDS 2327989 2328098 . - . transcript "212" Adh GeneMarkHMM CDS 2328160 2328238 . - . transcript "212" Adh GeneMarkHMM stop_codon 2328236 2328238 . - . transcript "212" Adh GeneMarkHMM stop_codon 2328290 2328292 . - . transcript "213" Adh GeneMarkHMM CDS 2328290 2328403 . - . transcript "213" Adh GeneMarkHMM CDS 2328611 2329967 . - . transcript "213" Adh GeneMarkHMM CDS 2330026 2330135 . - . transcript "213" Adh GeneMarkHMM stop_codon 2330133 2330135 . - . transcript "213" Adh GeneMarkHMM stop_codon 2339377 2339379 . - . transcript "214" Adh GeneMarkHMM CDS 2339377 2340420 . - . transcript "214" Adh GeneMarkHMM CDS 2340535 2341630 . - . transcript "214" Adh GeneMarkHMM CDS 2341682 2341790 . - . transcript "214" Adh GeneMarkHMM CDS 2341855 2341911 . - . transcript "214" Adh GeneMarkHMM CDS 2341973 2341993 . - . transcript "214" Adh GeneMarkHMM CDS 2342049 2342274 . - . transcript "214" Adh GeneMarkHMM CDS 2342341 2342602 . - . transcript "214" Adh GeneMarkHMM CDS 2342664 2343851 . - . transcript "214" Adh GeneMarkHMM CDS 2349629 2349890 . - . transcript "214" Adh GeneMarkHMM CDS 2349968 2350879 . - . transcript "214" Adh GeneMarkHMM CDS 2351469 2351518 . - . transcript "214" Adh GeneMarkHMM CDS 2351765 2352026 . - . transcript "214" Adh GeneMarkHMM CDS 2352080 2352995 . - . transcript "214" Adh GeneMarkHMM CDS 2357224 2357480 . - . transcript "214" Adh GeneMarkHMM CDS 2357539 2357674 . - . transcript "214" Adh GeneMarkHMM CDS 2358742 2358953 . - . transcript "214" Adh GeneMarkHMM CDS 2362230 2362329 . - . transcript "214" Adh GeneMarkHMM stop_codon 2362327 2362329 . - . transcript "214" Adh GeneMarkHMM stop_codon 2365325 2365327 . - . transcript "215" Adh GeneMarkHMM CDS 2365325 2365399 . - . transcript "215" Adh GeneMarkHMM CDS 2365727 2365814 . - . transcript "215" Adh GeneMarkHMM CDS 2365912 2365956 . - . transcript "215" Adh GeneMarkHMM CDS 2366015 2366148 . - . transcript "215" Adh GeneMarkHMM stop_codon 2366146 2366148 . - . transcript "215" Adh GeneMarkHMM start_codon 2374482 2374484 . + . transcript "216" Adh GeneMarkHMM CDS 2374482 2375094 . + . transcript "216" Adh GeneMarkHMM CDS 2375482 2375580 . + . transcript "216" Adh GeneMarkHMM CDS 2375644 2375808 . + . transcript "216" Adh GeneMarkHMM CDS 2375872 2376036 . + . transcript "216" Adh GeneMarkHMM CDS 2376100 2376264 . + . transcript "216" Adh GeneMarkHMM CDS 2376328 2376492 . + . transcript "216" Adh GeneMarkHMM CDS 2376556 2376617 . + . transcript "216" Adh GeneMarkHMM CDS 2376903 2376908 . + . transcript "216" Adh GeneMarkHMM stop_codon 2376906 2376908 . + . transcript "216" Adh GeneMarkHMM start_codon 2392181 2392183 . + . transcript "217" Adh GeneMarkHMM CDS 2392181 2392737 . + . transcript "217" Adh GeneMarkHMM CDS 2392800 2393095 . + . transcript "217" Adh GeneMarkHMM CDS 2393155 2393360 . + . transcript "217" Adh GeneMarkHMM stop_codon 2393358 2393360 . + . transcript "217" Adh GeneMarkHMM start_codon 2406122 2406124 . + . transcript "218" Adh GeneMarkHMM CDS 2406122 2406329 . + . transcript "218" Adh GeneMarkHMM CDS 2407321 2407393 . + . transcript "218" Adh GeneMarkHMM CDS 2407447 2407845 . + . transcript "218" Adh GeneMarkHMM CDS 2407960 2408288 . + . transcript "218" Adh GeneMarkHMM CDS 2408358 2408554 . + . transcript "218" Adh GeneMarkHMM CDS 2410044 2410049 . + . transcript "218" Adh GeneMarkHMM stop_codon 2410047 2410049 . + . transcript "218" Adh GeneMarkHMM stop_codon 2421375 2421377 . - . transcript "219" Adh GeneMarkHMM CDS 2421375 2421443 . - . transcript "219" Adh GeneMarkHMM CDS 2421495 2421629 . - . transcript "219" Adh GeneMarkHMM stop_codon 2421627 2421629 . - . transcript "219" Adh GeneMarkHMM start_codon 2428833 2428835 . + . transcript "220" Adh GeneMarkHMM CDS 2428833 2429381 . + . transcript "220" Adh GeneMarkHMM stop_codon 2429379 2429381 . + . transcript "220" Adh GeneMarkHMM stop_codon 2440029 2440031 . - . transcript "221" Adh GeneMarkHMM CDS 2440029 2440096 . - . transcript "221" Adh GeneMarkHMM CDS 2440152 2440232 . - . transcript "221" Adh GeneMarkHMM CDS 2452399 2452589 . - . transcript "221" Adh GeneMarkHMM CDS 2452651 2452685 . - . transcript "221" Adh GeneMarkHMM stop_codon 2452683 2452685 . - . transcript "221" Adh GeneMarkHMM start_codon 2453955 2453957 . + . transcript "222" Adh GeneMarkHMM CDS 2453955 2454115 . + . transcript "222" Adh GeneMarkHMM CDS 2454183 2454275 . + . transcript "222" Adh GeneMarkHMM CDS 2454348 2454445 . + . transcript "222" Adh GeneMarkHMM CDS 2454499 2454611 . + . transcript "222" Adh GeneMarkHMM stop_codon 2454609 2454611 . + . transcript "222" Adh GeneMarkHMM start_codon 2480542 2480544 . + . transcript "223" Adh GeneMarkHMM CDS 2480542 2480707 . + . transcript "223" Adh GeneMarkHMM CDS 2481639 2481850 . + . transcript "223" Adh GeneMarkHMM CDS 2483447 2483582 . + . transcript "223" Adh GeneMarkHMM CDS 2483839 2483972 . + . transcript "223" Adh GeneMarkHMM CDS 2484693 2484860 . + . transcript "223" Adh GeneMarkHMM CDS 2485878 2485976 . + . transcript "223" Adh GeneMarkHMM CDS 2486400 2486522 . + . transcript "223" Adh GeneMarkHMM CDS 2486596 2486785 . + . transcript "223" Adh GeneMarkHMM CDS 2488187 2488227 . + . transcript "223" Adh GeneMarkHMM CDS 2488301 2488669 . + . transcript "223" Adh GeneMarkHMM CDS 2489186 2489191 . + . transcript "223" Adh GeneMarkHMM stop_codon 2489189 2489191 . + . transcript "223" Adh GeneMarkHMM start_codon 2493314 2493316 . + . transcript "224" Adh GeneMarkHMM CDS 2493314 2493620 . + . transcript "224" Adh GeneMarkHMM CDS 2493682 2493731 . + . transcript "224" Adh GeneMarkHMM CDS 2494047 2494116 . + . transcript "224" Adh GeneMarkHMM CDS 2494180 2494259 . + . transcript "224" Adh GeneMarkHMM CDS 2494325 2494651 . + . transcript "224" Adh GeneMarkHMM CDS 2495100 2495225 . + . transcript "224" Adh GeneMarkHMM CDS 2495286 2495667 . + . transcript "224" Adh GeneMarkHMM CDS 2495861 2496988 . + . transcript "224" Adh GeneMarkHMM CDS 2497217 2497460 . + . transcript "224" Adh GeneMarkHMM CDS 2497541 2497619 . + . transcript "224" Adh GeneMarkHMM stop_codon 2497617 2497619 . + . transcript "224" Adh GeneMarkHMM stop_codon 2520836 2520838 . - . transcript "225" Adh GeneMarkHMM CDS 2520836 2520978 . - . transcript "225" Adh GeneMarkHMM CDS 2522463 2522552 . - . transcript "225" Adh GeneMarkHMM CDS 2522638 2522802 . - . transcript "225" Adh GeneMarkHMM CDS 2522851 2522881 . - . transcript "225" Adh GeneMarkHMM stop_codon 2522879 2522881 . - . transcript "225" Adh GeneMarkHMM start_codon 2524359 2524361 . + . transcript "226" Adh GeneMarkHMM CDS 2524359 2524559 . + . transcript "226" Adh GeneMarkHMM CDS 2525929 2526064 . + . transcript "226" Adh GeneMarkHMM CDS 2527415 2527548 . + . transcript "226" Adh GeneMarkHMM CDS 2529073 2529195 . + . transcript "226" Adh GeneMarkHMM CDS 2529260 2529455 . + . transcript "226" Adh GeneMarkHMM CDS 2529735 2530066 . + . transcript "226" Adh GeneMarkHMM CDS 2530123 2530197 . + . transcript "226" Adh GeneMarkHMM stop_codon 2530195 2530197 . + . transcript "226" Adh GeneMarkHMM start_codon 2543568 2543570 . + . transcript "227" Adh GeneMarkHMM CDS 2543568 2543579 . + . transcript "227" Adh GeneMarkHMM CDS 2544334 2545099 . + . transcript "227" Adh GeneMarkHMM CDS 2548670 2548839 . + . transcript "227" Adh GeneMarkHMM stop_codon 2548837 2548839 . + . transcript "227" Adh GeneMarkHMM start_codon 2582975 2582977 . + . transcript "228" Adh GeneMarkHMM CDS 2582975 2583504 . + . transcript "228" Adh GeneMarkHMM CDS 2584127 2584238 . + . transcript "228" Adh GeneMarkHMM stop_codon 2584236 2584238 . + . transcript "228" Adh GeneMarkHMM start_codon 2590910 2590912 . + . transcript "229" Adh GeneMarkHMM CDS 2590910 2592084 . + . transcript "229" Adh GeneMarkHMM CDS 2592779 2593544 . + . transcript "229" Adh GeneMarkHMM CDS 2593610 2593615 . + . transcript "229" Adh GeneMarkHMM stop_codon 2593613 2593615 . + . transcript "229" Adh GeneMarkHMM stop_codon 2595904 2595906 . - . transcript "230" Adh GeneMarkHMM CDS 2595904 2596119 . - . transcript "230" Adh GeneMarkHMM CDS 2610337 2610462 . - . transcript "230" Adh GeneMarkHMM stop_codon 2610460 2610462 . - . transcript "230" Adh GeneMarkHMM start_codon 2619156 2619158 . + . transcript "231" Adh GeneMarkHMM CDS 2619156 2619165 . + . transcript "231" Adh GeneMarkHMM CDS 2619518 2620403 . + . transcript "231" Adh GeneMarkHMM CDS 2621231 2622507 . + . transcript "231" Adh GeneMarkHMM CDS 2622578 2622676 . + . transcript "231" Adh GeneMarkHMM CDS 2624114 2624266 . + . transcript "231" Adh GeneMarkHMM CDS 2624694 2624875 . + . transcript "231" Adh GeneMarkHMM CDS 2624976 2625495 . + . transcript "231" Adh GeneMarkHMM CDS 2625559 2625784 . + . transcript "231" Adh GeneMarkHMM CDS 2625851 2626052 . + . transcript "231" Adh GeneMarkHMM CDS 2626124 2626333 . + . transcript "231" Adh GeneMarkHMM CDS 2626392 2626547 . + . transcript "231" Adh GeneMarkHMM stop_codon 2626545 2626547 . + . transcript "231" Adh GeneMarkHMM start_codon 2632071 2632073 . + . transcript "232" Adh GeneMarkHMM CDS 2632071 2632090 . + . transcript "232" Adh GeneMarkHMM CDS 2632152 2632298 . + . transcript "232" Adh GeneMarkHMM CDS 2632363 2632834 . + . transcript "232" Adh GeneMarkHMM CDS 2632889 2632972 . + . transcript "232" Adh GeneMarkHMM CDS 2633028 2633093 . + . transcript "232" Adh GeneMarkHMM CDS 2633149 2633337 . + . transcript "232" Adh GeneMarkHMM CDS 2633397 2633645 . + . transcript "232" Adh GeneMarkHMM CDS 2633706 2634365 . + . transcript "232" Adh GeneMarkHMM CDS 2634452 2634889 . + . transcript "232" Adh GeneMarkHMM stop_codon 2634887 2634889 . + . transcript "232" Adh GeneMarkHMM start_codon 2638322 2638324 . + . transcript "233" Adh GeneMarkHMM CDS 2638322 2638414 . + . transcript "233" Adh GeneMarkHMM CDS 2638470 2639006 . + . transcript "233" Adh GeneMarkHMM stop_codon 2639004 2639006 . + . transcript "233" Adh GeneMarkHMM start_codon 2660848 2660850 . + . transcript "234" Adh GeneMarkHMM CDS 2660848 2661318 . + . transcript "234" Adh GeneMarkHMM CDS 2661378 2662292 . + . transcript "234" Adh GeneMarkHMM CDS 2662849 2663049 . + . transcript "234" Adh GeneMarkHMM stop_codon 2663047 2663049 . + . transcript "234" Adh GeneMarkHMM start_codon 2675920 2675922 . + . transcript "235" Adh GeneMarkHMM CDS 2675920 2675954 . + . transcript "235" Adh GeneMarkHMM CDS 2676013 2676043 . + . transcript "235" Adh GeneMarkHMM CDS 2681403 2681494 . + . transcript "235" Adh GeneMarkHMM CDS 2684880 2686209 . + . transcript "235" Adh GeneMarkHMM CDS 2686394 2686570 . + . transcript "235" Adh GeneMarkHMM CDS 2686628 2686705 . + . transcript "235" Adh GeneMarkHMM CDS 2686770 2687146 . + . transcript "235" Adh GeneMarkHMM CDS 2687211 2687359 . + . transcript "235" Adh GeneMarkHMM CDS 2687415 2687920 . + . transcript "235" Adh GeneMarkHMM CDS 2687988 2688230 . + . transcript "235" Adh GeneMarkHMM CDS 2688365 2688395 . + . transcript "235" Adh GeneMarkHMM CDS 2688462 2688883 . + . transcript "235" Adh GeneMarkHMM CDS 2689073 2689183 . + . transcript "235" Adh GeneMarkHMM stop_codon 2689181 2689183 . + . transcript "235" Adh GeneMarkHMM stop_codon 2697858 2697860 . - . transcript "236" Adh GeneMarkHMM CDS 2697858 2698028 . - . transcript "236" Adh GeneMarkHMM CDS 2698091 2698198 . - . transcript "236" Adh GeneMarkHMM stop_codon 2698196 2698198 . - . transcript "236" Adh GeneMarkHMM start_codon 2707374 2707376 . + . transcript "237" Adh GeneMarkHMM CDS 2707374 2707439 . + . transcript "237" Adh GeneMarkHMM CDS 2707509 2708522 . + . transcript "237" Adh GeneMarkHMM stop_codon 2708520 2708522 . + . transcript "237" Adh GeneMarkHMM stop_codon 2709485 2709487 . - . transcript "238" Adh GeneMarkHMM CDS 2709485 2710765 . - . transcript "238" Adh GeneMarkHMM stop_codon 2710763 2710765 . - . transcript "238" Adh GeneMarkHMM start_codon 2711460 2711462 . + . transcript "239" Adh GeneMarkHMM CDS 2711460 2711538 . + . transcript "239" Adh GeneMarkHMM CDS 2711599 2711717 . + . transcript "239" Adh GeneMarkHMM CDS 2711781 2711853 . + . transcript "239" Adh GeneMarkHMM CDS 2711910 2712440 . + . transcript "239" Adh GeneMarkHMM CDS 2712522 2712646 . + . transcript "239" Adh GeneMarkHMM stop_codon 2712644 2712646 . + . transcript "239" Adh GeneMarkHMM stop_codon 2714781 2714783 . - . transcript "240" Adh GeneMarkHMM CDS 2714781 2716277 . - . transcript "240" Adh GeneMarkHMM CDS 2728123 2728429 . - . transcript "240" Adh GeneMarkHMM CDS 2736358 2736449 . - . transcript "240" Adh GeneMarkHMM stop_codon 2736447 2736449 . - . transcript "240" Adh GeneMarkHMM start_codon 2737704 2737706 . + . transcript "241" Adh GeneMarkHMM CDS 2737704 2737731 . + . transcript "241" Adh GeneMarkHMM CDS 2737860 2738132 . + . transcript "241" Adh GeneMarkHMM CDS 2738403 2739461 . + . transcript "241" Adh GeneMarkHMM CDS 2739531 2740039 . + . transcript "241" Adh GeneMarkHMM stop_codon 2740037 2740039 . + . transcript "241" Adh GeneMarkHMM start_codon 2740542 2740544 . + . transcript "242" Adh GeneMarkHMM CDS 2740542 2741090 . + . transcript "242" Adh GeneMarkHMM stop_codon 2741088 2741090 . + . transcript "242" Adh GeneMarkHMM stop_codon 2741243 2741245 . - . transcript "243" Adh GeneMarkHMM CDS 2741243 2741254 . - . transcript "243" Adh GeneMarkHMM CDS 2741396 2741990 . - . transcript "243" Adh GeneMarkHMM CDS 2742666 2742709 . - . transcript "243" Adh GeneMarkHMM stop_codon 2742707 2742709 . - . transcript "243" Adh GeneMarkHMM start_codon 2743611 2743613 . + . transcript "244" Adh GeneMarkHMM CDS 2743611 2745122 . + . transcript "244" Adh GeneMarkHMM stop_codon 2745120 2745122 . + . transcript "244" Adh GeneMarkHMM stop_codon 2746815 2746817 . - . transcript "245" Adh GeneMarkHMM CDS 2746815 2747453 . - . transcript "245" Adh GeneMarkHMM CDS 2748132 2748572 . - . transcript "245" Adh GeneMarkHMM stop_codon 2748570 2748572 . - . transcript "245" Adh GeneMarkHMM start_codon 2749571 2749573 . + . transcript "246" Adh GeneMarkHMM CDS 2749571 2749696 . + . transcript "246" Adh GeneMarkHMM CDS 2749753 2750868 . + . transcript "246" Adh GeneMarkHMM stop_codon 2750866 2750868 . + . transcript "246" Adh GeneMarkHMM stop_codon 2751337 2751339 . - . transcript "247" Adh GeneMarkHMM CDS 2751337 2751465 . - . transcript "247" Adh GeneMarkHMM CDS 2751521 2751711 . - . transcript "247" Adh GeneMarkHMM CDS 2751778 2751871 . - . transcript "247" Adh GeneMarkHMM CDS 2751973 2751984 . - . transcript "247" Adh GeneMarkHMM stop_codon 2751982 2751984 . - . transcript "247" Adh GeneMarkHMM start_codon 2752612 2752614 . + . transcript "248" Adh GeneMarkHMM CDS 2752612 2752742 . + . transcript "248" Adh GeneMarkHMM CDS 2752822 2752985 . + . transcript "248" Adh GeneMarkHMM CDS 2753042 2753322 . + . transcript "248" Adh GeneMarkHMM CDS 2753412 2753565 . + . transcript "248" Adh GeneMarkHMM CDS 2753620 2753756 . + . transcript "248" Adh GeneMarkHMM CDS 2753812 2753817 . + . transcript "248" Adh GeneMarkHMM stop_codon 2753815 2753817 . + . transcript "248" Adh GeneMarkHMM stop_codon 2755219 2755221 . - . transcript "249" Adh GeneMarkHMM CDS 2755219 2755580 . - . transcript "249" Adh GeneMarkHMM CDS 2755775 2755883 . - . transcript "249" Adh GeneMarkHMM CDS 2755954 2756092 . - . transcript "249" Adh GeneMarkHMM CDS 2756201 2756274 . - . transcript "249" Adh GeneMarkHMM stop_codon 2756272 2756274 . - . transcript "249" Adh GeneMarkHMM start_codon 2756920 2756922 . + . transcript "250" Adh GeneMarkHMM CDS 2756920 2757589 . + . transcript "250" Adh GeneMarkHMM CDS 2757658 2758391 . + . transcript "250" Adh GeneMarkHMM stop_codon 2758389 2758391 . + . transcript "250" Adh GeneMarkHMM stop_codon 2759163 2759165 . - . transcript "251" Adh GeneMarkHMM CDS 2759163 2759190 . - . transcript "251" Adh GeneMarkHMM CDS 2759260 2759403 . - . transcript "251" Adh GeneMarkHMM CDS 2759527 2759639 . - . transcript "251" Adh GeneMarkHMM CDS 2759701 2759850 . - . transcript "251" Adh GeneMarkHMM stop_codon 2759848 2759850 . - . transcript "251" Adh GeneMarkHMM start_codon 2760361 2760363 . + . transcript "252" Adh GeneMarkHMM CDS 2760361 2760672 . + . transcript "252" Adh GeneMarkHMM CDS 2760766 2761087 . + . transcript "252" Adh GeneMarkHMM CDS 2761141 2762087 . + . transcript "252" Adh GeneMarkHMM stop_codon 2762085 2762087 . + . transcript "252" Adh GeneMarkHMM stop_codon 2762604 2762606 . - . transcript "253" Adh GeneMarkHMM CDS 2762604 2762608 . - . transcript "253" Adh GeneMarkHMM CDS 2762665 2762710 . - . transcript "253" Adh GeneMarkHMM CDS 2763711 2763968 . - . transcript "253" Adh GeneMarkHMM CDS 2764030 2764118 . - . transcript "253" Adh GeneMarkHMM CDS 2772220 2772430 . - . transcript "253" Adh GeneMarkHMM CDS 2772600 2772777 . - . transcript "253" Adh GeneMarkHMM CDS 2773593 2774287 . - . transcript "253" Adh GeneMarkHMM stop_codon 2774285 2774287 . - . transcript "253" Adh GeneMarkHMM start_codon 2776429 2776431 . + . transcript "254" Adh GeneMarkHMM CDS 2776429 2777295 . + . transcript "254" Adh GeneMarkHMM stop_codon 2777293 2777295 . + . transcript "254" Adh GeneMarkHMM stop_codon 2777390 2777392 . - . transcript "255" Adh GeneMarkHMM CDS 2777390 2777609 . - . transcript "255" Adh GeneMarkHMM CDS 2777672 2778342 . - . transcript "255" Adh GeneMarkHMM stop_codon 2778340 2778342 . - . transcript "255" Adh GeneMarkHMM start_codon 2779268 2779270 . + . transcript "256" Adh GeneMarkHMM CDS 2779268 2779279 . + . transcript "256" Adh GeneMarkHMM CDS 2779339 2779566 . + . transcript "256" Adh GeneMarkHMM stop_codon 2779564 2779566 . + . transcript "256" Adh GeneMarkHMM stop_codon 2785078 2785080 . - . transcript "257" Adh GeneMarkHMM CDS 2785078 2785356 . - . transcript "257" Adh GeneMarkHMM CDS 2786105 2786724 . - . transcript "257" Adh GeneMarkHMM CDS 2786839 2787069 . - . transcript "257" Adh GeneMarkHMM CDS 2787522 2787885 . - . transcript "257" Adh GeneMarkHMM CDS 2787948 2788135 . - . transcript "257" Adh GeneMarkHMM CDS 2788407 2788454 . - . transcript "257" Adh GeneMarkHMM CDS 2788523 2788540 . - . transcript "257" Adh GeneMarkHMM CDS 2788598 2788684 . - . transcript "257" Adh GeneMarkHMM CDS 2788808 2789082 . - . transcript "257" Adh GeneMarkHMM CDS 2789143 2789555 . - . transcript "257" Adh GeneMarkHMM CDS 2789836 2790921 . - . transcript "257" Adh GeneMarkHMM stop_codon 2790919 2790921 . - . transcript "257" Adh GeneMarkHMM stop_codon 2791866 2791868 . - . transcript "258" Adh GeneMarkHMM CDS 2791866 2792011 . - . transcript "258" Adh GeneMarkHMM CDS 2792082 2792564 . - . transcript "258" Adh GeneMarkHMM CDS 2793554 2793668 . - . transcript "258" Adh GeneMarkHMM CDS 2793686 2795139 . - . transcript "258" Adh GeneMarkHMM CDS 2795176 2798715 . - . transcript "258" Adh GeneMarkHMM CDS 2801187 2801286 . - . transcript "258" Adh GeneMarkHMM stop_codon 2801284 2801286 . - . transcript "258" Adh GeneMarkHMM start_codon 2802355 2802357 . + . transcript "259" Adh GeneMarkHMM CDS 2802355 2802394 . + . transcript "259" Adh GeneMarkHMM CDS 2802473 2802813 . + . transcript "259" Adh GeneMarkHMM stop_codon 2802811 2802813 . + . transcript "259" Adh GeneMarkHMM stop_codon 2804442 2804444 . - . transcript "260" Adh GeneMarkHMM CDS 2804442 2805730 . - . transcript "260" Adh GeneMarkHMM CDS 2805800 2805812 . - . transcript "260" Adh GeneMarkHMM stop_codon 2805810 2805812 . - . transcript "260" Adh GeneMarkHMM start_codon 2815178 2815180 . + . transcript "261" Adh GeneMarkHMM CDS 2815178 2815829 . + . transcript "261" Adh GeneMarkHMM CDS 2815894 2816135 . + . transcript "261" Adh GeneMarkHMM stop_codon 2816133 2816135 . + . transcript "261" Adh GeneMarkHMM stop_codon 2853316 2853318 . - . transcript "262" Adh GeneMarkHMM CDS 2853316 2853362 . - . transcript "262" Adh GeneMarkHMM CDS 2853744 2854099 . - . transcript "262" Adh GeneMarkHMM CDS 2854197 2855134 . - . transcript "262" Adh GeneMarkHMM CDS 2856104 2856265 . - . transcript "262" Adh GeneMarkHMM stop_codon 2856263 2856265 . - . transcript "262" Adh GeneMarkHMM start_codon 2894707 2894709 . + . transcript "263" Adh GeneMarkHMM CDS 2894707 2895247 . + . transcript "263" Adh GeneMarkHMM CDS 2895319 2895952 . + . transcript "263" Adh GeneMarkHMM CDS 2896639 2896763 . + . transcript "263" Adh GeneMarkHMM CDS 2898444 2899001 . + . transcript "263" Adh GeneMarkHMM CDS 2899061 2899716 . + . transcript "263" Adh GeneMarkHMM stop_codon 2899714 2899716 . + . transcript "263" Adh GeneMarkHMM start_codon 2900448 2900450 . + . transcript "264" Adh GeneMarkHMM CDS 2900448 2900565 . + . transcript "264" Adh GeneMarkHMM CDS 2900634 2901185 . + . transcript "264" Adh GeneMarkHMM CDS 2901452 2902107 . + . transcript "264" Adh GeneMarkHMM stop_codon 2902105 2902107 . + . transcript "264" Adh GeneMarkHMM stop_codon 2916879 2916881 . - . transcript "265" Adh GeneMarkHMM CDS 2916879 2917012 . - . transcript "265" Adh GeneMarkHMM CDS 2917311 2917504 . - . transcript "265" Adh GeneMarkHMM CDS 2917751 2917988 . - . transcript "265" Adh GeneMarkHMM CDS 2918253 2918513 . - . transcript "265" # # compfly: 1. replaced "IMIM" with "GeneID" Oct 4 (MR) # 2. Added new line at the end of the file. Oct 4 (MR) # 3. tabs added Oct 4 (MR) # Adh GeneID CDS 90 441 . - . transcript "0" Adh GeneID CDS 2379 2862 . - . transcript "0" Adh GeneID CDS 3225 3550 . - . transcript "0" Adh GeneID CDS 6718 7018 . - . transcript "0" Adh GeneID start_codon 7016 7018 . - . transcript "0" Adh GeneID start_codon 12833 12835 . + . transcript "1" Adh GeneID CDS 12833 12879 . + . transcript "1" Adh GeneID CDS 16005 16158 . + . transcript "1" Adh GeneID CDS 17242 17286 . + . transcript "1" Adh GeneID stop_codon 17284 17286 . + . transcript "1" Adh GeneID start_codon 21920 21922 . + . transcript "2" Adh GeneID CDS 21920 21979 . + . transcript "2" Adh GeneID CDS 22140 22295 . + . transcript "2" Adh GeneID stop_codon 22293 22295 . + . transcript "2" Adh GeneID start_codon 22929 22931 . + . transcript "3" Adh GeneID CDS 22929 23189 . + . transcript "3" Adh GeneID CDS 23249 23404 . + . transcript "3" Adh GeneID stop_codon 23402 23404 . + . transcript "3" Adh GeneID start_codon 23970 23972 . + . transcript "4" Adh GeneID CDS 23970 24134 . + . transcript "4" Adh GeneID CDS 24195 24356 . + . transcript "4" Adh GeneID stop_codon 24354 24356 . + . transcript "4" Adh GeneID start_codon 25084 25086 . + . transcript "5" Adh GeneID CDS 25084 25209 . + . transcript "5" Adh GeneID CDS 25377 25436 . + . transcript "5" Adh GeneID stop_codon 25434 25436 . + . transcript "5" Adh GeneID stop_codon 26939 26941 . - . transcript "6" Adh GeneID CDS 26939 26982 . - . transcript "6" Adh GeneID CDS 28665 28784 . - . transcript "6" Adh GeneID CDS 31856 31925 . - . transcript "6" Adh GeneID CDS 33637 33735 . - . transcript "6" Adh GeneID start_codon 33733 33735 . - . transcript "6" Adh GeneID start_codon 34783 34785 . + . transcript "7" Adh GeneID CDS 34783 34822 . + . transcript "7" Adh GeneID CDS 34884 34957 . + . transcript "7" Adh GeneID CDS 35906 35995 . + . transcript "7" Adh GeneID stop_codon 35993 35995 . + . transcript "7" Adh GeneID start_codon 36731 36733 . + . transcript "8" Adh GeneID CDS 36731 37222 . + . transcript "8" Adh GeneID CDS 37795 37836 . + . transcript "8" Adh GeneID stop_codon 37834 37836 . + . transcript "8" Adh GeneID start_codon 45369 45371 . + . transcript "9" Adh GeneID CDS 45369 45421 . + . transcript "9" Adh GeneID CDS 46147 46201 . + . transcript "9" Adh GeneID CDS 52555 52587 . + . transcript "9" Adh GeneID CDS 53283 53330 . + . transcript "9" Adh GeneID stop_codon 53328 53330 . + . transcript "9" Adh GeneID stop_codon 63112 63114 . - . transcript "10" Adh GeneID CDS 63112 63146 . - . transcript "10" Adh GeneID CDS 65175 65209 . - . transcript "10" Adh GeneID CDS 65813 65904 . - . transcript "10" Adh GeneID CDS 66456 66512 . - . transcript "10" Adh GeneID start_codon 66510 66512 . - . transcript "10" Adh GeneID start_codon 69331 69333 . + . transcript "11" Adh GeneID CDS 69331 69426 . + . transcript "11" Adh GeneID CDS 71954 72014 . + . transcript "11" Adh GeneID CDS 78205 78266 . + . transcript "11" Adh GeneID CDS 80772 80831 . + . transcript "11" Adh GeneID stop_codon 80829 80831 . + . transcript "11" Adh GeneID stop_codon 84468 84470 . - . transcript "12" Adh GeneID CDS 84468 84563 . - . transcript "12" Adh GeneID CDS 86763 86927 . - . transcript "12" Adh GeneID start_codon 86925 86927 . - . transcript "12" Adh GeneID stop_codon 94344 94346 . - . transcript "13" Adh GeneID CDS 94344 94481 . - . transcript "13" Adh GeneID CDS 96195 96257 . - . transcript "13" Adh GeneID start_codon 96255 96257 . - . transcript "13" Adh GeneID start_codon 98960 98962 . + . transcript "14" Adh GeneID CDS 98960 99046 . + . transcript "14" Adh GeneID CDS 103543 103641 . + . transcript "14" Adh GeneID stop_codon 103639 103641 . + . transcript "14" Adh GeneID start_codon 104250 104252 . + . transcript "15" Adh GeneID CDS 104250 104330 . + . transcript "15" Adh GeneID CDS 110660 110741 . + . transcript "15" Adh GeneID CDS 124458 124936 . + . transcript "15" Adh GeneID CDS 127146 127292 . + . transcript "15" Adh GeneID CDS 127771 127931 . + . transcript "15" Adh GeneID CDS 127991 128225 . + . transcript "15" Adh GeneID CDS 128296 129342 . + . transcript "15" Adh GeneID CDS 129401 129965 . + . transcript "15" Adh GeneID CDS 131040 131248 . + . transcript "15" Adh GeneID stop_codon 131246 131248 . + . transcript "15" Adh GeneID stop_codon 132274 132276 . - . transcript "16" Adh GeneID CDS 132274 132348 . - . transcript "16" Adh GeneID CDS 132736 132799 . - . transcript "16" Adh GeneID CDS 133612 134233 . - . transcript "16" Adh GeneID CDS 134862 135000 . - . transcript "16" Adh GeneID start_codon 134998 135000 . - . transcript "16" Adh GeneID start_codon 159578 159580 . + . transcript "17" Adh GeneID CDS 159578 159874 . + . transcript "17" Adh GeneID CDS 161727 162105 . + . transcript "17" Adh GeneID CDS 162442 162557 . + . transcript "17" Adh GeneID CDS 162616 163137 . + . transcript "17" Adh GeneID CDS 163297 163527 . + . transcript "17" Adh GeneID stop_codon 163525 163527 . + . transcript "17" Adh GeneID start_codon 172541 172543 . + . transcript "18" Adh GeneID CDS 172541 172596 . + . transcript "18" Adh GeneID CDS 173740 173896 . + . transcript "18" Adh GeneID stop_codon 173894 173896 . + . transcript "18" Adh GeneID stop_codon 174958 174960 . - . transcript "19" Adh GeneID CDS 174958 175001 . - . transcript "19" Adh GeneID CDS 175152 175341 . - . transcript "19" Adh GeneID CDS 176875 176961 . - . transcript "19" Adh GeneID start_codon 176959 176961 . - . transcript "19" Adh GeneID stop_codon 177933 177935 . - . transcript "20" Adh GeneID CDS 177933 178015 . - . transcript "20" Adh GeneID CDS 178136 178300 . - . transcript "20" Adh GeneID CDS 181272 181409 . - . transcript "20" Adh GeneID CDS 183596 183635 . - . transcript "20" Adh GeneID CDS 183699 183764 . - . transcript "20" Adh GeneID CDS 183835 184040 . - . transcript "20" Adh GeneID CDS 184241 184282 . - . transcript "20" Adh GeneID CDS 196417 196460 . - . transcript "20" Adh GeneID CDS 197423 197466 . - . transcript "20" Adh GeneID CDS 198338 198400 . - . transcript "20" Adh GeneID start_codon 198398 198400 . - . transcript "20" Adh GeneID start_codon 202266 202268 . + . transcript "21" Adh GeneID CDS 202266 202646 . + . transcript "21" Adh GeneID CDS 202700 204199 . + . transcript "21" Adh GeneID stop_codon 204197 204199 . + . transcript "21" Adh GeneID stop_codon 213884 213886 . - . transcript "22" Adh GeneID CDS 213884 213925 . - . transcript "22" Adh GeneID CDS 216171 216746 . - . transcript "22" Adh GeneID start_codon 216744 216746 . - . transcript "22" Adh GeneID start_codon 220828 220830 . + . transcript "23" Adh GeneID CDS 220828 220908 . + . transcript "23" Adh GeneID CDS 224679 224738 . + . transcript "23" Adh GeneID CDS 225336 225380 . + . transcript "23" Adh GeneID CDS 233119 233181 . + . transcript "23" Adh GeneID stop_codon 233179 233181 . + . transcript "23" Adh GeneID start_codon 235935 235937 . + . transcript "24" Adh GeneID CDS 235935 235985 . + . transcript "24" Adh GeneID CDS 236048 236116 . + . transcript "24" Adh GeneID CDS 253725 253802 . + . transcript "24" Adh GeneID stop_codon 253800 253802 . + . transcript "24" Adh GeneID start_codon 260672 260674 . + . transcript "25" Adh GeneID CDS 260672 260736 . + . transcript "25" Adh GeneID CDS 262958 262991 . + . transcript "25" Adh GeneID CDS 264927 264997 . + . transcript "25" Adh GeneID CDS 265273 266322 . + . transcript "25" Adh GeneID CDS 266392 266619 . + . transcript "25" Adh GeneID CDS 266684 266867 . + . transcript "25" Adh GeneID CDS 266935 267073 . + . transcript "25" Adh GeneID CDS 267309 267367 . + . transcript "25" Adh GeneID stop_codon 267365 267367 . + . transcript "25" Adh GeneID stop_codon 268487 268489 . - . transcript "26" Adh GeneID CDS 268487 268518 . - . transcript "26" Adh GeneID CDS 269222 269559 . - . transcript "26" Adh GeneID CDS 269629 269907 . - . transcript "26" Adh GeneID CDS 271522 271573 . - . transcript "26" Adh GeneID CDS 273396 273483 . - . transcript "26" Adh GeneID start_codon 273481 273483 . - . transcript "26" Adh GeneID start_codon 274763 274765 . + . transcript "27" Adh GeneID CDS 274763 275383 . + . transcript "27" Adh GeneID CDS 277228 277299 . + . transcript "27" Adh GeneID stop_codon 277297 277299 . + . transcript "27" Adh GeneID start_codon 277921 277923 . + . transcript "28" Adh GeneID CDS 277921 278103 . + . transcript "28" Adh GeneID CDS 278222 278345 . + . transcript "28" Adh GeneID CDS 278537 278737 . + . transcript "28" Adh GeneID CDS 278802 279272 . + . transcript "28" Adh GeneID CDS 279548 279726 . + . transcript "28" Adh GeneID CDS 280031 280247 . + . transcript "28" Adh GeneID CDS 280310 280610 . + . transcript "28" Adh GeneID CDS 280674 280986 . + . transcript "28" Adh GeneID CDS 281051 281202 . + . transcript "28" Adh GeneID CDS 281264 281447 . + . transcript "28" Adh GeneID CDS 281550 281787 . + . transcript "28" Adh GeneID CDS 281848 282471 . + . transcript "28" Adh GeneID CDS 282539 283541 . + . transcript "28" Adh GeneID CDS 284969 285346 . + . transcript "28" Adh GeneID CDS 285416 286203 . + . transcript "28" Adh GeneID CDS 287010 287068 . + . transcript "28" Adh GeneID stop_codon 287066 287068 . + . transcript "28" Adh GeneID start_codon 287599 287601 . + . transcript "29" Adh GeneID CDS 287599 288379 . + . transcript "29" Adh GeneID CDS 288647 292689 . + . transcript "29" Adh GeneID CDS 296837 296911 . + . transcript "29" Adh GeneID stop_codon 296909 296911 . + . transcript "29" Adh GeneID start_codon 297680 297682 . + . transcript "30" Adh GeneID CDS 297680 297713 . + . transcript "30" Adh GeneID CDS 300675 300768 . + . transcript "30" Adh GeneID CDS 301078 301163 . + . transcript "30" Adh GeneID CDS 302560 302718 . + . transcript "30" Adh GeneID CDS 302786 303405 . + . transcript "30" Adh GeneID stop_codon 303403 303405 . + . transcript "30" Adh GeneID stop_codon 303960 303962 . - . transcript "31" Adh GeneID CDS 303960 304272 . - . transcript "31" Adh GeneID CDS 304330 304868 . - . transcript "31" Adh GeneID start_codon 304866 304868 . - . transcript "31" Adh GeneID start_codon 305396 305398 . + . transcript "32" Adh GeneID CDS 305396 305516 . + . transcript "32" Adh GeneID CDS 305577 305737 . + . transcript "32" Adh GeneID CDS 305803 306108 . + . transcript "32" Adh GeneID CDS 307656 309056 . + . transcript "32" Adh GeneID CDS 309110 309467 . + . transcript "32" Adh GeneID CDS 309530 310452 . + . transcript "32" Adh GeneID CDS 310517 311365 . + . transcript "32" Adh GeneID CDS 311428 312318 . + . transcript "32" Adh GeneID CDS 312387 313020 . + . transcript "32" Adh GeneID CDS 313086 313129 . + . transcript "32" Adh GeneID stop_codon 313127 313129 . + . transcript "32" Adh GeneID start_codon 315321 315323 . + . transcript "33" Adh GeneID CDS 315321 315899 . + . transcript "33" Adh GeneID CDS 316433 316800 . + . transcript "33" Adh GeneID CDS 316865 317462 . + . transcript "33" Adh GeneID stop_codon 317460 317462 . + . transcript "33" Adh GeneID stop_codon 318604 318606 . - . transcript "34" Adh GeneID CDS 318604 319430 . - . transcript "34" Adh GeneID CDS 319486 321442 . - . transcript "34" Adh GeneID start_codon 321440 321442 . - . transcript "34" Adh GeneID stop_codon 321967 321969 . - . transcript "35" Adh GeneID CDS 321967 323027 . - . transcript "35" Adh GeneID CDS 323097 323169 . - . transcript "35" Adh GeneID start_codon 323167 323169 . - . transcript "35" Adh GeneID start_codon 324088 324090 . + . transcript "36" Adh GeneID CDS 324088 324885 . + . transcript "36" Adh GeneID CDS 324939 325181 . + . transcript "36" Adh GeneID CDS 327205 328002 . + . transcript "36" Adh GeneID stop_codon 328000 328002 . + . transcript "36" Adh GeneID start_codon 329808 329810 . + . transcript "37" Adh GeneID CDS 329808 330183 . + . transcript "37" Adh GeneID CDS 331090 331184 . + . transcript "37" Adh GeneID stop_codon 331182 331184 . + . transcript "37" Adh GeneID stop_codon 336668 336670 . - . transcript "38" Adh GeneID CDS 336668 337323 . - . transcript "38" Adh GeneID CDS 338217 338879 . - . transcript "38" Adh GeneID CDS 338944 339013 . - . transcript "38" Adh GeneID start_codon 339011 339013 . - . transcript "38" Adh GeneID start_codon 340801 340803 . + . transcript "39" Adh GeneID CDS 340801 340870 . + . transcript "39" Adh GeneID CDS 341042 341517 . + . transcript "39" Adh GeneID stop_codon 341515 341517 . + . transcript "39" Adh GeneID start_codon 342065 342067 . + . transcript "40" Adh GeneID CDS 342065 342689 . + . transcript "40" Adh GeneID CDS 352465 352507 . + . transcript "40" Adh GeneID CDS 352710 352779 . + . transcript "40" Adh GeneID CDS 353896 353995 . + . transcript "40" Adh GeneID CDS 355461 355495 . + . transcript "40" Adh GeneID stop_codon 355493 355495 . + . transcript "40" Adh GeneID stop_codon 357545 357547 . - . transcript "41" Adh GeneID CDS 357545 357620 . - . transcript "41" Adh GeneID CDS 360158 360259 . - . transcript "41" Adh GeneID CDS 360758 360834 . - . transcript "41" Adh GeneID start_codon 360832 360834 . - . transcript "41" Adh GeneID start_codon 363679 363681 . + . transcript "42" Adh GeneID CDS 363679 363789 . + . transcript "42" Adh GeneID CDS 365825 365872 . + . transcript "42" Adh GeneID CDS 366881 366996 . + . transcript "42" Adh GeneID CDS 367823 367921 . + . transcript "42" Adh GeneID CDS 368199 368283 . + . transcript "42" Adh GeneID stop_codon 368281 368283 . + . transcript "42" Adh GeneID start_codon 373286 373288 . + . transcript "43" Adh GeneID CDS 373286 373457 . + . transcript "43" Adh GeneID CDS 380155 380203 . + . transcript "43" Adh GeneID CDS 381372 381403 . + . transcript "43" Adh GeneID CDS 385051 385283 . + . transcript "43" Adh GeneID CDS 388780 388921 . + . transcript "43" Adh GeneID CDS 389006 389140 . + . transcript "43" Adh GeneID CDS 389208 390491 . + . transcript "43" Adh GeneID CDS 390556 390673 . + . transcript "43" Adh GeneID CDS 390737 391112 . + . transcript "43" Adh GeneID CDS 391177 391489 . + . transcript "43" Adh GeneID CDS 391830 391921 . + . transcript "43" Adh GeneID stop_codon 391919 391921 . + . transcript "43" Adh GeneID stop_codon 393573 393575 . - . transcript "44" Adh GeneID CDS 393573 393814 . - . transcript "44" Adh GeneID CDS 393894 394052 . - . transcript "44" Adh GeneID CDS 394383 395732 . - . transcript "44" Adh GeneID CDS 395826 397468 . - . transcript "44" Adh GeneID CDS 397532 397671 . - . transcript "44" Adh GeneID start_codon 397669 397671 . - . transcript "44" Adh GeneID start_codon 400338 400340 . + . transcript "45" Adh GeneID CDS 400338 400923 . + . transcript "45" Adh GeneID CDS 401350 401713 . + . transcript "45" Adh GeneID CDS 401775 402341 . + . transcript "45" Adh GeneID CDS 402399 402539 . + . transcript "45" Adh GeneID CDS 403000 403033 . + . transcript "45" Adh GeneID stop_codon 403031 403033 . + . transcript "45" Adh GeneID start_codon 403813 403815 . + . transcript "46" Adh GeneID CDS 403813 404414 . + . transcript "46" Adh GeneID CDS 404467 405027 . + . transcript "46" Adh GeneID CDS 405085 405391 . + . transcript "46" Adh GeneID stop_codon 405389 405391 . + . transcript "46" Adh GeneID start_codon 408759 408761 . + . transcript "47" Adh GeneID CDS 408759 409001 . + . transcript "47" Adh GeneID CDS 409150 409656 . + . transcript "47" Adh GeneID CDS 410157 410315 . + . transcript "47" Adh GeneID CDS 410372 410612 . + . transcript "47" Adh GeneID CDS 410677 411401 . + . transcript "47" Adh GeneID CDS 411728 411835 . + . transcript "47" Adh GeneID stop_codon 411833 411835 . + . transcript "47" Adh GeneID stop_codon 415576 415578 . - . transcript "48" Adh GeneID CDS 415576 416211 . - . transcript "48" Adh GeneID CDS 416276 416749 . - . transcript "48" Adh GeneID CDS 424891 424974 . - . transcript "48" Adh GeneID start_codon 424972 424974 . - . transcript "48" Adh GeneID stop_codon 426746 426748 . - . transcript "49" Adh GeneID CDS 426746 427546 . - . transcript "49" Adh GeneID CDS 434505 434541 . - . transcript "49" Adh GeneID CDS 438983 439800 . - . transcript "49" Adh GeneID CDS 440839 440877 . - . transcript "49" Adh GeneID CDS 443615 443701 . - . transcript "49" Adh GeneID start_codon 443699 443701 . - . transcript "49" Adh GeneID start_codon 444366 444368 . + . transcript "50" Adh GeneID CDS 444366 444410 . + . transcript "50" Adh GeneID CDS 448492 448607 . + . transcript "50" Adh GeneID CDS 449015 449184 . + . transcript "50" Adh GeneID CDS 450558 450589 . + . transcript "50" Adh GeneID stop_codon 450587 450589 . + . transcript "50" Adh GeneID start_codon 451645 451647 . + . transcript "51" Adh GeneID CDS 451645 451902 . + . transcript "51" Adh GeneID CDS 454718 454755 . + . transcript "51" Adh GeneID CDS 454999 455702 . + . transcript "51" Adh GeneID CDS 455870 456267 . + . transcript "51" Adh GeneID stop_codon 456265 456267 . + . transcript "51" Adh GeneID start_codon 457298 457300 . + . transcript "52" Adh GeneID CDS 457298 457488 . + . transcript "52" Adh GeneID CDS 457649 458210 . + . transcript "52" Adh GeneID stop_codon 458208 458210 . + . transcript "52" Adh GeneID stop_codon 458837 458839 . - . transcript "53" Adh GeneID CDS 458837 459146 . - . transcript "53" Adh GeneID CDS 459225 459761 . - . transcript "53" Adh GeneID CDS 460256 460674 . - . transcript "53" Adh GeneID start_codon 460672 460674 . - . transcript "53" Adh GeneID stop_codon 462092 462094 . - . transcript "54" Adh GeneID CDS 462092 462584 . - . transcript "54" Adh GeneID CDS 462646 463209 . - . transcript "54" Adh GeneID CDS 463368 463657 . - . transcript "54" Adh GeneID start_codon 463655 463657 . - . transcript "54" Adh GeneID start_codon 464308 464310 . + . transcript "55" Adh GeneID CDS 464308 464615 . + . transcript "55" Adh GeneID CDS 464888 465434 . + . transcript "55" Adh GeneID stop_codon 465432 465434 . + . transcript "55" Adh GeneID stop_codon 466940 466942 . - . transcript "56" Adh GeneID CDS 466940 466984 . - . transcript "56" Adh GeneID CDS 468156 469610 . - . transcript "56" Adh GeneID start_codon 469608 469610 . - . transcript "56" Adh GeneID start_codon 471109 471111 . + . transcript "57" Adh GeneID CDS 471109 471296 . + . transcript "57" Adh GeneID CDS 471441 471687 . + . transcript "57" Adh GeneID CDS 471752 471856 . + . transcript "57" Adh GeneID CDS 471944 472490 . + . transcript "57" Adh GeneID CDS 472557 472823 . + . transcript "57" Adh GeneID CDS 472965 473128 . + . transcript "57" Adh GeneID stop_codon 473126 473128 . + . transcript "57" Adh GeneID start_codon 474097 474099 . + . transcript "58" Adh GeneID CDS 474097 474189 . + . transcript "58" Adh GeneID CDS 474251 474306 . + . transcript "58" Adh GeneID CDS 474365 475283 . + . transcript "58" Adh GeneID CDS 475427 476389 . + . transcript "58" Adh GeneID stop_codon 476387 476389 . + . transcript "58" Adh GeneID stop_codon 477171 477173 . - . transcript "59" Adh GeneID CDS 477171 477490 . - . transcript "59" Adh GeneID CDS 477548 479329 . - . transcript "59" Adh GeneID CDS 479386 479753 . - . transcript "59" Adh GeneID CDS 480016 480081 . - . transcript "59" Adh GeneID CDS 481570 481638 . - . transcript "59" Adh GeneID CDS 483386 483457 . - . transcript "59" Adh GeneID CDS 486686 487236 . - . transcript "59" Adh GeneID start_codon 487234 487236 . - . transcript "59" Adh GeneID start_codon 501938 501940 . + . transcript "60" Adh GeneID CDS 501938 502055 . + . transcript "60" Adh GeneID CDS 502113 502184 . + . transcript "60" Adh GeneID CDS 506504 506598 . + . transcript "60" Adh GeneID stop_codon 506596 506598 . + . transcript "60" Adh GeneID start_codon 509545 509547 . + . transcript "61" Adh GeneID CDS 509545 509783 . + . transcript "61" Adh GeneID CDS 509881 510226 . + . transcript "61" Adh GeneID CDS 510287 510786 . + . transcript "61" Adh GeneID CDS 511784 512375 . + . transcript "61" Adh GeneID CDS 512435 512758 . + . transcript "61" Adh GeneID stop_codon 512756 512758 . + . transcript "61" Adh GeneID start_codon 514500 514502 . + . transcript "62" Adh GeneID CDS 514500 514568 . + . transcript "62" Adh GeneID CDS 516142 516186 . + . transcript "62" Adh GeneID CDS 517385 517424 . + . transcript "62" Adh GeneID CDS 519063 519100 . + . transcript "62" Adh GeneID stop_codon 519098 519100 . + . transcript "62" Adh GeneID start_codon 520781 520783 . + . transcript "63" Adh GeneID CDS 520781 521850 . + . transcript "63" Adh GeneID CDS 522013 522988 . + . transcript "63" Adh GeneID stop_codon 522986 522988 . + . transcript "63" Adh GeneID start_codon 541380 541382 . + . transcript "64" Adh GeneID CDS 541380 541868 . + . transcript "64" Adh GeneID CDS 546070 546114 . + . transcript "64" Adh GeneID stop_codon 546112 546114 . + . transcript "64" Adh GeneID start_codon 552260 552262 . + . transcript "65" Adh GeneID CDS 552260 552388 . + . transcript "65" Adh GeneID CDS 554707 554823 . + . transcript "65" Adh GeneID stop_codon 554821 554823 . + . transcript "65" Adh GeneID start_codon 555669 555671 . + . transcript "66" Adh GeneID CDS 555669 555824 . + . transcript "66" Adh GeneID CDS 555920 556370 . + . transcript "66" Adh GeneID CDS 565238 565272 . + . transcript "66" Adh GeneID CDS 570329 570621 . + . transcript "66" Adh GeneID CDS 570790 570947 . + . transcript "66" Adh GeneID CDS 574289 574483 . + . transcript "66" Adh GeneID CDS 575409 575495 . + . transcript "66" Adh GeneID CDS 577240 577316 . + . transcript "66" Adh GeneID CDS 578136 578177 . + . transcript "66" Adh GeneID stop_codon 578175 578177 . + . transcript "66" Adh GeneID start_codon 582449 582451 . + . transcript "67" Adh GeneID CDS 582449 582610 . + . transcript "67" Adh GeneID CDS 588100 588144 . + . transcript "67" Adh GeneID CDS 590806 590840 . + . transcript "67" Adh GeneID CDS 597180 597264 . + . transcript "67" Adh GeneID stop_codon 597262 597264 . + . transcript "67" Adh GeneID start_codon 598403 598405 . + . transcript "68" Adh GeneID CDS 598403 598796 . + . transcript "68" Adh GeneID CDS 598857 599119 . + . transcript "68" Adh GeneID CDS 599219 600403 . + . transcript "68" Adh GeneID CDS 601852 601887 . + . transcript "68" Adh GeneID stop_codon 601885 601887 . + . transcript "68" Adh GeneID stop_codon 618525 618527 . - . transcript "69" Adh GeneID CDS 618525 618629 . - . transcript "69" Adh GeneID CDS 619451 619606 . - . transcript "69" Adh GeneID CDS 619825 619926 . - . transcript "69" Adh GeneID start_codon 619924 619926 . - . transcript "69" Adh GeneID start_codon 645844 645846 . + . transcript "70" Adh GeneID CDS 645844 645912 . + . transcript "70" Adh GeneID CDS 650611 651153 . + . transcript "70" Adh GeneID CDS 651278 651478 . + . transcript "70" Adh GeneID CDS 651583 652282 . + . transcript "70" Adh GeneID CDS 652397 652740 . + . transcript "70" Adh GeneID CDS 654404 654441 . + . transcript "70" Adh GeneID CDS 654829 654889 . + . transcript "70" Adh GeneID stop_codon 654887 654889 . + . transcript "70" Adh GeneID start_codon 655882 655884 . + . transcript "71" Adh GeneID CDS 655882 655918 . + . transcript "71" Adh GeneID CDS 656060 656143 . + . transcript "71" Adh GeneID CDS 656207 656368 . + . transcript "71" Adh GeneID CDS 656510 656593 . + . transcript "71" Adh GeneID CDS 656717 656922 . + . transcript "71" Adh GeneID stop_codon 656920 656922 . + . transcript "71" Adh GeneID stop_codon 657691 657693 . - . transcript "72" Adh GeneID CDS 657691 658001 . - . transcript "72" Adh GeneID CDS 658058 658265 . - . transcript "72" Adh GeneID CDS 658326 658463 . - . transcript "72" Adh GeneID CDS 658526 660838 . - . transcript "72" Adh GeneID CDS 660917 661225 . - . transcript "72" Adh GeneID start_codon 661223 661225 . - . transcript "72" Adh GeneID stop_codon 675845 675847 . - . transcript "73" Adh GeneID CDS 675845 675884 . - . transcript "73" Adh GeneID CDS 678040 678080 . - . transcript "73" Adh GeneID CDS 678702 678757 . - . transcript "73" Adh GeneID CDS 679981 680889 . - . transcript "73" Adh GeneID CDS 682192 682252 . - . transcript "73" Adh GeneID CDS 682831 682969 . - . transcript "73" Adh GeneID CDS 683154 683188 . - . transcript "73" Adh GeneID start_codon 683186 683188 . - . transcript "73" Adh GeneID stop_codon 686267 686269 . - . transcript "74" Adh GeneID CDS 686267 686318 . - . transcript "74" Adh GeneID CDS 689469 689746 . - . transcript "74" Adh GeneID CDS 689811 689983 . - . transcript "74" Adh GeneID CDS 691393 691603 . - . transcript "74" Adh GeneID CDS 692320 692362 . - . transcript "74" Adh GeneID CDS 692525 692589 . - . transcript "74" Adh GeneID start_codon 692587 692589 . - . transcript "74" Adh GeneID start_codon 694468 694470 . + . transcript "75" Adh GeneID CDS 694468 694500 . + . transcript "75" Adh GeneID CDS 694884 695008 . + . transcript "75" Adh GeneID CDS 695350 695392 . + . transcript "75" Adh GeneID stop_codon 695390 695392 . + . transcript "75" Adh GeneID stop_codon 702813 702815 . - . transcript "76" Adh GeneID CDS 702813 702853 . - . transcript "76" Adh GeneID CDS 708573 708672 . - . transcript "76" Adh GeneID CDS 710763 710805 . - . transcript "76" Adh GeneID CDS 716575 716639 . - . transcript "76" Adh GeneID start_codon 716637 716639 . - . transcript "76" Adh GeneID start_codon 717626 717628 . + . transcript "77" Adh GeneID CDS 717626 717770 . + . transcript "77" Adh GeneID CDS 717926 718029 . + . transcript "77" Adh GeneID stop_codon 718027 718029 . + . transcript "77" Adh GeneID start_codon 722080 722082 . + . transcript "78" Adh GeneID CDS 722080 722124 . + . transcript "78" Adh GeneID CDS 725159 725302 . + . transcript "78" Adh GeneID CDS 735103 735171 . + . transcript "78" Adh GeneID stop_codon 735169 735171 . + . transcript "78" Adh GeneID stop_codon 739646 739648 . - . transcript "79" Adh GeneID CDS 739646 739678 . - . transcript "79" Adh GeneID CDS 742986 743055 . - . transcript "79" Adh GeneID CDS 748186 748265 . - . transcript "79" Adh GeneID CDS 749991 750045 . - . transcript "79" Adh GeneID CDS 753536 753620 . - . transcript "79" Adh GeneID CDS 756108 756171 . - . transcript "79" Adh GeneID CDS 758657 758746 . - . transcript "79" Adh GeneID start_codon 758744 758746 . - . transcript "79" Adh GeneID start_codon 761011 761013 . + . transcript "80" Adh GeneID CDS 761011 761042 . + . transcript "80" Adh GeneID CDS 768619 768676 . + . transcript "80" Adh GeneID CDS 770770 770851 . + . transcript "80" Adh GeneID CDS 771955 772295 . + . transcript "80" Adh GeneID CDS 779692 781583 . + . transcript "80" Adh GeneID CDS 781886 782694 . + . transcript "80" Adh GeneID CDS 786542 786593 . + . transcript "80" Adh GeneID CDS 789714 789824 . + . transcript "80" Adh GeneID CDS 792099 792144 . + . transcript "80" Adh GeneID stop_codon 792142 792144 . + . transcript "80" Adh GeneID start_codon 801924 801926 . + . transcript "81" Adh GeneID CDS 801924 802914 . + . transcript "81" Adh GeneID CDS 809050 809081 . + . transcript "81" Adh GeneID stop_codon 809079 809081 . + . transcript "81" Adh GeneID start_codon 811439 811441 . + . transcript "82" Adh GeneID CDS 811439 811483 . + . transcript "82" Adh GeneID CDS 813257 814049 . + . transcript "82" Adh GeneID CDS 814383 814650 . + . transcript "82" Adh GeneID CDS 814726 814981 . + . transcript "82" Adh GeneID CDS 815046 815442 . + . transcript "82" Adh GeneID CDS 815528 817215 . + . transcript "82" Adh GeneID CDS 817273 818025 . + . transcript "82" Adh GeneID CDS 818086 818367 . + . transcript "82" Adh GeneID CDS 818447 818574 . + . transcript "82" Adh GeneID CDS 818633 819290 . + . transcript "82" Adh GeneID CDS 820171 820789 . + . transcript "82" Adh GeneID CDS 820846 820979 . + . transcript "82" Adh GeneID CDS 821037 821265 . + . transcript "82" Adh GeneID CDS 821333 821487 . + . transcript "82" Adh GeneID stop_codon 821485 821487 . + . transcript "82" Adh GeneID start_codon 822205 822207 . + . transcript "83" Adh GeneID CDS 822205 822454 . + . transcript "83" Adh GeneID CDS 822511 822815 . + . transcript "83" Adh GeneID CDS 822874 824011 . + . transcript "83" Adh GeneID CDS 824074 824822 . + . transcript "83" Adh GeneID CDS 824885 825688 . + . transcript "83" Adh GeneID CDS 825804 826423 . + . transcript "83" Adh GeneID CDS 827148 827511 . + . transcript "83" Adh GeneID stop_codon 827509 827511 . + . transcript "83" Adh GeneID start_codon 828047 828049 . + . transcript "84" Adh GeneID CDS 828047 828306 . + . transcript "84" Adh GeneID CDS 829802 829847 . + . transcript "84" Adh GeneID stop_codon 829845 829847 . + . transcript "84" Adh GeneID start_codon 832137 832139 . + . transcript "85" Adh GeneID CDS 832137 833531 . + . transcript "85" Adh GeneID CDS 834471 834502 . + . transcript "85" Adh GeneID CDS 835043 835312 . + . transcript "85" Adh GeneID CDS 836589 837106 . + . transcript "85" Adh GeneID CDS 837173 837428 . + . transcript "85" Adh GeneID CDS 837486 837859 . + . transcript "85" Adh GeneID CDS 837919 838152 . + . transcript "85" Adh GeneID CDS 838217 839076 . + . transcript "85" Adh GeneID stop_codon 839074 839076 . + . transcript "85" Adh GeneID stop_codon 841091 841093 . - . transcript "86" Adh GeneID CDS 841091 841333 . - . transcript "86" Adh GeneID CDS 841389 841969 . - . transcript "86" Adh GeneID CDS 842034 842362 . - . transcript "86" Adh GeneID CDS 843445 843518 . - . transcript "86" Adh GeneID CDS 846607 847372 . - . transcript "86" Adh GeneID CDS 847433 848154 . - . transcript "86" Adh GeneID CDS 848208 848609 . - . transcript "86" Adh GeneID CDS 848668 848733 . - . transcript "86" Adh GeneID start_codon 848731 848733 . - . transcript "86" Adh GeneID start_codon 851085 851087 . + . transcript "87" Adh GeneID CDS 851085 851190 . + . transcript "87" Adh GeneID CDS 851256 851436 . + . transcript "87" Adh GeneID CDS 851491 851673 . + . transcript "87" Adh GeneID CDS 853223 855014 . + . transcript "87" Adh GeneID stop_codon 855012 855014 . + . transcript "87" Adh GeneID start_codon 855874 855876 . + . transcript "88" Adh GeneID CDS 855874 855922 . + . transcript "88" Adh GeneID CDS 855982 856031 . + . transcript "88" Adh GeneID CDS 856092 856876 . + . transcript "88" Adh GeneID CDS 856942 858029 . + . transcript "88" Adh GeneID CDS 858109 858341 . + . transcript "88" Adh GeneID CDS 858418 858955 . + . transcript "88" Adh GeneID CDS 859860 859891 . + . transcript "88" Adh GeneID stop_codon 859889 859891 . + . transcript "88" Adh GeneID stop_codon 870700 870702 . - . transcript "89" Adh GeneID CDS 870700 870991 . - . transcript "89" Adh GeneID CDS 872891 873131 . - . transcript "89" Adh GeneID CDS 873191 873263 . - . transcript "89" Adh GeneID CDS 873583 874093 . - . transcript "89" Adh GeneID CDS 875573 875604 . - . transcript "89" Adh GeneID start_codon 875602 875604 . - . transcript "89" Adh GeneID stop_codon 876384 876386 . - . transcript "90" Adh GeneID CDS 876384 876445 . - . transcript "90" Adh GeneID CDS 878185 878253 . - . transcript "90" Adh GeneID CDS 885047 885676 . - . transcript "90" Adh GeneID CDS 885967 886798 . - . transcript "90" Adh GeneID CDS 892950 893033 . - . transcript "90" Adh GeneID start_codon 893031 893033 . - . transcript "90" Adh GeneID stop_codon 909468 909470 . - . transcript "91" Adh GeneID CDS 909468 909520 . - . transcript "91" Adh GeneID CDS 909634 909694 . - . transcript "91" Adh GeneID CDS 910801 911055 . - . transcript "91" Adh GeneID start_codon 911053 911055 . - . transcript "91" Adh GeneID stop_codon 918151 918153 . - . transcript "92" Adh GeneID CDS 918151 918795 . - . transcript "92" Adh GeneID CDS 923305 923338 . - . transcript "92" Adh GeneID CDS 927072 927193 . - . transcript "92" Adh GeneID start_codon 927191 927193 . - . transcript "92" Adh GeneID start_codon 936628 936630 . + . transcript "93" Adh GeneID CDS 936628 936689 . + . transcript "93" Adh GeneID CDS 937004 937060 . + . transcript "93" Adh GeneID CDS 940648 940729 . + . transcript "93" Adh GeneID CDS 952073 952111 . + . transcript "93" Adh GeneID CDS 954429 954461 . + . transcript "93" Adh GeneID stop_codon 954459 954461 . + . transcript "93" Adh GeneID start_codon 964272 964274 . + . transcript "94" Adh GeneID CDS 964272 964449 . + . transcript "94" Adh GeneID CDS 965831 965886 . + . transcript "94" Adh GeneID stop_codon 965884 965886 . + . transcript "94" Adh GeneID start_codon 984981 984983 . + . transcript "95" Adh GeneID CDS 984981 985070 . + . transcript "95" Adh GeneID CDS 985373 986896 . + . transcript "95" Adh GeneID stop_codon 986894 986896 . + . transcript "95" Adh GeneID stop_codon 988365 988367 . - . transcript "96" Adh GeneID CDS 988365 988405 . - . transcript "96" Adh GeneID CDS 997178 997221 . - . transcript "96" Adh GeneID CDS 997414 997461 . - . transcript "96" Adh GeneID CDS 1002231 1002292 . - . transcript "96" Adh GeneID start_codon 1002290 1002292 . - . transcript "96" Adh GeneID start_codon 1005238 1005240 . + . transcript "97" Adh GeneID CDS 1005238 1005277 . + . transcript "97" Adh GeneID CDS 1007522 1007590 . + . transcript "97" Adh GeneID CDS 1012157 1012246 . + . transcript "97" Adh GeneID CDS 1012639 1012679 . + . transcript "97" Adh GeneID stop_codon 1012677 1012679 . + . transcript "97" Adh GeneID start_codon 1014189 1014191 . + . transcript "98" Adh GeneID CDS 1014189 1014225 . + . transcript "98" Adh GeneID CDS 1015461 1015515 . + . transcript "98" Adh GeneID CDS 1016252 1016384 . + . transcript "98" Adh GeneID stop_codon 1016382 1016384 . + . transcript "98" Adh GeneID stop_codon 1028782 1028784 . - . transcript "99" Adh GeneID CDS 1028782 1028824 . - . transcript "99" Adh GeneID CDS 1031524 1031590 . - . transcript "99" Adh GeneID CDS 1041602 1041989 . - . transcript "99" Adh GeneID CDS 1042386 1042688 . - . transcript "99" Adh GeneID start_codon 1042686 1042688 . - . transcript "99" Adh GeneID stop_codon 1064499 1064501 . - . transcript "100" Adh GeneID CDS 1064499 1064541 . - . transcript "100" Adh GeneID CDS 1065198 1065299 . - . transcript "100" Adh GeneID CDS 1065545 1065723 . - . transcript "100" Adh GeneID start_codon 1065721 1065723 . - . transcript "100" Adh GeneID start_codon 1075625 1075627 . + . transcript "101" Adh GeneID CDS 1075625 1075695 . + . transcript "101" Adh GeneID CDS 1078475 1078592 . + . transcript "101" Adh GeneID CDS 1084256 1084368 . + . transcript "101" Adh GeneID CDS 1088043 1088085 . + . transcript "101" Adh GeneID stop_codon 1088083 1088085 . + . transcript "101" Adh GeneID stop_codon 1094605 1094607 . - . transcript "102" Adh GeneID CDS 1094605 1094643 . - . transcript "102" Adh GeneID CDS 1095422 1095533 . - . transcript "102" Adh GeneID CDS 1095586 1095735 . - . transcript "102" Adh GeneID CDS 1095848 1095987 . - . transcript "102" Adh GeneID CDS 1096326 1098979 . - . transcript "102" Adh GeneID CDS 1101509 1101797 . - . transcript "102" Adh GeneID start_codon 1101795 1101797 . - . transcript "102" Adh GeneID stop_codon 1103603 1103605 . - . transcript "103" Adh GeneID CDS 1103603 1103634 . - . transcript "103" Adh GeneID CDS 1104419 1104995 . - . transcript "103" Adh GeneID CDS 1105586 1105651 . - . transcript "103" Adh GeneID CDS 1109073 1109168 . - . transcript "103" Adh GeneID start_codon 1109166 1109168 . - . transcript "103" Adh GeneID start_codon 1110074 1110076 . + . transcript "104" Adh GeneID CDS 1110074 1110172 . + . transcript "104" Adh GeneID CDS 1110238 1110642 . + . transcript "104" Adh GeneID CDS 1110713 1110979 . + . transcript "104" Adh GeneID stop_codon 1110977 1110979 . + . transcript "104" Adh GeneID start_codon 1112087 1112089 . + . transcript "105" Adh GeneID CDS 1112087 1112209 . + . transcript "105" Adh GeneID CDS 1112261 1112578 . + . transcript "105" Adh GeneID stop_codon 1112576 1112578 . + . transcript "105" Adh GeneID stop_codon 1120749 1120751 . - . transcript "106" Adh GeneID CDS 1120749 1120789 . - . transcript "106" Adh GeneID CDS 1127373 1127404 . - . transcript "106" Adh GeneID CDS 1129815 1129895 . - . transcript "106" Adh GeneID CDS 1135298 1135448 . - . transcript "106" Adh GeneID CDS 1140650 1140710 . - . transcript "106" Adh GeneID start_codon 1140708 1140710 . - . transcript "106" Adh GeneID start_codon 1141729 1141731 . + . transcript "107" Adh GeneID CDS 1141729 1141828 . + . transcript "107" Adh GeneID CDS 1141947 1141989 . + . transcript "107" Adh GeneID CDS 1142192 1142261 . + . transcript "107" Adh GeneID CDS 1145597 1145713 . + . transcript "107" Adh GeneID stop_codon 1145711 1145713 . + . transcript "107" Adh GeneID stop_codon 1147763 1147765 . - . transcript "108" Adh GeneID CDS 1147763 1147806 . - . transcript "108" Adh GeneID CDS 1148478 1148530 . - . transcript "108" Adh GeneID CDS 1149750 1149784 . - . transcript "108" Adh GeneID CDS 1150024 1150103 . - . transcript "108" Adh GeneID CDS 1151840 1151874 . - . transcript "108" Adh GeneID CDS 1153200 1153246 . - . transcript "108" Adh GeneID start_codon 1153244 1153246 . - . transcript "108" Adh GeneID stop_codon 1157306 1157308 . - . transcript "109" Adh GeneID CDS 1157306 1157372 . - . transcript "109" Adh GeneID CDS 1159055 1159137 . - . transcript "109" Adh GeneID CDS 1159497 1159579 . - . transcript "109" Adh GeneID CDS 1169027 1169084 . - . transcript "109" Adh GeneID CDS 1179474 1179518 . - . transcript "109" Adh GeneID start_codon 1179516 1179518 . - . transcript "109" Adh GeneID stop_codon 1181634 1181636 . - . transcript "110" Adh GeneID CDS 1181634 1181705 . - . transcript "110" Adh GeneID CDS 1182203 1182415 . - . transcript "110" Adh GeneID start_codon 1182413 1182415 . - . transcript "110" Adh GeneID start_codon 1190280 1190282 . + . transcript "111" Adh GeneID CDS 1190280 1190389 . + . transcript "111" Adh GeneID CDS 1194789 1194854 . + . transcript "111" Adh GeneID CDS 1197300 1197354 . + . transcript "111" Adh GeneID stop_codon 1197352 1197354 . + . transcript "111" Adh GeneID stop_codon 1211853 1211855 . - . transcript "112" Adh GeneID CDS 1211853 1211963 . - . transcript "112" Adh GeneID CDS 1213712 1213750 . - . transcript "112" Adh GeneID CDS 1219570 1220115 . - . transcript "112" Adh GeneID CDS 1220453 1220706 . - . transcript "112" Adh GeneID CDS 1221529 1221762 . - . transcript "112" Adh GeneID CDS 1223350 1223572 . - . transcript "112" Adh GeneID start_codon 1223570 1223572 . - . transcript "112" Adh GeneID start_codon 1229684 1229686 . + . transcript "113" Adh GeneID CDS 1229684 1230238 . + . transcript "113" Adh GeneID CDS 1233044 1233280 . + . transcript "113" Adh GeneID stop_codon 1233278 1233280 . + . transcript "113" Adh GeneID start_codon 1252523 1252525 . + . transcript "114" Adh GeneID CDS 1252523 1253521 . + . transcript "114" Adh GeneID CDS 1253934 1254107 . + . transcript "114" Adh GeneID stop_codon 1254105 1254107 . + . transcript "114" Adh GeneID start_codon 1255669 1255671 . + . transcript "115" Adh GeneID CDS 1255669 1256020 . + . transcript "115" Adh GeneID CDS 1256255 1256823 . + . transcript "115" Adh GeneID stop_codon 1256821 1256823 . + . transcript "115" Adh GeneID stop_codon 1258365 1258367 . - . transcript "116" Adh GeneID CDS 1258365 1258396 . - . transcript "116" Adh GeneID CDS 1264126 1264286 . - . transcript "116" Adh GeneID CDS 1266094 1266134 . - . transcript "116" Adh GeneID start_codon 1266132 1266134 . - . transcript "116" Adh GeneID stop_codon 1267417 1267419 . - . transcript "117" Adh GeneID CDS 1267417 1267448 . - . transcript "117" Adh GeneID CDS 1269247 1269312 . - . transcript "117" Adh GeneID CDS 1272217 1272395 . - . transcript "117" Adh GeneID CDS 1273008 1273596 . - . transcript "117" Adh GeneID CDS 1274014 1274321 . - . transcript "117" Adh GeneID CDS 1279181 1279254 . - . transcript "117" Adh GeneID start_codon 1279252 1279254 . - . transcript "117" Adh GeneID stop_codon 1281793 1281795 . - . transcript "118" Adh GeneID CDS 1281793 1281831 . - . transcript "118" Adh GeneID CDS 1285216 1285502 . - . transcript "118" Adh GeneID CDS 1285595 1285746 . - . transcript "118" Adh GeneID CDS 1285814 1285859 . - . transcript "118" Adh GeneID CDS 1297137 1298310 . - . transcript "118" Adh GeneID start_codon 1298308 1298310 . - . transcript "118" Adh GeneID start_codon 1307887 1307889 . + . transcript "119" Adh GeneID CDS 1307887 1307937 . + . transcript "119" Adh GeneID CDS 1315241 1315331 . + . transcript "119" Adh GeneID CDS 1316134 1316186 . + . transcript "119" Adh GeneID stop_codon 1316184 1316186 . + . transcript "119" Adh GeneID stop_codon 1318581 1318583 . - . transcript "120" Adh GeneID CDS 1318581 1318735 . - . transcript "120" Adh GeneID CDS 1319386 1319494 . - . transcript "120" Adh GeneID start_codon 1319492 1319494 . - . transcript "120" Adh GeneID start_codon 1320688 1320690 . + . transcript "121" Adh GeneID CDS 1320688 1320757 . + . transcript "121" Adh GeneID CDS 1327079 1327129 . + . transcript "121" Adh GeneID CDS 1332021 1332113 . + . transcript "121" Adh GeneID CDS 1332968 1333107 . + . transcript "121" Adh GeneID stop_codon 1333105 1333107 . + . transcript "121" Adh GeneID stop_codon 1333719 1333721 . - . transcript "122" Adh GeneID CDS 1333719 1333789 . - . transcript "122" Adh GeneID CDS 1334947 1335024 . - . transcript "122" Adh GeneID CDS 1335080 1335356 . - . transcript "122" Adh GeneID CDS 1335416 1336157 . - . transcript "122" Adh GeneID CDS 1337668 1337917 . - . transcript "122" Adh GeneID CDS 1338337 1338640 . - . transcript "122" Adh GeneID CDS 1338702 1338785 . - . transcript "122" Adh GeneID start_codon 1338783 1338785 . - . transcript "122" Adh GeneID start_codon 1342117 1342119 . + . transcript "123" Adh GeneID CDS 1342117 1342152 . + . transcript "123" Adh GeneID CDS 1348357 1348416 . + . transcript "123" Adh GeneID CDS 1357856 1357920 . + . transcript "123" Adh GeneID CDS 1360498 1360540 . + . transcript "123" Adh GeneID stop_codon 1360538 1360540 . + . transcript "123" Adh GeneID stop_codon 1363672 1363674 . - . transcript "124" Adh GeneID CDS 1363672 1363731 . - . transcript "124" Adh GeneID CDS 1365170 1365361 . - . transcript "124" Adh GeneID CDS 1365421 1365611 . - . transcript "124" Adh GeneID CDS 1365666 1365762 . - . transcript "124" Adh GeneID CDS 1368902 1369189 . - . transcript "124" Adh GeneID start_codon 1369187 1369189 . - . transcript "124" Adh GeneID stop_codon 1371868 1371870 . - . transcript "125" Adh GeneID CDS 1371868 1371921 . - . transcript "125" Adh GeneID CDS 1371971 1372258 . - . transcript "125" Adh GeneID start_codon 1372256 1372258 . - . transcript "125" Adh GeneID start_codon 1376930 1376932 . + . transcript "126" Adh GeneID CDS 1376930 1377005 . + . transcript "126" Adh GeneID CDS 1377839 1377878 . + . transcript "126" Adh GeneID CDS 1392232 1392359 . + . transcript "126" Adh GeneID CDS 1397377 1397429 . + . transcript "126" Adh GeneID stop_codon 1397427 1397429 . + . transcript "126" Adh GeneID stop_codon 1398183 1398185 . - . transcript "127" Adh GeneID CDS 1398183 1398833 . - . transcript "127" Adh GeneID CDS 1399745 1399785 . - . transcript "127" Adh GeneID CDS 1400636 1400669 . - . transcript "127" Adh GeneID CDS 1401633 1401874 . - . transcript "127" Adh GeneID CDS 1402535 1402643 . - . transcript "127" Adh GeneID CDS 1402808 1402995 . - . transcript "127" Adh GeneID CDS 1403930 1404111 . - . transcript "127" Adh GeneID CDS 1405762 1405903 . - . transcript "127" Adh GeneID CDS 1406801 1406882 . - . transcript "127" Adh GeneID CDS 1407035 1407146 . - . transcript "127" Adh GeneID CDS 1408830 1408932 . - . transcript "127" Adh GeneID CDS 1411600 1411759 . - . transcript "127" Adh GeneID CDS 1412611 1412796 . - . transcript "127" Adh GeneID CDS 1412885 1412929 . - . transcript "127" Adh GeneID start_codon 1412927 1412929 . - . transcript "127" Adh GeneID start_codon 1416137 1416139 . + . transcript "128" Adh GeneID CDS 1416137 1418081 . + . transcript "128" Adh GeneID CDS 1418142 1419321 . + . transcript "128" Adh GeneID CDS 1419378 1419918 . + . transcript "128" Adh GeneID stop_codon 1419916 1419918 . + . transcript "128" Adh GeneID stop_codon 1420890 1420892 . - . transcript "129" Adh GeneID CDS 1420890 1420960 . - . transcript "129" Adh GeneID CDS 1422176 1422320 . - . transcript "129" Adh GeneID CDS 1424531 1424676 . - . transcript "129" Adh GeneID CDS 1425549 1425752 . - . transcript "129" Adh GeneID CDS 1426168 1426258 . - . transcript "129" Adh GeneID start_codon 1426256 1426258 . - . transcript "129" Adh GeneID stop_codon 1426880 1426882 . - . transcript "130" Adh GeneID CDS 1426880 1426919 . - . transcript "130" Adh GeneID CDS 1428573 1428690 . - . transcript "130" Adh GeneID CDS 1431180 1431231 . - . transcript "130" Adh GeneID start_codon 1431229 1431231 . - . transcript "130" Adh GeneID start_codon 1433593 1433595 . + . transcript "131" Adh GeneID CDS 1433593 1433625 . + . transcript "131" Adh GeneID CDS 1437091 1437123 . + . transcript "131" Adh GeneID CDS 1437932 1438005 . + . transcript "131" Adh GeneID CDS 1438274 1438368 . + . transcript "131" Adh GeneID CDS 1441776 1441821 . + . transcript "131" Adh GeneID CDS 1442523 1442576 . + . transcript "131" Adh GeneID CDS 1444445 1444487 . + . transcript "131" Adh GeneID CDS 1444717 1444764 . + . transcript "131" Adh GeneID CDS 1445532 1445710 . + . transcript "131" Adh GeneID CDS 1450916 1450963 . + . transcript "131" Adh GeneID CDS 1451479 1451512 . + . transcript "131" Adh GeneID stop_codon 1451510 1451512 . + . transcript "131" Adh GeneID stop_codon 1452945 1452947 . - . transcript "132" Adh GeneID CDS 1452945 1453020 . - . transcript "132" Adh GeneID CDS 1454848 1455010 . - . transcript "132" Adh GeneID CDS 1462140 1462195 . - . transcript "132" Adh GeneID CDS 1465981 1466019 . - . transcript "132" Adh GeneID CDS 1466153 1466744 . - . transcript "132" Adh GeneID CDS 1466876 1467307 . - . transcript "132" Adh GeneID CDS 1470304 1470339 . - . transcript "132" Adh GeneID CDS 1473611 1473791 . - . transcript "132" Adh GeneID start_codon 1473789 1473791 . - . transcript "132" Adh GeneID stop_codon 1475429 1475431 . - . transcript "133" Adh GeneID CDS 1475429 1475467 . - . transcript "133" Adh GeneID CDS 1477478 1477592 . - . transcript "133" Adh GeneID CDS 1480158 1480195 . - . transcript "133" Adh GeneID CDS 1481966 1482130 . - . transcript "133" Adh GeneID start_codon 1482128 1482130 . - . transcript "133" Adh GeneID stop_codon 1496304 1496306 . - . transcript "134" Adh GeneID CDS 1496304 1496815 . - . transcript "134" Adh GeneID CDS 1496865 1497000 . - . transcript "134" Adh GeneID start_codon 1496998 1497000 . - . transcript "134" Adh GeneID start_codon 1497576 1497578 . + . transcript "135" Adh GeneID CDS 1497576 1498089 . + . transcript "135" Adh GeneID CDS 1498983 1499050 . + . transcript "135" Adh GeneID stop_codon 1499048 1499050 . + . transcript "135" Adh GeneID start_codon 1499670 1499672 . + . transcript "136" Adh GeneID CDS 1499670 1500870 . + . transcript "136" Adh GeneID CDS 1500928 1501010 . + . transcript "136" Adh GeneID stop_codon 1501008 1501010 . + . transcript "136" Adh GeneID start_codon 1507074 1507076 . + . transcript "137" Adh GeneID CDS 1507074 1507134 . + . transcript "137" Adh GeneID CDS 1508779 1508852 . + . transcript "137" Adh GeneID CDS 1510744 1510998 . + . transcript "137" Adh GeneID CDS 1515041 1515175 . + . transcript "137" Adh GeneID CDS 1515266 1515440 . + . transcript "137" Adh GeneID CDS 1515807 1516279 . + . transcript "137" Adh GeneID CDS 1516339 1516488 . + . transcript "137" Adh GeneID CDS 1519636 1519752 . + . transcript "137" Adh GeneID CDS 1519897 1520023 . + . transcript "137" Adh GeneID CDS 1520081 1520232 . + . transcript "137" Adh GeneID CDS 1520398 1520535 . + . transcript "137" Adh GeneID CDS 1521654 1521834 . + . transcript "137" Adh GeneID CDS 1523263 1523303 . + . transcript "137" Adh GeneID stop_codon 1523301 1523303 . + . transcript "137" Adh GeneID start_codon 1525215 1525217 . + . transcript "138" Adh GeneID CDS 1525215 1525447 . + . transcript "138" Adh GeneID CDS 1526237 1526669 . + . transcript "138" Adh GeneID stop_codon 1526667 1526669 . + . transcript "138" Adh GeneID stop_codon 1527523 1527525 . - . transcript "139" Adh GeneID CDS 1527523 1527636 . - . transcript "139" Adh GeneID CDS 1527705 1528201 . - . transcript "139" Adh GeneID CDS 1528291 1528426 . - . transcript "139" Adh GeneID start_codon 1528424 1528426 . - . transcript "139" Adh GeneID start_codon 1529588 1529590 . + . transcript "140" Adh GeneID CDS 1529588 1529971 . + . transcript "140" Adh GeneID CDS 1530746 1531626 . + . transcript "140" Adh GeneID CDS 1531685 1531892 . + . transcript "140" Adh GeneID CDS 1531958 1532269 . + . transcript "140" Adh GeneID stop_codon 1532267 1532269 . + . transcript "140" Adh GeneID stop_codon 1533193 1533195 . - . transcript "141" Adh GeneID CDS 1533193 1533225 . - . transcript "141" Adh GeneID CDS 1535341 1535461 . - . transcript "141" Adh GeneID CDS 1535530 1535676 . - . transcript "141" Adh GeneID CDS 1535739 1536304 . - . transcript "141" Adh GeneID CDS 1536364 1537150 . - . transcript "141" Adh GeneID CDS 1537212 1538662 . - . transcript "141" Adh GeneID CDS 1538719 1541113 . - . transcript "141" Adh GeneID CDS 1541178 1541378 . - . transcript "141" Adh GeneID CDS 1541445 1541794 . - . transcript "141" Adh GeneID CDS 1542125 1542202 . - . transcript "141" Adh GeneID start_codon 1542200 1542202 . - . transcript "141" Adh GeneID start_codon 1542931 1542933 . + . transcript "142" Adh GeneID CDS 1542931 1542989 . + . transcript "142" Adh GeneID CDS 1546650 1546719 . + . transcript "142" Adh GeneID CDS 1548383 1548538 . + . transcript "142" Adh GeneID stop_codon 1548536 1548538 . + . transcript "142" Adh GeneID stop_codon 1549142 1549144 . - . transcript "143" Adh GeneID CDS 1549142 1550017 . - . transcript "143" Adh GeneID CDS 1550084 1550149 . - . transcript "143" Adh GeneID start_codon 1550147 1550149 . - . transcript "143" Adh GeneID stop_codon 1554085 1554087 . - . transcript "144" Adh GeneID CDS 1554085 1554599 . - . transcript "144" Adh GeneID CDS 1554841 1555107 . - . transcript "144" Adh GeneID CDS 1556588 1557278 . - . transcript "144" Adh GeneID start_codon 1557276 1557278 . - . transcript "144" Adh GeneID start_codon 1558057 1558059 . + . transcript "145" Adh GeneID CDS 1558057 1558521 . + . transcript "145" Adh GeneID CDS 1562338 1563081 . + . transcript "145" Adh GeneID CDS 1563140 1563353 . + . transcript "145" Adh GeneID CDS 1563418 1563689 . + . transcript "145" Adh GeneID CDS 1563761 1563814 . + . transcript "145" Adh GeneID stop_codon 1563812 1563814 . + . transcript "145" Adh GeneID start_codon 1565272 1565274 . + . transcript "146" Adh GeneID CDS 1565272 1565530 . + . transcript "146" Adh GeneID CDS 1565726 1565773 . + . transcript "146" Adh GeneID CDS 1576691 1576943 . + . transcript "146" Adh GeneID CDS 1577036 1577406 . + . transcript "146" Adh GeneID CDS 1577568 1577860 . + . transcript "146" Adh GeneID CDS 1579167 1579245 . + . transcript "146" Adh GeneID CDS 1580846 1580880 . + . transcript "146" Adh GeneID CDS 1581294 1581623 . + . transcript "146" Adh GeneID CDS 1581774 1582136 . + . transcript "146" Adh GeneID CDS 1582201 1582292 . + . transcript "146" Adh GeneID CDS 1582550 1582687 . + . transcript "146" Adh GeneID CDS 1583483 1583573 . + . transcript "146" Adh GeneID stop_codon 1583571 1583573 . + . transcript "146" Adh GeneID start_codon 1584396 1584398 . + . transcript "147" Adh GeneID CDS 1584396 1584828 . + . transcript "147" Adh GeneID CDS 1584949 1585094 . + . transcript "147" Adh GeneID CDS 1585153 1585380 . + . transcript "147" Adh GeneID stop_codon 1585378 1585380 . + . transcript "147" Adh GeneID start_codon 1593013 1593015 . + . transcript "148" Adh GeneID CDS 1593013 1593223 . + . transcript "148" Adh GeneID CDS 1596533 1596753 . + . transcript "148" Adh GeneID stop_codon 1596751 1596753 . + . transcript "148" Adh GeneID start_codon 1599218 1599220 . + . transcript "149" Adh GeneID CDS 1599218 1600177 . + . transcript "149" Adh GeneID CDS 1601744 1602565 . + . transcript "149" Adh GeneID stop_codon 1602563 1602565 . + . transcript "149" Adh GeneID start_codon 1603610 1603612 . + . transcript "150" Adh GeneID CDS 1603610 1603864 . + . transcript "150" Adh GeneID CDS 1603963 1605404 . + . transcript "150" Adh GeneID CDS 1605651 1606718 . + . transcript "150" Adh GeneID CDS 1606791 1607142 . + . transcript "150" Adh GeneID CDS 1610986 1611030 . + . transcript "150" Adh GeneID stop_codon 1611028 1611030 . + . transcript "150" Adh GeneID stop_codon 1613642 1613644 . - . transcript "151" Adh GeneID CDS 1613642 1613682 . - . transcript "151" Adh GeneID CDS 1615296 1615362 . - . transcript "151" Adh GeneID CDS 1615931 1615992 . - . transcript "151" Adh GeneID CDS 1623880 1623920 . - . transcript "151" Adh GeneID CDS 1630351 1630487 . - . transcript "151" Adh GeneID start_codon 1630485 1630487 . - . transcript "151" Adh GeneID stop_codon 1638007 1638009 . - . transcript "152" Adh GeneID CDS 1638007 1638042 . - . transcript "152" Adh GeneID CDS 1638160 1638209 . - . transcript "152" Adh GeneID CDS 1642165 1642329 . - . transcript "152" Adh GeneID CDS 1642667 1642853 . - . transcript "152" Adh GeneID CDS 1647638 1647703 . - . transcript "152" Adh GeneID start_codon 1647701 1647703 . - . transcript "152" Adh GeneID stop_codon 1650286 1650288 . - . transcript "153" Adh GeneID CDS 1650286 1650332 . - . transcript "153" Adh GeneID CDS 1651337 1651403 . - . transcript "153" Adh GeneID CDS 1653857 1657133 . - . transcript "153" Adh GeneID CDS 1657232 1657342 . - . transcript "153" Adh GeneID CDS 1661045 1661189 . - . transcript "153" Adh GeneID CDS 1667694 1667971 . - . transcript "153" Adh GeneID CDS 1678820 1678862 . - . transcript "153" Adh GeneID CDS 1681578 1681630 . - . transcript "153" Adh GeneID CDS 1682424 1682539 . - . transcript "153" Adh GeneID start_codon 1682537 1682539 . - . transcript "153" Adh GeneID start_codon 1690082 1690084 . + . transcript "154" Adh GeneID CDS 1690082 1690270 . + . transcript "154" Adh GeneID CDS 1692741 1692848 . + . transcript "154" Adh GeneID CDS 1694369 1694408 . + . transcript "154" Adh GeneID CDS 1703494 1703537 . + . transcript "154" Adh GeneID stop_codon 1703535 1703537 . + . transcript "154" Adh GeneID stop_codon 1711986 1711988 . - . transcript "155" Adh GeneID CDS 1711986 1712040 . - . transcript "155" Adh GeneID CDS 1716770 1716818 . - . transcript "155" Adh GeneID CDS 1719195 1719342 . - . transcript "155" Adh GeneID CDS 1719504 1720004 . - . transcript "155" Adh GeneID start_codon 1720002 1720004 . - . transcript "155" Adh GeneID stop_codon 1724655 1724657 . - . transcript "156" Adh GeneID CDS 1724655 1724709 . - . transcript "156" Adh GeneID CDS 1726256 1726435 . - . transcript "156" Adh GeneID CDS 1730116 1730236 . - . transcript "156" Adh GeneID CDS 1731062 1731172 . - . transcript "156" Adh GeneID CDS 1735826 1736004 . - . transcript "156" Adh GeneID CDS 1737215 1737246 . - . transcript "156" Adh GeneID start_codon 1737244 1737246 . - . transcript "156" Adh GeneID start_codon 1740274 1740276 . + . transcript "157" Adh GeneID CDS 1740274 1740540 . + . transcript "157" Adh GeneID CDS 1740659 1740939 . + . transcript "157" Adh GeneID CDS 1740995 1742042 . + . transcript "157" Adh GeneID CDS 1742104 1742446 . + . transcript "157" Adh GeneID CDS 1742505 1742590 . + . transcript "157" Adh GeneID stop_codon 1742588 1742590 . + . transcript "157" Adh GeneID stop_codon 1743988 1743990 . - . transcript "158" Adh GeneID CDS 1743988 1744025 . - . transcript "158" Adh GeneID CDS 1744330 1744361 . - . transcript "158" Adh GeneID CDS 1744624 1745915 . - . transcript "158" Adh GeneID start_codon 1745913 1745915 . - . transcript "158" Adh GeneID stop_codon 1748111 1748113 . - . transcript "159" Adh GeneID CDS 1748111 1748361 . - . transcript "159" Adh GeneID CDS 1751370 1751492 . - . transcript "159" Adh GeneID CDS 1751722 1751956 . - . transcript "159" Adh GeneID CDS 1752622 1752780 . - . transcript "159" Adh GeneID CDS 1752984 1753316 . - . transcript "159" Adh GeneID CDS 1753422 1753778 . - . transcript "159" Adh GeneID start_codon 1753776 1753778 . - . transcript "159" Adh GeneID stop_codon 1756026 1756028 . - . transcript "160" Adh GeneID CDS 1756026 1756178 . - . transcript "160" Adh GeneID CDS 1756797 1756973 . - . transcript "160" Adh GeneID CDS 1757182 1757352 . - . transcript "160" Adh GeneID CDS 1757415 1757585 . - . transcript "160" Adh GeneID CDS 1757648 1758409 . - . transcript "160" Adh GeneID CDS 1758473 1758856 . - . transcript "160" Adh GeneID CDS 1760557 1760616 . - . transcript "160" Adh GeneID start_codon 1760614 1760616 . - . transcript "160" Adh GeneID stop_codon 1763095 1763097 . - . transcript "161" Adh GeneID CDS 1763095 1763162 . - . transcript "161" Adh GeneID CDS 1764272 1764501 . - . transcript "161" Adh GeneID CDS 1764574 1764638 . - . transcript "161" Adh GeneID start_codon 1764636 1764638 . - . transcript "161" Adh GeneID start_codon 1766243 1766245 . + . transcript "162" Adh GeneID CDS 1766243 1766345 . + . transcript "162" Adh GeneID CDS 1769046 1769146 . + . transcript "162" Adh GeneID stop_codon 1769144 1769146 . + . transcript "162" Adh GeneID start_codon 1769829 1769831 . + . transcript "163" Adh GeneID CDS 1769829 1769976 . + . transcript "163" Adh GeneID CDS 1774716 1775557 . + . transcript "163" Adh GeneID stop_codon 1775555 1775557 . + . transcript "163" Adh GeneID start_codon 1776889 1776891 . + . transcript "164" Adh GeneID CDS 1776889 1777083 . + . transcript "164" Adh GeneID CDS 1786963 1786994 . + . transcript "164" Adh GeneID CDS 1787063 1787135 . + . transcript "164" Adh GeneID CDS 1787713 1788915 . + . transcript "164" Adh GeneID stop_codon 1788913 1788915 . + . transcript "164" Adh GeneID stop_codon 1790485 1790487 . - . transcript "165" Adh GeneID CDS 1790485 1790625 . - . transcript "165" Adh GeneID CDS 1792846 1792911 . - . transcript "165" Adh GeneID start_codon 1792909 1792911 . - . transcript "165" Adh GeneID stop_codon 1801494 1801496 . - . transcript "166" Adh GeneID CDS 1801494 1801614 . - . transcript "166" Adh GeneID CDS 1803081 1803155 . - . transcript "166" Adh GeneID CDS 1806093 1806145 . - . transcript "166" Adh GeneID CDS 1808001 1808476 . - . transcript "166" Adh GeneID CDS 1811030 1811121 . - . transcript "166" Adh GeneID CDS 1811467 1811600 . - . transcript "166" Adh GeneID start_codon 1811598 1811600 . - . transcript "166" Adh GeneID start_codon 1823887 1823889 . + . transcript "167" Adh GeneID CDS 1823887 1825154 . + . transcript "167" Adh GeneID CDS 1827797 1827872 . + . transcript "167" Adh GeneID stop_codon 1827870 1827872 . + . transcript "167" Adh GeneID start_codon 1850930 1850932 . + . transcript "168" Adh GeneID CDS 1850930 1850963 . + . transcript "168" Adh GeneID CDS 1862221 1862289 . + . transcript "168" Adh GeneID CDS 1871587 1871681 . + . transcript "168" Adh GeneID CDS 1874024 1874072 . + . transcript "168" Adh GeneID CDS 1875402 1875519 . + . transcript "168" Adh GeneID CDS 1878749 1878806 . + . transcript "168" Adh GeneID CDS 1880168 1880203 . + . transcript "168" Adh GeneID stop_codon 1880201 1880203 . + . transcript "168" Adh GeneID stop_codon 1884846 1884848 . - . transcript "169" Adh GeneID CDS 1884846 1884892 . - . transcript "169" Adh GeneID CDS 1885049 1885144 . - . transcript "169" Adh GeneID CDS 1886790 1886886 . - . transcript "169" Adh GeneID CDS 1891514 1891615 . - . transcript "169" Adh GeneID start_codon 1891613 1891615 . - . transcript "169" Adh GeneID start_codon 1894883 1894885 . + . transcript "170" Adh GeneID CDS 1894883 1894914 . + . transcript "170" Adh GeneID CDS 1895818 1895942 . + . transcript "170" Adh GeneID CDS 1898098 1898210 . + . transcript "170" Adh GeneID CDS 1901397 1901522 . + . transcript "170" Adh GeneID stop_codon 1901520 1901522 . + . transcript "170" Adh GeneID stop_codon 1904399 1904401 . - . transcript "171" Adh GeneID CDS 1904399 1904459 . - . transcript "171" Adh GeneID CDS 1905522 1905641 . - . transcript "171" Adh GeneID CDS 1912285 1912316 . - . transcript "171" Adh GeneID start_codon 1912314 1912316 . - . transcript "171" Adh GeneID stop_codon 1913374 1913376 . - . transcript "172" Adh GeneID CDS 1913374 1914932 . - . transcript "172" Adh GeneID CDS 1914995 1915082 . - . transcript "172" Adh GeneID start_codon 1915080 1915082 . - . transcript "172" Adh GeneID stop_codon 1920587 1920589 . - . transcript "173" Adh GeneID CDS 1920587 1920743 . - . transcript "173" Adh GeneID CDS 1922620 1922753 . - . transcript "173" Adh GeneID start_codon 1922751 1922753 . - . transcript "173" Adh GeneID start_codon 1923367 1923369 . + . transcript "174" Adh GeneID CDS 1923367 1924417 . + . transcript "174" Adh GeneID CDS 1935160 1935208 . + . transcript "174" Adh GeneID CDS 1935491 1935551 . + . transcript "174" Adh GeneID stop_codon 1935549 1935551 . + . transcript "174" Adh GeneID start_codon 1938049 1938051 . + . transcript "175" Adh GeneID CDS 1938049 1938118 . + . transcript "175" Adh GeneID CDS 1947070 1947197 . + . transcript "175" Adh GeneID CDS 1951837 1951895 . + . transcript "175" Adh GeneID CDS 1955064 1955133 . + . transcript "175" Adh GeneID CDS 1958152 1958236 . + . transcript "175" Adh GeneID CDS 1963680 1963768 . + . transcript "175" Adh GeneID stop_codon 1963766 1963768 . + . transcript "175" Adh GeneID stop_codon 1965627 1965629 . - . transcript "176" Adh GeneID CDS 1965627 1965662 . - . transcript "176" Adh GeneID CDS 1966664 1967758 . - . transcript "176" Adh GeneID start_codon 1967756 1967758 . - . transcript "176" Adh GeneID start_codon 1974488 1974490 . + . transcript "177" Adh GeneID CDS 1974488 1974956 . + . transcript "177" Adh GeneID CDS 1976787 1976905 . + . transcript "177" Adh GeneID stop_codon 1976903 1976905 . + . transcript "177" Adh GeneID start_codon 1981483 1981485 . + . transcript "178" Adh GeneID CDS 1981483 1981563 . + . transcript "178" Adh GeneID CDS 1983788 1983859 . + . transcript "178" Adh GeneID CDS 1986147 1986200 . + . transcript "178" Adh GeneID CDS 1987265 1987306 . + . transcript "178" Adh GeneID stop_codon 1987304 1987306 . + . transcript "178" Adh GeneID start_codon 1988872 1988874 . + . transcript "179" Adh GeneID CDS 1988872 1989075 . + . transcript "179" Adh GeneID CDS 1991768 1992877 . + . transcript "179" Adh GeneID CDS 1992942 1993204 . + . transcript "179" Adh GeneID CDS 1993350 1993566 . + . transcript "179" Adh GeneID stop_codon 1993564 1993566 . + . transcript "179" Adh GeneID stop_codon 1996049 1996051 . - . transcript "180" Adh GeneID CDS 1996049 1996120 . - . transcript "180" Adh GeneID CDS 2001465 2001677 . - . transcript "180" Adh GeneID start_codon 2001675 2001677 . - . transcript "180" Adh GeneID stop_codon 2007477 2007479 . - . transcript "181" Adh GeneID CDS 2007477 2007530 . - . transcript "181" Adh GeneID CDS 2007824 2007985 . - . transcript "181" Adh GeneID start_codon 2007983 2007985 . - . transcript "181" Adh GeneID start_codon 2008964 2008966 . + . transcript "182" Adh GeneID CDS 2008964 2009015 . + . transcript "182" Adh GeneID CDS 2011611 2011726 . + . transcript "182" Adh GeneID CDS 2013133 2013204 . + . transcript "182" Adh GeneID CDS 2014032 2014097 . + . transcript "182" Adh GeneID stop_codon 2014095 2014097 . + . transcript "182" Adh GeneID stop_codon 2015366 2015368 . - . transcript "183" Adh GeneID CDS 2015366 2015570 . - . transcript "183" Adh GeneID CDS 2029224 2029304 . - . transcript "183" Adh GeneID CDS 2029576 2029678 . - . transcript "183" Adh GeneID CDS 2034415 2034457 . - . transcript "183" Adh GeneID start_codon 2034455 2034457 . - . transcript "183" Adh GeneID start_codon 2040123 2040125 . + . transcript "184" Adh GeneID CDS 2040123 2040280 . + . transcript "184" Adh GeneID CDS 2040432 2040689 . + . transcript "184" Adh GeneID CDS 2046730 2046916 . + . transcript "184" Adh GeneID stop_codon 2046914 2046916 . + . transcript "184" Adh GeneID stop_codon 2047919 2047921 . - . transcript "185" Adh GeneID CDS 2047919 2048017 . - . transcript "185" Adh GeneID CDS 2053549 2053607 . - . transcript "185" Adh GeneID CDS 2054826 2054966 . - . transcript "185" Adh GeneID CDS 2063366 2063403 . - . transcript "185" Adh GeneID CDS 2067212 2067252 . - . transcript "185" Adh GeneID start_codon 2067250 2067252 . - . transcript "185" Adh GeneID start_codon 2068604 2068606 . + . transcript "186" Adh GeneID CDS 2068604 2070501 . + . transcript "186" Adh GeneID CDS 2071510 2072677 . + . transcript "186" Adh GeneID stop_codon 2072675 2072677 . + . transcript "186" Adh GeneID stop_codon 2087665 2087667 . - . transcript "187" Adh GeneID CDS 2087665 2087812 . - . transcript "187" Adh GeneID CDS 2092009 2092070 . - . transcript "187" Adh GeneID CDS 2097188 2097251 . - . transcript "187" Adh GeneID CDS 2099502 2099545 . - . transcript "187" Adh GeneID start_codon 2099543 2099545 . - . transcript "187" Adh GeneID stop_codon 2100422 2100424 . - . transcript "188" Adh GeneID CDS 2100422 2100484 . - . transcript "188" Adh GeneID CDS 2100632 2101336 . - . transcript "188" Adh GeneID start_codon 2101334 2101336 . - . transcript "188" Adh GeneID stop_codon 2103622 2103624 . - . transcript "189" Adh GeneID CDS 2103622 2104169 . - . transcript "189" Adh GeneID CDS 2104226 2104442 . - . transcript "189" Adh GeneID start_codon 2104440 2104442 . - . transcript "189" Adh GeneID stop_codon 2107451 2107453 . - . transcript "190" Adh GeneID CDS 2107451 2107499 . - . transcript "190" Adh GeneID CDS 2111222 2111292 . - . transcript "190" Adh GeneID CDS 2111897 2112079 . - . transcript "190" Adh GeneID CDS 2112328 2112381 . - . transcript "190" Adh GeneID start_codon 2112379 2112381 . - . transcript "190" Adh GeneID start_codon 2118335 2118337 . + . transcript "191" Adh GeneID CDS 2118335 2118551 . + . transcript "191" Adh GeneID CDS 2118614 2119161 . + . transcript "191" Adh GeneID stop_codon 2119159 2119161 . + . transcript "191" Adh GeneID start_codon 2119874 2119876 . + . transcript "192" Adh GeneID CDS 2119874 2120025 . + . transcript "192" Adh GeneID CDS 2120092 2120194 . + . transcript "192" Adh GeneID CDS 2120312 2121269 . + . transcript "192" Adh GeneID CDS 2121336 2121745 . + . transcript "192" Adh GeneID stop_codon 2121743 2121745 . + . transcript "192" Adh GeneID stop_codon 2128376 2128378 . - . transcript "193" Adh GeneID CDS 2128376 2128438 . - . transcript "193" Adh GeneID CDS 2131207 2131344 . - . transcript "193" Adh GeneID start_codon 2131342 2131344 . - . transcript "193" Adh GeneID stop_codon 2137486 2137488 . - . transcript "194" Adh GeneID CDS 2137486 2137679 . - . transcript "194" Adh GeneID CDS 2137746 2137902 . - . transcript "194" Adh GeneID CDS 2137961 2138116 . - . transcript "194" Adh GeneID CDS 2138186 2138671 . - . transcript "194" Adh GeneID CDS 2138733 2138985 . - . transcript "194" Adh GeneID CDS 2139065 2139169 . - . transcript "194" Adh GeneID CDS 2139350 2139382 . - . transcript "194" Adh GeneID CDS 2139824 2139903 . - . transcript "194" Adh GeneID CDS 2140148 2140353 . - . transcript "194" Adh GeneID CDS 2140417 2140630 . - . transcript "194" Adh GeneID CDS 2140705 2141412 . - . transcript "194" Adh GeneID CDS 2141998 2142471 . - . transcript "194" Adh GeneID CDS 2151821 2151931 . - . transcript "194" Adh GeneID CDS 2161195 2161276 . - . transcript "194" Adh GeneID CDS 2167365 2167477 . - . transcript "194" Adh GeneID start_codon 2167475 2167477 . - . transcript "194" Adh GeneID start_codon 2173083 2173085 . + . transcript "195" Adh GeneID CDS 2173083 2173437 . + . transcript "195" Adh GeneID CDS 2179601 2179638 . + . transcript "195" Adh GeneID stop_codon 2179636 2179638 . + . transcript "195" Adh GeneID stop_codon 2180707 2180709 . - . transcript "196" Adh GeneID CDS 2180707 2180982 . - . transcript "196" Adh GeneID CDS 2181100 2181325 . - . transcript "196" Adh GeneID CDS 2181392 2182662 . - . transcript "196" Adh GeneID CDS 2189454 2189790 . - . transcript "196" Adh GeneID CDS 2196827 2196891 . - . transcript "196" Adh GeneID CDS 2199659 2199721 . - . transcript "196" Adh GeneID CDS 2202548 2202802 . - . transcript "196" Adh GeneID start_codon 2202800 2202802 . - . transcript "196" Adh GeneID start_codon 2204183 2204185 . + . transcript "197" Adh GeneID CDS 2204183 2205278 . + . transcript "197" Adh GeneID CDS 2205332 2207403 . + . transcript "197" Adh GeneID stop_codon 2207401 2207403 . + . transcript "197" Adh GeneID stop_codon 2208922 2208924 . - . transcript "198" Adh GeneID CDS 2208922 2209531 . - . transcript "198" Adh GeneID CDS 2209593 2209904 . - . transcript "198" Adh GeneID CDS 2209967 2211186 . - . transcript "198" Adh GeneID CDS 2211243 2211671 . - . transcript "198" Adh GeneID CDS 2212036 2212168 . - . transcript "198" Adh GeneID CDS 2213422 2213491 . - . transcript "198" Adh GeneID CDS 2214022 2214088 . - . transcript "198" Adh GeneID start_codon 2214086 2214088 . - . transcript "198" Adh GeneID start_codon 2216202 2216204 . + . transcript "199" Adh GeneID CDS 2216202 2216447 . + . transcript "199" Adh GeneID CDS 2216609 2217034 . + . transcript "199" Adh GeneID CDS 2217501 2217533 . + . transcript "199" Adh GeneID stop_codon 2217531 2217533 . + . transcript "199" Adh GeneID stop_codon 2218461 2218463 . - . transcript "200" Adh GeneID CDS 2218461 2218494 . - . transcript "200" Adh GeneID CDS 2218559 2218905 . - . transcript "200" Adh GeneID CDS 2218966 2219871 . - . transcript "200" Adh GeneID CDS 2219932 2220057 . - . transcript "200" Adh GeneID start_codon 2220055 2220057 . - . transcript "200" Adh GeneID stop_codon 2220565 2220567 . - . transcript "201" Adh GeneID CDS 2220565 2222197 . - . transcript "201" Adh GeneID CDS 2222257 2222379 . - . transcript "201" Adh GeneID CDS 2223854 2223936 . - . transcript "201" Adh GeneID start_codon 2223934 2223936 . - . transcript "201" Adh GeneID start_codon 2237851 2237853 . + . transcript "202" Adh GeneID CDS 2237851 2237952 . + . transcript "202" Adh GeneID CDS 2244126 2244196 . + . transcript "202" Adh GeneID CDS 2250859 2250930 . + . transcript "202" Adh GeneID CDS 2251817 2251866 . + . transcript "202" Adh GeneID CDS 2262725 2262759 . + . transcript "202" Adh GeneID CDS 2262817 2262878 . + . transcript "202" Adh GeneID CDS 2267007 2267131 . + . transcript "202" Adh GeneID CDS 2272887 2272955 . + . transcript "202" Adh GeneID CDS 2274308 2274403 . + . transcript "202" Adh GeneID CDS 2283007 2283038 . + . transcript "202" Adh GeneID stop_codon 2283036 2283038 . + . transcript "202" Adh GeneID stop_codon 2284226 2284228 . - . transcript "203" Adh GeneID CDS 2284226 2284343 . - . transcript "203" Adh GeneID CDS 2284489 2284627 . - . transcript "203" Adh GeneID CDS 2286518 2286620 . - . transcript "203" Adh GeneID start_codon 2286618 2286620 . - . transcript "203" Adh GeneID stop_codon 2290884 2290886 . - . transcript "204" Adh GeneID CDS 2290884 2290927 . - . transcript "204" Adh GeneID CDS 2291643 2291847 . - . transcript "204" Adh GeneID start_codon 2291845 2291847 . - . transcript "204" Adh GeneID stop_codon 2292586 2292588 . - . transcript "205" Adh GeneID CDS 2292586 2292621 . - . transcript "205" Adh GeneID CDS 2298512 2298552 . - . transcript "205" Adh GeneID CDS 2300876 2300916 . - . transcript "205" Adh GeneID CDS 2302837 2302964 . - . transcript "205" Adh GeneID start_codon 2302962 2302964 . - . transcript "205" Adh GeneID start_codon 2303484 2303486 . + . transcript "206" Adh GeneID CDS 2303484 2304233 . + . transcript "206" Adh GeneID CDS 2305489 2305763 . + . transcript "206" Adh GeneID CDS 2305829 2306951 . + . transcript "206" Adh GeneID stop_codon 2306949 2306951 . + . transcript "206" Adh GeneID stop_codon 2308690 2308692 . - . transcript "207" Adh GeneID CDS 2308690 2308818 . - . transcript "207" Adh GeneID CDS 2310854 2310893 . - . transcript "207" Adh GeneID CDS 2311611 2311681 . - . transcript "207" Adh GeneID start_codon 2311679 2311681 . - . transcript "207" Adh GeneID stop_codon 2312684 2312686 . - . transcript "208" Adh GeneID CDS 2312684 2312753 . - . transcript "208" Adh GeneID CDS 2313467 2313611 . - . transcript "208" Adh GeneID CDS 2313807 2313838 . - . transcript "208" Adh GeneID CDS 2317213 2317246 . - . transcript "208" Adh GeneID CDS 2322940 2323009 . - . transcript "208" Adh GeneID CDS 2328611 2329967 . - . transcript "208" Adh GeneID CDS 2330026 2330087 . - . transcript "208" Adh GeneID start_codon 2330085 2330087 . - . transcript "208" Adh GeneID stop_codon 2338099 2338101 . - . transcript "209" Adh GeneID CDS 2338099 2338134 . - . transcript "209" Adh GeneID CDS 2339959 2340420 . - . transcript "209" Adh GeneID CDS 2340535 2341630 . - . transcript "209" Adh GeneID CDS 2341682 2341790 . - . transcript "209" Adh GeneID CDS 2342049 2342274 . - . transcript "209" Adh GeneID CDS 2342341 2342602 . - . transcript "209" Adh GeneID CDS 2342664 2343851 . - . transcript "209" Adh GeneID CDS 2343934 2343971 . - . transcript "209" Adh GeneID CDS 2344178 2344216 . - . transcript "209" Adh GeneID start_codon 2344214 2344216 . - . transcript "209" Adh GeneID start_codon 2346572 2346574 . + . transcript "210" Adh GeneID CDS 2346572 2346942 . + . transcript "210" Adh GeneID CDS 2347420 2347473 . + . transcript "210" Adh GeneID CDS 2347977 2348040 . + . transcript "210" Adh GeneID stop_codon 2348038 2348040 . + . transcript "210" Adh GeneID stop_codon 2349924 2349926 . - . transcript "211" Adh GeneID CDS 2349924 2350879 . - . transcript "211" Adh GeneID CDS 2352080 2353052 . - . transcript "211" Adh GeneID start_codon 2353050 2353052 . - . transcript "211" Adh GeneID stop_codon 2356352 2356354 . - . transcript "212" Adh GeneID CDS 2356352 2356488 . - . transcript "212" Adh GeneID CDS 2356993 2357164 . - . transcript "212" Adh GeneID CDS 2357224 2357437 . - . transcript "212" Adh GeneID CDS 2357539 2357674 . - . transcript "212" Adh GeneID CDS 2358742 2358835 . - . transcript "212" Adh GeneID start_codon 2358833 2358835 . - . transcript "212" Adh GeneID start_codon 2365166 2365168 . + . transcript "213" Adh GeneID CDS 2365166 2365310 . + . transcript "213" Adh GeneID CDS 2365994 2366070 . + . transcript "213" Adh GeneID stop_codon 2366068 2366070 . + . transcript "213" Adh GeneID stop_codon 2378084 2378086 . - . transcript "214" Adh GeneID CDS 2378084 2378124 . - . transcript "214" Adh GeneID CDS 2380142 2380199 . - . transcript "214" Adh GeneID CDS 2384370 2384440 . - . transcript "214" Adh GeneID CDS 2390039 2390108 . - . transcript "214" Adh GeneID start_codon 2390106 2390108 . - . transcript "214" Adh GeneID start_codon 2392553 2392555 . + . transcript "215" Adh GeneID CDS 2392553 2392737 . + . transcript "215" Adh GeneID CDS 2392800 2393095 . + . transcript "215" Adh GeneID CDS 2395174 2395226 . + . transcript "215" Adh GeneID stop_codon 2395224 2395226 . + . transcript "215" Adh GeneID start_codon 2400780 2400782 . + . transcript "216" Adh GeneID CDS 2400780 2400843 . + . transcript "216" Adh GeneID CDS 2402303 2402354 . + . transcript "216" Adh GeneID CDS 2407292 2407393 . + . transcript "216" Adh GeneID CDS 2407447 2407845 . + . transcript "216" Adh GeneID CDS 2407960 2408288 . + . transcript "216" Adh GeneID CDS 2408358 2408483 . + . transcript "216" Adh GeneID CDS 2415763 2415817 . + . transcript "216" Adh GeneID CDS 2416779 2416879 . + . transcript "216" Adh GeneID CDS 2417331 2417431 . + . transcript "216" Adh GeneID stop_codon 2417429 2417431 . + . transcript "216" Adh GeneID start_codon 2428833 2428835 . + . transcript "217" Adh GeneID CDS 2428833 2429184 . + . transcript "217" Adh GeneID CDS 2444164 2444213 . + . transcript "217" Adh GeneID CDS 2445792 2445848 . + . transcript "217" Adh GeneID CDS 2446577 2446664 . + . transcript "217" Adh GeneID CDS 2448038 2448087 . + . transcript "217" Adh GeneID CDS 2448799 2448851 . + . transcript "217" Adh GeneID CDS 2449238 2449271 . + . transcript "217" Adh GeneID stop_codon 2449269 2449271 . + . transcript "217" Adh GeneID start_codon 2465772 2465774 . + . transcript "218" Adh GeneID CDS 2465772 2465965 . + . transcript "218" Adh GeneID CDS 2466655 2466742 . + . transcript "218" Adh GeneID stop_codon 2466740 2466742 . + . transcript "218" Adh GeneID start_codon 2468501 2468503 . + . transcript "219" Adh GeneID CDS 2468501 2468536 . + . transcript "219" Adh GeneID CDS 2479652 2479721 . + . transcript "219" Adh GeneID CDS 2481639 2481850 . + . transcript "219" Adh GeneID CDS 2483447 2483582 . + . transcript "219" Adh GeneID CDS 2483839 2483972 . + . transcript "219" Adh GeneID CDS 2484693 2484860 . + . transcript "219" Adh GeneID CDS 2486400 2486522 . + . transcript "219" Adh GeneID CDS 2486596 2486785 . + . transcript "219" Adh GeneID CDS 2488301 2488344 . + . transcript "219" Adh GeneID stop_codon 2488342 2488344 . + . transcript "219" Adh GeneID start_codon 2493314 2493316 . + . transcript "220" Adh GeneID CDS 2493314 2493620 . + . transcript "220" Adh GeneID CDS 2493682 2493731 . + . transcript "220" Adh GeneID CDS 2494047 2494116 . + . transcript "220" Adh GeneID CDS 2494180 2494259 . + . transcript "220" Adh GeneID CDS 2494325 2494651 . + . transcript "220" Adh GeneID CDS 2495100 2495225 . + . transcript "220" Adh GeneID CDS 2495286 2495667 . + . transcript "220" Adh GeneID CDS 2495783 2496988 . + . transcript "220" Adh GeneID CDS 2497217 2497464 . + . transcript "220" Adh GeneID stop_codon 2497462 2497464 . + . transcript "220" Adh GeneID start_codon 2505534 2505536 . + . transcript "221" Adh GeneID CDS 2505534 2505597 . + . transcript "221" Adh GeneID CDS 2507301 2507374 . + . transcript "221" Adh GeneID CDS 2516024 2516126 . + . transcript "221" Adh GeneID CDS 2524318 2524565 . + . transcript "221" Adh GeneID CDS 2525929 2526064 . + . transcript "221" Adh GeneID CDS 2527415 2527548 . + . transcript "221" Adh GeneID CDS 2529073 2529195 . + . transcript "221" Adh GeneID CDS 2529260 2529455 . + . transcript "221" Adh GeneID CDS 2529735 2529997 . + . transcript "221" Adh GeneID CDS 2532892 2532954 . + . transcript "221" Adh GeneID stop_codon 2532952 2532954 . + . transcript "221" Adh GeneID start_codon 2537881 2537883 . + . transcript "222" Adh GeneID CDS 2537881 2537946 . + . transcript "222" Adh GeneID CDS 2542060 2542092 . + . transcript "222" Adh GeneID CDS 2544388 2545047 . + . transcript "222" Adh GeneID CDS 2549114 2549149 . + . transcript "222" Adh GeneID CDS 2551735 2551826 . + . transcript "222" Adh GeneID CDS 2552831 2552875 . + . transcript "222" Adh GeneID CDS 2562735 2562789 . + . transcript "222" Adh GeneID CDS 2570235 2570303 . + . transcript "222" Adh GeneID stop_codon 2570301 2570303 . + . transcript "222" Adh GeneID stop_codon 2572782 2572784 . - . transcript "223" Adh GeneID CDS 2572782 2572813 . - . transcript "223" Adh GeneID CDS 2576390 2576423 . - . transcript "223" Adh GeneID CDS 2579249 2579323 . - . transcript "223" Adh GeneID CDS 2580473 2580611 . - . transcript "223" Adh GeneID CDS 2581149 2581234 . - . transcript "223" Adh GeneID start_codon 2581232 2581234 . - . transcript "223" Adh GeneID start_codon 2590910 2590912 . + . transcript "224" Adh GeneID CDS 2590910 2591975 . + . transcript "224" Adh GeneID CDS 2595330 2595382 . + . transcript "224" Adh GeneID stop_codon 2595380 2595382 . + . transcript "224" Adh GeneID start_codon 2596549 2596551 . + . transcript "225" Adh GeneID CDS 2596549 2596639 . + . transcript "225" Adh GeneID CDS 2601031 2601171 . + . transcript "225" Adh GeneID CDS 2609590 2609636 . + . transcript "225" Adh GeneID stop_codon 2609634 2609636 . + . transcript "225" Adh GeneID stop_codon 2610624 2610626 . - . transcript "226" Adh GeneID CDS 2610624 2610673 . - . transcript "226" Adh GeneID CDS 2613845 2613908 . - . transcript "226" Adh GeneID CDS 2615080 2615192 . - . transcript "226" Adh GeneID CDS 2619035 2619107 . - . transcript "226" Adh GeneID start_codon 2619105 2619107 . - . transcript "226" Adh GeneID start_codon 2621205 2621207 . + . transcript "227" Adh GeneID CDS 2621205 2622507 . + . transcript "227" Adh GeneID CDS 2622578 2622779 . + . transcript "227" Adh GeneID CDS 2622977 2623082 . + . transcript "227" Adh GeneID CDS 2624976 2625495 . + . transcript "227" Adh GeneID CDS 2625559 2625784 . + . transcript "227" Adh GeneID CDS 2625851 2625978 . + . transcript "227" Adh GeneID CDS 2626595 2626653 . + . transcript "227" Adh GeneID CDS 2628411 2628470 . + . transcript "227" Adh GeneID stop_codon 2628468 2628470 . + . transcript "227" Adh GeneID start_codon 2632081 2632083 . + . transcript "228" Adh GeneID CDS 2632081 2632298 . + . transcript "228" Adh GeneID CDS 2632363 2632834 . + . transcript "228" Adh GeneID CDS 2633397 2633645 . + . transcript "228" Adh GeneID CDS 2633706 2634365 . + . transcript "228" Adh GeneID CDS 2634452 2634885 . + . transcript "228" Adh GeneID CDS 2641353 2641395 . + . transcript "228" Adh GeneID stop_codon 2641393 2641395 . + . transcript "228" Adh GeneID start_codon 2643798 2643800 . + . transcript "229" Adh GeneID CDS 2643798 2643862 . + . transcript "229" Adh GeneID CDS 2644474 2644588 . + . transcript "229" Adh GeneID CDS 2654047 2654208 . + . transcript "229" Adh GeneID CDS 2656498 2656563 . + . transcript "229" Adh GeneID stop_codon 2656561 2656563 . + . transcript "229" Adh GeneID start_codon 2660938 2660940 . + . transcript "230" Adh GeneID CDS 2660938 2661318 . + . transcript "230" Adh GeneID CDS 2661378 2662292 . + . transcript "230" Adh GeneID CDS 2662390 2662437 . + . transcript "230" Adh GeneID CDS 2664895 2664990 . + . transcript "230" Adh GeneID CDS 2681403 2681494 . + . transcript "230" Adh GeneID CDS 2684880 2686209 . + . transcript "230" Adh GeneID CDS 2686394 2686570 . + . transcript "230" Adh GeneID CDS 2686628 2686705 . + . transcript "230" Adh GeneID CDS 2686770 2687146 . + . transcript "230" Adh GeneID CDS 2687211 2687359 . + . transcript "230" Adh GeneID CDS 2687415 2687920 . + . transcript "230" Adh GeneID CDS 2687988 2688230 . + . transcript "230" Adh GeneID CDS 2688638 2688883 . + . transcript "230" Adh GeneID CDS 2689073 2689178 . + . transcript "230" Adh GeneID CDS 2689306 2689406 . + . transcript "230" Adh GeneID stop_codon 2689404 2689406 . + . transcript "230" Adh GeneID stop_codon 2696509 2696511 . - . transcript "231" Adh GeneID CDS 2696509 2696644 . - . transcript "231" Adh GeneID CDS 2697862 2698028 . - . transcript "231" Adh GeneID CDS 2698091 2698198 . - . transcript "231" Adh GeneID start_codon 2698196 2698198 . - . transcript "231" Adh GeneID stop_codon 2699344 2699346 . - . transcript "232" Adh GeneID CDS 2699344 2699418 . - . transcript "232" Adh GeneID CDS 2699909 2699957 . - . transcript "232" Adh GeneID CDS 2705551 2705590 . - . transcript "232" Adh GeneID CDS 2709814 2710672 . - . transcript "232" Adh GeneID start_codon 2710670 2710672 . - . transcript "232" Adh GeneID start_codon 2711460 2711462 . + . transcript "233" Adh GeneID CDS 2711460 2711538 . + . transcript "233" Adh GeneID CDS 2711758 2711853 . + . transcript "233" Adh GeneID CDS 2711910 2712440 . + . transcript "233" Adh GeneID CDS 2713038 2713174 . + . transcript "233" Adh GeneID stop_codon 2713172 2713174 . + . transcript "233" Adh GeneID stop_codon 2714781 2714783 . - . transcript "234" Adh GeneID CDS 2714781 2716277 . - . transcript "234" Adh GeneID CDS 2723356 2723388 . - . transcript "234" Adh GeneID start_codon 2723386 2723388 . - . transcript "234" Adh GeneID stop_codon 2724822 2724824 . - . transcript "235" Adh GeneID CDS 2724822 2724887 . - . transcript "235" Adh GeneID CDS 2728123 2728429 . - . transcript "235" Adh GeneID CDS 2729821 2729853 . - . transcript "235" Adh GeneID CDS 2734718 2734759 . - . transcript "235" Adh GeneID CDS 2736358 2736449 . - . transcript "235" Adh GeneID start_codon 2736447 2736449 . - . transcript "235" Adh GeneID start_codon 2737907 2737909 . + . transcript "236" Adh GeneID CDS 2737907 2738132 . + . transcript "236" Adh GeneID CDS 2738403 2739461 . + . transcript "236" Adh GeneID CDS 2739531 2740039 . + . transcript "236" Adh GeneID stop_codon 2740037 2740039 . + . transcript "236" Adh GeneID start_codon 2743611 2743613 . + . transcript "237" Adh GeneID CDS 2743611 2743977 . + . transcript "237" Adh GeneID CDS 2744320 2745122 . + . transcript "237" Adh GeneID stop_codon 2745120 2745122 . + . transcript "237" Adh GeneID stop_codon 2746815 2746817 . - . transcript "238" Adh GeneID CDS 2746815 2747453 . - . transcript "238" Adh GeneID CDS 2748132 2748572 . - . transcript "238" Adh GeneID start_codon 2748570 2748572 . - . transcript "238" Adh GeneID stop_codon 2751337 2751339 . - . transcript "239" Adh GeneID CDS 2751337 2751465 . - . transcript "239" Adh GeneID CDS 2751521 2751589 . - . transcript "239" Adh GeneID start_codon 2751587 2751589 . - . transcript "239" Adh GeneID start_codon 2752612 2752614 . + . transcript "240" Adh GeneID CDS 2752612 2752742 . + . transcript "240" Adh GeneID CDS 2752822 2752985 . + . transcript "240" Adh GeneID CDS 2753042 2753322 . + . transcript "240" Adh GeneID CDS 2754071 2754139 . + . transcript "240" Adh GeneID stop_codon 2754137 2754139 . + . transcript "240" Adh GeneID stop_codon 2755219 2755221 . - . transcript "241" Adh GeneID CDS 2755219 2755580 . - . transcript "241" Adh GeneID CDS 2755775 2755865 . - . transcript "241" Adh GeneID start_codon 2755863 2755865 . - . transcript "241" Adh GeneID start_codon 2756920 2756922 . + . transcript "242" Adh GeneID CDS 2756920 2757589 . + . transcript "242" Adh GeneID CDS 2757658 2758391 . + . transcript "242" Adh GeneID stop_codon 2758389 2758391 . + . transcript "242" Adh GeneID stop_codon 2759256 2759258 . - . transcript "243" Adh GeneID CDS 2759256 2759403 . - . transcript "243" Adh GeneID CDS 2759527 2759639 . - . transcript "243" Adh GeneID CDS 2759701 2759850 . - . transcript "243" Adh GeneID start_codon 2759848 2759850 . - . transcript "243" Adh GeneID start_codon 2760406 2760408 . + . transcript "244" Adh GeneID CDS 2760406 2760672 . + . transcript "244" Adh GeneID CDS 2760766 2761087 . + . transcript "244" Adh GeneID CDS 2761141 2762087 . + . transcript "244" Adh GeneID stop_codon 2762085 2762087 . + . transcript "244" Adh GeneID stop_codon 2762639 2762641 . - . transcript "245" Adh GeneID CDS 2762639 2762710 . - . transcript "245" Adh GeneID CDS 2763711 2763968 . - . transcript "245" Adh GeneID CDS 2764030 2764118 . - . transcript "245" Adh GeneID CDS 2765359 2765411 . - . transcript "245" Adh GeneID CDS 2766573 2766663 . - . transcript "245" Adh GeneID CDS 2772220 2772430 . - . transcript "245" Adh GeneID CDS 2772600 2772777 . - . transcript "245" Adh GeneID CDS 2773593 2774287 . - . transcript "245" Adh GeneID start_codon 2774285 2774287 . - . transcript "245" Adh GeneID stop_codon 2777390 2777392 . - . transcript "246" Adh GeneID CDS 2777390 2777609 . - . transcript "246" Adh GeneID CDS 2777672 2778342 . - . transcript "246" Adh GeneID start_codon 2778340 2778342 . - . transcript "246" Adh GeneID stop_codon 2785384 2785386 . - . transcript "247" Adh GeneID CDS 2785384 2785491 . - . transcript "247" Adh GeneID CDS 2787948 2788341 . - . transcript "247" Adh GeneID CDS 2788808 2789086 . - . transcript "247" Adh GeneID CDS 2789143 2789567 . - . transcript "247" Adh GeneID start_codon 2789565 2789567 . - . transcript "247" Adh GeneID stop_codon 2791866 2791868 . - . transcript "248" Adh GeneID CDS 2791866 2792011 . - . transcript "248" Adh GeneID CDS 2792082 2792601 . - . transcript "248" Adh GeneID start_codon 2792599 2792601 . - . transcript "248" Adh GeneID stop_codon 2793626 2793628 . - . transcript "249" Adh GeneID CDS 2793626 2797674 . - . transcript "249" Adh GeneID CDS 2801187 2801286 . - . transcript "249" Adh GeneID start_codon 2801284 2801286 . - . transcript "249" Adh GeneID stop_codon 2804442 2804444 . - . transcript "250" Adh GeneID CDS 2804442 2805730 . - . transcript "250" Adh GeneID CDS 2807942 2808020 . - . transcript "250" Adh GeneID start_codon 2808018 2808020 . - . transcript "250" Adh GeneID start_codon 2808552 2808554 . + . transcript "251" Adh GeneID CDS 2808552 2808602 . + . transcript "251" Adh GeneID CDS 2809680 2809823 . + . transcript "251" Adh GeneID CDS 2811810 2811890 . + . transcript "251" Adh GeneID stop_codon 2811888 2811890 . + . transcript "251" Adh GeneID start_codon 2815178 2815180 . + . transcript "252" Adh GeneID CDS 2815178 2815829 . + . transcript "252" Adh GeneID CDS 2815894 2816001 . + . transcript "252" Adh GeneID CDS 2817050 2817135 . + . transcript "252" Adh GeneID stop_codon 2817133 2817135 . + . transcript "252" Adh GeneID start_codon 2818476 2818478 . + . transcript "253" Adh GeneID CDS 2818476 2818511 . + . transcript "253" Adh GeneID CDS 2822268 2822465 . + . transcript "253" Adh GeneID stop_codon 2822463 2822465 . + . transcript "253" Adh GeneID stop_codon 2825764 2825766 . - . transcript "254" Adh GeneID CDS 2825764 2825833 . - . transcript "254" Adh GeneID CDS 2826113 2826233 . - . transcript "254" Adh GeneID CDS 2836812 2836843 . - . transcript "254" Adh GeneID CDS 2838610 2838665 . - . transcript "254" Adh GeneID CDS 2842689 2842759 . - . transcript "254" Adh GeneID CDS 2853744 2854099 . - . transcript "254" Adh GeneID CDS 2854197 2855182 . - . transcript "254" Adh GeneID start_codon 2855180 2855182 . - . transcript "254" Adh GeneID start_codon 2870618 2870620 . + . transcript "255" Adh GeneID CDS 2870618 2870720 . + . transcript "255" Adh GeneID CDS 2876212 2876251 . + . transcript "255" Adh GeneID CDS 2877802 2877835 . + . transcript "255" Adh GeneID CDS 2885189 2885284 . + . transcript "255" Adh GeneID stop_codon 2885282 2885284 . + . transcript "255" Adh GeneID start_codon 2894707 2894709 . + . transcript "256" Adh GeneID CDS 2894707 2895247 . + . transcript "256" Adh GeneID CDS 2895441 2895487 . + . transcript "256" Adh GeneID stop_codon 2895485 2895487 . + . transcript "256" Adh GeneID start_codon 2896655 2896657 . + . transcript "257" Adh GeneID CDS 2896655 2896763 . + . transcript "257" Adh GeneID CDS 2898444 2899001 . + . transcript "257" Adh GeneID CDS 2899061 2899716 . + . transcript "257" Adh GeneID stop_codon 2899714 2899716 . + . transcript "257" Adh GeneID start_codon 2900448 2900450 . + . transcript "258" Adh GeneID CDS 2900448 2900565 . + . transcript "258" Adh GeneID CDS 2900634 2901185 . + . transcript "258" Adh GeneID CDS 2901452 2902107 . + . transcript "258" Adh GeneID stop_codon 2902105 2902107 . + . transcript "258" Adh GeneID stop_codon 2910965 2910967 . - . transcript "259" Adh GeneID CDS 2910965 2911002 . - . transcript "259" Adh GeneID CDS 2911839 2911898 . - . transcript "259" Adh GeneID CDS 2917311 2917504 . - . transcript "259" Adh GeneID CDS 2917751 2917988 . - . transcript "259" Adh GeneID CDS 2918253 2918513 . - . transcript "259" # GENE ANNOTATION 1 for Adh region of Drosophila melanogaster (file: CGG1_Annotation_of_Adh.gff) # Computational Genomic Group, The Sanger Centre, Hinxton, Cambridge CB10 1SA, UK # Group Leader Victor Solovyev: Email: solovyev@sanger.ac.uk # WWW: http://genomic.sanger.ac.uk/ # ANNOTATION 1 (MAIN): CGG1 (use this file to compare with the other group annotations) # Presented most probable gene structures 1 variant for any sequence region # Total 288 genes; 1115 exons; Predictions based on Fgenes/Fgenesh programs; # 58 genes have significant similarity with known proteins, transcript marked "homo" # 2 other files (auxiliary annotations): # Annotation 2 (CGG2) (file: CGG2_Annotation_of_Adh.gff) # Presents most reliable list of Coding exons, that might be useful # to start experimental verification of genes using PCR primers; these exons # are the same in fgenes/fgenesh predictions: # Total 598 exons. # Annotation 3 (CGG3) (file: CGG3_Annotation_of_Adh.gff) # Presents possible gene variants predicted by 2 programs Fgenes/Fgenesh # it is very redundant, but should have the highest coverage of real genes: # Total 875 genes; 2900 exons. # # compfly: 1. replaced sequence feature entry Jul 5 (MR) # Adh FGenesCGG1 CDS 1 441 . - . transcript "1" Adh FGenesCGG1 CDS 2379 2862 . - . transcript "1" Adh FGenesCGG1 CDS 3225 3550 . - . transcript "1" Adh FGenesCGG1 CDS 6718 7018 . - . transcript "1" Adh FGenesCGG1 start_codon 7016 7018 . - . transcript "1" Adh FGenesCGG1 CDS 12148 12250 . - . transcript "2" Adh FGenesCGG1 stop_codon 12148 12150 . - . transcript "2" Adh FGenesCGG1 CDS 14333 14407 . - . transcript "2" Adh FGenesCGG1 CDS 15268 15437 . - . transcript "2" Adh FGenesCGG1 start_codon 15435 15437 . - . transcript "2" Adh FGenesCGG1 CDS 16481 19594 . - . transcript "3" Adh FGenesCGG1 start_codon 19592 19594 . - . transcript "3" Adh FGenesCGG1 stop_codon 16481 16483 . - . transcript "3" Adh FGenesCGG1 CDS 21599 21979 . + . transcript "4" Adh FGenesCGG1 start_codon 21599 21601 . + . transcript "4" Adh FGenesCGG1 CDS 23871 24134 . + . transcript "4" Adh FGenesCGG1 CDS 24195 24356 . + . transcript "4" Adh FGenesCGG1 stop_codon 24354 24356 . + . transcript "4" Adh FGenesCGG1 CDS 26050 26166 . + . transcript "5" Adh FGenesCGG1 start_codon 26050 26052 . + . transcript "5" Adh FGenesCGG1 CDS 26209 26394 . + . transcript "5" Adh FGenesCGG1 stop_codon 26392 26394 . + . transcript "5" Adh FGenesCGG1 CDS 29156 29479 . - . transcript "6" Adh FGenesCGG1 start_codon 29477 29479 . - . transcript "6" Adh FGenesCGG1 stop_codon 29156 29158 . - . transcript "6" Adh FGenesCGG1 CDS 31722 31768 . + . transcript "7" Adh FGenesCGG1 start_codon 31722 31724 . + . transcript "7" Adh FGenesCGG1 CDS 32102 32319 . + . transcript "7" Adh FGenesCGG1 CDS 34532 34822 . + . transcript "7" Adh FGenesCGG1 CDS 34857 35332 . + . transcript "7" Adh FGenesCGG1 stop_codon 35330 35332 . + . transcript "7" Adh FGenesCGG1 CDS 35433 35749 . - . transcript "8" Adh FGenesCGG1 stop_codon 35433 35435 . - . transcript "8" Adh FGenesCGG1 CDS 35938 36226 . - . transcript "8" Adh FGenesCGG1 start_codon 36224 36226 . - . transcript "8" Adh FGenesCGG1 CDS 36410 37315 . + . transcript "9" Adh FGenesCGG1 start_codon 36410 36412 . + . transcript "9" Adh FGenesCGG1 stop_codon 37313 37315 . + . transcript "9" Adh FGenesCGG1 CDS 45358 45421 . + . transcript "10" Adh FGenesCGG1 start_codon 45358 45360 . + . transcript "10" Adh FGenesCGG1 CDS 52555 52587 . + . transcript "10" Adh FGenesCGG1 CDS 103543 103769 . + . transcript "10" Adh FGenesCGG1 CDS 103808 104330 . + . transcript "10" Adh FGenesCGG1 CDS 124458 124936 . + . transcript "10" Adh FGenesCGG1 CDS 127146 127292 . + . transcript "10" Adh FGenesCGG1 CDS 127771 127931 . + . transcript "10" Adh FGenesCGG1 CDS 127991 128225 . + . transcript "10" Adh FGenesCGG1 CDS 128296 129342 . + . transcript "10" Adh FGenesCGG1 CDS 129401 129965 . + . transcript "10" Adh FGenesCGG1 CDS 130136 130401 . + . transcript "10" Adh FGenesCGG1 stop_codon 130399 130401 . + . transcript "10" Adh FGenesCGG1 CDS 54448 55900 . + . transcript "11" Adh FGenesCGG1 stop_codon 55898 55900 . + . transcript "11" Adh FGenesCGG1 CDS 56155 58817 . + . transcript "12" Adh FGenesCGG1 start_codon 56155 56157 . + . transcript "12" Adh FGenesCGG1 CDS 89305 90666 . - . transcript "13" Adh FGenesCGG1 start_codon 90664 90666 . - . transcript "13" Adh FGenesCGG1 stop_codon 89305 89307 . - . transcript "13" Adh FGenesCGG1 CDS 93123 94100 . - . transcript "14" Adh FGenesCGG1 stop_codon 93123 93125 . - . transcript "14" Adh FGenesCGG1 CDS 95215 95259 . - . transcript "14" Adh FGenesCGG1 CDS 96195 96257 . - . transcript "14" Adh FGenesCGG1 start_codon 96255 96257 . - . transcript "14" Adh FGenesCGG1 CDS 133458 133548 . - . transcript "15" Adh FGenesCGG1 stop_codon 133458 133460 . - . transcript "15" Adh FGenesCGG1 CDS 133612 133750 . - . transcript "15" Adh FGenesCGG1 CDS 133961 134233 . - . transcript "15" Adh FGenesCGG1 CDS 134862 135000 . - . transcript "15" Adh FGenesCGG1 start_codon 134998 135000 . - . transcript "15" Adh FGenesCGG1 CDS 159578 159874 . + . transcript "16" Adh FGenesCGG1 start_codon 159578 159580 . + . transcript "16" Adh FGenesCGG1 CDS 160778 160792 . + . transcript "16" Adh FGenesCGG1 CDS 161727 162105 . + . transcript "16" Adh FGenesCGG1 CDS 162442 162557 . + . transcript "16" Adh FGenesCGG1 CDS 162616 163137 . + . transcript "16" Adh FGenesCGG1 CDS 163297 163527 . + . transcript "16" Adh FGenesCGG1 stop_codon 163525 163527 . + . transcript "16" Adh FGenesCGG1 CDS 167469 167524 . - . transcript "17" Adh FGenesCGG1 stop_codon 167469 167471 . - . transcript "17" Adh FGenesCGG1 CDS 172369 172869 . - . transcript "17" Adh FGenesCGG1 CDS 175152 175341 . - . transcript "17" Adh FGenesCGG1 CDS 176875 176942 . - . transcript "17" Adh FGenesCGG1 CDS 177956 178015 . - . transcript "17" Adh FGenesCGG1 CDS 178136 178300 . - . transcript "17" Adh FGenesCGG1 CDS 181272 181409 . - . transcript "17" Adh FGenesCGG1 CDS 183107 183235 . - . transcript "17" Adh FGenesCGG1 CDS 183341 183496 . - . transcript "17" Adh FGenesCGG1 CDS 183596 183635 . - . transcript "17" Adh FGenesCGG1 CDS 183699 183764 . - . transcript "17" Adh FGenesCGG1 CDS 183835 184040 . - . transcript "17" Adh FGenesCGG1 CDS 184241 184282 . - . transcript "17" Adh FGenesCGG1 CDS 185558 185615 . - . transcript "17" Adh FGenesCGG1 start_codon 185613 185615 . - . transcript "17" Adh FGenesCGG1 CDS 188492 188640 . + . transcript "18" Adh FGenesCGG1 start_codon 188492 188494 . + . transcript "18" Adh FGenesCGG1 CDS 189065 189192 . + . transcript "18" Adh FGenesCGG1 CDS 189224 189348 . + . transcript "18" Adh FGenesCGG1 CDS 189492 189584 . + . transcript "18" Adh FGenesCGG1 stop_codon 189582 189584 . + . transcript "18" Adh FGenesCGG1 CDS 202128 202646 . + . transcript "19" Adh FGenesCGG1 start_codon 202128 202130 . + . transcript "19" Adh FGenesCGG1 CDS 202700 204199 . + . transcript "19" Adh FGenesCGG1 stop_codon 204197 204199 . + . transcript "19" Adh FGenesCGG1 CDS 216144 216761 . - . transcript "20" Adh FGenesCGG1 stop_codon 216144 216146 . - . transcript "20" Adh FGenesCGG1 CDS 216820 217188 . - . transcript "20" Adh FGenesCGG1 start_codon 217186 217188 . - . transcript "20" Adh FGenesCGG1 CDS 229944 230462 . + . transcript "21" Adh FGenesCGG1 start_codon 229944 229946 . + . transcript "21" Adh FGenesCGG1 stop_codon 230460 230462 . + . transcript "21" Adh FGenesCGG1 CDS 230985 231322 . - . transcript "22" Adh FGenesCGG1 stop_codon 230985 230987 . - . transcript "22" Adh FGenesCGG1 CDS 231417 231615 . - . transcript "22" Adh FGenesCGG1 start_codon 231613 231615 . - . transcript "22" Adh FGenesCGG1 CDS 237474 237694 . - . transcript "23" Adh FGenesCGG1 stop_codon 237474 237476 . - . transcript "23" Adh FGenesCGG1 CDS 238361 238436 . - . transcript "23" Adh FGenesCGG1 CDS 238885 238894 . - . transcript "23" Adh FGenesCGG1 CDS 240094 240232 . - . transcript "23" Adh FGenesCGG1 CDS 240585 240630 . - . transcript "23" Adh FGenesCGG1 start_codon 240628 240630 . - . transcript "23" Adh FGenesCGG1 CDS 255763 256582 . - . transcript "24" Adh FGenesCGG1 stop_codon 255763 255765 . - . transcript "24" Adh FGenesCGG1 CDS 260965 261005 . - . transcript "24" Adh FGenesCGG1 start_codon 261003 261005 . - . transcript "24" Adh FGenesCGG1 CDS 263040 263066 . + . transcript "25" Adh FGenesCGG1 start_codon 263040 263042 . + . transcript "25" Adh FGenesCGG1 CDS 265187 266322 . + . transcript "25" Adh FGenesCGG1 CDS 266392 266611 . + . transcript "25" Adh FGenesCGG1 CDS 266760 266867 . + . transcript "25" Adh FGenesCGG1 CDS 266935 267073 . + . transcript "25" Adh FGenesCGG1 CDS 267134 267234 . + . transcript "25" Adh FGenesCGG1 stop_codon 267232 267234 . + . transcript "25" Adh FGenesCGG1 CDS 267759 268130 . - . transcript "26" Adh FGenesCGG1 stop_codon 267759 267761 . - . transcript "26" Adh FGenesCGG1 CDS 268725 268798 . - . transcript "26" Adh FGenesCGG1 CDS 269222 269541 . - . transcript "26" Adh FGenesCGG1 CDS 269629 269907 . - . transcript "26" Adh FGenesCGG1 CDS 271522 271573 . - . transcript "26" Adh FGenesCGG1 CDS 273396 273483 . - . transcript "26" Adh FGenesCGG1 start_codon 273481 273483 . - . transcript "26" Adh FGenesCGG1 CDS 274751 275848 . + . transcript "27" Adh FGenesCGG1 start_codon 274751 274753 . + . transcript "27" Adh FGenesCGG1 stop_codon 275846 275848 . + . transcript "27" Adh FGenesCGG1 CDS 276361 276696 . - . transcript "28" Adh FGenesCGG1 stop_codon 276361 276363 . - . transcript "28" Adh FGenesCGG1 CDS 276748 277188 . - . transcript "28" Adh FGenesCGG1 start_codon 277186 277188 . - . transcript "28" Adh FGenesCGG1 CDS 277921 278103 . + . transcript "29" Adh FGenesCGG1 start_codon 277921 277923 . + . transcript "29" Adh FGenesCGG1 CDS 278222 278345 . + . transcript "29" Adh FGenesCGG1 CDS 278537 278737 . + . transcript "29" Adh FGenesCGG1 CDS 278802 279272 . + . transcript "29" Adh FGenesCGG1 CDS 279331 279483 . + . transcript "29" Adh FGenesCGG1 CDS 279548 279726 . + . transcript "29" Adh FGenesCGG1 CDS 280031 280247 . + . transcript "29" Adh FGenesCGG1 CDS 280310 280610 . + . transcript "29" Adh FGenesCGG1 CDS 280674 280986 . + . transcript "29" Adh FGenesCGG1 CDS 281051 281202 . + . transcript "29" Adh FGenesCGG1 CDS 281264 281447 . + . transcript "29" Adh FGenesCGG1 CDS 281550 281787 . + . transcript "29" Adh FGenesCGG1 CDS 281848 282471 . + . transcript "29" Adh FGenesCGG1 CDS 282539 283541 . + . transcript "29" Adh FGenesCGG1 CDS 283608 284052 . + . transcript "29" Adh FGenesCGG1 stop_codon 284050 284052 . + . transcript "29" Adh FGenesCGG1 CDS 284779 284915 . + . transcript "30" Adh FGenesCGG1 start_codon 284779 284781 . + . transcript "30" Adh FGenesCGG1 CDS 284969 285346 . + . transcript "30" Adh FGenesCGG1 CDS 285416 286886 . + . transcript "30" Adh FGenesCGG1 stop_codon 286884 286886 . + . transcript "30" Adh FGenesCGG1 CDS 287599 288379 . + . transcript "31" Adh FGenesCGG1 start_codon 287599 287601 . + . transcript "31" Adh FGenesCGG1 CDS 288647 292689 . + . transcript "31" Adh FGenesCGG1 CDS 292759 292896 . + . transcript "31" Adh FGenesCGG1 stop_codon 292894 292896 . + . transcript "31" Adh FGenesCGG1 CDS 297680 297713 . + . transcript "32" Adh FGenesCGG1 start_codon 297680 297682 . + . transcript "32" Adh FGenesCGG1 CDS 302560 302718 . + . transcript "32" Adh FGenesCGG1 CDS 302786 303072 . + . transcript "32" Adh FGenesCGG1 CDS 303214 303405 . + . transcript "32" Adh FGenesCGG1 stop_codon 303403 303405 . + . transcript "32" Adh FGenesCGG1 CDS 303960 304272 . - . transcript "33" Adh FGenesCGG1 stop_codon 303960 303962 . - . transcript "33" Adh FGenesCGG1 CDS 304330 305000 . - . transcript "33" Adh FGenesCGG1 start_codon 304998 305000 . - . transcript "33" Adh FGenesCGG1 CDS 307965 309056 . + . transcript "34" Adh FGenesCGG1 start_codon 307965 307967 . + . transcript "34" Adh FGenesCGG1 CDS 309110 309467 . + . transcript "34" Adh FGenesCGG1 CDS 309530 310452 . + . transcript "34" Adh FGenesCGG1 CDS 310517 311365 . + . transcript "34" Adh FGenesCGG1 CDS 311428 312318 . + . transcript "34" Adh FGenesCGG1 CDS 312387 313020 . + . transcript "34" Adh FGenesCGG1 CDS 313086 313129 . + . transcript "34" Adh FGenesCGG1 stop_codon 313127 313129 . + . transcript "34" Adh FGenesCGG1 CDS 315138 315899 . + . transcript "35" Adh FGenesCGG1 start_codon 315138 315140 . + . transcript "35" Adh FGenesCGG1 CDS 316433 316800 . + . transcript "35" Adh FGenesCGG1 CDS 316865 317462 . + . transcript "35" Adh FGenesCGG1 stop_codon 317460 317462 . + . transcript "35" Adh FGenesCGG1 CDS 317891 318548 . - . transcript "36" Adh FGenesCGG1 stop_codon 317891 317893 . - . transcript "36" Adh FGenesCGG1 CDS 318608 319430 . - . transcript "36" Adh FGenesCGG1 CDS 319486 321442 . - . transcript "36" Adh FGenesCGG1 start_codon 321440 321442 . - . transcript "36" Adh FGenesCGG1 CDS 321967 323027 . - . transcript "37" Adh FGenesCGG1 stop_codon 321967 321969 . - . transcript "37" Adh FGenesCGG1 CDS 323097 323169 . - . transcript "37" Adh FGenesCGG1 start_codon 323167 323169 . - . transcript "37" Adh FGenesCGG1 CDS 323788 324885 . + . transcript "38" Adh FGenesCGG1 start_codon 323788 323790 . + . transcript "38" Adh FGenesCGG1 CDS 324939 325223 . + . transcript "38" Adh FGenesCGG1 stop_codon 325221 325223 . + . transcript "38" Adh FGenesCGG1 CDS 325240 325634 . - . transcript "39" Adh FGenesCGG1 stop_codon 325240 325242 . - . transcript "39" Adh FGenesCGG1 CDS 325689 326379 . - . transcript "39" Adh FGenesCGG1 start_codon 326377 326379 . - . transcript "39" Adh FGenesCGG1 CDS 326381 326822 . - . transcript "40" Adh FGenesCGG1 start_codon 326820 326822 . - . transcript "40" Adh FGenesCGG1 stop_codon 326381 326383 . - . transcript "40" Adh FGenesCGG1 CDS 327175 328002 . + . transcript "41" Adh FGenesCGG1 start_codon 327175 327177 . + . transcript "41" Adh FGenesCGG1 stop_codon 328000 328002 . + . transcript "41" Adh FGenesCGG1 CDS 328048 328383 . - . transcript "42" Adh FGenesCGG1 stop_codon 328048 328050 . - . transcript "42" Adh FGenesCGG1 CDS 328469 328634 . - . transcript "42" Adh FGenesCGG1 CDS 328690 328733 . - . transcript "42" Adh FGenesCGG1 start_codon 328731 328733 . - . transcript "42" Adh FGenesCGG1 CDS 329808 329867 . + . transcript "43" Adh FGenesCGG1 start_codon 329808 329810 . + . transcript "43" Adh FGenesCGG1 CDS 330027 330183 . + . transcript "43" Adh FGenesCGG1 CDS 333808 334040 . + . transcript "43" Adh FGenesCGG1 stop_codon 334038 334040 . + . transcript "43" Adh FGenesCGG1 CDS 334589 334786 . - . transcript "44" Adh FGenesCGG1 stop_codon 334589 334591 . - . transcript "44" Adh FGenesCGG1 CDS 334847 335125 . - . transcript "44" Adh FGenesCGG1 CDS 335195 335230 . - . transcript "44" Adh FGenesCGG1 start_codon 335228 335230 . - . transcript "44" Adh FGenesCGG1 CDS 336668 337323 . - . transcript "45" Adh FGenesCGG1 stop_codon 336668 336670 . - . transcript "45" Adh FGenesCGG1 CDS 337379 337457 . - . transcript "45" Adh FGenesCGG1 start_codon 337455 337457 . - . transcript "45" Adh FGenesCGG1 CDS 338167 338879 . - . transcript "46" Adh FGenesCGG1 stop_codon 338167 338169 . - . transcript "46" Adh FGenesCGG1 CDS 338944 339013 . - . transcript "46" Adh FGenesCGG1 start_codon 339011 339013 . - . transcript "46" Adh FGenesCGG1 CDS 340529 340634 . + . transcript "47" Adh FGenesCGG1 start_codon 340529 340531 . + . transcript "47" Adh FGenesCGG1 CDS 340705 340870 . + . transcript "47" Adh FGenesCGG1 CDS 340926 341517 . + . transcript "47" Adh FGenesCGG1 stop_codon 341515 341517 . + . transcript "47" Adh FGenesCGG1 CDS 341713 341857 . + . transcript "48" Adh FGenesCGG1 start_codon 341713 341715 . + . transcript "48" Adh FGenesCGG1 CDS 342003 342689 . + . transcript "48" Adh FGenesCGG1 CDS 343143 343368 . + . transcript "48" Adh FGenesCGG1 CDS 343432 343984 . + . transcript "48" Adh FGenesCGG1 stop_codon 343982 343984 . + . transcript "48" Adh FGenesCGG1 CDS 347626 349437 . - . transcript "49" Adh FGenesCGG1 stop_codon 347626 347628 . - . transcript "49" Adh FGenesCGG1 CDS 350212 351429 . - . transcript "49" Adh FGenesCGG1 CDS 352375 353478 . - . transcript "49" Adh FGenesCGG1 CDS 354175 354562 . - . transcript "49" Adh FGenesCGG1 CDS 360158 360259 . - . transcript "49" Adh FGenesCGG1 CDS 361766 361794 . - . transcript "49" Adh FGenesCGG1 start_codon 361792 361794 . - . transcript "49" Adh FGenesCGG1 CDS 385176 385283 . + . transcript "50" Adh FGenesCGG1 start_codon 385176 385178 . + . transcript "50" Adh FGenesCGG1 CDS 388780 388921 . + . transcript "50" Adh FGenesCGG1 CDS 389006 389140 . + . transcript "50" Adh FGenesCGG1 CDS 389208 390491 . + . transcript "50" Adh FGenesCGG1 CDS 390556 390673 . + . transcript "50" Adh FGenesCGG1 CDS 390737 391112 . + . transcript "50" Adh FGenesCGG1 CDS 391177 391500 . + . transcript "50" Adh FGenesCGG1 stop_codon 391498 391500 . + . transcript "50" Adh FGenesCGG1 CDS 393573 393814 . - . transcript "51" Adh FGenesCGG1 stop_codon 393573 393575 . - . transcript "51" Adh FGenesCGG1 CDS 393894 394052 . - . transcript "51" Adh FGenesCGG1 CDS 394383 395732 . - . transcript "51" Adh FGenesCGG1 CDS 395826 396192 . - . transcript "51" Adh FGenesCGG1 CDS 396385 397468 . - . transcript "51" Adh FGenesCGG1 CDS 397532 397671 . - . transcript "51" Adh FGenesCGG1 start_codon 397669 397671 . - . transcript "51" Adh FGenesCGG1 CDS 400338 400923 . + . transcript "52" Adh FGenesCGG1 start_codon 400338 400340 . + . transcript "52" Adh FGenesCGG1 CDS 401350 401713 . + . transcript "52" Adh FGenesCGG1 CDS 401775 402341 . + . transcript "52" Adh FGenesCGG1 CDS 402399 402539 . + . transcript "52" Adh FGenesCGG1 CDS 402607 402779 . + . transcript "52" Adh FGenesCGG1 CDS 402844 402860 . + . transcript "52" Adh FGenesCGG1 stop_codon 402858 402860 . + . transcript "52" Adh FGenesCGG1 CDS 403203 403277 . + . transcript "53" Adh FGenesCGG1 start_codon 403203 403205 . + . transcript "53" Adh FGenesCGG1 CDS 403468 404414 . + . transcript "53" Adh FGenesCGG1 CDS 404467 405027 . + . transcript "53" Adh FGenesCGG1 CDS 405085 405391 . + . transcript "53" Adh FGenesCGG1 stop_codon 405389 405391 . + . transcript "53" Adh FGenesCGG1 CDS 405952 406314 . + . transcript "54" Adh FGenesCGG1 start_codon 405952 405954 . + . transcript "54" Adh FGenesCGG1 stop_codon 406312 406314 . + . transcript "54" Adh FGenesCGG1 CDS 408759 409001 . + . transcript "55" Adh FGenesCGG1 start_codon 408759 408761 . + . transcript "55" Adh FGenesCGG1 CDS 409150 409656 . + . transcript "55" Adh FGenesCGG1 CDS 410157 410315 . + . transcript "55" Adh FGenesCGG1 CDS 410372 410612 . + . transcript "55" Adh FGenesCGG1 CDS 410677 411401 . + . transcript "55" Adh FGenesCGG1 CDS 411728 411831 . + . transcript "55" Adh FGenesCGG1 CDS 411898 411996 . + . transcript "55" Adh FGenesCGG1 CDS 412708 412711 . + . transcript "55" Adh FGenesCGG1 stop_codon 412709 412711 . + . transcript "55" Adh FGenesCGG1 CDS 414711 415055 . - . transcript "56" Adh FGenesCGG1 stop_codon 414711 414713 . - . transcript "56" Adh FGenesCGG1 CDS 415356 415519 . - . transcript "56" Adh FGenesCGG1 CDS 415584 416211 . - . transcript "56" Adh FGenesCGG1 CDS 416276 416749 . - . transcript "56" Adh FGenesCGG1 CDS 417100 417111 . - . transcript "56" Adh FGenesCGG1 start_codon 417109 417111 . - . transcript "56" Adh FGenesCGG1 CDS 417380 417492 . + . transcript "57" Adh FGenesCGG1 start_codon 417380 417382 . + . transcript "57" Adh FGenesCGG1 CDS 420781 420901 . + . transcript "57" Adh FGenesCGG1 CDS 423538 423693 . + . transcript "57" Adh FGenesCGG1 stop_codon 423691 423693 . + . transcript "57" Adh FGenesCGG1 CDS 426746 427546 . - . transcript "58" Adh FGenesCGG1 stop_codon 426746 426748 . - . transcript "58" Adh FGenesCGG1 CDS 432888 432947 . - . transcript "58" Adh FGenesCGG1 start_codon 432945 432947 . - . transcript "58" Adh FGenesCGG1 CDS 438994 439176 . + . transcript "59" Adh FGenesCGG1 start_codon 438994 438996 . + . transcript "59" Adh FGenesCGG1 CDS 439499 439600 . + . transcript "59" Adh FGenesCGG1 CDS 448492 448607 . + . transcript "59" Adh FGenesCGG1 CDS 449015 449225 . + . transcript "59" Adh FGenesCGG1 CDS 451744 451902 . + . transcript "59" Adh FGenesCGG1 CDS 453313 453459 . + . transcript "59" Adh FGenesCGG1 CDS 455021 455702 . + . transcript "59" Adh FGenesCGG1 CDS 455870 456267 . + . transcript "59" Adh FGenesCGG1 stop_codon 456265 456267 . + . transcript "59" Adh FGenesCGG1 CDS 457298 457488 . + . transcript "60" Adh FGenesCGG1 start_codon 457298 457300 . + . transcript "60" Adh FGenesCGG1 CDS 457649 458206 . + . transcript "60" Adh FGenesCGG1 CDS 458285 458481 . + . transcript "60" Adh FGenesCGG1 CDS 458547 458692 . + . transcript "60" Adh FGenesCGG1 stop_codon 458690 458692 . + . transcript "60" Adh FGenesCGG1 CDS 458837 459146 . - . transcript "61" Adh FGenesCGG1 stop_codon 458837 458839 . - . transcript "61" Adh FGenesCGG1 CDS 459225 459761 . - . transcript "61" Adh FGenesCGG1 CDS 460256 460674 . - . transcript "61" Adh FGenesCGG1 start_codon 460672 460674 . - . transcript "61" Adh FGenesCGG1 CDS 462092 462584 . - . transcript "62" Adh FGenesCGG1 stop_codon 462092 462094 . - . transcript "62" Adh FGenesCGG1 CDS 462646 463209 . - . transcript "62" Adh FGenesCGG1 CDS 463368 463657 . - . transcript "62" Adh FGenesCGG1 start_codon 463655 463657 . - . transcript "62" Adh FGenesCGG1 CDS 464308 464615 . + . transcript "63" Adh FGenesCGG1 start_codon 464308 464310 . + . transcript "63" Adh FGenesCGG1 CDS 464888 465434 . + . transcript "63" Adh FGenesCGG1 stop_codon 465432 465434 . + . transcript "63" Adh FGenesCGG1 CDS 467979 469628 . - . transcript "64" Adh FGenesCGG1 stop_codon 467979 467981 . - . transcript "64" Adh FGenesCGG1 CDS 469682 469686 . - . transcript "64" Adh FGenesCGG1 CDS 470967 471022 . - . transcript "64" Adh FGenesCGG1 start_codon 471020 471022 . - . transcript "64" Adh FGenesCGG1 CDS 471109 471296 . + . transcript "65" Adh FGenesCGG1 start_codon 471109 471111 . + . transcript "65" Adh FGenesCGG1 CDS 471441 471687 . + . transcript "65" Adh FGenesCGG1 CDS 471752 471856 . + . transcript "65" Adh FGenesCGG1 CDS 471944 472490 . + . transcript "65" Adh FGenesCGG1 CDS 472557 472823 . + . transcript "65" Adh FGenesCGG1 CDS 472965 473128 . + . transcript "65" Adh FGenesCGG1 stop_codon 473126 473128 . + . transcript "65" Adh FGenesCGG1 CDS 473959 474023 . + . transcript "66" Adh FGenesCGG1 start_codon 473959 473961 . + . transcript "66" Adh FGenesCGG1 CDS 474087 474189 . + . transcript "66" Adh FGenesCGG1 CDS 474251 474306 . + . transcript "66" Adh FGenesCGG1 CDS 474365 475283 . + . transcript "66" Adh FGenesCGG1 CDS 475427 476389 . + . transcript "66" Adh FGenesCGG1 stop_codon 476387 476389 . + . transcript "66" Adh FGenesCGG1 CDS 477171 477490 . - . transcript "67" Adh FGenesCGG1 stop_codon 477171 477173 . - . transcript "67" Adh FGenesCGG1 CDS 477548 479329 . - . transcript "67" Adh FGenesCGG1 CDS 479386 479753 . - . transcript "67" Adh FGenesCGG1 CDS 479815 479958 . - . transcript "67" Adh FGenesCGG1 CDS 480016 480081 . - . transcript "67" Adh FGenesCGG1 CDS 480147 480287 . - . transcript "67" Adh FGenesCGG1 CDS 480343 480480 . - . transcript "67" Adh FGenesCGG1 CDS 481570 481638 . - . transcript "67" Adh FGenesCGG1 CDS 483386 483457 . - . transcript "67" Adh FGenesCGG1 CDS 483532 483603 . - . transcript "67" Adh FGenesCGG1 CDS 484195 484338 . - . transcript "67" Adh FGenesCGG1 CDS 484664 484807 . - . transcript "67" Adh FGenesCGG1 CDS 485391 485462 . - . transcript "67" Adh FGenesCGG1 CDS 486686 487236 . - . transcript "67" Adh FGenesCGG1 start_codon 487234 487236 . - . transcript "67" Adh FGenesCGG1 CDS 498520 498979 . + . transcript "68" Adh FGenesCGG1 start_codon 498520 498522 . + . transcript "68" Adh FGenesCGG1 CDS 499082 499159 . + . transcript "68" Adh FGenesCGG1 CDS 499280 499593 . + . transcript "68" Adh FGenesCGG1 stop_codon 499591 499593 . + . transcript "68" Adh FGenesCGG1 CDS 505505 505549 . + . transcript "69" Adh FGenesCGG1 start_codon 505505 505507 . + . transcript "69" Adh FGenesCGG1 CDS 506822 506887 . + . transcript "69" Adh FGenesCGG1 CDS 509536 509783 . + . transcript "69" Adh FGenesCGG1 CDS 509881 510226 . + . transcript "69" Adh FGenesCGG1 CDS 510287 510786 . + . transcript "69" Adh FGenesCGG1 CDS 511784 512375 . + . transcript "69" Adh FGenesCGG1 CDS 512435 512758 . + . transcript "69" Adh FGenesCGG1 stop_codon 512756 512758 . + . transcript "69" Adh FGenesCGG1 CDS 520781 521850 . + . transcript "70" Adh FGenesCGG1 start_codon 520781 520783 . + . transcript "70" Adh FGenesCGG1 CDS 522013 522988 . + . transcript "70" Adh FGenesCGG1 stop_codon 522986 522988 . + . transcript "70" Adh FGenesCGG1 CDS 523395 523601 . - . transcript "71" Adh FGenesCGG1 stop_codon 523395 523397 . - . transcript "71" Adh FGenesCGG1 CDS 523705 524253 . - . transcript "71" Adh FGenesCGG1 CDS 524438 525283 . - . transcript "71" Adh FGenesCGG1 start_codon 525281 525283 . - . transcript "71" Adh FGenesCGG1 CDS 532399 532709 . + . transcript "72" Adh FGenesCGG1 start_codon 532399 532401 . + . transcript "72" Adh FGenesCGG1 CDS 533739 534006 . + . transcript "72" Adh FGenesCGG1 stop_codon 534004 534006 . + . transcript "72" Adh FGenesCGG1 CDS 541380 542513 . + . transcript "73" Adh FGenesCGG1 start_codon 541380 541382 . + . transcript "73" Adh FGenesCGG1 stop_codon 542511 542513 . + . transcript "73" Adh FGenesCGG1 CDS 555360 555824 . + . transcript "74" Adh FGenesCGG1 start_codon 555360 555362 . + . transcript "74" Adh FGenesCGG1 CDS 555920 556258 . + . transcript "74" Adh FGenesCGG1 stop_codon 556256 556258 . + . transcript "74" Adh FGenesCGG1 CDS 562642 562755 . + . transcript "75" Adh FGenesCGG1 CDS 570329 570664 . + . transcript "75" Adh FGenesCGG1 CDS 570872 570947 . + . transcript "75" Adh FGenesCGG1 CDS 574289 574483 . + . transcript "75" Adh FGenesCGG1 CDS 575409 575495 . + . transcript "75" Adh FGenesCGG1 CDS 577207 577316 . + . transcript "75" Adh FGenesCGG1 CDS 581726 581877 . + . transcript "75" Adh FGenesCGG1 CDS 598403 598796 . + . transcript "76" Adh FGenesCGG1 start_codon 598403 598405 . + . transcript "76" Adh FGenesCGG1 CDS 598857 599119 . + . transcript "76" Adh FGenesCGG1 CDS 599219 600403 . + . transcript "76" Adh FGenesCGG1 CDS 601476 601487 . + . transcript "76" Adh FGenesCGG1 stop_codon 601485 601487 . + . transcript "76" Adh FGenesCGG1 CDS 601945 602354 . - . transcript "77" Adh FGenesCGG1 stop_codon 601945 601947 . - . transcript "77" Adh FGenesCGG1 CDS 602559 602889 . - . transcript "77" Adh FGenesCGG1 CDS 603886 604323 . - . transcript "77" Adh FGenesCGG1 CDS 607752 607819 . - . transcript "77" Adh FGenesCGG1 CDS 615333 615618 . - . transcript "77" Adh FGenesCGG1 CDS 616137 616184 . - . transcript "77" Adh FGenesCGG1 CDS 619451 619606 . - . transcript "77" Adh FGenesCGG1 CDS 619825 619938 . - . transcript "77" Adh FGenesCGG1 CDS 627803 627966 . - . transcript "77" Adh FGenesCGG1 CDS 628785 628852 . - . transcript "77" Adh FGenesCGG1 CDS 629799 629926 . - . transcript "77" Adh FGenesCGG1 start_codon 629924 629926 . - . transcript "77" Adh FGenesCGG1 CDS 639175 639609 . + . transcript "78" Adh FGenesCGG1 start_codon 639175 639177 . + . transcript "78" Adh FGenesCGG1 stop_codon 639607 639609 . + . transcript "78" Adh FGenesCGG1 CDS 649359 649372 . + . transcript "79" Adh FGenesCGG1 start_codon 649359 649361 . + . transcript "79" Adh FGenesCGG1 CDS 650568 651153 . + . transcript "79" Adh FGenesCGG1 CDS 651278 651478 . + . transcript "79" Adh FGenesCGG1 CDS 651583 652282 . + . transcript "79" Adh FGenesCGG1 CDS 652397 652824 . + . transcript "79" Adh FGenesCGG1 stop_codon 652822 652824 . + . transcript "79" Adh FGenesCGG1 CDS 654984 656897 . - . transcript "80" Adh FGenesCGG1 stop_codon 654984 654986 . - . transcript "80" Adh FGenesCGG1 CDS 656952 656954 . - . transcript "80" Adh FGenesCGG1 start_codon 656952 656954 . - . transcript "80" Adh FGenesCGG1 CDS 657691 658001 . - . transcript "81" Adh FGenesCGG1 stop_codon 657691 657693 . - . transcript "81" Adh FGenesCGG1 CDS 658058 658265 . - . transcript "81" Adh FGenesCGG1 CDS 658326 658463 . - . transcript "81" Adh FGenesCGG1 CDS 658526 659000 . - . transcript "81" Adh FGenesCGG1 CDS 659094 660852 . - . transcript "81" Adh FGenesCGG1 CDS 660917 661061 . - . transcript "81" Adh FGenesCGG1 CDS 661834 661866 . - . transcript "81" Adh FGenesCGG1 start_codon 661864 661866 . - . transcript "81" Adh FGenesCGG1 CDS 679874 680889 . - . transcript "82" Adh FGenesCGG1 stop_codon 679874 679876 . - . transcript "82" Adh FGenesCGG1 CDS 682600 682771 . - . transcript "82" Adh FGenesCGG1 CDS 682831 682969 . - . transcript "82" Adh FGenesCGG1 CDS 689469 689596 . - . transcript "82" Adh FGenesCGG1 CDS 689705 689746 . - . transcript "82" Adh FGenesCGG1 CDS 689811 689983 . - . transcript "82" Adh FGenesCGG1 CDS 690663 691029 . - . transcript "82" Adh FGenesCGG1 CDS 691393 691416 . - . transcript "82" Adh FGenesCGG1 start_codon 691414 691416 . - . transcript "82" Adh FGenesCGG1 CDS 687440 687521 . - . transcript "83" Adh FGenesCGG1 stop_codon 687440 687442 . - . transcript "83" Adh FGenesCGG1 CDS 689469 689746 . - . transcript "83" Adh FGenesCGG1 CDS 689811 689983 . - . transcript "83" Adh FGenesCGG1 CDS 690663 691029 . - . transcript "83" Adh FGenesCGG1 CDS 691393 691416 . - . transcript "83" Adh FGenesCGG1 start_codon 691414 691416 . - . transcript "83" Adh FGenesCGG1 CDS 749101 749175 . + . transcript "84" Adh FGenesCGG1 start_codon 749101 749103 . + . transcript "84" Adh FGenesCGG1 CDS 753465 753640 . + . transcript "84" Adh FGenesCGG1 CDS 755993 756089 . + . transcript "84" Adh FGenesCGG1 CDS 756663 756872 . + . transcript "84" Adh FGenesCGG1 stop_codon 756870 756872 . + . transcript "84" Adh FGenesCGG1 CDS 771285 771386 . + . transcript "85" Adh FGenesCGG1 CDS 772047 772295 . + . transcript "85" Adh FGenesCGG1 CDS 779692 781583 . + . transcript "85" Adh FGenesCGG1 CDS 781886 781966 . + . transcript "85" Adh FGenesCGG1 CDS 781997 782694 . + . transcript "85" Adh FGenesCGG1 CDS 801976 802914 . + . transcript "85" Adh FGenesCGG1 CDS 813291 814049 . + . transcript "85" Adh FGenesCGG1 CDS 814794 814981 . + . transcript "85" Adh FGenesCGG1 CDS 815046 815442 . + . transcript "85" Adh FGenesCGG1 CDS 815528 815648 . + . transcript "85" Adh FGenesCGG1 CDS 815697 817215 . + . transcript "85" Adh FGenesCGG1 CDS 817273 818025 . + . transcript "85" Adh FGenesCGG1 CDS 818664 819290 . + . transcript "85" Adh FGenesCGG1 CDS 820171 820789 . + . transcript "85" Adh FGenesCGG1 CDS 820846 820979 . + . transcript "85" Adh FGenesCGG1 CDS 821037 821265 . + . transcript "85" Adh FGenesCGG1 CDS 822205 822454 . + . transcript "86" Adh FGenesCGG1 start_codon 822205 822207 . + . transcript "86" Adh FGenesCGG1 CDS 822511 822848 . + . transcript "86" Adh FGenesCGG1 CDS 822907 824011 . + . transcript "86" Adh FGenesCGG1 CDS 824074 824822 . + . transcript "86" Adh FGenesCGG1 CDS 824885 825688 . + . transcript "86" Adh FGenesCGG1 CDS 825804 826423 . + . transcript "86" Adh FGenesCGG1 CDS 826499 826653 . + . transcript "86" Adh FGenesCGG1 CDS 826714 826921 . + . transcript "86" Adh FGenesCGG1 CDS 826980 827087 . + . transcript "86" Adh FGenesCGG1 CDS 827148 827511 . + . transcript "86" Adh FGenesCGG1 stop_codon 827509 827511 . + . transcript "86" Adh FGenesCGG1 CDS 832137 833672 . + . transcript "87" Adh FGenesCGG1 start_codon 832137 832139 . + . transcript "87" Adh FGenesCGG1 stop_codon 833670 833672 . + . transcript "87" Adh FGenesCGG1 CDS 834884 834897 . + . transcript "88" Adh FGenesCGG1 start_codon 834884 834886 . + . transcript "88" Adh FGenesCGG1 CDS 835043 835312 . + . transcript "88" Adh FGenesCGG1 CDS 836514 837106 . + . transcript "88" Adh FGenesCGG1 CDS 837173 837428 . + . transcript "88" Adh FGenesCGG1 CDS 837486 837859 . + . transcript "88" Adh FGenesCGG1 CDS 837919 838152 . + . transcript "88" Adh FGenesCGG1 CDS 838217 839076 . + . transcript "88" Adh FGenesCGG1 stop_codon 839074 839076 . + . transcript "88" Adh FGenesCGG1 CDS 839671 840390 . - . transcript "89" Adh FGenesCGG1 start_codon 840388 840390 . - . transcript "89" Adh FGenesCGG1 stop_codon 839671 839673 . - . transcript "89" Adh FGenesCGG1 CDS 841091 841333 . - . transcript "90" Adh FGenesCGG1 stop_codon 841091 841093 . - . transcript "90" Adh FGenesCGG1 CDS 841389 841969 . - . transcript "90" Adh FGenesCGG1 CDS 842034 842442 . - . transcript "90" Adh FGenesCGG1 start_codon 842440 842442 . - . transcript "90" Adh FGenesCGG1 CDS 842968 843375 . - . transcript "91" Adh FGenesCGG1 stop_codon 842968 842970 . - . transcript "91" Adh FGenesCGG1 CDS 843445 843518 . - . transcript "91" Adh FGenesCGG1 CDS 847272 847372 . - . transcript "91" Adh FGenesCGG1 CDS 847433 848154 . - . transcript "91" Adh FGenesCGG1 CDS 848208 848348 . - . transcript "91" Adh FGenesCGG1 start_codon 848346 848348 . - . transcript "91" Adh FGenesCGG1 CDS 845892 846081 . + . transcript "92" Adh FGenesCGG1 start_codon 845892 845894 . + . transcript "92" Adh FGenesCGG1 CDS 846134 846339 . + . transcript "92" Adh FGenesCGG1 stop_codon 846337 846339 . + . transcript "92" Adh FGenesCGG1 CDS 846397 847372 . - . transcript "93" Adh FGenesCGG1 stop_codon 846397