BDGP Resources
In-Fusion Protocol
v.08.08.05
Materials:
DpnI (20U/uL)
NEB #R0176L
10mM dNTP
NEB #N0447L
Finnzymes Phusion DNA Polymerase (2U/uL)
MJ Research #F-530L
TAM1 Competent Cells
Active Motif #11096
In-Fusion PCR Cloning Kit
BDBiosciences #631775
LB/Amp/X-Gal Plates
PCR Template
Inoculate 5uL cDNA clone from bacterial stock into 600uL LB/Antibiotic
Grow overnight @ 37C.
PCR Reaction
1:10 Cell Dilution in H2O 3.0uL
5X Phusion Buffer 4.0uL
10mM dNTP 0.4uL
5uM 5' BD Oligo 1.2uL
5uM 3' BD Oligo 1.2uL
Phusion Polymerase 0.15uL
dH2O 10.05uL
Total 20uL
98C 1 Min.
98C 10 Sec.
59C-->50C 30 Sec. 3 Cycles (Annealing temp. lowered 3C per cycle)
72C 2 Min.
98C 10 Sec.
50C 30 Sec. 13 Cycles
72C 2 Min.
72C 5 Min.
4C Forever
Analyze 5uL on 1% agarose gel.
NOTE: For PCR templates that carry the Ampicillin resistant gene, an enzymatic digestion of the template plasmid must be performed since the pDNR-Dual vector is also Ampr. This eliminates the possibility of the originating parent plasmid from being carried over. This DpnI enzymatic step is not necessary for PCR templates carrying antibiotic resistant genes other than Amp and can be skipped.
DpnI Digest
PCR Products 15uL
NEB Buffer 4.2uL
DpnI 0.5uL
dH20 2.5uL
Total 20uL
37C 2 Hours
80C 20 Mins
G50 PCR Products
1. Add 300uL dH2O to hydrate G50.
2. Let plate sit at room temp for 3 hours.
3. Place hydrated G50 plate on top of Nunc plate fitted with the blue adapter to collect water.
4. Spin 950xG for 5 minutes.
5. Discard water.
6. Add additional 150uL dH2O to G50
7. Spin 950xG for 5 minutes.
8. Discard water.
9. Place G50 plate on top of a PCR plate (E&K #489096). No adapter necessary.
10. Place assembly on PCR plate base.
11. Transfer all of the PCR products into the G50 columns, being careful to aspirate the sample into the center of each column.
12. Spin 950xG for 5 minutes to collect sample in the PCR plate.
13. Should recover ~15-20uL of sample.
BD Reaction
G50'd PCR Product ~2.0 uL (~100ng/kb)
10X Infusion Reaction Buffer 1.0uL
10X BSA 1.0uL
pDNR-Dual Linearized Vector 0.5uL
Diluted Infusion Enzyme 0.5uL (stock is 10X, dilute to 1X with dilution buffer)
dH2O 5.0uL
Total 10ul
Incubate @25C 30 Mins
(NOTE: For ORFs >3kb: incubate 37C for 15 Mins., then 50C for 15
Mins)
Add 20uL TE to BD reaction.
Store at -20C
Transformation
Thaw TAM1 cells on ice for 5 minutes
Add 1.5uL BD reaction to TAM1 cells
Tap cells gently to mix
Incubate on ice for 30 minutes
Heat shock cells at 42C for 30 seconds
Place cells back on ice for 2 minutes
Add 150uL SOC
Shake 37C at 250rpm for 40 min.
Plate all onto LB/Amp/X-Gal plates
Pick and Prep for end sequencing
Pick white colonies into 2XYT/Amp blocks
Grow overnight
Make frozen stock and spin down remainder for DNA mini-prep
Sequence 5' end with M13 forward primer: TGTAAAACGACGGCCAGT
Sequence 3' end with PDD3.1 primer: GTTTTTTATTGGTGAGAATCCAAGC
