BDGP Resources
PCR Amplification of D. melanogaster UniGene Collection
Using plasmid DNA as template (Pavel Tomancak 8.15.2000)
- 5µ of DNA template purified using Qiagen 96-well Turbo kit on a Qiagen BioRobot 9600 were diluted with 150 µ of ddH20 to achieve final concentration in a 1-10 ng/µ range.
(Both the concentrated and the diluted templates were covered with Scotch Pad sealing tape and stored at -20 C. Before use, the plates were thawed and briefly centrifuged so as to remove any water that had condensed on the sealing tape.)
-
5µ of diluted DNA template were transferred to a 96-well PCR plate (Applied Scientific #AS-2065).
-
Up to 400x PCR master mix was prepared on ice and aliquotted on top of the template DNA using a multichannel pipettor (no mixing necessary).
[PCR primers OTf and OTr (White, KP et al., Science 1999, 286(5447):2179-84) were synthetised by Operon - 1.0 mmol scale; no purification]
PCR reaction conditions for cDNAs in size categories 1 and 2:
For cDNAs in size categories 1 and 2, a 100 µ amplification reaction using standard Taq polymerase (Amersham #27-0799-03) was used.
1x PCR coctail:
10 µ 10x PCR buffer (Amersham #27-0799-03)
1.0 µ dNTP mix (20 mM each Amersham #27-2035-01)
0.5 µ pOTf (0.4 µ/µ 5' AATGCAGGTTAACCTGGCTTATCG 3')
0.5 µ pOTr (0.4 µ/µ 5' AACGCGGCTACAATTAATACATAACC 3')
0.375 µ Amersham Taq (5U/µ Amersham #27-0799-03)
82.625 µ ddH20
----------------
95.0 µ
Thermal cycling was performed on PE GeneAmp PCR system 9700 under the following conditions:
Size 1 Templates Size 2 Templates
1x 94 C 4 min. 1x 94 C 4 min.
35x 94 C 30 sec. 35x 94 C 30 sec.
57 C 30 sec. 57 C 30 sec.
72 C 4 min. 72 C 6 min.
1x 72 C 5 min. 1x 72 C 7 min.
4 C hold 4 C hold
One-twentieth of each reaction was analyzed by agarose gel electrophoresis. On average, 92 % of PCR reactions produced a satisfactory single strong PCR product. Templates that failed to amplify altogether and templates that produced weak, smeared, or multiple bands were manually re-arrayed into a new plate and amplified using Herculase polymerase.
PCR reaction conditions for cDNAs in size categories 3 and 4:
For cDNAs in size categories 3 and 4, [as well as Full Length Sequenced (FLS) clones and failed samples from size 1 and 2] a 20 µ amlification reaction using Herculase polymerase (Stratagene #600264) was performed.
1x PCR coctail:
2.0 µ 10x Herculase PCR buffer (Stratagene #600264)
0.2 µ dNTP mix (20 mM each Amersham #27-2035-01)
0.1 µ pOTf (0.4 µ/µ 5' AATGCAGGTTAACCTGGCTTATCG 3')
0.1 µ pOTr (0.4 µ/µ 5' AACGCGGCTACAATTAATACATAACC 3')
0.2 µ Herculase (5U/µ Stratagene #600264)
12.4 µ ddH20
-------------
15.0 µ
Thermal cycling was performed on PE GeneAmp PCR system 9700 under the following conditions: Size 1 & 2 re-amplification FLS & Size 3 Templates Size 4 Templates
1x 92 C 4 min. 1x 92 C 4 min. 1x 92 C 4 min.
35x 92 C 30 sec. 35x 92 C 30 sec. 35x 92 C 30 sec.
57 C 30 sec. 57 C 30 sec. 57 C 30 sec.
72 C 6 min. 72 C 7 min. 72 C 8 min.
1x 72 C 7 min. 1x 72 C 8 min. 1x 72 C 9 min.
4 C hold 4 C hold 4 C hold
Reactions were diluted with ddH20 to 50 µ One-twentieth of this dilution was analyzed by agarose gel electrophoresis. The yields of the 20 µ Herculase PCR reactions were about half that of the 100 µ Amersham Taq PCR reactions. Approximately 95% of the PCR reactions produced a satisfactory product, however the frequency of multiple bands was higher for size categories 3 and 4 than it was for size categories 1 and 2.
