Isolation of mRNA from Drosophila rough endoplasmic reticulum
Casey Kopczynski, UC-Berkeley (Goodman lab)
Current address: Exelixis Pharmaceuticals, Inc
S. San Francisco, CA 94080
650-825-2239
caseyk@exelixis.com
This protocol has been used to produce an RNA sample at least 10-fold enriched for mRNAs encoding membrane and secreted proteins versus cytosolic proteins (C. C. Kopczynski, J. N. Noordermeer, T. L. Serano, W. Chen, J. D. Pendleton, S. Lewis, C. S. Goodman, and G. R. Rubin, 1998, PNAS 95:9973-9978).
I. Isolation of rough ER RNA
1) Collect 10g (appr.) of 8 - 16 hr embryos, wash and dechorionate.
2) Place 1/2 of embryos in 40 ml Dounce homogenizer, add 35 ml ice cold homogenization
buffer.
Homogenization buffer
---------------------
40mM Tris 7.4
50mM KCl
10mM MgCl2
3mM DTT
0.5mg/ml heparin
Add 1/4 vol of 2.5M sucrose to the above -> 0.5M sucrose final
3) Homogenize on ice with B pestle then follow with A pestle. Pour into 50ml tube on
ice. Homogenize remaining embryos as above.
4) Spin homogenates in separate tubes at 8K rpm x 10' x 4° in JS 13 rotor to pellet nuclei
and mitochondria.
5) Transfer post-mitochondrial supt (PMS) to new tube on ice.
6) Reextract each pellet in 12ml homogenization buffer, spin, and add supt to PMS. Total
PMS volume at this point should be ~90ml.
Optional: Phenol/chloroform extract 2ml PMS for unfractionated RNA sample.
7) Prepare solutions for step gradient:
Step A: 10.2ml PMS + 20.4ml 2.5M sucrose (1.8M final)
Step B: 6.0ml PMS + 6.6ml 2.5M sucrose (1.55M final)
Step C: 66.0ml PMS + 46.0ml 2.5M sucrose (1.35M final)
8) Place marks on 4 - 70Ti ultracentrifuge tubes indicating 2ml from bottom, 7ml from
bottom, and 28ml from bottom. Then add, in order, 28ml Step C, 2ml Step B, and 7ml
Step A to each tube. Top off tubes with homogenization buffer to balance.
The heavier solutions (A & B) are added under the lighter Step C using a 100ul capillary hooked up
to tygon tubing - a peristaltic pump was used to obtain a slow, steady flow of liquid.
9) Spin 48K x 6 hrs x 4°C in Beckman Type 70 Ti rotor.
Polysomes bound to ER membrane ("rough microsomes"or "RMs") are less dense
than free polysomes. Thus, RMs float in Step B, while free polysomes pass thru Step B
and pellet on the bottm of the tube.
10) Using a peristaltic pump, remove Step B and the the cloudy material above it (RM
sample) to a new tube on ice (~ 6ml/ gradient).
This is a crude RM preparation that contains a large amount of contaminating free
polysomes.
11) Split RM sample into each of 2 - 50ml tubes (~12ml/tube). Slowly add 1.2ml 1M KCl
to each tube while vortexing at low speed. Then add 12ml 2.5M sucrose to each tube and
mix well (~2M sucrose final).
The increased K+ concentration should destabilize weak protein:protein interactions and
help dissociate free polysomes from membrane-bound polysomes.
12) Add 6ml RM sample to each of 8 Beckman SW41 tubes, then overlay with 3ml 1.8M
sucrose (in homogenization buffer adjusted to 150mM KCl) and 3ml 1.3M sucrose (in
homogenization buffer adjusted to 150mM KCl).
13) Spin tubes 35K x 5.5hrs x 4°C in 2 separate SW41 rotors.
14) Using a peristaltic pump, remove the cloudy material at the 1.8M/1.3M interface to a
new tube on ice (~1.6ml/ gradient). This sample (~12ml) represents the "washed" RMs.
15) To prepare RNA from washed RMs:
a) Add 24ml dH20 to sample.
b) Add 0.36ml 500mM EDTA and 3.6ml 10% SDS. If SDS precipitates, warm
sample briefly until it goes back into solution.
c) Extact sample with an equal vol of phenol/chloroform, spin to separate phases.
d) Add 1/10 vol 3M NaAc, pH 5.2 to aqueous phase and split sample into 4 -
SW28 tubes (~10ml/tube). Add 2.5 vols EtOH to each tube and place at
-20° x O/N.
e) Spin tubes 20K x 1hr x 4°C in SW28 rotor to pellet RNA.
f) Resuspend damp pellets in 0.5ml dH2O each. Combine samples and spin
briefly to pellet insoluble material.
g) Repeat EtOH pptn. Resuspend dry pellet in 1ml dH20. Expect a yield of 730ug
RM RNA per 10 grams of embryos.
II. Selection of polyA+ RNA from RM RNA
I used the Promega PolyA Select kit to purify polyA+ RNA from RM RNA. However, I
found that approx. 50% of the polyA+ RNA corresponded to a "polyA+" mitochondrial
rRNA of 1.4kb (a Drosophila anomaly). I was able to remove this contaminant from the
RM RNA by following the protocol below, then I repeated the polyA+ RNA selection on
the "mitochondrial RNA-free" RM RNA.
1) Heat 170ul (500ug) RM RNA to 65° x 10'.
2) Add 2ul (200pmol) biotinylated antisense mt rRNA oligo (5'biotin-
cctggcttacaccggtttgaactcagt) and 4.5ul 20X SSC (0.5X SSC final).
3) Place tube in 250ml beaker containing H2O at 65° and let cool to 37° over 20', then
remove and sit at RT x 10'.
4) Add annealed mix to 100ul Promega streptavidin magnetic beads (washed as per
Promega instructions).
5) Incubate RT x 10'.
6) Place tube in magnetic stand x 30sec then remove supt to new tube.
7) Repeat steps 4, 5 and 6.
8) Select polyA+ RNA from the "mitochondrial RNA-free" RM RNA using the Promega
PolyA Select kit.
I obtained 4ug of polyA+ RNA from 500ug RM RNA, which corresponds to 7g of
embryos. This is only 1//100 of the yield of polyA+ RNA I obtained from the
unfractionated RNA sample (step6). I suspect that a good portion of the rough ER
remained associated with the nuclei and thus was lost at step 4. Whatever the reason, this
small yield from a relatively large amount of tissue is worth noting when considering
whether this protocol can be adapted to other tissues of interest.
Normalization of a Drosophila cDNA library by hybridization to gDNA beads
This protocol was used to normalize the representation of mRNAs in a rough microsome
cDNA library cloned into Bluescript (C. C. Kopczynski, T. Serrano, G. R. Rubin, and C.
S. Goodman, in preparation). In brief, cDNA inserts were hybridized to genomic DNA
(gDNA) and a normalized library prepared from the cDNAs that were subsequently eluted
from the gDNA.
I. Preparation of gDNA beads
A. Digestion and size fractionation of gDNA
1) Partially digest 400ug gDNA with Sau3A and another 400ug gDNA with MaeIII to give
a maximum amount of DNA in the 1 - 4 kb size range. Phenol/chloroform extract, EtOH
ppt, and resuspend pellets in 200ul TE 7.4.
2) Load each digested gDNA sample onto separate 10-40% sucrose gradients (10.5ml
gradient in SW41 tube).
3) Spin 28K x 20hrs x 20°.
4) Puncture bottom of tube with 18g needle and collect 300ul fractions into Falcon 96 well
plate (40 fractions).
5) Run 10ul of even numbered fractions between fractions 10 and 34 on agarose gel to
determine size distribution.
6) Pool fractions that contain the most DNA beween 1 and 4kb but do not contain DNA
smaller than 500bp.
This corresponded to fractions 18, 19 and 20 on my gradients.
7) EtOH ppt pooled fractions and resuspend DNA pellet in 150ul dH2O.
I obtained ~100ug DNA from each gradient.
B. End-labeling gDNA with biotin
1) Label MaeIII and Sau3A-cut gDNA separately in the following reaction:
75.0ul 1-4 kb gDNA (~50ug or ~80 pmol ends)
10.0ul BMB restriction buffer M (100mM tris 7.8,
100mM MgCl2, 500mM NaCl, 10mM dithiothreitol)
3.3ul 0.3mM biotin-dUTP (1 nmol, ENZO Biochem)
1.0ul 32P-dCTP (3.3pmol, 3000Ci/mmol)
1.0ul 1mM dCTP
1.0ul 10mM dGTP
1.0ul 10mM dATP
2.7ul dH2O
5.0ul Klenow (10U)
-------
100.0ul
2) Incubate 37° x 1 hr.
3) Spot 1ul of reaction onto each of 2 - DEAE filter paper circles. Wash one circle 3x
with 0.5M NaH2PO4, pH 7.2, 1x with dH2O, 1x with 70% EtOH and allow to dry.
Determine percent incorporation of 32P-dCTP by comparing total cpm to cpm present on
the washed circle. A successful reaction will result in 5 - 10% incorporation, depending on
the size distribution of the DNA.
4) Spin reactions through a Millipore UFMC 100 filter according to manufacturers
instructions to remove unincorporated dNTPS (most importantly, biotin-dUTP).
C. Binding gDNA to magnetic beads
1) Mix MaeIII and Sau3A end-labeled gDNA preps (tot vol 180ul) then boil x 5'.
2) Quick cool sample in ice bath.
3) Add 45ul 5M NaCl and 220ul TE 7.4, 1M NaCl.
4) Wash 4mg Streptavidin-coated Dynabeads (Dynal) with 1ml TE 7.4, 1M NaCl in a
1.6ml Eppendorf tube .
5) Add boiled DNA to beads, rock 30' x RT.
6) Place tube in magnetic stand. Remove supernatant and save as unbound gDNA.
I lost 20% of my cpm at this step.
7) Wash beads twice with 1 ml TE 7.4, 1M NaCl.
Negligible counts lost at this step.
8) Wash with 400ul elution buffer (30% formamide, 10mM Tris 8.0) at 65° x 10'.
This step removes gDNA not bound directly to the beads - I lost 10% of the total cpm here.
9) Resuspend beads in 400ul TE 7.4, 1M NaCl, store at 4°.
II. Selection of cDNA library on gDNA beads
A. Preparation of single-stranded cDNA for hybridization to beads
1) Linearize 20ug of plasmid from the rough microsome cDNA library with a rare-cutting
enzyme that cuts at 3' end of cDNA insert. After digestion, phenol/chloroform extract,
EtOH ppt, and resuspend plasmid in dH2O.
I used NotI and SmaI (separately) for the Bluescript-based library.
2) Perform 10 separate in vitro transcription reactions as follows:
a) Prepare reaction mix
150ul dH2O
120ul 5x Promega in vitro transcription buffer (0.5M HEPES-
KOH, pH 7.5, 60mM MgCl2, 10mM spermidine,
200mM DTT)
120ul 10mM dNTPs
30ul RNase inhibitor (30U, BMB)
90ul T7 RNA polymerase (360U, BMB)
-----
510ul
b) Add 50ul reaction mix to each of 10 tubes containing 10ul (1ug) of template
DNA.
c) Incubate 37° x 2 hrs.
d) Add 40ul DNase mix:
320ul dH2O
40ul 10x DNaseI buffer (200mM Tris 8.0, 100mM MgCl2)
40ul DNaseI (1200U, RNase-free)
-----
400ul
e) Incubate 37° X 15'.
f) Combine reactions (1ml total) then phenol/chloroform extract sample.
g) Add 1/2 volume 7.5M NH4Ac and 2.5 volumes EtOH.
h) Spin 20' X 4° in 5 microfuge tubes.
i) Resuspend each pellet in 100ul dH2O and combine samples. Total yield should
be ~500ug "cRNA" (~50ug per reaction).
3) Prepare first-strand cDNA from 360ug cRNA as follows:
a) To each of 18 - 1.5ml microfuge tubes, add 20ul (20ug) cRNA, 1ul (1nmol)
Pst-T15 primer (an oligo(dT) primer with a Pst site at the 5' end), 19ul dH20.
b) Incubate 65° x 5', then quickly place tubes on ice.
c) Add 40ul cDNA reaction mix and 20ul (4000U, BRL) MMLV-RT to each tube.
cDNA reaction mix
-----------------
360ul 5X First Strand Buffer (BRL)
180ul 0.1M DTT
90ul 10mM dNTPs (2.5M 5m-dCTP*, 2.5M each dATP, dGTP, dTTP)
72ul 32P-dCTP (240pmol, 3000Ci/mmol; final spec. act. in rxn:
< 1 Ci/mmol)
36ul RNase inhibitor (36U, BMB)
-----
738ul
* Note: 5m-dCTP is used to protect Pst sites within the cDNA from digestion
during the subsequent cloning of the cDNA into Bluescript.
d) Incubate tubes at 37° X 1.5 hrs.
e) Spot 1ul of a single reaction onto each of 2 - DEAE filter paper circles.
Determine % incorporation of dNTPs as above.
I obtained 14% incorporation, which corresponds to 9 ug of cDNA
synthesized per reaction (162ug cDNA/18 rxns).
f) Pool samples (1.8ml total). Add 1/2 volume 7.5M NH4Ac and 2.5 volumes
EtOH. Split sample into 8 microfuge tubes (~1.2ml/tube) and store on
ice x 10'.
g) Spin 20' X 4° in microfuge.
h) Rinse pellets with 70% EtOH, then resuspend each pellet in 90ul dH2O.
Combine samples.
i) To 700ul sample, add 28ul 0.5M Na2EDTA and 728ul 0.2M NaOH (fresh).
j) Split sample into 4 tubes (364ul/tube), then heat 65° x 15' to hydrolyze RNA.
k) Place samples on ice. Add 1/2 volume 7.5M NH4Ac and 2.5 volumes
EtOH to each tube and store on ice x 10'.
l) Spin 20' X 4° in microfuge.
m) Rinse pellets with 70% EtOH, then resuspend each pellet in 30ul dH2O.
Combine cDNA samples and store at -20°.
n) Run 1ul (~1ug) on a mini formaldehyde gel to check yield and length relative to
cRNA template.
B. Selection of single-stranded cDNA on gDNA beads
1) Wash beads in 500ul 0.1N NaOH for 5', then resuspend in 500ul wash buffer A
(50mM Na2HPO4, pH 7.2, 0.1% SDS).
All steps were carried out in a 1.5ml Eppendorf tube.
2) Remove wash then add 500ul hybridization mix (preheated to 65°).
Hybridization mix
-----------------
130ul cDNA (120ug)
33ul "free polysome" polyA+ RNA*
200ul 0.5M NaHPO4, pH 7.2
4ul 10% SDS
4ul 0.5M Na2EDTA
29ul dH2O
100ul 50% Dextran Sulfate (Pharmacia)
-----
500ul
3) Rock tube at 65°C x 16hrs.
4) Pull beads to side of tube and remove supernatant.
5) Wash beads briefly at room temperature in 500ul wash buffer B (25mM Na2HPO4, pH
7.2, 0.1% SDS).
6) Wash beads four times at 65° in wash buffer B.
7) Resuspend beads in 100ul elution buffer (0.1N NaOH). Incubate at room
temperature x 10' to elute cDNA.
8) Remove elution buffer to new tube then repeat step 7.
9) Combine eluates (200ul total) and heat 65° x 15' to hydrolyze any RNA in sample.
10) Place tube on ice. Add 1/2 volume 7.5M NH4Ac and 2.5 volumes
EtOH to each tube and store on ice x 10'.
11) Spin 20' X 4° in microfuge.
12) Rinse pellet with 70% EtOH, then resuspend pellet in 50ul dH2O.
13) Count 1ul of sample in scintillation counter to determine yield.
I obtained 580ng cDNA from the gDNA beads (0.5% of the total cDNA present in
the hybridization mix).
* Note: "Free polysomes" are those in the cell that are not bound to the rough endoplasmic
reticulum and thus are not translating membrane or secreted proteins. Free polysome RNA
was added to the hyb mix as a competitor to prevent cDNAs representing non-membrane
proteins from binding to the gDNA. This helped keep the library biased for cDNAs
encoding membrane and secreted proteins.
III. Preparation of the cDNA library
A. Second strand synthesis
1) Combine:
46ul eluted cDNA (580ng, ~2pmol)
2ul Bluescript KS primer (KS complementary sequence is present at the
5' ends of all cDNA inserts)
6ul 10X Klenow buffer (0.5M NaCl, 0.1M Tris, 7.4, 0.1M MgCl2)
2) Heat 65° x 2', slow cool to 30° over 30'.
3) Add:
1.0ul 6mM dNTPs
3.0ul 0.1M DTT
1.2ul 32P-dATP (4pmol, 3000Ci/mmol)
5.0ul Klenow (30U, Pharmacia)
4) Incubate 15°C x 5hrs.
5) Incubate at room temperature x 30'.
6) Add:
1ul 1mM ATP
1ul polynucleotide kinase (10U)
7) Incubate 37° x 15'.
8) Add an equal volume (60ul) phenol/chloroform, vortex, spin 5'.
9) Remove aqueous phase to new tube. Reextract organic phase with 60ul TE 7.4.
10) Combine aqueous phases, add 1/2 volume 7.5M NH4Ac and 2.5 volumes
EtOH and store on ice x 10'.
11) Spin 20' X 4° in microfuge.
12) Rinse pellet with 70% EtOH, then dry pellet and resuspend in 33ul dH2O.
B. Repair of cDNA ends
1) Combine:
33.00ul cDNA sample
1.25ul 10mM dNTPs
5.00ul 8X repair buffer (265mM Tris-acetate, 7.8, 535mM KAc, 80mM
MgAc, 4mM DTT, 640ug/ml BSA)
1.30ul T4 DNA polymerase (4U)
-------
40.50ul
2) Incubate 37° x 45'.
3) Add 40ul dH2O, then phenol/chloroform extract as above.
4) Combine aqueous phases, add 1/2 volume 7.5M NH4Ac and 2.5 volumes
EtOH and store on ice x 10'.
5) Spin 20' X 4° in microfuge.
6) Rinse pellet with 70% EtOH, then dry pellet and resuspend in 50ul dH2O.
C. Linker ligation
1) Combine:
25ul cDNA (~330ng by cpm)
4ul 10X ligation buffer (NEB)
1ul 20mM ATP
6ul annealed HindIII/XmnI adaptor (NEB)
4ul T4 ligase (4U, BMB)
----
40ul
2) Incubate 16°C x 8hrs.
3) Heat 65° x 10'.
4) Add 10ul 0.5M NaCl, 50ul 1X BMB restriction buffer H, and 1.5ul Pst (15U).
The Pst digestion will cut at the Pst site downstream of the oligo dT tail but
will not cut at internal sites since the cDNA was synthesized with 5m-
dCTP.
5) Incubate 37° x 1hr.
6) Add 40ul dH2O, then phenol/chloroform extract as above.
7) Combine aqueous phases, add 1/10 volume 3M NaAc and 2.5 volumes
EtOH and store on ice x 10'.
5) Spin 20' X 4° in microfuge.
6) Rinse pellet with 70% EtOH, then resuspend in 50ul dH2O.
D. Cloning the cDNA into Bluescript
1) Size select cDNA (~300ng) as described in Molecular Cloning, eds. Fritsch et al.
2) Ligate size-selected cDNA into Bluescript as follows:
a) Combine:
10.0ul cDNA (~100ng)
2.0ul Pst/HindIII-digested Bluescript SK+ (~100ng)
1.4ul BMB ligase buffer
1.0ul BMB ligase (1U)
------
14.4ul
b) Incubate 16° x 8hrs.
c) Transform 2 - 100ul aliquots of Stratagene XL1 Blue MRF' competent
cells (1 x 109 cfu/ug) each with 5ul ligation mix.
d) Plate each transformation onto 5 LB-amp plates.
I obtained 88,000 colonies total, ~50% of which were dark blue and
thus probably lacked an insert. I pooled the colonies to produce a
library with ~44,000 independent clones.
This page last updated on: 12/2/03