BDGP Resources

PCR Amplification of cDNAs fromBacterial Cultures: DGC/pOT2


Monica Moore Lab, UCSF Ernest Gallo Research Center

For Drosophila DGC set in pOT2 vector using Bacterial template:

  1. transfer 5ul bacterial culture to a PCR plate.

  2. Mix and aliquot the following cocktail:

5ul Bacterial template
2.5ul DNTP mix (10mM each, Perkin Elmer)
10ul MgCl2, 25mM (Perkin Elmer)
10ul 10x PCR buffer
0.30ul Amplitaq gold enzyme (5U/ul, Perkin Elmer)
0.025 Pfu Turbo DNA polymerase
0.05ul Primer 1 500pmol/ul
0.05ul Primer 2 500pmol/ul
72.075 DdH2O
100ul Total
  1. Spin the plate briefly to remove any air bubbles. Use an MJ thermocycler for the following cycle conditions:

          95C 10min.  Denaturation 
          95C 45sec.  Melting 
          64C 45sec.  Annealing 
          72C 7min.   Extension 
          72C 8min.   Final Extension 
          4C  forever
        
    

Cycle 35 times. Slow cool from final extension at 72C to final hold at 4C at a ramping rate of 0.1C/sec.

    Vector  Primer Name     Sequence

    POT2a   OTf             AATGCAGGTTAACCTGGCTTATCG
    POT2a   OTr             AACGCGGCTACAATTAATACATAACC
    pBS     ESTf            GAAACAGCTATGACCATGATTACGCC
    pBS     ESTr            CGGCCAGTGAATTGTAATACGACTC
    

Order oligos from Operon at a 1umol scale, HPLC purified and shipped lyophilized rev. 8.23.00