BDGP Resources

pOTB7 Vector

(Vector diagram drawn using PlasMapper).

The pOTB7 plasmid began with the pOT2A backbone. A 204bp fragment was designed to facilitate the use of the Gateway expression system from Life Technologies. Specifically:
An attB1 site is between the BamHI and M13 forward sites. An attB2 site is between BglII and M13 reverse sites.
The basic layout of the insert is shown above. The 204bp insert was ligated into the existing XhoI and EcoRI sites within the pOT2A vector. The XhoI site was destroyed and the EcoRI has been changed to a BglII site. The HindIII site in pOT2A was replaced by a NotI site. It is important to note that the EcoRI and XhoI sites are reversed with regard to the Sp6 and T7 sequencing primers compared to the pOT2A vector.

We sequence the 5' ESTs using the M13 Forward primer and the 3' ESTs using the M13 Reverse primer.

M13 forward (-21) 18-mer
TGTAA AACGA CGGCC AGT

M13 reverse 17-mer
CAGGA AACAG CTATG AC

>pOTB7, 1815 bases, 2153 checksum.
CGTTAGAACGCGGCTACAATTAATACATAACCTTATGTATCATACACATA
CGATTTAGGTGACACTATAGAACTCGAAGGATCCACAAGTTTGTACAAAA
AAGCAGGCTTGTAAAACGACGGCCAGTAACTATAACGGTCCTAAGGTAGC
GAGGCCTGGGTGGCGAATTCCCTTACTAGTTTCCCTCGAGGCATCTATGT
CGGGTGCGGAGAAAGAGGTAATGAAATGGCACATGGTCATAGCTGTTTCC
TGACCCAGCTTTCTTGTACAAAGTGGTAGATCTGCCGGTCTCCCTATAGT
GAGTCGTATTAATTTCGATAAGCCAGGTTAACCTGCATTAATGAATCGGC
TGCAGTACCCGGGAATTTAACCCGCCTAATGAGCGGGCTTTTTTTTGTGA
TCCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTT
GCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAG
AGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATA
CCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAA
CTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGG
CTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGA
TAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCAC
ACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGC
GTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGG
TATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCC
AGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCT
GACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGG
AAAAACGCCAGCAACGCGGATCACAACAAAAAGCCCGCTCATTAGGCGGG
CTAAATTCTCATGTTTGACAGCTTATCATCGATAAGCTAGCGGCCGCTAG
CTTTAATGAGTTATCGAGATTTTCAGGAGCTAAGGAAGCTAAAATGGAGA
AAAAAATCACTGGATATACCACCGTTGATATATCCCAATGGCATCGTAAA
GAACATTTTGAGGCATTTCAGTCAGTTGCTCAATGTACCTATAACCAGAC
CGTTCAGCTGGATATTACGGCCTTTTTAAAGACCGTAAAGAAAAATAAGC
ACAAGTTTTATCCGGCCTTTATTCACATTCTTGCCCGCCTGATGAATGCT
CATCCGGAGTTCCGTATGGCAATGAAAGACGGTGAGCTGGTGATATGGGA
TAGTGTTCACCCTTGTTACACCGTTTTCCATGAGCAAACTGAAACGTTTT
CATCGCTCTGGAGTGAATACCACGACGATTTCCGGCAGTTTCTACACATA
TATTCGCAAGATGTGGCGTGTTACGGTGAAAACCTGGCCTATTTCCCTAA
AGGGTTTATTGAGAATATGTTTTTCGTCTCAGCCAATCCCTGGGTGAGTT
TCACCAGTTTTGATTTAAACGTGGCCAATATGGACAACTTCTTCGCCCCC
GTTTTCACCATGGGCAAATATTATACGCAAGGCGACAAGGTGCTGATGCC
GCTGGCGATTCAGGTTCATCATGCCGTTTGTGATGGCTTCCATGTCGGCA
GAATGCTTAATGAATTACAACAGTACTGCGATGAGTGGCAGGGCGGGGCG
TAATTGGTACGTCGA