## gff-version 2
## source-version tandem repeats finder (TRF) 2.02
## source-parameters  2 7 7 80 10 50 500
## conversion-program trf2gff.pl 1.00
## date Wed Jul  7 11:31:28 1999
## DNA Adh
Adh	TRF	tandem_repeat	1423	1474	68	.	.	Period_size 9;   Copy Number 5.8;   Match_percent 83;   Indel_percent 0   Consensus_size 9;   Consensus GGTGGTGTC
Adh	TRF	tandem_repeat	10493	10542	84	.	.	Period_size 23;   Copy Number 2.1;   Match_percent 92;   Indel_percent 3   Consensus_size 24;   Consensus TTGGGTTAACATGGGTCAAACACT
Adh	TRF	tandem_repeat	11266	11311	53	.	.	Period_size 14;   Copy Number 3.4;   Match_percent 75;   Indel_percent 22   Consensus_size 14;   Consensus TGCATTTCGCATTT
Adh	TRF	tandem_repeat	28336	28360	50	.	.	Period_size 2;   Copy Number 12.5;   Match_percent 100;   Indel_percent 0   Consensus_size 2;   Consensus TA
Adh	TRF	tandem_repeat	29335	29366	55	.	.	Period_size 15;   Copy Number 2.1;   Match_percent 94;   Indel_percent 0   Consensus_size 15;   Consensus GCTGTGGACGTGGGT
Adh	TRF	tandem_repeat	54212	54236	50	.	.	Period_size 13;   Copy Number 1.9;   Match_percent 100;   Indel_percent 0   Consensus_size 13;   Consensus CAATTGCAATTTG
Adh	TRF	tandem_repeat	66331	66365	61	.	.	Period_size 16;   Copy Number 2.2;   Match_percent 94;   Indel_percent 0   Consensus_size 16;   Consensus CTGAATGGCTGAATGG
Adh	TRF	tandem_repeat	74562	74596	70	.	.	Period_size 3;   Copy Number 11.7;   Match_percent 100;   Indel_percent 0   Consensus_size 3;   Consensus AAT
Adh	TRF	tandem_repeat	82238	82267	51	.	.	Period_size 6;   Copy Number 4.8;   Match_percent 95;   Indel_percent 4   Consensus_size 6;   Consensus TATGTA
Adh	TRF	tandem_repeat	92979	93003	50	.	.	Period_size 1;   Copy Number 25.0;   Match_percent 100;   Indel_percent 0   Consensus_size 1;   Consensus T
Adh	TRF	tandem_repeat	109140	109194	76	.	.	Period_size 5;   Copy Number 10.8;   Match_percent 86;   Indel_percent 11   Consensus_size 5;   Consensus TATAT
Adh	TRF	tandem_repeat	131094	131166	56	.	.	Period_size 3;   Copy Number 24.3;   Match_percent 75;   Indel_percent 0   Consensus_size 3;   Consensus AGC
Adh	TRF	tandem_repeat	135644	135675	55	.	.	Period_size 12;   Copy Number 2.7;   Match_percent 90;   Indel_percent 0   Consensus_size 12;   Consensus TTAAATTATGTA
Adh	TRF	tandem_repeat	172331	172382	59	.	.	Period_size 18;   Copy Number 2.8;   Match_percent 76;   Indel_percent 2   Consensus_size 18;   Consensus CATTGCCACTGCCACTGA
Adh	TRF	tandem_repeat	177054	177078	50	.	.	Period_size 10;   Copy Number 2.5;   Match_percent 100;   Indel_percent 0   Consensus_size 10;   Consensus CGGTTGTTGT
Adh	TRF	tandem_repeat	178716	178746	53	.	.	Period_size 15;   Copy Number 2.1;   Match_percent 93;   Indel_percent 0   Consensus_size 15;   Consensus TTTCGTTCCATTTCG
Adh	TRF	tandem_repeat	189135	189186	59	.	.	Period_size 19;   Copy Number 2.6;   Match_percent 81;   Indel_percent 6   Consensus_size 19;   Consensus AAAGGAGCGAAAGGAGCGA
Adh	TRF	tandem_repeat	200058	200084	54	.	.	Period_size 3;   Copy Number 9.0;   Match_percent 100;   Indel_percent 0   Consensus_size 3;   Consensus ACA
Adh	TRF	tandem_repeat	234430	234470	55	.	.	Period_size 6;   Copy Number 6.8;   Match_percent 91;   Indel_percent 0   Consensus_size 6;   Consensus ATTCAC
Adh	TRF	tandem_repeat	236713	236751	71	.	.	Period_size 18;   Copy Number 2.1;   Match_percent 95;   Indel_percent 4   Consensus_size 19;   Consensus TGGCGCATGATGGGAATGA
Adh	TRF	tandem_repeat	240427	240452	52	.	.	Period_size 12;   Copy Number 2.2;   Match_percent 100;   Indel_percent 0   Consensus_size 12;   Consensus TCGGTCCCGTAG
Adh	TRF	tandem_repeat	254268	254303	54	.	.	Period_size 10;   Copy Number 3.6;   Match_percent 84;   Indel_percent 0   Consensus_size 10;   Consensus GAGTTGAGTT
Adh	TRF	tandem_repeat	254268	254303	54	.	.	Period_size 15;   Copy Number 2.4;   Match_percent 90;   Indel_percent 0   Consensus_size 15;   Consensus GAGTTGAGCTCAGTT
Adh	TRF	tandem_repeat	271285	271309	50	.	.	Period_size 3;   Copy Number 8.3;   Match_percent 100;   Indel_percent 0   Consensus_size 3;   Consensus CTG
Adh	TRF	tandem_repeat	293134	293180	67	.	.	Period_size 2;   Copy Number 23.5;   Match_percent 86;   Indel_percent 0   Consensus_size 2;   Consensus TA
Adh	TRF	tandem_repeat	354397	354431	61	.	.	Period_size 18;   Copy Number 1.9;   Match_percent 94;   Indel_percent 0   Consensus_size 18;   Consensus AGGGTTTGATTTAGGGAC
Adh	TRF	tandem_repeat	354831	354922	94	.	.	Period_size 12;   Copy Number 7.7;   Match_percent 83;   Indel_percent 0   Consensus_size 12;   Consensus TGTTGCTGCTGC
Adh	TRF	tandem_repeat	354837	354922	82	.	.	Period_size 3;   Copy Number 28.7;   Match_percent 80;   Indel_percent 0   Consensus_size 3;   Consensus TGC
Adh	TRF	tandem_repeat	355065	355258	345	.	.	Period_size 99;   Copy Number 2.0;   Match_percent 94;   Indel_percent 2   Consensus_size 99;   Consensus ATTTATGCTCTTATGGCATATACACTGCACTCTATTTATGAGCTGATTTAATGCTATTAGAGCATTTATAAGGCACTTTTGTCAGGCACTTTTTATTTA
Adh	TRF	tandem_repeat	367195	367226	55	.	.	Period_size 5;   Copy Number 6.4;   Match_percent 92;   Indel_percent 0   Consensus_size 5;   Consensus TTCAG
Adh	TRF	tandem_repeat	368001	368026	52	.	.	Period_size 6;   Copy Number 4.3;   Match_percent 100;   Indel_percent 0   Consensus_size 6;   Consensus ATACAG
Adh	TRF	tandem_repeat	368110	368168	82	.	.	Period_size 6;   Copy Number 9.8;   Match_percent 84;   Indel_percent 0   Consensus_size 6;   Consensus ACAGAT
Adh	TRF	tandem_repeat	386164	386197	59	.	.	Period_size 7;   Copy Number 4.9;   Match_percent 96;   Indel_percent 0   Consensus_size 7;   Consensus AAATGCG
Adh	TRF	tandem_repeat	407404	407442	62	.	.	Period_size 7;   Copy Number 5.7;   Match_percent 90;   Indel_percent 6   Consensus_size 7;   Consensus AATAATA
Adh	TRF	tandem_repeat	407402	407451	66	.	.	Period_size 10;   Copy Number 4.8;   Match_percent 83;   Indel_percent 16   Consensus_size 10;   Consensus ATAATAATAA
Adh	TRF	tandem_repeat	415973	416034	88	.	.	Period_size 24;   Copy Number 2.6;   Match_percent 89;   Indel_percent 0   Consensus_size 24;   Consensus GGCACTGGTTTGTCCACATAGTGG
Adh	TRF	tandem_repeat	425533	425570	51	.	.	Period_size 12;   Copy Number 3.1;   Match_percent 88;   Indel_percent 11   Consensus_size 12;   Consensus ATATTATTATTA
Adh	TRF	tandem_repeat	426019	426074	57	.	.	Period_size 2;   Copy Number 30.0;   Match_percent 75;   Indel_percent 13   Consensus_size 2;   Consensus AT
Adh	TRF	tandem_repeat	426015	426074	93	.	.	Period_size 15;   Copy Number 4.0;   Match_percent 88;   Indel_percent 0   Consensus_size 15;   Consensus ATAAATATATAATAT
Adh	TRF	tandem_repeat	426757	426809	61	.	.	Period_size 15;   Copy Number 3.5;   Match_percent 84;   Indel_percent 2   Consensus_size 15;   Consensus GGAGGAGCCGCCGTA
Adh	TRF	tandem_repeat	426810	426853	70	.	.	Period_size 15;   Copy Number 2.9;   Match_percent 89;   Indel_percent 0   Consensus_size 15;   Consensus ATTCCGTGTCCGGAA
Adh	TRF	tandem_repeat	439526	439577	68	.	.	Period_size 27;   Copy Number 1.9;   Match_percent 84;   Indel_percent 0   Consensus_size 27;   Consensus GCGGGACCACTGTGGCCAACGGCGATC
Adh	TRF	tandem_repeat	446338	446371	52	.	.	Period_size 18;   Copy Number 1.9;   Match_percent 88;   Indel_percent 5   Consensus_size 18;   Consensus GCAGCACAATTACAGGCC
Adh	TRF	tandem_repeat	476603	476632	51	.	.	Period_size 2;   Copy Number 15.0;   Match_percent 92;   Indel_percent 0   Consensus_size 2;   Consensus TA
Adh	TRF	tandem_repeat	495027	495079	61	.	.	Period_size 3;   Copy Number 17.7;   Match_percent 84;   Indel_percent 0   Consensus_size 3;   Consensus CAG
Adh	TRF	tandem_repeat	507896	507921	52	.	.	Period_size 4;   Copy Number 6.5;   Match_percent 100;   Indel_percent 0   Consensus_size 4;   Consensus TCCA
Adh	TRF	tandem_repeat	515824	515862	60	.	.	Period_size 2;   Copy Number 19.0;   Match_percent 89;   Indel_percent 5   Consensus_size 2;   Consensus GT
Adh	TRF	tandem_repeat	530227	530254	56	.	.	Period_size 7;   Copy Number 4.0;   Match_percent 100;   Indel_percent 0   Consensus_size 7;   Consensus GAGCATC
Adh	TRF	tandem_repeat	531726	531752	54	.	.	Period_size 7;   Copy Number 3.9;   Match_percent 100;   Indel_percent 0   Consensus_size 7;   Consensus ACTGGAT
Adh	TRF	tandem_repeat	542734	542764	62	.	.	Period_size 16;   Copy Number 1.9;   Match_percent 100;   Indel_percent 0   Consensus_size 16;   Consensus ATTCAATGGTGTTCTA
Adh	TRF	tandem_repeat	543934	543964	53	.	.	Period_size 2;   Copy Number 15.5;   Match_percent 93;   Indel_percent 0   Consensus_size 2;   Consensus TG
Adh	TRF	tandem_repeat	556247	556298	59	.	.	Period_size 3;   Copy Number 17.3;   Match_percent 79;   Indel_percent 0   Consensus_size 3;   Consensus AGC
Adh	TRF	tandem_repeat	581128	581171	54	.	.	Period_size 6;   Copy Number 7.2;   Match_percent 82;   Indel_percent 12   Consensus_size 6;   Consensus CTGTAT
Adh	TRF	tandem_repeat	591168	591192	50	.	.	Period_size 2;   Copy Number 12.5;   Match_percent 100;   Indel_percent 0   Consensus_size 2;   Consensus CA
Adh	TRF	tandem_repeat	599702	599739	51	.	.	Period_size 12;   Copy Number 3.2;   Match_percent 81;   Indel_percent 11   Consensus_size 12;   Consensus TCCCAATCTCAG
Adh	TRF	tandem_repeat	599717	599766	55	.	.	Period_size 12;   Copy Number 4.2;   Match_percent 81;   Indel_percent 0   Consensus_size 12;   Consensus CAATCCCAGTCA
Adh	TRF	tandem_repeat	609695	609731	56	.	.	Period_size 2;   Copy Number 18.5;   Match_percent 88;   Indel_percent 0   Consensus_size 2;   Consensus CA
Adh	TRF	tandem_repeat	627015	627040	52	.	.	Period_size 5;   Copy Number 5.2;   Match_percent 100;   Indel_percent 0   Consensus_size 5;   Consensus CCAAC
Adh	TRF	tandem_repeat	630658	630694	51	.	.	Period_size 5;   Copy Number 7.8;   Match_percent 82;   Indel_percent 11   Consensus_size 5;   Consensus ATTAC
Adh	TRF	tandem_repeat	633557	633599	50	.	.	Period_size 3;   Copy Number 14.3;   Match_percent 82;   Indel_percent 0   Consensus_size 3;   Consensus TGC
Adh	TRF	tandem_repeat	649044	649070	54	.	.	Period_size 2;   Copy Number 13.5;   Match_percent 100;   Indel_percent 0   Consensus_size 2;   Consensus TG
Adh	TRF	tandem_repeat	652588	652639	59	.	.	Period_size 9;   Copy Number 5.8;   Match_percent 83;   Indel_percent 0   Consensus_size 9;   Consensus CAGCAACAA
Adh	TRF	tandem_repeat	652585	652637	79	.	.	Period_size 12;   Copy Number 4.2;   Match_percent 86;   Indel_percent 13   Consensus_size 12;   Consensus CAGCAGCAACAA
Adh	TRF	tandem_repeat	654840	654881	84	.	.	Period_size 17;   Copy Number 2.5;   Match_percent 100;   Indel_percent 0   Consensus_size 17;   Consensus CATTCCATGCTCAAAAT
Adh	TRF	tandem_repeat	655124	655173	66	.	.	Period_size 21;   Copy Number 2.4;   Match_percent 83;   Indel_percent 6   Consensus_size 21;   Consensus GTGGAGGTGGAAGCGGGAAGC
Adh	TRF	tandem_repeat	655735	656675	1634	.	.	Period_size 225;   Copy Number 4.2;   Match_percent 95;   Indel_percent 0   Consensus_size 225;   Consensus GTTATTCCTTCTGTCGTTGTGGGTGCATTTGTGGTGGTCGGTATATTATCAGTGGTAGTAGGAGCAGGTGTGGTTGTTTTCAAGTCTTCAGCTGTTGTAGGAGATGCTGCAGTGGTCGTGATGTCCCTCGTAGTTGTGGAATCAGAGATGGATGTCGTAGTCGTCGTACTTACCAAACATATTGGTAAGTACGGAAAATCTTTACACTGAATTGAGTCCGTTGTA
Adh	TRF	tandem_repeat	669576	669614	60	.	.	Period_size 3;   Copy Number 13.0;   Match_percent 88;   Indel_percent 0   Consensus_size 3;   Consensus GCA
Adh	TRF	tandem_repeat	669816	669847	50	.	.	Period_size 12;   Copy Number 2.6;   Match_percent 85;   Indel_percent 14   Consensus_size 13;   Consensus GCTATTGCCTATT
Adh	TRF	tandem_repeat	704056	704087	55	.	.	Period_size 5;   Copy Number 6.4;   Match_percent 92;   Indel_percent 0   Consensus_size 5;   Consensus TCCAC
Adh	TRF	tandem_repeat	710193	710220	56	.	.	Period_size 3;   Copy Number 9.3;   Match_percent 100;   Indel_percent 0   Consensus_size 3;   Consensus TAT
Adh	TRF	tandem_repeat	711816	711859	61	.	.	Period_size 6;   Copy Number 7.3;   Match_percent 84;   Indel_percent 0   Consensus_size 6;   Consensus TTGTCG
Adh	TRF	tandem_repeat	720535	720575	55	.	.	Period_size 1;   Copy Number 41.0;   Match_percent 90;   Indel_percent 0   Consensus_size 1;   Consensus T
Adh	TRF	tandem_repeat	735327	735355	51	.	.	Period_size 14;   Copy Number 2.0;   Match_percent 93;   Indel_percent 6   Consensus_size 15;   Consensus CGATCGGACGATGGA
Adh	TRF	tandem_repeat	745219	745251	50	.	.	Period_size 16;   Copy Number 2.1;   Match_percent 88;   Indel_percent 11   Consensus_size 16;   Consensus TTTGTAATATTAATAT
Adh	TRF	tandem_repeat	758073	758098	52	.	.	Period_size 1;   Copy Number 26.0;   Match_percent 100;   Indel_percent 0   Consensus_size 1;   Consensus T
Adh	TRF	tandem_repeat	766754	766782	51	.	.	Period_size 14;   Copy Number 2.0;   Match_percent 93;   Indel_percent 6   Consensus_size 15;   Consensus CTTAATTAATGAGCT
Adh	TRF	tandem_repeat	767649	767684	54	.	.	Period_size 8;   Copy Number 4.5;   Match_percent 89;   Indel_percent 0   Consensus_size 8;   Consensus GGATGGTT
Adh	TRF	tandem_repeat	772182	772212	62	.	.	Period_size 6;   Copy Number 5.2;   Match_percent 100;   Indel_percent 0   Consensus_size 6;   Consensus TCGGGA
Adh	TRF	tandem_repeat	773325	773349	50	.	.	Period_size 6;   Copy Number 4.2;   Match_percent 100;   Indel_percent 0   Consensus_size 6;   Consensus AAAGGC
Adh	TRF	tandem_repeat	828833	828882	55	.	.	Period_size 2;   Copy Number 25.0;   Match_percent 79;   Indel_percent 0   Consensus_size 2;   Consensus AC
Adh	TRF	tandem_repeat	833863	833890	56	.	.	Period_size 13;   Copy Number 2.2;   Match_percent 100;   Indel_percent 0   Consensus_size 13;   Consensus ATTCAAATTGAAA
Adh	TRF	tandem_repeat	836531	836555	50	.	.	Period_size 12;   Copy Number 2.1;   Match_percent 100;   Indel_percent 0   Consensus_size 12;   Consensus GCGATCCGGATG
Adh	TRF	tandem_repeat	858058	858090	57	.	.	Period_size 12;   Copy Number 2.7;   Match_percent 95;   Indel_percent 4   Consensus_size 12;   Consensus TTTTTTTTTAAC
Adh	TRF	tandem_repeat	870704	870846	214	.	.	Period_size 9;   Copy Number 15.9;   Match_percent 89;   Indel_percent 0   Consensus_size 9;   Consensus TGTCCGTAA
Adh	TRF	tandem_repeat	875703	875746	79	.	.	Period_size 18;   Copy Number 2.4;   Match_percent 96;   Indel_percent 0   Consensus_size 18;   Consensus TGGTATTGCCAATGGTAT
Adh	TRF	tandem_repeat	877842	877877	63	.	.	Period_size 6;   Copy Number 6.0;   Match_percent 93;   Indel_percent 0   Consensus_size 6;   Consensus TGCAGT
Adh	TRF	tandem_repeat	879111	879147	65	.	.	Period_size 2;   Copy Number 18.5;   Match_percent 94;   Indel_percent 0   Consensus_size 2;   Consensus CT
Adh	TRF	tandem_repeat	883243	883272	51	.	.	Period_size 7;   Copy Number 4.3;   Match_percent 91;   Indel_percent 0   Consensus_size 7;   Consensus GCGGAGG
Adh	TRF	tandem_repeat	883468	883497	60	.	.	Period_size 12;   Copy Number 2.5;   Match_percent 100;   Indel_percent 0   Consensus_size 12;   Consensus TGTGTGCGAGTG
Adh	TRF	tandem_repeat	892148	892187	62	.	.	Period_size 6;   Copy Number 6.7;   Match_percent 88;   Indel_percent 0   Consensus_size 6;   Consensus TTGCTG
Adh	TRF	tandem_repeat	899819	899845	54	.	.	Period_size 5;   Copy Number 5.4;   Match_percent 100;   Indel_percent 0   Consensus_size 5;   Consensus CCAAA
Adh	TRF	tandem_repeat	936152	936184	57	.	.	Period_size 4;   Copy Number 8.2;   Match_percent 93;   Indel_percent 0   Consensus_size 4;   Consensus TATG
Adh	TRF	tandem_repeat	949082	949115	59	.	.	Period_size 4;   Copy Number 8.5;   Match_percent 93;   Indel_percent 0   Consensus_size 4;   Consensus TGGA
Adh	TRF	tandem_repeat	959936	959960	50	.	.	Period_size 1;   Copy Number 25.0;   Match_percent 100;   Indel_percent 0   Consensus_size 1;   Consensus T
Adh	TRF	tandem_repeat	972869	972904	56	.	.	Period_size 14;   Copy Number 2.5;   Match_percent 86;   Indel_percent 4   Consensus_size 15;   Consensus GACCAGTGACCGGTG
Adh	TRF	tandem_repeat	976963	976987	50	.	.	Period_size 10;   Copy Number 2.5;   Match_percent 100;   Indel_percent 0   Consensus_size 10;   Consensus GATGCGATGA
Adh	TRF	tandem_repeat	993381	993447	61	.	.	Period_size 6;   Copy Number 11.7;   Match_percent 74;   Indel_percent 15   Consensus_size 6;   Consensus AGCAAA
Adh	TRF	tandem_repeat	993387	993447	97	.	.	Period_size 17;   Copy Number 3.6;   Match_percent 91;   Indel_percent 4   Consensus_size 17;   Consensus AGCAAAAGCAACAGAAA
Adh	TRF	tandem_repeat	1004719	1004761	50	.	.	Period_size 9;   Copy Number 4.8;   Match_percent 82;   Indel_percent 0   Consensus_size 9;   Consensus CAGCAACAA
Adh	TRF	tandem_repeat	1004895	1004943	62	.	.	Period_size 3;   Copy Number 16.3;   Match_percent 82;   Indel_percent 0   Consensus_size 3;   Consensus CAG
Adh	TRF	tandem_repeat	1008095	1008119	50	.	.	Period_size 13;   Copy Number 1.9;   Match_percent 100;   Indel_percent 0   Consensus_size 13;   Consensus GAGTAGTAGGTCC
Adh	TRF	tandem_repeat	1016065	1016097	57	.	.	Period_size 15;   Copy Number 2.3;   Match_percent 94;   Indel_percent 5   Consensus_size 14;   Consensus AAAAATTGTAAGTA
Adh	TRF	tandem_repeat	1021305	1021365	70	.	.	Period_size 8;   Copy Number 7.6;   Match_percent 81;   Indel_percent 7   Consensus_size 8;   Consensus ACTGAGTG
Adh	TRF	tandem_repeat	1021305	1021365	86	.	.	Period_size 16;   Copy Number 3.8;   Match_percent 88;   Indel_percent 0   Consensus_size 16;   Consensus ACTGAATGACTGAGTG
Adh	TRF	tandem_repeat	1021305	1021365	52	.	.	Period_size 4;   Copy Number 15.2;   Match_percent 76;   Indel_percent 6   Consensus_size 4;   Consensus ACTG
Adh	TRF	tandem_repeat	1022268	1022312	63	.	.	Period_size 20;   Copy Number 2.2;   Match_percent 88;   Indel_percent 0   Consensus_size 20;   Consensus TGACTAACCCACCAACTGAC
Adh	TRF	tandem_repeat	1036671	1036700	51	.	.	Period_size 7;   Copy Number 4.3;   Match_percent 91;   Indel_percent 0   Consensus_size 7;   Consensus TCCTGGC
Adh	TRF	tandem_repeat	1054682	1054708	54	.	.	Period_size 5;   Copy Number 5.4;   Match_percent 100;   Indel_percent 0   Consensus_size 5;   Consensus GAACT
Adh	TRF	tandem_repeat	1064007	1064032	52	.	.	Period_size 8;   Copy Number 3.2;   Match_percent 100;   Indel_percent 0   Consensus_size 8;   Consensus CCATATCG
Adh	TRF	tandem_repeat	1064744	1064778	52	.	.	Period_size 12;   Copy Number 2.9;   Match_percent 82;   Indel_percent 0   Consensus_size 12;   Consensus CAATCAGTCAGT
Adh	TRF	tandem_repeat	1070139	1070168	51	.	.	Period_size 9;   Copy Number 3.2;   Match_percent 95;   Indel_percent 4   Consensus_size 9;   Consensus TTTTTATTC
Adh	TRF	tandem_repeat	1070495	1070528	50	.	.	Period_size 5;   Copy Number 6.8;   Match_percent 86;   Indel_percent 0   Consensus_size 5;   Consensus CGAGT
Adh	TRF	tandem_repeat	1072955	1072985	53	.	.	Period_size 16;   Copy Number 1.9;   Match_percent 93;   Indel_percent 0   Consensus_size 16;   Consensus GGTGGTTCAGTGGTTT
Adh	TRF	tandem_repeat	1079614	1079643	60	.	.	Period_size 4;   Copy Number 7.5;   Match_percent 100;   Indel_percent 0   Consensus_size 4;   Consensus ATGA
Adh	TRF	tandem_repeat	1081006	1081059	72	.	.	Period_size 12;   Copy Number 4.5;   Match_percent 85;   Indel_percent 0   Consensus_size 12;   Consensus CGCGGATGTGTG
Adh	TRF	tandem_repeat	1081006	1081059	90	.	.	Period_size 24;   Copy Number 2.2;   Match_percent 93;   Indel_percent 0   Consensus_size 24;   Consensus CGCGGATGTGTGCGCGGATGGGAG
Adh	TRF	tandem_repeat	1095224	1095260	51	.	.	Period_size 5;   Copy Number 7.6;   Match_percent 85;   Indel_percent 14   Consensus_size 5;   Consensus GTTGT
Adh	TRF	tandem_repeat	1099411	1099459	71	.	.	Period_size 7;   Copy Number 7.0;   Match_percent 85;   Indel_percent 0   Consensus_size 7;   Consensus TGAGGAC
Adh	TRF	tandem_repeat	1099407	1099459	106	.	.	Period_size 14;   Copy Number 3.8;   Match_percent 100;   Indel_percent 0   Consensus_size 14;   Consensus GGATTGAGGACTGA
Adh	TRF	tandem_repeat	1105993	1106033	64	.	.	Period_size 18;   Copy Number 2.3;   Match_percent 91;   Indel_percent 0   Consensus_size 18;   Consensus ATCTGCATCTCTATCTGT
Adh	TRF	tandem_repeat	1106229	1106260	55	.	.	Period_size 7;   Copy Number 4.6;   Match_percent 92;   Indel_percent 0   Consensus_size 7;   Consensus TGCAAGT
Adh	TRF	tandem_repeat	1109743	1109769	54	.	.	Period_size 6;   Copy Number 4.5;   Match_percent 100;   Indel_percent 0   Consensus_size 6;   Consensus ATACTA
Adh	TRF	tandem_repeat	1112646	1112683	76	.	.	Period_size 1;   Copy Number 38.0;   Match_percent 100;   Indel_percent 0   Consensus_size 1;   Consensus T
Adh	TRF	tandem_repeat	1121317	1121349	57	.	.	Period_size 4;   Copy Number 8.2;   Match_percent 93;   Indel_percent 0   Consensus_size 4;   Consensus GACA
Adh	TRF	tandem_repeat	1126403	1126433	53	.	.	Period_size 16;   Copy Number 1.9;   Match_percent 93;   Indel_percent 0   Consensus_size 16;   Consensus GAGACTGCGAGACTGA
Adh	TRF	tandem_repeat	1143879	1143913	61	.	.	Period_size 18;   Copy Number 1.9;   Match_percent 94;   Indel_percent 0   Consensus_size 18;   Consensus AGGGTTTGATTTAGGGAC
Adh	TRF	tandem_repeat	1144313	1144404	94	.	.	Period_size 12;   Copy Number 7.7;   Match_percent 83;   Indel_percent 0   Consensus_size 12;   Consensus TGTTGCTGCTGC
Adh	TRF	tandem_repeat	1144319	1144404	82	.	.	Period_size 3;   Copy Number 28.7;   Match_percent 80;   Indel_percent 0   Consensus_size 3;   Consensus TGC
Adh	TRF	tandem_repeat	1144550	1144743	345	.	.	Period_size 99;   Copy Number 2.0;   Match_percent 94;   Indel_percent 2   Consensus_size 99;   Consensus ATTTATGCTCTTATGGCATATACACTGCACTCTATTTATGAGCTGATTTAATGCTATTAGAGCATTTATAAGGCACTTTTGTCAGGCACTTTTTATTTA
Adh	TRF	tandem_repeat	1172531	1172585	94	.	.	Period_size 2;   Copy Number 27.5;   Match_percent 92;   Indel_percent 7   Consensus_size 2;   Consensus TA
Adh	TRF	tandem_repeat	1178536	1178560	50	.	.	Period_size 1;   Copy Number 25.0;   Match_percent 100;   Indel_percent 0   Consensus_size 1;   Consensus T
Adh	TRF	tandem_repeat	1183224	1183262	53	.	.	Period_size 17;   Copy Number 2.3;   Match_percent 82;   Indel_percent 8   Consensus_size 17;   Consensus ATATGTATTTATACTTC
Adh	TRF	tandem_repeat	1187932	1187970	62	.	.	Period_size 16;   Copy Number 2.5;   Match_percent 91;   Indel_percent 4   Consensus_size 16;   Consensus ATTCTAATAAAAACCC
Adh	TRF	tandem_repeat	1193722	1193759	67	.	.	Period_size 12;   Copy Number 3.2;   Match_percent 96;   Indel_percent 0   Consensus_size 12;   Consensus TTTGGTTTGGTT
Adh	TRF	tandem_repeat	1206620	1206742	129	.	.	Period_size 48;   Copy Number 2.6;   Match_percent 78;   Indel_percent 0   Consensus_size 48;   Consensus GATTCGGTGGATTCGGAGGATTCGGAGAACAACAACAGCAGCAAGAAA
Adh	TRF	tandem_repeat	1231161	1231192	55	.	.	Period_size 12;   Copy Number 2.7;   Match_percent 95;   Indel_percent 0   Consensus_size 12;   Consensus CCGAATCCACCT
Adh	TRF	tandem_repeat	1231173	1231327	175	.	.	Period_size 45;   Copy Number 3.2;   Match_percent 74;   Indel_percent 15   Consensus_size 45;   Consensus CCGAATCCACCTCCAAATCCTCCTTGCTGCTGCTGCTGCTGATCA
Adh	TRF	tandem_repeat	1231139	1231291	249	.	.	Period_size 57;   Copy Number 2.7;   Match_percent 92;   Indel_percent 3   Consensus_size 57;   Consensus TTGCTGCTGCTGCTGCTGATCACCGAATCCACCTCCGAATCCACCGCCAAATCCTCC
Adh	TRF	tandem_repeat	1233125	1233272	197	.	.	Period_size 30;   Copy Number 4.8;   Match_percent 86;   Indel_percent 4   Consensus_size 30;   Consensus CAGCAAGGATTCGGACAAGGTGGACACGGC
Adh	TRF	tandem_repeat	1233493	1233531	55	.	.	Period_size 5;   Copy Number 8.2;   Match_percent 83;   Indel_percent 11   Consensus_size 5;   Consensus TATTA
Adh	TRF	tandem_repeat	1233498	1233537	55	.	.	Period_size 8;   Copy Number 5.1;   Match_percent 84;   Indel_percent 6   Consensus_size 8;   Consensus TATTATAT
Adh	TRF	tandem_repeat	1241220	1241251	64	.	.	Period_size 14;   Copy Number 2.3;   Match_percent 100;   Indel_percent 0   Consensus_size 14;   Consensus TAAAGAATCTCACA
Adh	TRF	tandem_repeat	1249520	1249553	50	.	.	Period_size 15;   Copy Number 2.3;   Match_percent 89;   Indel_percent 0   Consensus_size 15;   Consensus AGAAGAAGTGCTTTA
Adh	TRF	tandem_repeat	1278306	1278348	50	.	.	Period_size 8;   Copy Number 5.1;   Match_percent 83;   Indel_percent 10   Consensus_size 8;   Consensus TATATGTA
Adh	TRF	tandem_repeat	1281321	1281346	52	.	.	Period_size 13;   Copy Number 2.0;   Match_percent 100;   Indel_percent 0   Consensus_size 13;   Consensus AAATTGTTTTATA
Adh	TRF	tandem_repeat	1295917	1296081	118	.	.	Period_size 36;   Copy Number 4.6;   Match_percent 70;   Indel_percent 10   Consensus_size 35;   Consensus TTCCTTACTATCATTCGGGAATTGTATTTGTCGCA
Adh	TRF	tandem_repeat	1295883	1296153	476	.	.	Period_size 108;   Copy Number 2.5;   Match_percent 95;   Indel_percent 1   Consensus_size 108;   Consensus TTTTCCTACTGTCATTCGGAAAATTTTTATTTTCACTTTCCTTACTATCTTTCAGGAATTGTATGTTGTCGCATTCCTTACTCTCATTCGGGAACTCTGTTTGTATTA
Adh	TRF	tandem_repeat	1298339	1298401	99	.	.	Period_size 26;   Copy Number 2.3;   Match_percent 91;   Indel_percent 5   Consensus_size 26;   Consensus ATTTCACAAGAATGTGAAAAAAAGCT
Adh	TRF	tandem_repeat	1301351	1301383	66	.	.	Period_size 17;   Copy Number 1.9;   Match_percent 100;   Indel_percent 0   Consensus_size 17;   Consensus ACAGAAGGTGAAGATCA
Adh	TRF	tandem_repeat	1308935	1308967	57	.	.	Period_size 11;   Copy Number 3.0;   Match_percent 95;   Indel_percent 0   Consensus_size 11;   Consensus TGGGTCGATGG
Adh	TRF	tandem_repeat	1369864	1369893	51	.	.	Period_size 13;   Copy Number 2.3;   Match_percent 94;   Indel_percent 0   Consensus_size 13;   Consensus AAATATTAATTCG
Adh	TRF	tandem_repeat	1370382	1370413	64	.	.	Period_size 12;   Copy Number 2.7;   Match_percent 100;   Indel_percent 0   Consensus_size 12;   Consensus CAGCAGCACAAG
Adh	TRF	tandem_repeat	1383109	1383133	50	.	.	Period_size 2;   Copy Number 12.5;   Match_percent 100;   Indel_percent 0   Consensus_size 2;   Consensus CA
Adh	TRF	tandem_repeat	1388183	1388207	50	.	.	Period_size 1;   Copy Number 25.0;   Match_percent 100;   Indel_percent 0   Consensus_size 1;   Consensus T
Adh	TRF	tandem_repeat	1389000	1389024	50	.	.	Period_size 13;   Copy Number 1.9;   Match_percent 100;   Indel_percent 0   Consensus_size 13;   Consensus TAGAAAACAAAGA
Adh	TRF	tandem_repeat	1397579	1397609	55	.	.	Period_size 15;   Copy Number 2.0;   Match_percent 93;   Indel_percent 6   Consensus_size 16;   Consensus AAAATATTTTAGCTAC
Adh	TRF	tandem_repeat	1398631	1398664	50	.	.	Period_size 6;   Copy Number 5.7;   Match_percent 85;   Indel_percent 0   Consensus_size 6;   Consensus CCCATG
Adh	TRF	tandem_repeat	1416062	1416119	82	.	.	Period_size 18;   Copy Number 3.2;   Match_percent 87;   Indel_percent 7   Consensus_size 18;   Consensus ATTCCTCCACAACCAGCT
Adh	TRF	tandem_repeat	1452268	1452296	51	.	.	Period_size 12;   Copy Number 2.3;   Match_percent 94;   Indel_percent 5   Consensus_size 13;   Consensus TGCCAGGACAACG
Adh	TRF	tandem_repeat	1453157	1453187	53	.	.	Period_size 2;   Copy Number 15.5;   Match_percent 93;   Indel_percent 0   Consensus_size 2;   Consensus TA
Adh	TRF	tandem_repeat	1459631	1459666	54	.	.	Period_size 14;   Copy Number 2.6;   Match_percent 90;   Indel_percent 0   Consensus_size 14;   Consensus TTGTATCTCGACAT
Adh	TRF	tandem_repeat	1463470	1463495	52	.	.	Period_size 5;   Copy Number 5.2;   Match_percent 100;   Indel_percent 0   Consensus_size 5;   Consensus TTCAG
Adh	TRF	tandem_repeat	1473545	1473601	60	.	.	Period_size 5;   Copy Number 11.4;   Match_percent 84;   Indel_percent 0   Consensus_size 5;   Consensus GGATT
Adh	TRF	tandem_repeat	1474088	1474113	52	.	.	Period_size 2;   Copy Number 13.0;   Match_percent 100;   Indel_percent 0   Consensus_size 2;   Consensus TA
Adh	TRF	tandem_repeat	1474112	1474339	420	.	.	Period_size 113;   Copy Number 2.0;   Match_percent 96;   Indel_percent 0   Consensus_size 113;   Consensus TAAGTTAAGAACCCTCTTCTTGCGATCTTCGTCAGGACTCACCAGCGCTCGGCTCTCGTGTTTTCGGGCCCCGTCAGCAGGCGACTCGGGGCCTGTCTAGGAACATGTTCGTG
Adh	TRF	tandem_repeat	1480217	1480252	72	.	.	Period_size 1;   Copy Number 36.0;   Match_percent 100;   Indel_percent 0   Consensus_size 1;   Consensus A
Adh	TRF	tandem_repeat	1480262	1480316	56	.	.	Period_size 12;   Copy Number 4.6;   Match_percent 82;   Indel_percent 13   Consensus_size 11;   Consensus AAATACAAAAA
Adh	TRF	tandem_repeat	1481117	1481342	416	.	.	Period_size 113;   Copy Number 2.0;   Match_percent 96;   Indel_percent 0   Consensus_size 113;   Consensus AGTTAAGAACCCTCTTCTTGCGATCTTCGTCAGGACTCACCAGCGCTCGGCTCTCGTGTTTTCGGGCCCCGTCAGCAGGCGACTCGGGGCCTGTCTAGGAACATGTTCGTGTA
Adh	TRF	tandem_repeat	1486616	1486669	81	.	.	Period_size 26;   Copy Number 2.1;   Match_percent 89;   Indel_percent 0   Consensus_size 26;   Consensus TTTTATTTATATTGCTACAGAGAAAC
Adh	TRF	tandem_repeat	1497094	1497133	71	.	.	Period_size 19;   Copy Number 2.1;   Match_percent 95;   Indel_percent 0   Consensus_size 19;   Consensus ACACTTAAAAAAATACTAA
Adh	TRF	tandem_repeat	1497979	1498010	55	.	.	Period_size 15;   Copy Number 2.1;   Match_percent 94;   Indel_percent 0   Consensus_size 15;   Consensus AGGCACGCGAGGAGC
Adh	TRF	tandem_repeat	1503315	1503343	58	.	.	Period_size 2;   Copy Number 14.5;   Match_percent 100;   Indel_percent 0   Consensus_size 2;   Consensus TC
Adh	TRF	tandem_repeat	1510588	1510627	62	.	.	Period_size 6;   Copy Number 6.7;   Match_percent 97;   Indel_percent 0   Consensus_size 6;   Consensus TATTTG
Adh	TRF	tandem_repeat	1517574	1517605	50	.	.	Period_size 12;   Copy Number 2.6;   Match_percent 85;   Indel_percent 14   Consensus_size 13;   Consensus AATAAAGATGTAA
Adh	TRF	tandem_repeat	1524577	1524613	60	.	.	Period_size 18;   Copy Number 1.9;   Match_percent 89;   Indel_percent 10   Consensus_size 20;   Consensus ACAAATTCGTTTCTTAAAAT
Adh	TRF	tandem_repeat	1558385	1558499	167	.	.	Period_size 21;   Copy Number 5.5;   Match_percent 91;   Indel_percent 0   Consensus_size 21;   Consensus CTTCCGCGGTGGAGAAGGCGG
Adh	TRF	tandem_repeat	1561993	1562077	170	.	.	Period_size 39;   Copy Number 2.2;   Match_percent 100;   Indel_percent 0   Consensus_size 39;   Consensus TGAACGTCGTGGAAGACTAGATCGGGAGGAACGCGGCGG
Adh	TRF	tandem_repeat	1584639	1584707	111	.	.	Period_size 21;   Copy Number 3.3;   Match_percent 93;   Indel_percent 0   Consensus_size 21;   Consensus AAGGAGGAGAAGGAGCGTGCT
Adh	TRF	tandem_repeat	1588215	1588257	59	.	.	Period_size 3;   Copy Number 14.3;   Match_percent 85;   Indel_percent 0   Consensus_size 3;   Consensus GAT
Adh	TRF	tandem_repeat	1604333	1604409	73	.	.	Period_size 6;   Copy Number 12.8;   Match_percent 76;   Indel_percent 0   Consensus_size 6;   Consensus GGGACA
Adh	TRF	tandem_repeat	1604321	1604396	91	.	.	Period_size 24;   Copy Number 3.2;   Match_percent 83;   Indel_percent 5   Consensus_size 24;   Consensus GGGAACGAGACCGGGACAGAGACA
Adh	TRF	tandem_repeat	1604335	1604405	88	.	.	Period_size 18;   Copy Number 3.9;   Match_percent 79;   Indel_percent 0   Consensus_size 18;   Consensus GACCGGGACAGGGACAGA
Adh	TRF	tandem_repeat	1604329	1604409	99	.	.	Period_size 12;   Copy Number 6.8;   Match_percent 85;   Indel_percent 0   Consensus_size 12;   Consensus GACCGGGACAGA
Adh	TRF	tandem_repeat	1614603	1614643	59	.	.	Period_size 5;   Copy Number 8.6;   Match_percent 84;   Indel_percent 10   Consensus_size 5;   Consensus CTGTT
Adh	TRF	tandem_repeat	1614598	1614643	58	.	.	Period_size 15;   Copy Number 3.3;   Match_percent 82;   Indel_percent 8   Consensus_size 14;   Consensus TCTGTCTGTTCTGT
Adh	TRF	tandem_repeat	1617132	1617172	52	.	.	Period_size 13;   Copy Number 3.1;   Match_percent 80;   Indel_percent 13   Consensus_size 14;   Consensus CAACTGTGCAACAC
Adh	TRF	tandem_repeat	1617125	1617193	79	.	.	Period_size 26;   Copy Number 2.7;   Match_percent 82;   Indel_percent 6   Consensus_size 26;   Consensus GCAACAGCAACGTGCAACACCAATGG
Adh	TRF	tandem_repeat	1644249	1644287	51	.	.	Period_size 7;   Copy Number 5.6;   Match_percent 84;   Indel_percent 0   Consensus_size 7;   Consensus GACGCAG
Adh	TRF	tandem_repeat	1683100	1683129	51	.	.	Period_size 16;   Copy Number 1.9;   Match_percent 93;   Indel_percent 6   Consensus_size 15;   Consensus GACGAGGGCACCGAA
Adh	TRF	tandem_repeat	1686677	1687141	930	.	.	Period_size 231;   Copy Number 2.0;   Match_percent 100;   Indel_percent 0   Consensus_size 231;   Consensus TCGGAAAATTATTTTTCCCTCTGTCTGTAATAAAATAATTTTATATGATTACAAGAAATATAAATCCTATTGAAAACATTCGACTCAGGCTTGTATTTCAAAAGGAGCTTGGCCAAAATGGTTTGGCATGCCGGTAGAAATTGACAAGACAAATAATAAAAAAAAGAGAGTCGATTTCCTCGGCTATCTGATACCCTGTACTCAGCGTTAGAGTGGGTAAGATGCACAATC
Adh	TRF	tandem_repeat	1698003	1698064	79	.	.	Period_size 4;   Copy Number 15.5;   Match_percent 82;   Indel_percent 0   Consensus_size 4;   Consensus ACCA
Adh	TRF	tandem_repeat	1698192	1698227	54	.	.	Period_size 9;   Copy Number 4.0;   Match_percent 85;   Indel_percent 0   Consensus_size 9;   Consensus GCAGCACCA
Adh	TRF	tandem_repeat	1705346	1705372	54	.	.	Period_size 14;   Copy Number 1.9;   Match_percent 100;   Indel_percent 0   Consensus_size 14;   Consensus CTCTGGACTTTGGA
Adh	TRF	tandem_repeat	1709366	1709404	51	.	.	Period_size 6;   Copy Number 6.5;   Match_percent 87;   Indel_percent 0   Consensus_size 6;   Consensus ACTCCC
Adh	TRF	tandem_repeat	1711879	1711912	59	.	.	Period_size 2;   Copy Number 17.0;   Match_percent 93;   Indel_percent 0   Consensus_size 2;   Consensus GT
Adh	TRF	tandem_repeat	1715744	1715779	51	.	.	Period_size 13;   Copy Number 2.8;   Match_percent 84;   Indel_percent 16   Consensus_size 14;   Consensus TTGTATTGGCCCTG
Adh	TRF	tandem_repeat	1723551	1723584	68	.	.	Period_size 17;   Copy Number 2.0;   Match_percent 100;   Indel_percent 0   Consensus_size 17;   Consensus ACTACTTTATATAAATT
Adh	TRF	tandem_repeat	1728633	1728685	52	.	.	Period_size 3;   Copy Number 17.0;   Match_percent 76;   Indel_percent 7   Consensus_size 3;   Consensus GCA
Adh	TRF	tandem_repeat	1732811	1732837	54	.	.	Period_size 9;   Copy Number 3.0;   Match_percent 100;   Indel_percent 0   Consensus_size 9;   Consensus CATCCTCCA
Adh	TRF	tandem_repeat	1732930	1732961	55	.	.	Period_size 6;   Copy Number 5.3;   Match_percent 92;   Indel_percent 0   Consensus_size 6;   Consensus GCAACT
Adh	TRF	tandem_repeat	1736761	1736791	53	.	.	Period_size 14;   Copy Number 2.2;   Match_percent 94;   Indel_percent 0   Consensus_size 14;   Consensus GTGCGTGGGTGGGC
Adh	TRF	tandem_repeat	1739991	1740037	85	.	.	Period_size 22;   Copy Number 2.1;   Match_percent 96;   Indel_percent 0   Consensus_size 22;   Consensus AATAAACTAAAAATTAATATTT
Adh	TRF	tandem_repeat	1740127	1740152	52	.	.	Period_size 10;   Copy Number 2.6;   Match_percent 100;   Indel_percent 0   Consensus_size 10;   Consensus CACTTTTTAC
Adh	TRF	tandem_repeat	1744038	1744094	60	.	.	Period_size 7;   Copy Number 8.1;   Match_percent 88;   Indel_percent 0   Consensus_size 7;   Consensus AAAACCA
Adh	TRF	tandem_repeat	1750886	1750922	67	.	.	Period_size 18;   Copy Number 2.0;   Match_percent 94;   Indel_percent 5   Consensus_size 19;   Consensus TTAAAACTAGTTCATTTCA
Adh	TRF	tandem_repeat	1768692	1768743	61	.	.	Period_size 7;   Copy Number 7.6;   Match_percent 78;   Indel_percent 4   Consensus_size 7;   Consensus ACATTCA
Adh	TRF	tandem_repeat	1768693	1768748	69	.	.	Period_size 14;   Copy Number 4.1;   Match_percent 83;   Indel_percent 2   Consensus_size 14;   Consensus CATTCAACATTCAG
Adh	TRF	tandem_repeat	1773901	1773930	51	.	.	Period_size 6;   Copy Number 5.0;   Match_percent 95;   Indel_percent 0   Consensus_size 6;   Consensus CAACTG
Adh	TRF	tandem_repeat	1783205	1783248	63	.	.	Period_size 6;   Copy Number 7.3;   Match_percent 85;   Indel_percent 10   Consensus_size 6;   Consensus CCCAGT
Adh	TRF	tandem_repeat	1787299	1787326	56	.	.	Period_size 13;   Copy Number 2.2;   Match_percent 100;   Indel_percent 0   Consensus_size 13;   Consensus ATCTATATAATCT
Adh	TRF	tandem_repeat	1787855	1787888	50	.	.	Period_size 12;   Copy Number 2.8;   Match_percent 90;   Indel_percent 0   Consensus_size 12;   Consensus CATTACCAACCG
Adh	TRF	tandem_repeat	1819458	1819487	51	.	.	Period_size 6;   Copy Number 5.0;   Match_percent 91;   Indel_percent 0   Consensus_size 6;   Consensus GTCCAT
Adh	TRF	tandem_repeat	1822078	1822107	60	.	.	Period_size 15;   Copy Number 2.0;   Match_percent 100;   Indel_percent 0   Consensus_size 15;   Consensus CAAAGTTTGCTTAAC
Adh	TRF	tandem_repeat	1837031	1837072	68	.	.	Period_size 7;   Copy Number 6.1;   Match_percent 88;   Indel_percent 5   Consensus_size 7;   Consensus GGGTATG
Adh	TRF	tandem_repeat	1837031	1837065	52	.	.	Period_size 13;   Copy Number 2.6;   Match_percent 90;   Indel_percent 4   Consensus_size 13;   Consensus GGGTATGGATATG
Adh	TRF	tandem_repeat	1837034	1837073	80	.	.	Period_size 20;   Copy Number 2.0;   Match_percent 100;   Indel_percent 0   Consensus_size 20;   Consensus TATGGGGTATGGGGTATGGA
Adh	TRF	tandem_repeat	1865544	1865596	65	.	.	Period_size 13;   Copy Number 4.2;   Match_percent 79;   Indel_percent 13   Consensus_size 13;   Consensus TTTGTATATTATA
Adh	TRF	tandem_repeat	1870671	1870699	51	.	.	Period_size 12;   Copy Number 2.3;   Match_percent 94;   Indel_percent 5   Consensus_size 13;   Consensus TAAAAAGTTTGAT
Adh	TRF	tandem_repeat	1872504	1872539	63	.	.	Period_size 14;   Copy Number 2.6;   Match_percent 95;   Indel_percent 0   Consensus_size 14;   Consensus TCCCAGTTCCAAGT
Adh	TRF	tandem_repeat	1883440	1883476	65	.	.	Period_size 17;   Copy Number 2.2;   Match_percent 95;   Indel_percent 0   Consensus_size 17;   Consensus AATTTAATATATAATTT
Adh	TRF	tandem_repeat	1885100	1885139	53	.	.	Period_size 9;   Copy Number 4.4;   Match_percent 80;   Indel_percent 0   Consensus_size 9;   Consensus CGTCGTCGC
Adh	TRF	tandem_repeat	1900736	1900766	53	.	.	Period_size 6;   Copy Number 5.2;   Match_percent 92;   Indel_percent 0   Consensus_size 6;   Consensus AATTGC
Adh	TRF	tandem_repeat	1911264	1911290	54	.	.	Period_size 12;   Copy Number 2.2;   Match_percent 100;   Indel_percent 0   Consensus_size 12;   Consensus AAAAATGCATTT
Adh	TRF	tandem_repeat	1938674	1938710	65	.	.	Period_size 12;   Copy Number 3.1;   Match_percent 96;   Indel_percent 0   Consensus_size 12;   Consensus ATAATTATAACC
Adh	TRF	tandem_repeat	1947505	1947547	50	.	.	Period_size 6;   Copy Number 7.2;   Match_percent 83;   Indel_percent 0   Consensus_size 6;   Consensus CATGTC
Adh	TRF	tandem_repeat	1957527	1957584	55	.	.	Period_size 6;   Copy Number 9.7;   Match_percent 79;   Indel_percent 5   Consensus_size 6;   Consensus CCAAAG
Adh	TRF	tandem_repeat	1957527	1957585	64	.	.	Period_size 11;   Copy Number 5.0;   Match_percent 80;   Indel_percent 12   Consensus_size 11;   Consensus CCAAAGCCAAG
Adh	TRF	tandem_repeat	1977435	1977459	50	.	.	Period_size 13;   Copy Number 1.9;   Match_percent 100;   Indel_percent 0   Consensus_size 13;   Consensus GATCATTGCACCG
Adh	TRF	tandem_repeat	2003999	2004062	119	.	.	Period_size 31;   Copy Number 2.1;   Match_percent 96;   Indel_percent 0   Consensus_size 31;   Consensus CCCGCCCACAGTGAGAAATGTGTACTAATTT
Adh	TRF	tandem_repeat	2006358	2006387	51	.	.	Period_size 2;   Copy Number 15.0;   Match_percent 92;   Indel_percent 0   Consensus_size 2;   Consensus CA
Adh	TRF	tandem_repeat	2023907	2023937	62	.	.	Period_size 15;   Copy Number 2.1;   Match_percent 100;   Indel_percent 0   Consensus_size 15;   Consensus TGGAGTATATATTCG
Adh	TRF	tandem_repeat	2026009	2026033	50	.	.	Period_size 9;   Copy Number 2.8;   Match_percent 100;   Indel_percent 0   Consensus_size 9;   Consensus CACCGAACA
Adh	TRF	tandem_repeat	2033746	2033775	51	.	.	Period_size 6;   Copy Number 5.0;   Match_percent 91;   Indel_percent 0   Consensus_size 6;   Consensus AGCTGG
Adh	TRF	tandem_repeat	2126704	2126735	55	.	.	Period_size 15;   Copy Number 2.2;   Match_percent 94;   Indel_percent 5   Consensus_size 14;   Consensus CGCTCACAAAAGCA
Adh	TRF	tandem_repeat	2146664	2146702	60	.	.	Period_size 20;   Copy Number 1.9;   Match_percent 89;   Indel_percent 0   Consensus_size 20;   Consensus GTGATGCGATGCGATGCAAT
Adh	TRF	tandem_repeat	2147202	2147226	50	.	.	Period_size 13;   Copy Number 1.9;   Match_percent 100;   Indel_percent 0   Consensus_size 13;   Consensus GAATTATCAATGT
Adh	TRF	tandem_repeat	2159937	2159963	54	.	.	Period_size 2;   Copy Number 13.5;   Match_percent 100;   Indel_percent 0   Consensus_size 2;   Consensus CA
Adh	TRF	tandem_repeat	2189123	2189147	50	.	.	Period_size 13;   Copy Number 1.9;   Match_percent 100;   Indel_percent 0   Consensus_size 13;   Consensus AATTAATAGATTA
Adh	TRF	tandem_repeat	2191532	2191557	52	.	.	Period_size 3;   Copy Number 8.7;   Match_percent 100;   Indel_percent 0   Consensus_size 3;   Consensus TGA
Adh	TRF	tandem_repeat	2202160	2202194	54	.	.	Period_size 17;   Copy Number 2.1;   Match_percent 89;   Indel_percent 5   Consensus_size 17;   Consensus GTTTTAAGACTAGTATA
Adh	TRF	tandem_repeat	2214721	2214877	104	.	.	Period_size 3;   Copy Number 53.0;   Match_percent 75;   Indel_percent 5   Consensus_size 3;   Consensus ATA
Adh	TRF	tandem_repeat	2215406	2215454	89	.	.	Period_size 4;   Copy Number 12.2;   Match_percent 95;   Indel_percent 0   Consensus_size 4;   Consensus GATG
Adh	TRF	tandem_repeat	2215825	2215876	77	.	.	Period_size 3;   Copy Number 17.3;   Match_percent 87;   Indel_percent 0   Consensus_size 3;   Consensus TAA
Adh	TRF	tandem_repeat	2227068	2227112	72	.	.	Period_size 11;   Copy Number 4.1;   Match_percent 91;   Indel_percent 0   Consensus_size 11;   Consensus AAGGGGGTAGC
Adh	TRF	tandem_repeat	2227058	2227112	76	.	.	Period_size 22;   Copy Number 2.5;   Match_percent 85;   Indel_percent 8   Consensus_size 22;   Consensus GAGGGTAGCAAGGGGGTAGCAA
Adh	TRF	tandem_repeat	2249721	2249747	54	.	.	Period_size 14;   Copy Number 1.9;   Match_percent 100;   Indel_percent 0   Consensus_size 14;   Consensus TTATATATTAAAGC
Adh	TRF	tandem_repeat	2259275	2259309	54	.	.	Period_size 17;   Copy Number 2.0;   Match_percent 88;   Indel_percent 5   Consensus_size 18;   Consensus TAAATTAAGCCTTGTAAT
Adh	TRF	tandem_repeat	2293699	2293728	53	.	.	Period_size 13;   Copy Number 2.4;   Match_percent 94;   Indel_percent 5   Consensus_size 13;   Consensus ATAGATATGGTTT
Adh	TRF	tandem_repeat	2359376	2359421	56	.	.	Period_size 11;   Copy Number 4.0;   Match_percent 81;   Indel_percent 10   Consensus_size 11;   Consensus TATATATTTTT
Adh	TRF	tandem_repeat	2362340	2362365	52	.	.	Period_size 9;   Copy Number 2.9;   Match_percent 100;   Indel_percent 0   Consensus_size 9;   Consensus AGCAGCACA
Adh	TRF	tandem_repeat	2366112	2366153	50	.	.	Period_size 6;   Copy Number 7.0;   Match_percent 78;   Indel_percent 10   Consensus_size 6;   Consensus TGTCCA
Adh	TRF	tandem_repeat	2375469	2376668	2240	.	.	Period_size 228;   Copy Number 5.3;   Match_percent 97;   Indel_percent 0   Consensus_size 228;   Consensus ATTCCAAATGTAGGCCAAGGAAACAGAGGGAATAGATATGATCCAAATCCGGAAATCGGAGCAGTTCCAGTCGGAAATCCTATTCCGAATGAAGGCAATGCATTTGGCGGTCGTGGATATGATTTAAATGAAATCCAAAAACATAATCAAGGTGGAAGATACATTCCACATGTAGGTCATGGAAATGGTCCCAATGCACCTAAAGAACCTCTTAAAATCGGAGGAAAT
Adh	TRF	tandem_repeat	2405834	2405892	63	.	.	Period_size 7;   Copy Number 8.9;   Match_percent 80;   Indel_percent 15   Consensus_size 7;   Consensus TATTATA
Adh	TRF	tandem_repeat	2410580	2410607	56	.	.	Period_size 14;   Copy Number 2.0;   Match_percent 100;   Indel_percent 0   Consensus_size 14;   Consensus GCCAAAGCGAAAAA
Adh	TRF	tandem_repeat	2424794	2424818	50	.	.	Period_size 13;   Copy Number 1.9;   Match_percent 100;   Indel_percent 0   Consensus_size 13;   Consensus ATAGTGGTTTGAG
Adh	TRF	tandem_repeat	2429836	2429865	53	.	.	Period_size 14;   Copy Number 2.1;   Match_percent 93;   Indel_percent 6   Consensus_size 15;   Consensus TTAATTCAATAATAT
Adh	TRF	tandem_repeat	2435866	2435908	50	.	.	Period_size 8;   Copy Number 5.4;   Match_percent 80;   Indel_percent 0   Consensus_size 8;   Consensus TGACTAGA
Adh	TRF	tandem_repeat	2443547	2443579	57	.	.	Period_size 10;   Copy Number 3.3;   Match_percent 91;   Indel_percent 0   Consensus_size 10;   Consensus AGGATATGCC
Adh	TRF	tandem_repeat	2444339	2444363	50	.	.	Period_size 2;   Copy Number 12.5;   Match_percent 100;   Indel_percent 0   Consensus_size 2;   Consensus GT
Adh	TRF	tandem_repeat	2452513	2452567	58	.	.	Period_size 12;   Copy Number 4.6;   Match_percent 81;   Indel_percent 4   Consensus_size 12;   Consensus ATCCGCCACATG
Adh	TRF	tandem_repeat	2454294	2454323	53	.	.	Period_size 13;   Copy Number 2.2;   Match_percent 94;   Indel_percent 5   Consensus_size 14;   Consensus TTTATAAAATTTTA
Adh	TRF	tandem_repeat	2465248	2465283	54	.	.	Period_size 18;   Copy Number 2.0;   Match_percent 88;   Indel_percent 0   Consensus_size 18;   Consensus CCGCCATCATCATGATCG
Adh	TRF	tandem_repeat	2476796	2476845	68	.	.	Period_size 13;   Copy Number 3.7;   Match_percent 84;   Indel_percent 7   Consensus_size 14;   Consensus ATTATATTTTACTT
Adh	TRF	tandem_repeat	2499015	2499060	69	.	.	Period_size 19;   Copy Number 2.3;   Match_percent 88;   Indel_percent 7   Consensus_size 21;   Consensus AAGCAGTGGGAAGGGGAAACC
Adh	TRF	tandem_repeat	2500796	2500828	57	.	.	Period_size 3;   Copy Number 11.0;   Match_percent 93;   Indel_percent 0   Consensus_size 3;   Consensus GGA
Adh	TRF	tandem_repeat	2512602	2512646	54	.	.	Period_size 5;   Copy Number 9.0;   Match_percent 87;   Indel_percent 0   Consensus_size 5;   Consensus CTGAA
Adh	TRF	tandem_repeat	2564818	2564865	60	.	.	Period_size 23;   Copy Number 2.1;   Match_percent 81;   Indel_percent 11   Consensus_size 22;   Consensus CAAAAACTAAAAGTTATTCAAG
Adh	TRF	tandem_repeat	2566337	2566364	56	.	.	Period_size 13;   Copy Number 2.2;   Match_percent 100;   Indel_percent 0   Consensus_size 13;   Consensus ATGTGCGGTAAAT
Adh	TRF	tandem_repeat	2570414	2570442	58	.	.	Period_size 2;   Copy Number 14.5;   Match_percent 100;   Indel_percent 0   Consensus_size 2;   Consensus AC
Adh	TRF	tandem_repeat	2571737	2571768	55	.	.	Period_size 7;   Copy Number 4.6;   Match_percent 96;   Indel_percent 0   Consensus_size 7;   Consensus GGCGGTG
Adh	TRF	tandem_repeat	2579771	2579797	54	.	.	Period_size 2;   Copy Number 13.5;   Match_percent 100;   Indel_percent 0   Consensus_size 2;   Consensus TA
Adh	TRF	tandem_repeat	2590413	2590442	60	.	.	Period_size 14;   Copy Number 2.1;   Match_percent 100;   Indel_percent 0   Consensus_size 14;   Consensus TCGAAATAAAGCGA
Adh	TRF	tandem_repeat	2593068	2593338	476	.	.	Period_size 108;   Copy Number 2.5;   Match_percent 95;   Indel_percent 1   Consensus_size 108;   Consensus TTCCTGAAAGATAGTAAGGAAAGTGAAAATAAAAATTTTCCGAATGACAGTAGGAAAATAATACAAACAGAATTCCCGAATGAGAGTAAGGAATGCGACAACATACAA
Adh	TRF	tandem_repeat	2593140	2593304	118	.	.	Period_size 36;   Copy Number 4.6;   Match_percent 70;   Indel_percent 10   Consensus_size 35;   Consensus TTCCCGAATGAGAGTAAGGAATGCGACAAATACAA
Adh	TRF	tandem_repeat	2597900	2597932	50	.	.	Period_size 5;   Copy Number 6.8;   Match_percent 93;   Indel_percent 3   Consensus_size 5;   Consensus TTCCG
Adh	TRF	tandem_repeat	2641313	2641337	50	.	.	Period_size 13;   Copy Number 1.9;   Match_percent 100;   Indel_percent 0   Consensus_size 13;   Consensus TACTCTACTATAG
Adh	TRF	tandem_repeat	2651478	2651506	58	.	.	Period_size 14;   Copy Number 2.1;   Match_percent 100;   Indel_percent 0   Consensus_size 14;   Consensus ACTTAATTTCTAGG
Adh	TRF	tandem_repeat	2660130	2660183	51	.	.	Period_size 5;   Copy Number 9.0;   Match_percent 82;   Indel_percent 13   Consensus_size 6;   Consensus TTTTTG
Adh	TRF	tandem_repeat	2666820	2666844	50	.	.	Period_size 7;   Copy Number 3.6;   Match_percent 100;   Indel_percent 0   Consensus_size 7;   Consensus AGTGGAA
Adh	TRF	tandem_repeat	2674186	2674230	63	.	.	Period_size 13;   Copy Number 3.5;   Match_percent 84;   Indel_percent 0   Consensus_size 13;   Consensus GGGACATCTCGGC
Adh	TRF	tandem_repeat	2688917	2688951	52	.	.	Period_size 12;   Copy Number 2.9;   Match_percent 91;   Indel_percent 0   Consensus_size 12;   Consensus CGTCTGTCCGTT
Adh	TRF	tandem_repeat	2689255	2689289	52	.	.	Period_size 2;   Copy Number 17.5;   Match_percent 87;   Indel_percent 0   Consensus_size 2;   Consensus TA
Adh	TRF	tandem_repeat	2703028	2703097	69	.	.	Period_size 10;   Copy Number 7.5;   Match_percent 73;   Indel_percent 15   Consensus_size 10;   Consensus AGATAGATAT
Adh	TRF	tandem_repeat	2703033	2703105	55	.	.	Period_size 6;   Copy Number 12.0;   Match_percent 71;   Indel_percent 23   Consensus_size 6;   Consensus GATATA
Adh	TRF	tandem_repeat	2713665	2713700	51	.	.	Period_size 5;   Copy Number 7.8;   Match_percent 87;   Indel_percent 12   Consensus_size 5;   Consensus TTTTG
Adh	TRF	tandem_repeat	2725501	2725557	105	.	.	Period_size 2;   Copy Number 28.5;   Match_percent 96;   Indel_percent 0   Consensus_size 2;   Consensus TA
Adh	TRF	tandem_repeat	2756438	2756487	57	.	.	Period_size 15;   Copy Number 3.6;   Match_percent 78;   Indel_percent 7   Consensus_size 14;   Consensus AATATTTTACAATA
Adh	TRF	tandem_repeat	2788846	2789016	218	.	.	Period_size 24;   Copy Number 7.1;   Match_percent 86;   Indel_percent 2   Consensus_size 24;   Consensus TCCCGGACCTGGATATCCTCTGGG
Adh	TRF	tandem_repeat	2808709	2808738	60	.	.	Period_size 14;   Copy Number 2.1;   Match_percent 100;   Indel_percent 0   Consensus_size 14;   Consensus TTAGTTGTAATTAG
Adh	TRF	tandem_repeat	2813993	2814020	56	.	.	Period_size 13;   Copy Number 2.2;   Match_percent 100;   Indel_percent 0   Consensus_size 13;   Consensus TTTCTGCCAGCAA
Adh	TRF	tandem_repeat	2856339	2856364	52	.	.	Period_size 5;   Copy Number 5.2;   Match_percent 100;   Indel_percent 0   Consensus_size 5;   Consensus GGTAT
Adh	TRF	tandem_repeat	2881397	2881426	51	.	.	Period_size 12;   Copy Number 2.5;   Match_percent 94;   Indel_percent 0   Consensus_size 12;   Consensus TTGCAAATCAAG
Adh	TRF	tandem_repeat	2885773	2885803	53	.	.	Period_size 15;   Copy Number 2.1;   Match_percent 93;   Indel_percent 0   Consensus_size 15;   Consensus ATTCAATAAAATTCA
Adh	TRF	tandem_repeat	2887597	2887626	51	.	.	Period_size 2;   Copy Number 15.0;   Match_percent 92;   Indel_percent 0   Consensus_size 2;   Consensus AT
Adh	TRF	tandem_repeat	2902098	2902146	89	.	.	Period_size 14;   Copy Number 3.5;   Match_percent 97;   Indel_percent 0   Consensus_size 14;   Consensus ACTTCTCTAAGCCA
Adh	TRF	tandem_repeat	2904963	2904992	51	.	.	Period_size 15;   Copy Number 2.0;   Match_percent 93;   Indel_percent 0   Consensus_size 15;   Consensus GAGAACCTGAGAACT
Adh	TRF	tandem_repeat	2905838	2905867	51	.	.	Period_size 10;   Copy Number 3.0;   Match_percent 95;   Indel_percent 0   Consensus_size 10;   Consensus CATATATATG
Adh	TRF	tandem_repeat	2913004	2913039	54	.	.	Period_size 8;   Copy Number 4.5;   Match_percent 85;   Indel_percent 0   Consensus_size 8;   Consensus AACAGCCA
Adh	TRF	tandem_repeat	2913083	2913122	62	.	.	Period_size 3;   Copy Number 13.3;   Match_percent 91;   Indel_percent 0   Consensus_size 3;   Consensus CAA


#
# complfy: 1. Calypso entries only Jul 5 (MR)
#          2. group field cleaned 5 (MR)
#
Adh	calypso	tandemrepeat	1622	1636	.	+	1	
# 15  x A							 
Adh	calypso	tandemrepeat	2551	2568	.	+	0	
# 3   x ACCAGA							 
Adh	calypso	tandemrepeat	2551	2568	.	+	0	
# 3   x ACCAGA							 
Adh	calypso	tandemrepeat	3603	3617	.	+	2	
# 3   x AACGC							 
Adh	calypso	tandemrepeat	3603	3617	.	+	2	
# 3   x AACGC							 
Adh	calypso	tandemrepeat	10170	10185	.	+	2	
# 4   x CCTG							 
Adh	calypso	tandemrepeat	10170	10185	.	+	2	
# 4   x CCTG							 
Adh	calypso	tandemrepeat	28336	28359	.	+	0	
# 12  x TA							 
Adh	calypso	tandemrepeat	28336	28359	.	+	0	
# 12  x TA							 
Adh	calypso	tandemrepeat	29566	29581	.	+	0	
# 4   x GTAT							 
Adh	calypso	tandemrepeat	29566	29581	.	+	0	
# 4   x GTAT							 
Adh	calypso	tandemrepeat	37867	37881	.	+	0	
# 3   x CTTGA							 
Adh	calypso	tandemrepeat	37867	37881	.	+	0	
# 3   x CTTGA							 
Adh	calypso	tandemrepeat	39133	39148	.	+	0	
# 16  x A							 
Adh	calypso	tandemrepeat	39133	39148	.	+	0	
# 16  x A							 
Adh	calypso	tandemrepeat	39991	40005	.	+	0	
# 15  x A							 
Adh	calypso	tandemrepeat	39991	40005	.	+	0	
# 15  x A							 
Adh	calypso	tandemrepeat	40748	40762	.	+	1	
# 5   x TGC							 
Adh	calypso	tandemrepeat	40748	40762	.	+	1	
# 5   x TGC							 
Adh	calypso	tandemrepeat	41083	41098	.	+	0	
# 4   x AATA							 
Adh	calypso	tandemrepeat	41083	41098	.	+	0	
# 4   x AATA							 
Adh	calypso	tandemrepeat	41804	41818	.	+	1	
# 5   x TTC							 
Adh	calypso	tandemrepeat	41804	41818	.	+	1	
# 5   x TTC							 
Adh	calypso	tandemrepeat	41852	41867	.	+	1	
# 8   x TG							 
Adh	calypso	tandemrepeat	41852	41867	.	+	1	
# 8   x TG							 
Adh	calypso	tandemrepeat	42651	42670	.	+	2	
# 10  x TC							 
Adh	calypso	tandemrepeat	42651	42670	.	+	2	
# 10  x TC							 
Adh	calypso	tandemrepeat	46851	46868	.	+	2	
# 9   x AT							 
Adh	calypso	tandemrepeat	46851	46868	.	+	2	
# 9   x AT							 
Adh	calypso	tandemrepeat	46851	46868	.	+	2	
# 9   x AT							 
Adh	calypso	tandemrepeat	46851	46868	.	+	2	
# 9   x AT							 
Adh	calypso	tandemrepeat	47082	47097	.	+	2	
# 16  x T							 
Adh	calypso	tandemrepeat	47082	47097	.	+	2	
# 16  x T							 
Adh	calypso	tandemrepeat	47082	47097	.	+	2	
# 16  x T							 
Adh	calypso	tandemrepeat	47082	47097	.	+	2	
# 16  x T							 
Adh	calypso	tandemrepeat	53890	53904	.	+	0	
# 3   x TTTTA							 
Adh	calypso	tandemrepeat	53890	53904	.	+	0	
# 3   x TTTTA							 
Adh	calypso	tandemrepeat	54248	54267	.	+	1	
# 20  x A							 
Adh	calypso	tandemrepeat	54248	54267	.	+	1	
# 20  x A							 
Adh	calypso	tandemrepeat	58947	58969	.	+	2	
# 23  x A							 
Adh	calypso	tandemrepeat	58947	58969	.	+	2	
# 23  x A							 
Adh	calypso	tandemrepeat	63281	63295	.	+	1	
# 3   x AACAG							 
Adh	calypso	tandemrepeat	63281	63295	.	+	1	
# 3   x AACAG							 
Adh	calypso	tandemrepeat	70833	70850	.	+	2	
# 3   x GATACA							 
Adh	calypso	tandemrepeat	70833	70850	.	+	2	
# 3   x GATACA							 
Adh	calypso	tandemrepeat	72090	72105	.	+	2	
# 4   x ATAC							 
Adh	calypso	tandemrepeat	72090	72105	.	+	2	
# 4   x ATAC							 
Adh	calypso	tandemrepeat	74562	74594	.	+	2	
# 11  x AAT							 
Adh	calypso	tandemrepeat	74562	74594	.	+	2	
# 11  x AAT							 
Adh	calypso	tandemrepeat	76467	76486	.	+	2	
# 4   x CGAAT							 
Adh	calypso	tandemrepeat	76467	76486	.	+	2	
# 4   x CGAAT							 
Adh	calypso	tandemrepeat	77989	78006	.	+	0	
# 9   x TG							 
Adh	calypso	tandemrepeat	77989	78006	.	+	0	
# 9   x TG							 
Adh	calypso	tandemrepeat	82238	82261	.	+	1	
# 4   x TATGTA							 
Adh	calypso	tandemrepeat	82238	82261	.	+	1	
# 4   x TATGTA							 
Adh	calypso	tandemrepeat	83275	83290	.	+	0	
# 4   x CAGA							 
Adh	calypso	tandemrepeat	83275	83290	.	+	0	
# 4   x CAGA							 
Adh	calypso	tandemrepeat	85957	85974	.	+	0	
# 6   x GCA							 
Adh	calypso	tandemrepeat	85957	85974	.	+	0	
# 6   x GCA							 
Adh	calypso	tandemrepeat	91308	91322	.	+	2	
# 5   x TCG							 
Adh	calypso	tandemrepeat	91308	91322	.	+	2	
# 5   x TCG							 
Adh	calypso	tandemrepeat	91308	91322	.	+	2	
# 5   x TCG							 
Adh	calypso	tandemrepeat	91308	91322	.	+	2	
# 5   x TCG							 
Adh	calypso	tandemrepeat	91725	91739	.	+	2	
# 3   x TGGTT							 
Adh	calypso	tandemrepeat	91725	91739	.	+	2	
# 3   x TGGTT							 
Adh	calypso	tandemrepeat	91725	91739	.	+	2	
# 3   x TGGTT							 
Adh	calypso	tandemrepeat	91725	91739	.	+	2	
# 3   x TGGTT							 
Adh	calypso	tandemrepeat	92979	93003	.	+	2	
# 25  x T							 
Adh	calypso	tandemrepeat	92979	93003	.	+	2	
# 25  x T							 
Adh	calypso	tandemrepeat	92979	93003	.	+	2	
# 25  x T							 
Adh	calypso	tandemrepeat	92979	93003	.	+	2	
# 25  x T							 
Adh	calypso	tandemrepeat	96698	96717	.	+	1	
# 10  x TG							 
Adh	calypso	tandemrepeat	96698	96717	.	+	1	
# 10  x TG							 
Adh	calypso	tandemrepeat	98583	98601	.	+	2	
# 19  x T							 
Adh	calypso	tandemrepeat	98583	98601	.	+	2	
# 19  x T							 
Adh	calypso	tandemrepeat	100384	100401	.	+	0	
# 18  x A							 
Adh	calypso	tandemrepeat	100384	100401	.	+	0	
# 18  x A							 
Adh	calypso	tandemrepeat	101289	101308	.	+	2	
# 20  x A							 
Adh	calypso	tandemrepeat	101289	101308	.	+	2	
# 20  x A							 
Adh	calypso	tandemrepeat	103257	103271	.	+	2	
# 3   x CTGGT							 
Adh	calypso	tandemrepeat	103257	103271	.	+	2	
# 3   x CTGGT							 
Adh	calypso	tandemrepeat	104183	104197	.	+	1	
# 5   x TCG							 
Adh	calypso	tandemrepeat	104183	104197	.	+	1	
# 5   x TCG							 
Adh	calypso	tandemrepeat	108993	109008	.	+	2	
# 16  x A							 
Adh	calypso	tandemrepeat	108993	109008	.	+	2	
# 16  x A							 
Adh	calypso	tandemrepeat	109140	109174	.	+	2	
# 7   x TATAT							 
Adh	calypso	tandemrepeat	109140	109174	.	+	2	
# 7   x TATAT							 
Adh	calypso	tandemrepeat	111964	111978	.	+	0	
# 5   x CAT							 
Adh	calypso	tandemrepeat	111964	111978	.	+	0	
# 5   x CAT							 
Adh	calypso	tandemrepeat	126718	126732	.	+	0	
# 3   x TGGAT							 
Adh	calypso	tandemrepeat	126718	126732	.	+	0	
# 3   x TGGAT							 
Adh	calypso	tandemrepeat	131119	131136	.	+	0	
# 6   x GCA							 
Adh	calypso	tandemrepeat	131119	131136	.	+	0	
# 6   x GCA							 
Adh	calypso	tandemrepeat	137480	137497	.	+	1	
# 18  x T							 
Adh	calypso	tandemrepeat	137480	137497	.	+	1	
# 18  x T							 
Adh	calypso	tandemrepeat	137480	137497	.	+	1	
# 18  x T							 
Adh	calypso	tandemrepeat	137480	137497	.	+	1	
# 18  x T							 
Adh	calypso	tandemrepeat	137594	137608	.	+	1	
# 5   x AAC							 
Adh	calypso	tandemrepeat	137594	137608	.	+	1	
# 5   x AAC							 
Adh	calypso	tandemrepeat	137594	137608	.	+	1	
# 5   x AAC							 
Adh	calypso	tandemrepeat	137594	137608	.	+	1	
# 5   x AAC							 
Adh	calypso	tandemrepeat	137931	137945	.	+	2	
# 3   x ATTGT							 
Adh	calypso	tandemrepeat	137931	137945	.	+	2	
# 3   x ATTGT							 
Adh	calypso	tandemrepeat	137931	137945	.	+	2	
# 3   x ATTGT							 
Adh	calypso	tandemrepeat	137931	137945	.	+	2	
# 3   x ATTGT							 
Adh	calypso	tandemrepeat	143823	143842	.	+	2	
# 10  x AC							 
Adh	calypso	tandemrepeat	143823	143842	.	+	2	
# 10  x AC							 
Adh	calypso	tandemrepeat	152870	152889	.	+	1	
# 10  x AC							 
Adh	calypso	tandemrepeat	152870	152889	.	+	1	
# 10  x AC							 
Adh	calypso	tandemrepeat	166341	166360	.	+	2	
# 5   x CAAA							 
Adh	calypso	tandemrepeat	166341	166360	.	+	2	
# 5   x CAAA							 
Adh	calypso	tandemrepeat	167926	167943	.	+	0	
# 9   x CA							 
Adh	calypso	tandemrepeat	167926	167943	.	+	0	
# 9   x CA							 
Adh	calypso	tandemrepeat	172510	172524	.	+	0	
# 5   x TGT							 
Adh	calypso	tandemrepeat	172510	172524	.	+	0	
# 5   x TGT							 
Adh	calypso	tandemrepeat	182041	182056	.	+	0	
# 4   x ACAA							 
Adh	calypso	tandemrepeat	182041	182056	.	+	0	
# 4   x ACAA							 
Adh	calypso	tandemrepeat	182041	182056	.	+	0	
# 4   x ACAA							 
Adh	calypso	tandemrepeat	182041	182056	.	+	0	
# 4   x ACAA							 
Adh	calypso	tandemrepeat	192791	192808	.	+	1	
# 3   x AATGGT							 
Adh	calypso	tandemrepeat	192791	192808	.	+	1	
# 3   x AATGGT							 
Adh	calypso	tandemrepeat	200058	200084	.	+	2	
# 9   x ACA							 
Adh	calypso	tandemrepeat	200058	200084	.	+	2	
# 9   x ACA							 
Adh	calypso	tandemrepeat	200215	200230	.	+	0	
# 16  x A							 
Adh	calypso	tandemrepeat	200215	200230	.	+	0	
# 16  x A							 
Adh	calypso	tandemrepeat	207660	207675	.	+	2	
# 4   x TCAA							 
Adh	calypso	tandemrepeat	207660	207675	.	+	2	
# 4   x TCAA							 
Adh	calypso	tandemrepeat	209347	209361	.	+	0	
# 15  x T							 
Adh	calypso	tandemrepeat	209347	209361	.	+	0	
# 15  x T							 
Adh	calypso	tandemrepeat	212843	212857	.	+	1	
# 5   x TTA							 
Adh	calypso	tandemrepeat	212843	212857	.	+	1	
# 5   x TTA							 
Adh	calypso	tandemrepeat	214781	214798	.	+	1	
# 3   x GGGCAT							 
Adh	calypso	tandemrepeat	214781	214798	.	+	1	
# 3   x GGGCAT							 
Adh	calypso	tandemrepeat	224959	224973	.	+	0	
# 3   x AATTA							 
Adh	calypso	tandemrepeat	224959	224973	.	+	0	
# 3   x AATTA							 
Adh	calypso	tandemrepeat	227156	227170	.	+	1	
# 5   x GCT							 
Adh	calypso	tandemrepeat	227156	227170	.	+	1	
# 5   x GCT							 
Adh	calypso	tandemrepeat	227156	227170	.	+	1	
# 5   x GCT							 
Adh	calypso	tandemrepeat	227156	227170	.	+	1	
# 5   x GCT							 
Adh	calypso	tandemrepeat	231257	231274	.	+	1	
# 3   x TCTTGG							 
Adh	calypso	tandemrepeat	231257	231274	.	+	1	
# 3   x TCTTGG							 
Adh	calypso	tandemrepeat	233834	233848	.	+	1	
# 5   x TAT							 
Adh	calypso	tandemrepeat	233834	233848	.	+	1	
# 5   x TAT							 
Adh	calypso	tandemrepeat	234017	234031	.	+	1	
# 3   x GGCGA							 
Adh	calypso	tandemrepeat	234017	234031	.	+	1	
# 3   x GGCGA							 
Adh	calypso	tandemrepeat	234438	234455	.	+	2	
# 3   x TCACAT							 
Adh	calypso	tandemrepeat	234438	234455	.	+	2	
# 3   x TCACAT							 
Adh	calypso	tandemrepeat	238711	238725	.	+	0	
# 5   x TGC							 
Adh	calypso	tandemrepeat	238711	238725	.	+	0	
# 5   x TGC							 
Adh	calypso	tandemrepeat	242300	242318	.	+	1	
# 19  x A							 
Adh	calypso	tandemrepeat	242300	242318	.	+	1	
# 19  x A							 
Adh	calypso	tandemrepeat	242376	242393	.	+	2	
# 9   x CA							 
Adh	calypso	tandemrepeat	242376	242393	.	+	2	
# 9   x CA							 
Adh	calypso	tandemrepeat	243709	243724	.	+	0	
# 16  x A							 
Adh	calypso	tandemrepeat	243709	243724	.	+	0	
# 16  x A							 
Adh	calypso	tandemrepeat	248282	248296	.	+	1	
# 5   x GAT							 
Adh	calypso	tandemrepeat	248282	248296	.	+	1	
# 5   x GAT							 
Adh	calypso	tandemrepeat	251018	251035	.	+	1	
# 3   x AGATAC							 
Adh	calypso	tandemrepeat	251018	251035	.	+	1	
# 3   x AGATAC							 
Adh	calypso	tandemrepeat	254583	254598	.	+	2	
# 8   x TA							 
Adh	calypso	tandemrepeat	254583	254598	.	+	2	
# 8   x TA							 
Adh	calypso	tandemrepeat	255611	255633	.	+	1	
# 23  x T							 
Adh	calypso	tandemrepeat	255611	255633	.	+	1	
# 23  x T							 
Adh	calypso	tandemrepeat	259848	259863	.	+	2	
# 4   x TATG							 
Adh	calypso	tandemrepeat	259848	259863	.	+	2	
# 4   x TATG							 
Adh	calypso	tandemrepeat	266340	266354	.	+	2	
# 3   x ATATA							 
Adh	calypso	tandemrepeat	266340	266354	.	+	2	
# 3   x ATATA							 
Adh	calypso	tandemrepeat	270098	270115	.	+	1	
# 9   x TG							 
Adh	calypso	tandemrepeat	270098	270115	.	+	1	
# 9   x TG							 
Adh	calypso	tandemrepeat	270098	270115	.	+	1	
# 9   x TG							 
Adh	calypso	tandemrepeat	270098	270115	.	+	1	
# 9   x TG							 
Adh	calypso	tandemrepeat	271285	271308	.	+	0	
# 8   x CTG							 
Adh	calypso	tandemrepeat	271285	271308	.	+	0	
# 8   x CTG							 
Adh	calypso	tandemrepeat	271285	271308	.	+	0	
# 8   x CTG							 
Adh	calypso	tandemrepeat	271285	271308	.	+	0	
# 8   x CTG							 
Adh	calypso	tandemrepeat	271412	271426	.	+	1	
# 3   x GCACA							 
Adh	calypso	tandemrepeat	271412	271426	.	+	1	
# 3   x GCACA							 
Adh	calypso	tandemrepeat	271412	271426	.	+	1	
# 3   x GCACA							 
Adh	calypso	tandemrepeat	271412	271426	.	+	1	
# 3   x GCACA							 
Adh	calypso	tandemrepeat	284448	284462	.	+	2	
# 15  x T							 
Adh	calypso	tandemrepeat	284448	284462	.	+	2	
# 15  x T							 
Adh	calypso	tandemrepeat	293149	293168	.	+	0	
# 10  x AT							 
Adh	calypso	tandemrepeat	293149	293168	.	+	0	
# 10  x AT							 
Adh	calypso	tandemrepeat	297736	297751	.	+	0	
# 4   x TTGT							 
Adh	calypso	tandemrepeat	297736	297751	.	+	0	
# 4   x TTGT							 
Adh	calypso	tandemrepeat	307350	307367	.	+	2	
# 3   x TATAAA							 
Adh	calypso	tandemrepeat	307350	307367	.	+	2	
# 3   x TATAAA							 
Adh	calypso	tandemrepeat	312806	312823	.	+	1	
# 6   x GCA							 
Adh	calypso	tandemrepeat	312806	312823	.	+	1	
# 6   x GCA							 
Adh	calypso	tandemrepeat	313243	313260	.	+	0	
# 9   x AT							 
Adh	calypso	tandemrepeat	313243	313260	.	+	0	
# 9   x AT							 
Adh	calypso	tandemrepeat	314920	314937	.	+	0	
# 3   x TTCGGA							 
Adh	calypso	tandemrepeat	314920	314937	.	+	0	
# 3   x TTCGGA							 
Adh	calypso	tandemrepeat	315342	315359	.	+	2	
# 6   x AAT							 
Adh	calypso	tandemrepeat	315342	315359	.	+	2	
# 6   x AAT							 
Adh	calypso	tandemrepeat	315342	315359	.	+	2	
# 6   x AAT							 
Adh	calypso	tandemrepeat	315342	315359	.	+	2	
# 6   x AAT							 
Adh	calypso	tandemrepeat	321786	321801	.	+	2	
# 16  x G							 
Adh	calypso	tandemrepeat	321786	321801	.	+	2	
# 16  x G							 
Adh	calypso	tandemrepeat	331264	331285	.	+	0	
# 11  x TG							 
Adh	calypso	tandemrepeat	331264	331285	.	+	0	
# 11  x TG							 
Adh	calypso	tandemrepeat	331475	331492	.	+	1	
# 3   x GGCAGC							 
Adh	calypso	tandemrepeat	331475	331492	.	+	1	
# 3   x GGCAGC							 
Adh	calypso	tandemrepeat	331997	332012	.	+	1	
# 16  x T							 
Adh	calypso	tandemrepeat	331997	332012	.	+	1	
# 16  x T							 
Adh	calypso	tandemrepeat	332637	332651	.	+	2	
# 5   x AAC							 
Adh	calypso	tandemrepeat	332637	332651	.	+	2	
# 5   x AAC							 
Adh	calypso	tandemrepeat	354987	355002	.	+	2	
# 16  x T							 
Adh	calypso	tandemrepeat	354987	355002	.	+	2	
# 16  x T							 
Adh	calypso	tandemrepeat	357348	357362	.	+	2	
# 3   x CACAC							 
Adh	calypso	tandemrepeat	357348	357362	.	+	2	
# 3   x CACAC							 
Adh	calypso	tandemrepeat	359448	359465	.	+	2	
# 3   x TCCTCA							 
Adh	calypso	tandemrepeat	359448	359465	.	+	2	
# 3   x TCCTCA							 
Adh	calypso	tandemrepeat	367195	367209	.	+	0	
# 3   x TTCAG							 
Adh	calypso	tandemrepeat	367195	367209	.	+	0	
# 3   x TTCAG							 
Adh	calypso	tandemrepeat	367673	367687	.	+	1	
# 3   x AATAT							 
Adh	calypso	tandemrepeat	367673	367687	.	+	1	
# 3   x AATAT							 
Adh	calypso	tandemrepeat	367803	367818	.	+	2	
# 16  x T							 
Adh	calypso	tandemrepeat	367803	367818	.	+	2	
# 16  x T							 
Adh	calypso	tandemrepeat	368001	368024	.	+	2	
# 4   x ATACAG							 
Adh	calypso	tandemrepeat	368001	368024	.	+	2	
# 4   x ATACAG							 
Adh	calypso	tandemrepeat	368715	368729	.	+	2	
# 3   x CTCCA							 
Adh	calypso	tandemrepeat	368715	368729	.	+	2	
# 3   x CTCCA							 
Adh	calypso	tandemrepeat	371089	371103	.	+	0	
# 5   x GCT							 
Adh	calypso	tandemrepeat	371089	371103	.	+	0	
# 5   x GCT							 
Adh	calypso	tandemrepeat	377546	377561	.	+	1	
# 4   x CTAT							 
Adh	calypso	tandemrepeat	377546	377561	.	+	1	
# 4   x CTAT							 
Adh	calypso	tandemrepeat	378071	378086	.	+	1	
# 4   x TATG							 
Adh	calypso	tandemrepeat	378071	378086	.	+	1	
# 4   x TATG							 
Adh	calypso	tandemrepeat	381769	381783	.	+	0	
# 5   x CCT							 
Adh	calypso	tandemrepeat	381769	381783	.	+	0	
# 5   x CCT							 
Adh	calypso	tandemrepeat	385735	385749	.	+	0	
# 5   x CAT							 
Adh	calypso	tandemrepeat	385735	385749	.	+	0	
# 5   x CAT							 
Adh	calypso	tandemrepeat	386121	386138	.	+	2	
# 3   x GCATTT							 
Adh	calypso	tandemrepeat	386121	386138	.	+	2	
# 3   x GCATTT							 
Adh	calypso	tandemrepeat	388289	388304	.	+	1	
# 8   x TG							 
Adh	calypso	tandemrepeat	388289	388304	.	+	1	
# 8   x TG							 
Adh	calypso	tandemrepeat	388376	388390	.	+	1	
# 3   x GGAGT							 
Adh	calypso	tandemrepeat	388376	388390	.	+	1	
# 3   x GGAGT							 
Adh	calypso	tandemrepeat	393337	393354	.	+	0	
# 3   x CAGTTT							 
Adh	calypso	tandemrepeat	393337	393354	.	+	0	
# 3   x CAGTTT							 
Adh	calypso	tandemrepeat	400273	400292	.	+	0	
# 20  x A							 
Adh	calypso	tandemrepeat	400273	400292	.	+	0	
# 20  x A							 
Adh	calypso	tandemrepeat	411848	411865	.	+	1	
# 3   x ATATAA							 
Adh	calypso	tandemrepeat	411848	411865	.	+	1	
# 3   x ATATAA							 
Adh	calypso	tandemrepeat	417518	417532	.	+	1	
# 5   x TGT							 
Adh	calypso	tandemrepeat	417518	417532	.	+	1	
# 5   x TGT							 
Adh	calypso	tandemrepeat	419180	419194	.	+	1	
# 3   x ACTCC							 
Adh	calypso	tandemrepeat	419180	419194	.	+	1	
# 3   x ACTCC							 
Adh	calypso	tandemrepeat	428234	428249	.	+	1	
# 8   x AT							 
Adh	calypso	tandemrepeat	428234	428249	.	+	1	
# 8   x AT							 
Adh	calypso	tandemrepeat	429724	429741	.	+	0	
# 3   x CAGTTG							 
Adh	calypso	tandemrepeat	429724	429741	.	+	0	
# 3   x CAGTTG							 
Adh	calypso	tandemrepeat	433158	433173	.	+	2	
# 16  x A							 
Adh	calypso	tandemrepeat	433158	433173	.	+	2	
# 16  x A							 
Adh	calypso	tandemrepeat	441893	441907	.	+	1	
# 15  x A							 
Adh	calypso	tandemrepeat	441893	441907	.	+	1	
# 15  x A							 
Adh	calypso	tandemrepeat	447518	447535	.	+	1	
# 3   x GTTGCA							 
Adh	calypso	tandemrepeat	447518	447535	.	+	1	
# 3   x GTTGCA							 
Adh	calypso	tandemrepeat	449494	449508	.	+	0	
# 15  x A							 
Adh	calypso	tandemrepeat	449494	449508	.	+	0	
# 15  x A							 
Adh	calypso	tandemrepeat	463991	464010	.	+	1	
# 4   x TATTT							 
Adh	calypso	tandemrepeat	463991	464010	.	+	1	
# 4   x TATTT							 
Adh	calypso	tandemrepeat	467074	467089	.	+	0	
# 4   x TATG							 
Adh	calypso	tandemrepeat	467074	467089	.	+	0	
# 4   x TATG							 
Adh	calypso	tandemrepeat	471909	471924	.	+	2	
# 16  x T							 
Adh	calypso	tandemrepeat	471909	471924	.	+	2	
# 16  x T							 
Adh	calypso	tandemrepeat	472925	472939	.	+	1	
# 5   x TAT							 
Adh	calypso	tandemrepeat	472925	472939	.	+	1	
# 5   x TAT							 
Adh	calypso	tandemrepeat	476610	476631	.	+	2	
# 11  x AT							 
Adh	calypso	tandemrepeat	476610	476631	.	+	2	
# 11  x AT							 
Adh	calypso	tandemrepeat	484358	484372	.	+	1	
# 15  x T							 
Adh	calypso	tandemrepeat	484358	484372	.	+	1	
# 15  x T							 
Adh	calypso	tandemrepeat	484595	484612	.	+	1	
# 9   x CA							 
Adh	calypso	tandemrepeat	484595	484612	.	+	1	
# 9   x CA							 
Adh	calypso	tandemrepeat	485890	485905	.	+	0	
# 4   x TTAT							 
Adh	calypso	tandemrepeat	485890	485905	.	+	0	
# 4   x TTAT							 
Adh	calypso	tandemrepeat	487040	487057	.	+	1	
# 6   x TGC							 
Adh	calypso	tandemrepeat	487040	487057	.	+	1	
# 6   x TGC							 
Adh	calypso	tandemrepeat	488023	488040	.	+	0	
# 9   x CA							 
Adh	calypso	tandemrepeat	488023	488040	.	+	0	
# 9   x CA							 
Adh	calypso	tandemrepeat	490320	490336	.	+	2	
# 17  x T							 
Adh	calypso	tandemrepeat	490320	490336	.	+	2	
# 17  x T							 
Adh	calypso	tandemrepeat	493299	493314	.	+	2	
# 16  x T							 
Adh	calypso	tandemrepeat	493299	493314	.	+	2	
# 16  x T							 
Adh	calypso	tandemrepeat	494589	494604	.	+	2	
# 8   x AC							 
Adh	calypso	tandemrepeat	494589	494604	.	+	2	
# 8   x AC							 
Adh	calypso	tandemrepeat	495032	495052	.	+	1	
# 7   x GCA							 
Adh	calypso	tandemrepeat	495032	495052	.	+	1	
# 7   x GCA							 
Adh	calypso	tandemrepeat	495032	495052	.	+	1	
# 7   x GCA							 
Adh	calypso	tandemrepeat	495032	495052	.	+	1	
# 7   x GCA							 
Adh	calypso	tandemrepeat	499214	499229	.	+	1	
# 4   x TAGT							 
Adh	calypso	tandemrepeat	499214	499229	.	+	1	
# 4   x TAGT							 
Adh	calypso	tandemrepeat	499214	499229	.	+	1	
# 4   x TAGT							 
Adh	calypso	tandemrepeat	499214	499229	.	+	1	
# 4   x TAGT							 
Adh	calypso	tandemrepeat	501325	501339	.	+	0	
# 15  x A							 
Adh	calypso	tandemrepeat	501325	501339	.	+	0	
# 15  x A							 
Adh	calypso	tandemrepeat	502593	502607	.	+	2	
# 3   x CAAAA							 
Adh	calypso	tandemrepeat	502593	502607	.	+	2	
# 3   x CAAAA							 
Adh	calypso	tandemrepeat	503810	503825	.	+	1	
# 16  x A							 
Adh	calypso	tandemrepeat	503810	503825	.	+	1	
# 16  x A							 
Adh	calypso	tandemrepeat	507896	507919	.	+	1	
# 6   x TCCA							 
Adh	calypso	tandemrepeat	507896	507919	.	+	1	
# 6   x TCCA							 
Adh	calypso	tandemrepeat	515838	515861	.	+	2	
# 12  x TG							 
Adh	calypso	tandemrepeat	515838	515861	.	+	2	
# 12  x TG							 
Adh	calypso	tandemrepeat	529704	529718	.	+	2	
# 3   x CATTT							 
Adh	calypso	tandemrepeat	529704	529718	.	+	2	
# 3   x CATTT							 
Adh	calypso	tandemrepeat	533284	533299	.	+	0	
# 4   x ATTT							 
Adh	calypso	tandemrepeat	533284	533299	.	+	0	
# 4   x ATTT							 
Adh	calypso	tandemrepeat	534250	534267	.	+	0	
# 9   x GT							 
Adh	calypso	tandemrepeat	534250	534267	.	+	0	
# 9   x GT							 
Adh	calypso	tandemrepeat	534551	534571	.	+	1	
# 7   x CAT							 
Adh	calypso	tandemrepeat	534551	534571	.	+	1	
# 7   x CAT							 
Adh	calypso	tandemrepeat	538105	538122	.	+	0	
# 9   x TG							 
Adh	calypso	tandemrepeat	538105	538122	.	+	0	
# 9   x TG							 
Adh	calypso	tandemrepeat	539677	539694	.	+	0	
# 3   x GATACA							 
Adh	calypso	tandemrepeat	539677	539694	.	+	0	
# 3   x GATACA							 
Adh	calypso	tandemrepeat	539709	539726	.	+	2	
# 9   x CA							 
Adh	calypso	tandemrepeat	539709	539726	.	+	2	
# 9   x CA							 
Adh	calypso	tandemrepeat	543940	543963	.	+	0	
# 12  x TG							 
Adh	calypso	tandemrepeat	543940	543963	.	+	0	
# 12  x TG							 
Adh	calypso	tandemrepeat	543940	543963	.	+	0	
# 12  x TG							 
Adh	calypso	tandemrepeat	543940	543963	.	+	0	
# 12  x TG							 
Adh	calypso	tandemrepeat	544062	544079	.	+	2	
# 3   x TGCCTT							 
Adh	calypso	tandemrepeat	544062	544079	.	+	2	
# 3   x TGCCTT							 
Adh	calypso	tandemrepeat	544062	544079	.	+	2	
# 3   x TGCCTT							 
Adh	calypso	tandemrepeat	544062	544079	.	+	2	
# 3   x TGCCTT							 
Adh	calypso	tandemrepeat	545026	545040	.	+	0	
# 5   x TGC							 
Adh	calypso	tandemrepeat	545026	545040	.	+	0	
# 5   x TGC							 
Adh	calypso	tandemrepeat	546049	546068	.	+	0	
# 4   x TTTTA							 
Adh	calypso	tandemrepeat	546049	546068	.	+	0	
# 4   x TTTTA							 
Adh	calypso	tandemrepeat	546183	546200	.	+	2	
# 9   x GT							 
Adh	calypso	tandemrepeat	546183	546200	.	+	2	
# 9   x GT							 
Adh	calypso	tandemrepeat	548133	548154	.	+	2	
# 11  x CA							 
Adh	calypso	tandemrepeat	548133	548154	.	+	2	
# 11  x CA							 
Adh	calypso	tandemrepeat	559442	559457	.	+	1	
# 8   x TG							 
Adh	calypso	tandemrepeat	559442	559457	.	+	1	
# 8   x TG							 
Adh	calypso	tandemrepeat	562060	562079	.	+	0	
# 10  x GT							 
Adh	calypso	tandemrepeat	562060	562079	.	+	0	
# 10  x GT							 
Adh	calypso	tandemrepeat	563160	563177	.	+	2	
# 9   x CA							 
Adh	calypso	tandemrepeat	563160	563177	.	+	2	
# 9   x CA							 
Adh	calypso	tandemrepeat	563387	563402	.	+	1	
# 4   x GGTT							 
Adh	calypso	tandemrepeat	563387	563402	.	+	1	
# 4   x GGTT							 
Adh	calypso	tandemrepeat	567593	567609	.	+	1	
# 17  x T							 
Adh	calypso	tandemrepeat	567593	567609	.	+	1	
# 17  x T							 
Adh	calypso	tandemrepeat	568971	568986	.	+	2	
# 8   x CA							 
Adh	calypso	tandemrepeat	568971	568986	.	+	2	
# 8   x CA							 
Adh	calypso	tandemrepeat	574093	574107	.	+	0	
# 5   x CTA							 
Adh	calypso	tandemrepeat	574093	574107	.	+	0	
# 5   x CTA							 
Adh	calypso	tandemrepeat	577165	577180	.	+	0	
# 8   x AT							 
Adh	calypso	tandemrepeat	577165	577180	.	+	0	
# 8   x AT							 
Adh	calypso	tandemrepeat	577385	577400	.	+	1	
# 4   x CCAA							 
Adh	calypso	tandemrepeat	577385	577400	.	+	1	
# 4   x CCAA							 
Adh	calypso	tandemrepeat	583460	583477	.	+	1	
# 9   x AT							 
Adh	calypso	tandemrepeat	583460	583477	.	+	1	
# 9   x AT							 
Adh	calypso	tandemrepeat	589692	589709	.	+	2	
# 6   x TGT							 
Adh	calypso	tandemrepeat	589692	589709	.	+	2	
# 6   x TGT							 
Adh	calypso	tandemrepeat	589692	589709	.	+	2	
# 6   x TGT							 
Adh	calypso	tandemrepeat	589692	589709	.	+	2	
# 6   x TGT							 
Adh	calypso	tandemrepeat	591168	591191	.	+	2	
# 12  x CA							 
Adh	calypso	tandemrepeat	591168	591191	.	+	2	
# 12  x CA							 
Adh	calypso	tandemrepeat	591549	591564	.	+	2	
# 8   x AC							 
Adh	calypso	tandemrepeat	591549	591564	.	+	2	
# 8   x AC							 
Adh	calypso	tandemrepeat	594324	594339	.	+	2	
# 8   x TG							 
Adh	calypso	tandemrepeat	594324	594339	.	+	2	
# 8   x TG							 
Adh	calypso	tandemrepeat	599735	599752	.	+	1	
# 3   x CAGTCA							 
Adh	calypso	tandemrepeat	599735	599752	.	+	1	
# 3   x CAGTCA							 
Adh	calypso	tandemrepeat	601674	601693	.	+	2	
# 10  x AT							 
Adh	calypso	tandemrepeat	601674	601693	.	+	2	
# 10  x AT							 
Adh	calypso	tandemrepeat	604540	604555	.	+	0	
# 8   x TA							 
Adh	calypso	tandemrepeat	604540	604555	.	+	0	
# 8   x TA							 
Adh	calypso	tandemrepeat	606257	606272	.	+	1	
# 8   x TG							 
Adh	calypso	tandemrepeat	606257	606272	.	+	1	
# 8   x TG							 
Adh	calypso	tandemrepeat	607358	607377	.	+	1	
# 10  x TG							 
Adh	calypso	tandemrepeat	607358	607377	.	+	1	
# 10  x TG							 
Adh	calypso	tandemrepeat	607856	607872	.	+	1	
# 17  x A							 
Adh	calypso	tandemrepeat	607856	607872	.	+	1	
# 17  x A							 
Adh	calypso	tandemrepeat	609272	609287	.	+	1	
# 8   x CA							 
Adh	calypso	tandemrepeat	609272	609287	.	+	1	
# 8   x CA							 
Adh	calypso	tandemrepeat	609701	609726	.	+	1	
# 13  x CA							 
Adh	calypso	tandemrepeat	609701	609726	.	+	1	
# 13  x CA							 
Adh	calypso	tandemrepeat	612948	612965	.	+	2	
# 9   x GT							 
Adh	calypso	tandemrepeat	612948	612965	.	+	2	
# 9   x GT							 
Adh	calypso	tandemrepeat	617773	617787	.	+	0	
# 15  x T							 
Adh	calypso	tandemrepeat	617773	617787	.	+	0	
# 15  x T							 
Adh	calypso	tandemrepeat	618402	618419	.	+	2	
# 9   x GT							 
Adh	calypso	tandemrepeat	618402	618419	.	+	2	
# 9   x GT							 
Adh	calypso	tandemrepeat	618655	618670	.	+	0	
# 16  x G							 
Adh	calypso	tandemrepeat	618655	618670	.	+	0	
# 16  x G							 
Adh	calypso	tandemrepeat	620005	620022	.	+	0	
# 9   x TG							 
Adh	calypso	tandemrepeat	620005	620022	.	+	0	
# 9   x TG							 
Adh	calypso	tandemrepeat	622152	622169	.	+	2	
# 3   x TTGTAG							 
Adh	calypso	tandemrepeat	622152	622169	.	+	2	
# 3   x TTGTAG							 
Adh	calypso	tandemrepeat	622509	622530	.	+	2	
# 11  x AC							 
Adh	calypso	tandemrepeat	622509	622530	.	+	2	
# 11  x AC							 
Adh	calypso	tandemrepeat	622870	622884	.	+	0	
# 15  x G							 
Adh	calypso	tandemrepeat	622870	622884	.	+	0	
# 15  x G							 
Adh	calypso	tandemrepeat	622975	622992	.	+	0	
# 6   x CTG							 
Adh	calypso	tandemrepeat	622975	622992	.	+	0	
# 6   x CTG							 
Adh	calypso	tandemrepeat	624332	624349	.	+	1	
# 9   x CA							 
Adh	calypso	tandemrepeat	624332	624349	.	+	1	
# 9   x CA							 
Adh	calypso	tandemrepeat	627015	627039	.	+	2	
# 5   x CCAAC							 
Adh	calypso	tandemrepeat	627015	627039	.	+	2	
# 5   x CCAAC							 
Adh	calypso	tandemrepeat	630667	630681	.	+	0	
# 3   x ATTAC							 
Adh	calypso	tandemrepeat	630667	630681	.	+	0	
# 3   x ATTAC							 
Adh	calypso	tandemrepeat	630667	630681	.	+	0	
# 3   x ATTAC							 
Adh	calypso	tandemrepeat	630667	630681	.	+	0	
# 3   x ATTAC							 
Adh	calypso	tandemrepeat	649044	649069	.	+	2	
# 13  x TG							 
Adh	calypso	tandemrepeat	649044	649069	.	+	2	
# 13  x TG							 
Adh	calypso	tandemrepeat	659049	659069	.	+	2	
# 7   x GTG							 
Adh	calypso	tandemrepeat	659049	659069	.	+	2	
# 7   x GTG							 
Adh	calypso	tandemrepeat	661041	661055	.	+	2	
# 5   x CTG							 
Adh	calypso	tandemrepeat	661041	661055	.	+	2	
# 5   x CTG							 
Adh	calypso	tandemrepeat	661129	661146	.	+	0	
# 6   x TGC							 
Adh	calypso	tandemrepeat	661129	661146	.	+	0	
# 6   x TGC							 
Adh	calypso	tandemrepeat	669576	669602	.	+	2	
# 9   x GCA							 
Adh	calypso	tandemrepeat	669576	669602	.	+	2	
# 9   x GCA							 
Adh	calypso	tandemrepeat	669827	669844	.	+	1	
# 3   x TGCTAT							 
Adh	calypso	tandemrepeat	669827	669844	.	+	1	
# 3   x TGCTAT							 
Adh	calypso	tandemrepeat	676949	676966	.	+	1	
# 3   x GATCAT							 
Adh	calypso	tandemrepeat	676949	676966	.	+	1	
# 3   x GATCAT							 
Adh	calypso	tandemrepeat	676949	676966	.	+	1	
# 3   x GATCAT							 
Adh	calypso	tandemrepeat	676949	676966	.	+	1	
# 3   x GATCAT							 
Adh	calypso	tandemrepeat	680908	680923	.	+	0	
# 4   x AAGT							 
Adh	calypso	tandemrepeat	680908	680923	.	+	0	
# 4   x AAGT							 
Adh	calypso	tandemrepeat	687118	687135	.	+	0	
# 9   x CA							 
Adh	calypso	tandemrepeat	687118	687135	.	+	0	
# 9   x CA							 
Adh	calypso	tandemrepeat	688329	688343	.	+	2	
# 15  x T							 
Adh	calypso	tandemrepeat	688329	688343	.	+	2	
# 15  x T							 
Adh	calypso	tandemrepeat	690828	690842	.	+	2	
# 5   x TGT							 
Adh	calypso	tandemrepeat	690828	690842	.	+	2	
# 5   x TGT							 
Adh	calypso	tandemrepeat	691711	691731	.	+	0	
# 7   x ATA							 
Adh	calypso	tandemrepeat	691711	691731	.	+	0	
# 7   x ATA							 
Adh	calypso	tandemrepeat	697796	697811	.	+	1	
# 8   x TG							 
Adh	calypso	tandemrepeat	697796	697811	.	+	1	
# 8   x TG							 
Adh	calypso	tandemrepeat	704064	704083	.	+	2	
# 4   x ACTCC							 
Adh	calypso	tandemrepeat	704064	704083	.	+	2	
# 4   x ACTCC							 
Adh	calypso	tandemrepeat	704275	704290	.	+	0	
# 4   x ATCT							 
Adh	calypso	tandemrepeat	704275	704290	.	+	0	
# 4   x ATCT							 
Adh	calypso	tandemrepeat	706091	706105	.	+	1	
# 15  x A							 
Adh	calypso	tandemrepeat	706091	706105	.	+	1	
# 15  x A							 
Adh	calypso	tandemrepeat	710193	710219	.	+	2	
# 9   x TAT							 
Adh	calypso	tandemrepeat	710193	710219	.	+	2	
# 9   x TAT							 
Adh	calypso	tandemrepeat	710810	710824	.	+	1	
# 15  x A							 
Adh	calypso	tandemrepeat	710810	710824	.	+	1	
# 15  x A							 
Adh	calypso	tandemrepeat	711842	711859	.	+	1	
# 3   x GTCGTT							 
Adh	calypso	tandemrepeat	711842	711859	.	+	1	
# 3   x GTCGTT							 
Adh	calypso	tandemrepeat	712971	712988	.	+	2	
# 9   x GT							 
Adh	calypso	tandemrepeat	712971	712988	.	+	2	
# 9   x GT							 
Adh	calypso	tandemrepeat	717661	717675	.	+	0	
# 3   x GCCAA							 
Adh	calypso	tandemrepeat	717661	717675	.	+	0	
# 3   x GCCAA							 
Adh	calypso	tandemrepeat	720535	720552	.	+	0	
# 18  x T							 
Adh	calypso	tandemrepeat	720535	720552	.	+	0	
# 18  x T							 
Adh	calypso	tandemrepeat	720535	720552	.	+	0	
# 18  x T							 
Adh	calypso	tandemrepeat	733228	733245	.	+	0	
# 18  x A							 
Adh	calypso	tandemrepeat	733228	733245	.	+	0	
# 18  x A							 
Adh	calypso	tandemrepeat	735072	735091	.	+	2	
# 4   x TATTA							 
Adh	calypso	tandemrepeat	735072	735091	.	+	2	
# 4   x TATTA							 
Adh	calypso	tandemrepeat	738596	738611	.	+	1	
# 4   x ATAA							 
Adh	calypso	tandemrepeat	738596	738611	.	+	1	
# 4   x ATAA							 
Adh	calypso	tandemrepeat	740801	740815	.	+	1	
# 15  x T							 
Adh	calypso	tandemrepeat	740801	740815	.	+	1	
# 15  x T							 
Adh	calypso	tandemrepeat	741415	741429	.	+	0	
# 3   x GTAAA							 
Adh	calypso	tandemrepeat	741415	741429	.	+	0	
# 3   x GTAAA							 
Adh	calypso	tandemrepeat	743744	743761	.	+	1	
# 3   x AAAGCC							 
Adh	calypso	tandemrepeat	743744	743761	.	+	1	
# 3   x AAAGCC							 
Adh	calypso	tandemrepeat	758073	758098	.	+	2	
# 26  x T							 
Adh	calypso	tandemrepeat	758073	758098	.	+	2	
# 26  x T							 
Adh	calypso	tandemrepeat	759896	759913	.	+	1	
# 3   x ATACAG							 
Adh	calypso	tandemrepeat	759896	759913	.	+	1	
# 3   x ATACAG							 
Adh	calypso	tandemrepeat	765789	765803	.	+	2	
# 3   x TCCAT							 
Adh	calypso	tandemrepeat	765789	765803	.	+	2	
# 3   x TCCAT							 
Adh	calypso	tandemrepeat	765789	765803	.	+	2	
# 3   x TCCAT							 
Adh	calypso	tandemrepeat	765789	765803	.	+	2	
# 3   x TCCAT							 
Adh	calypso	tandemrepeat	767787	767802	.	+	2	
# 4   x TCTG							 
Adh	calypso	tandemrepeat	767787	767802	.	+	2	
# 4   x TCTG							 
Adh	calypso	tandemrepeat	767787	767802	.	+	2	
# 4   x TCTG							 
Adh	calypso	tandemrepeat	767787	767802	.	+	2	
# 4   x TCTG							 
Adh	calypso	tandemrepeat	767944	767958	.	+	0	
# 3   x GGTCT							 
Adh	calypso	tandemrepeat	767944	767958	.	+	0	
# 3   x GGTCT							 
Adh	calypso	tandemrepeat	767944	767958	.	+	0	
# 3   x GGTCT							 
Adh	calypso	tandemrepeat	767944	767958	.	+	0	
# 3   x GGTCT							 
Adh	calypso	tandemrepeat	772182	772211	.	+	2	
# 5   x TCGGGA							 
Adh	calypso	tandemrepeat	772182	772211	.	+	2	
# 5   x TCGGGA							 
Adh	calypso	tandemrepeat	773325	773348	.	+	2	
# 4   x AAAGGC							 
Adh	calypso	tandemrepeat	773325	773348	.	+	2	
# 4   x AAAGGC							 
Adh	calypso	tandemrepeat	781674	781688	.	+	2	
# 3   x AAATT							 
Adh	calypso	tandemrepeat	781674	781688	.	+	2	
# 3   x AAATT							 
Adh	calypso	tandemrepeat	784148	784162	.	+	1	
# 5   x AGC							 
Adh	calypso	tandemrepeat	784148	784162	.	+	1	
# 5   x AGC							 
Adh	calypso	tandemrepeat	784264	784278	.	+	0	
# 3   x CCAAG							 
Adh	calypso	tandemrepeat	784264	784278	.	+	0	
# 3   x CCAAG							 
Adh	calypso	tandemrepeat	784461	784475	.	+	2	
# 15  x A							 
Adh	calypso	tandemrepeat	784461	784475	.	+	2	
# 15  x A							 
Adh	calypso	tandemrepeat	796709	796728	.	+	1	
# 4   x TCGCA							 
Adh	calypso	tandemrepeat	796709	796728	.	+	1	
# 4   x TCGCA							 
Adh	calypso	tandemrepeat	797684	797701	.	+	1	
# 3   x CAAAGT							 
Adh	calypso	tandemrepeat	797684	797701	.	+	1	
# 3   x CAAAGT							 
Adh	calypso	tandemrepeat	802077	802091	.	+	2	
# 5   x CAG							 
Adh	calypso	tandemrepeat	802077	802091	.	+	2	
# 5   x CAG							 
Adh	calypso	tandemrepeat	802572	802589	.	+	2	
# 6   x CAG							 
Adh	calypso	tandemrepeat	802572	802589	.	+	2	
# 6   x CAG							 
Adh	calypso	tandemrepeat	808315	808329	.	+	0	
# 3   x TCGGA							 
Adh	calypso	tandemrepeat	808315	808329	.	+	0	
# 3   x TCGGA							 
Adh	calypso	tandemrepeat	821966	821980	.	+	1	
# 3   x AATAA							 
Adh	calypso	tandemrepeat	821966	821980	.	+	1	
# 3   x AATAA							 
Adh	calypso	tandemrepeat	828833	828848	.	+	1	
# 8   x AC							 
Adh	calypso	tandemrepeat	828833	828848	.	+	1	
# 8   x AC							 
Adh	calypso	tandemrepeat	829935	829954	.	+	2	
# 5   x AATA							 
Adh	calypso	tandemrepeat	829935	829954	.	+	2	
# 5   x AATA							 
Adh	calypso	tandemrepeat	832947	832961	.	+	2	
# 5   x CAG							 
Adh	calypso	tandemrepeat	832947	832961	.	+	2	
# 5   x CAG							 
Adh	calypso	tandemrepeat	850690	850704	.	+	0	
# 15  x T							 
Adh	calypso	tandemrepeat	850690	850704	.	+	0	
# 15  x T							 
Adh	calypso	tandemrepeat	851045	851059	.	+	1	
# 5   x TAA							 
Adh	calypso	tandemrepeat	851045	851059	.	+	1	
# 5   x TAA							 
Adh	calypso	tandemrepeat	852082	852096	.	+	0	
# 15  x A							 
Adh	calypso	tandemrepeat	852082	852096	.	+	0	
# 15  x A							 
Adh	calypso	tandemrepeat	877842	877859	.	+	2	
# 3   x TGCAGT							 
Adh	calypso	tandemrepeat	877842	877859	.	+	2	
# 3   x TGCAGT							 
Adh	calypso	tandemrepeat	879111	879140	.	+	2	
# 15  x CT							 
Adh	calypso	tandemrepeat	879111	879140	.	+	2	
# 15  x CT							 
Adh	calypso	tandemrepeat	881602	881616	.	+	0	
# 3   x GCATC							 
Adh	calypso	tandemrepeat	881602	881616	.	+	0	
# 3   x GCATC							 
Adh	calypso	tandemrepeat	881685	881699	.	+	2	
# 3   x ATCAA							 
Adh	calypso	tandemrepeat	881685	881699	.	+	2	
# 3   x ATCAA							 
Adh	calypso	tandemrepeat	886116	886133	.	+	2	
# 3   x GCCGCT							 
Adh	calypso	tandemrepeat	886116	886133	.	+	2	
# 3   x GCCGCT							 
Adh	calypso	tandemrepeat	886492	886509	.	+	0	
# 6   x TGC							 
Adh	calypso	tandemrepeat	886492	886509	.	+	0	
# 6   x TGC							 
Adh	calypso	tandemrepeat	889369	889385	.	+	0	
# 17  x A							 
Adh	calypso	tandemrepeat	889369	889385	.	+	0	
# 17  x A							 
Adh	calypso	tandemrepeat	889677	889691	.	+	2	
# 3   x TGATT							 
Adh	calypso	tandemrepeat	889677	889691	.	+	2	
# 3   x TGATT							 
Adh	calypso	tandemrepeat	890317	890334	.	+	0	
# 6   x TTG							 
Adh	calypso	tandemrepeat	890317	890334	.	+	0	
# 6   x TTG							 
Adh	calypso	tandemrepeat	892159	892182	.	+	0	
# 4   x GTTGCT							 
Adh	calypso	tandemrepeat	892159	892182	.	+	0	
# 4   x GTTGCT							 
Adh	calypso	tandemrepeat	892925	892940	.	+	1	
# 4   x ATCT							 
Adh	calypso	tandemrepeat	892925	892940	.	+	1	
# 4   x ATCT							 
Adh	calypso	tandemrepeat	893320	893334	.	+	0	
# 15  x A							 
Adh	calypso	tandemrepeat	893320	893334	.	+	0	
# 15  x A							 
Adh	calypso	tandemrepeat	899819	899843	.	+	1	
# 5   x CCAAA							 
Adh	calypso	tandemrepeat	899819	899843	.	+	1	
# 5   x CCAAA							 
Adh	calypso	tandemrepeat	900010	900029	.	+	0	
# 5   x GACT							 
Adh	calypso	tandemrepeat	900010	900029	.	+	0	
# 5   x GACT							 
Adh	calypso	tandemrepeat	900010	900029	.	+	0	
# 5   x GACT							 
Adh	calypso	tandemrepeat	900010	900029	.	+	0	
# 5   x GACT							 
Adh	calypso	tandemrepeat	901102	901119	.	+	0	
# 9   x GT							 
Adh	calypso	tandemrepeat	901102	901119	.	+	0	
# 9   x GT							 
Adh	calypso	tandemrepeat	901102	901119	.	+	0	
# 9   x GT							 
Adh	calypso	tandemrepeat	901102	901119	.	+	0	
# 9   x GT							 
Adh	calypso	tandemrepeat	910341	910355	.	+	2	
# 3   x TTAAT							 
Adh	calypso	tandemrepeat	910341	910355	.	+	2	
# 3   x TTAAT							 
Adh	calypso	tandemrepeat	914388	914402	.	+	2	
# 3   x AGTCG							 
Adh	calypso	tandemrepeat	914388	914402	.	+	2	
# 3   x AGTCG							 
Adh	calypso	tandemrepeat	919523	919537	.	+	1	
# 3   x ATCCC							 
Adh	calypso	tandemrepeat	919523	919537	.	+	1	
# 3   x ATCCC							 
Adh	calypso	tandemrepeat	920663	920680	.	+	1	
# 6   x CAG							 
Adh	calypso	tandemrepeat	920663	920680	.	+	1	
# 6   x CAG							 
Adh	calypso	tandemrepeat	926131	926151	.	+	0	
# 7   x GCA							 
Adh	calypso	tandemrepeat	926131	926151	.	+	0	
# 7   x GCA							 
Adh	calypso	tandemrepeat	930584	930607	.	+	1	
# 4   x CCCATT							 
Adh	calypso	tandemrepeat	930584	930607	.	+	1	
# 4   x CCCATT							 
Adh	calypso	tandemrepeat	931193	931207	.	+	1	
# 3   x AACGA							 
Adh	calypso	tandemrepeat	931193	931207	.	+	1	
# 3   x AACGA							 
Adh	calypso	tandemrepeat	936152	936179	.	+	1	
# 7   x TATG							 
Adh	calypso	tandemrepeat	936152	936179	.	+	1	
# 7   x TATG							 
Adh	calypso	tandemrepeat	948020	948034	.	+	1	
# 3   x TCAGC							 
Adh	calypso	tandemrepeat	948020	948034	.	+	1	
# 3   x TCAGC							 
Adh	calypso	tandemrepeat	948020	948034	.	+	1	
# 3   x TCAGC							 
Adh	calypso	tandemrepeat	948020	948034	.	+	1	
# 3   x TCAGC							 
Adh	calypso	tandemrepeat	949088	949115	.	+	1	
# 7   x GATG							 
Adh	calypso	tandemrepeat	949088	949115	.	+	1	
# 7   x GATG							 
Adh	calypso	tandemrepeat	949088	949115	.	+	1	
# 7   x GATG							 
Adh	calypso	tandemrepeat	949088	949115	.	+	1	
# 7   x GATG							 
Adh	calypso	tandemrepeat	950677	950696	.	+	0	
# 10  x TG							 
Adh	calypso	tandemrepeat	950677	950696	.	+	0	
# 10  x TG							 
Adh	calypso	tandemrepeat	951654	951668	.	+	2	
# 5   x TGT							 
Adh	calypso	tandemrepeat	951654	951668	.	+	2	
# 5   x TGT							 
Adh	calypso	tandemrepeat	954660	954675	.	+	2	
# 16  x A							 
Adh	calypso	tandemrepeat	954660	954675	.	+	2	
# 16  x A							 
Adh	calypso	tandemrepeat	955339	955353	.	+	0	
# 3   x TGAGC							 
Adh	calypso	tandemrepeat	955339	955353	.	+	0	
# 3   x TGAGC							 
Adh	calypso	tandemrepeat	959024	959038	.	+	1	
# 15  x T							 
Adh	calypso	tandemrepeat	959024	959038	.	+	1	
# 15  x T							 
Adh	calypso	tandemrepeat	959377	959393	.	+	0	
# 17  x T							 
Adh	calypso	tandemrepeat	959377	959393	.	+	0	
# 17  x T							 
Adh	calypso	tandemrepeat	959936	959960	.	+	1	
# 25  x T							 
Adh	calypso	tandemrepeat	959936	959960	.	+	1	
# 25  x T							 
Adh	calypso	tandemrepeat	960528	960542	.	+	2	
# 5   x TTA							 
Adh	calypso	tandemrepeat	960528	960542	.	+	2	
# 5   x TTA							 
Adh	calypso	tandemrepeat	966188	966207	.	+	1	
# 10  x CA							 
Adh	calypso	tandemrepeat	966188	966207	.	+	1	
# 10  x CA							 
Adh	calypso	tandemrepeat	968087	968106	.	+	1	
# 10  x GT							 
Adh	calypso	tandemrepeat	968087	968106	.	+	1	
# 10  x GT							 
Adh	calypso	tandemrepeat	970545	970559	.	+	2	
# 3   x ATTGG							 
Adh	calypso	tandemrepeat	970545	970559	.	+	2	
# 3   x ATTGG							 
Adh	calypso	tandemrepeat	971138	971155	.	+	1	
# 3   x CGATAA							 
Adh	calypso	tandemrepeat	971138	971155	.	+	1	
# 3   x CGATAA							 
Adh	calypso	tandemrepeat	985994	986008	.	+	1	
# 5   x GCA							 
Adh	calypso	tandemrepeat	985994	986008	.	+	1	
# 5   x GCA							 
Adh	calypso	tandemrepeat	996726	996740	.	+	2	
# 5   x GGC							 
Adh	calypso	tandemrepeat	996726	996740	.	+	2	
# 5   x GGC							 
Adh	calypso	tandemrepeat	1002557	1002571	.	+	1	
# 3   x AACTC							 
Adh	calypso	tandemrepeat	1002557	1002571	.	+	1	
# 3   x AACTC							 
Adh	calypso	tandemrepeat	1002591	1002605	.	+	2	
# 3   x GAACT							 
Adh	calypso	tandemrepeat	1002591	1002605	.	+	2	
# 3   x GAACT							 
Adh	calypso	tandemrepeat	1002776	1002793	.	+	1	
# 9   x AG							 
Adh	calypso	tandemrepeat	1002776	1002793	.	+	1	
# 9   x AG							 
Adh	calypso	tandemrepeat	1005219	1005233	.	+	2	
# 5   x CAG							 
Adh	calypso	tandemrepeat	1005219	1005233	.	+	2	
# 5   x CAG							 
Adh	calypso	tandemrepeat	1005416	1005432	.	+	1	
# 17  x T							 
Adh	calypso	tandemrepeat	1005416	1005432	.	+	1	
# 17  x T							 
Adh	calypso	tandemrepeat	1005865	1005880	.	+	0	
# 4   x CTGA							 
Adh	calypso	tandemrepeat	1005865	1005880	.	+	0	
# 4   x CTGA							 
Adh	calypso	tandemrepeat	1014404	1014418	.	+	1	
# 3   x CGTTA							 
Adh	calypso	tandemrepeat	1014404	1014418	.	+	1	
# 3   x CGTTA							 
Adh	calypso	tandemrepeat	1015976	1015992	.	+	1	
# 17  x T							 
Adh	calypso	tandemrepeat	1015976	1015992	.	+	1	
# 17  x T							 
Adh	calypso	tandemrepeat	1020695	1020709	.	+	1	
# 3   x ATAAT							 
Adh	calypso	tandemrepeat	1020695	1020709	.	+	1	
# 3   x ATAAT							 
Adh	calypso	tandemrepeat	1020710	1020724	.	+	1	
# 3   x ATATA							 
Adh	calypso	tandemrepeat	1020710	1020724	.	+	1	
# 3   x ATATA							 
Adh	calypso	tandemrepeat	1021501	1021515	.	+	0	
# 15  x T							 
Adh	calypso	tandemrepeat	1021501	1021515	.	+	0	
# 15  x T							 
Adh	calypso	tandemrepeat	1026809	1026826	.	+	1	
# 3   x ATTGCG							 
Adh	calypso	tandemrepeat	1026809	1026826	.	+	1	
# 3   x ATTGCG							 
Adh	calypso	tandemrepeat	1027847	1027863	.	+	1	
# 17  x A							 
Adh	calypso	tandemrepeat	1027847	1027863	.	+	1	
# 17  x A							 
Adh	calypso	tandemrepeat	1038688	1038702	.	+	0	
# 5   x CTA							 
Adh	calypso	tandemrepeat	1038688	1038702	.	+	0	
# 5   x CTA							 
Adh	calypso	tandemrepeat	1038688	1038702	.	+	0	
# 5   x CTA							 
Adh	calypso	tandemrepeat	1038688	1038702	.	+	0	
# 5   x CTA							 
Adh	calypso	tandemrepeat	1045156	1045173	.	+	0	
# 3   x GGTCCA							 
Adh	calypso	tandemrepeat	1045156	1045173	.	+	0	
# 3   x GGTCCA							 
Adh	calypso	tandemrepeat	1054544	1054558	.	+	1	
# 3   x GCATC							 
Adh	calypso	tandemrepeat	1054544	1054558	.	+	1	
# 3   x GCATC							 
Adh	calypso	tandemrepeat	1054682	1054706	.	+	1	
# 5   x GAACT							 
Adh	calypso	tandemrepeat	1054682	1054706	.	+	1	
# 5   x GAACT							 
Adh	calypso	tandemrepeat	1062793	1062807	.	+	0	
# 3   x GTTGG							 
Adh	calypso	tandemrepeat	1062793	1062807	.	+	0	
# 3   x GTTGG							 
Adh	calypso	tandemrepeat	1064755	1064770	.	+	0	
# 4   x TCAA							 
Adh	calypso	tandemrepeat	1064755	1064770	.	+	0	
# 4   x TCAA							 
Adh	calypso	tandemrepeat	1065563	1065580	.	+	1	
# 6   x GCA							 
Adh	calypso	tandemrepeat	1065563	1065580	.	+	1	
# 6   x GCA							 
Adh	calypso	tandemrepeat	1070495	1070514	.	+	1	
# 4   x CGAGT							 
Adh	calypso	tandemrepeat	1070495	1070514	.	+	1	
# 4   x CGAGT							 
Adh	calypso	tandemrepeat	1073168	1073182	.	+	1	
# 5   x CTT							 
Adh	calypso	tandemrepeat	1073168	1073182	.	+	1	
# 5   x CTT							 
Adh	calypso	tandemrepeat	1079614	1079641	.	+	0	
# 7   x ATGA							 
Adh	calypso	tandemrepeat	1079614	1079641	.	+	0	
# 7   x ATGA							 
Adh	calypso	tandemrepeat	1086467	1086481	.	+	1	
# 5   x CAG							 
Adh	calypso	tandemrepeat	1086467	1086481	.	+	1	
# 5   x CAG							 
Adh	calypso	tandemrepeat	1088991	1089005	.	+	2	
# 5   x TCC							 
Adh	calypso	tandemrepeat	1088991	1089005	.	+	2	
# 5   x TCC							 
Adh	calypso	tandemrepeat	1089936	1089956	.	+	2	
# 7   x CTG							 
Adh	calypso	tandemrepeat	1089936	1089956	.	+	2	
# 7   x CTG							 
Adh	calypso	tandemrepeat	1094143	1094157	.	+	0	
# 5   x CAT							 
Adh	calypso	tandemrepeat	1094143	1094157	.	+	0	
# 5   x CAT							 
Adh	calypso	tandemrepeat	1094519	1094533	.	+	1	
# 5   x TGT							 
Adh	calypso	tandemrepeat	1094519	1094533	.	+	1	
# 5   x TGT							 
Adh	calypso	tandemrepeat	1095234	1095248	.	+	2	
# 3   x GTTGT							 
Adh	calypso	tandemrepeat	1095234	1095248	.	+	2	
# 3   x GTTGT							 
Adh	calypso	tandemrepeat	1096242	1096257	.	+	2	
# 4   x TTTA							 
Adh	calypso	tandemrepeat	1096242	1096257	.	+	2	
# 4   x TTTA							 
Adh	calypso	tandemrepeat	1099313	1099328	.	+	1	
# 4   x TGGC							 
Adh	calypso	tandemrepeat	1099313	1099328	.	+	1	
# 4   x TGGC							 
Adh	calypso	tandemrepeat	1107046	1107063	.	+	0	
# 3   x GCCACC							 
Adh	calypso	tandemrepeat	1107046	1107063	.	+	0	
# 3   x GCCACC							 
Adh	calypso	tandemrepeat	1109743	1109766	.	+	0	
# 4   x ATACTA							 
Adh	calypso	tandemrepeat	1109743	1109766	.	+	0	
# 4   x ATACTA							 
Adh	calypso	tandemrepeat	1110994	1111008	.	+	0	
# 15  x A							 
Adh	calypso	tandemrepeat	1110994	1111008	.	+	0	
# 15  x A							 
Adh	calypso	tandemrepeat	1112646	1112683	.	+	2	
# 38  x T							 
Adh	calypso	tandemrepeat	1112646	1112683	.	+	2	
# 38  x T							 
Adh	calypso	tandemrepeat	1120256	1120275	.	+	1	
# 5   x ATGG							 
Adh	calypso	tandemrepeat	1120256	1120275	.	+	1	
# 5   x ATGG							 
Adh	calypso	tandemrepeat	1121325	1121348	.	+	2	
# 6   x GACA							 
Adh	calypso	tandemrepeat	1121325	1121348	.	+	2	
# 6   x GACA							 
Adh	calypso	tandemrepeat	1123531	1123545	.	+	0	
# 5   x TTA							 
Adh	calypso	tandemrepeat	1123531	1123545	.	+	0	
# 5   x TTA							 
Adh	calypso	tandemrepeat	1125075	1125095	.	+	2	
# 7   x GCA							 
Adh	calypso	tandemrepeat	1125075	1125095	.	+	2	
# 7   x GCA							 
Adh	calypso	tandemrepeat	1125075	1125095	.	+	2	
# 7   x GCA							 
Adh	calypso	tandemrepeat	1125075	1125095	.	+	2	
# 7   x GCA							 
Adh	calypso	tandemrepeat	1131750	1131767	.	+	2	
# 3   x AGTTGC							 
Adh	calypso	tandemrepeat	1131750	1131767	.	+	2	
# 3   x AGTTGC							 
Adh	calypso	tandemrepeat	1135457	1135472	.	+	1	
# 8   x AT							 
Adh	calypso	tandemrepeat	1135457	1135472	.	+	1	
# 8   x AT							 
Adh	calypso	tandemrepeat	1144469	1144487	.	+	1	
# 19  x T							 
Adh	calypso	tandemrepeat	1144469	1144487	.	+	1	
# 19  x T							 
Adh	calypso	tandemrepeat	1145749	1145763	.	+	0	
# 3   x CCGAT							 
Adh	calypso	tandemrepeat	1145749	1145763	.	+	0	
# 3   x CCGAT							 
Adh	calypso	tandemrepeat	1146320	1146335	.	+	1	
# 16  x A							 
Adh	calypso	tandemrepeat	1146320	1146335	.	+	1	
# 16  x A							 
Adh	calypso	tandemrepeat	1147126	1147143	.	+	0	
# 3   x TTATTT							 
Adh	calypso	tandemrepeat	1147126	1147143	.	+	0	
# 3   x TTATTT							 
Adh	calypso	tandemrepeat	1151879	1151897	.	+	1	
# 19  x A							 
Adh	calypso	tandemrepeat	1151879	1151897	.	+	1	
# 19  x A							 
Adh	calypso	tandemrepeat	1152128	1152145	.	+	1	
# 3   x ATGCTG							 
Adh	calypso	tandemrepeat	1152128	1152145	.	+	1	
# 3   x ATGCTG							 
Adh	calypso	tandemrepeat	1155339	1155357	.	+	2	
# 19  x A							 
Adh	calypso	tandemrepeat	1155339	1155357	.	+	2	
# 19  x A							 
Adh	calypso	tandemrepeat	1155686	1155703	.	+	1	
# 6   x GAT							 
Adh	calypso	tandemrepeat	1155686	1155703	.	+	1	
# 6   x GAT							 
Adh	calypso	tandemrepeat	1157057	1157074	.	+	1	
# 3   x GCAATT							 
Adh	calypso	tandemrepeat	1157057	1157074	.	+	1	
# 3   x GCAATT							 
Adh	calypso	tandemrepeat	1160948	1160964	.	+	1	
# 17  x T							 
Adh	calypso	tandemrepeat	1160948	1160964	.	+	1	
# 17  x T							 
Adh	calypso	tandemrepeat	1161184	1161198	.	+	0	
# 5   x TTG							 
Adh	calypso	tandemrepeat	1161184	1161198	.	+	0	
# 5   x TTG							 
Adh	calypso	tandemrepeat	1162208	1162222	.	+	1	
# 15  x A							 
Adh	calypso	tandemrepeat	1162208	1162222	.	+	1	
# 15  x A							 
Adh	calypso	tandemrepeat	1168371	1168390	.	+	2	
# 10  x AC							 
Adh	calypso	tandemrepeat	1168371	1168390	.	+	2	
# 10  x AC							 
Adh	calypso	tandemrepeat	1172531	1172568	.	+	1	
# 19  x TA							 
Adh	calypso	tandemrepeat	1172531	1172568	.	+	1	
# 19  x TA							 
Adh	calypso	tandemrepeat	1172531	1172568	.	+	1	
# 19  x TA							 
Adh	calypso	tandemrepeat	1172531	1172568	.	+	1	
# 19  x TA							 
Adh	calypso	tandemrepeat	1176269	1176286	.	+	1	
# 18  x A							 
Adh	calypso	tandemrepeat	1176269	1176286	.	+	1	
# 18  x A							 
Adh	calypso	tandemrepeat	1178536	1178560	.	+	0	
# 25  x T							 
Adh	calypso	tandemrepeat	1178536	1178560	.	+	0	
# 25  x T							 
Adh	calypso	tandemrepeat	1190348	1190365	.	+	1	
# 3   x TGTTGC							 
Adh	calypso	tandemrepeat	1190348	1190365	.	+	1	
# 3   x TGTTGC							 
Adh	calypso	tandemrepeat	1195025	1195039	.	+	1	
# 15  x T							 
Adh	calypso	tandemrepeat	1195025	1195039	.	+	1	
# 15  x T							 
Adh	calypso	tandemrepeat	1196579	1196596	.	+	1	
# 3   x GCAACA							 
Adh	calypso	tandemrepeat	1196579	1196596	.	+	1	
# 3   x GCAACA							 
Adh	calypso	tandemrepeat	1206749	1206766	.	+	1	
# 6   x AGC							 
Adh	calypso	tandemrepeat	1206749	1206766	.	+	1	
# 6   x AGC							 
Adh	calypso	tandemrepeat	1207025	1207039	.	+	1	
# 3   x ATTAA							 
Adh	calypso	tandemrepeat	1207025	1207039	.	+	1	
# 3   x ATTAA							 
Adh	calypso	tandemrepeat	1227377	1227391	.	+	1	
# 15  x A							 
Adh	calypso	tandemrepeat	1227377	1227391	.	+	1	
# 15  x A							 
Adh	calypso	tandemrepeat	1231197	1231211	.	+	2	
# 5   x TGC							 
Adh	calypso	tandemrepeat	1231197	1231211	.	+	2	
# 5   x TGC							 
Adh	calypso	tandemrepeat	1231296	1231310	.	+	2	
# 5   x TGC							 
Adh	calypso	tandemrepeat	1231296	1231310	.	+	2	
# 5   x TGC							 
Adh	calypso	tandemrepeat	1233493	1233507	.	+	0	
# 3   x TATTA							 
Adh	calypso	tandemrepeat	1233493	1233507	.	+	0	
# 3   x TATTA							 
Adh	calypso	tandemrepeat	1237958	1237977	.	+	1	
# 10  x TG							 
Adh	calypso	tandemrepeat	1237958	1237977	.	+	1	
# 10  x TG							 
Adh	calypso	tandemrepeat	1254492	1254506	.	+	2	
# 3   x ATTCA							 
Adh	calypso	tandemrepeat	1254492	1254506	.	+	2	
# 3   x ATTCA							 
Adh	calypso	tandemrepeat	1278334	1278349	.	+	0	
# 4   x TATG							 
Adh	calypso	tandemrepeat	1278334	1278349	.	+	0	
# 4   x TATG							 
Adh	calypso	tandemrepeat	1284489	1284503	.	+	2	
# 15  x T							 
Adh	calypso	tandemrepeat	1284489	1284503	.	+	2	
# 15  x T							 
Adh	calypso	tandemrepeat	1291267	1291284	.	+	0	
# 3   x CGAGGA							 
Adh	calypso	tandemrepeat	1291267	1291284	.	+	0	
# 3   x CGAGGA							 
Adh	calypso	tandemrepeat	1293629	1293644	.	+	1	
# 4   x AATA							 
Adh	calypso	tandemrepeat	1293629	1293644	.	+	1	
# 4   x AATA							 
Adh	calypso	tandemrepeat	1298498	1298513	.	+	1	
# 4   x AATA							 
Adh	calypso	tandemrepeat	1298498	1298513	.	+	1	
# 4   x AATA							 
Adh	calypso	tandemrepeat	1305659	1305674	.	+	1	
# 4   x TTCA							 
Adh	calypso	tandemrepeat	1305659	1305674	.	+	1	
# 4   x TTCA							 
Adh	calypso	tandemrepeat	1305659	1305674	.	+	1	
# 4   x TTCA							 
Adh	calypso	tandemrepeat	1305659	1305674	.	+	1	
# 4   x TTCA							 
Adh	calypso	tandemrepeat	1311852	1311868	.	+	2	
# 17  x T							 
Adh	calypso	tandemrepeat	1311852	1311868	.	+	2	
# 17  x T							 
Adh	calypso	tandemrepeat	1313762	1313777	.	+	1	
# 8   x GT							 
Adh	calypso	tandemrepeat	1313762	1313777	.	+	1	
# 8   x GT							 
Adh	calypso	tandemrepeat	1316848	1316865	.	+	0	
# 9   x AG							 
Adh	calypso	tandemrepeat	1316848	1316865	.	+	0	
# 9   x AG							 
Adh	calypso	tandemrepeat	1342013	1342030	.	+	1	
# 3   x TCTTGG							 
Adh	calypso	tandemrepeat	1342013	1342030	.	+	1	
# 3   x TCTTGG							 
Adh	calypso	tandemrepeat	1348479	1348494	.	+	2	
# 16  x G							 
Adh	calypso	tandemrepeat	1348479	1348494	.	+	2	
# 16  x G							 
Adh	calypso	tandemrepeat	1354064	1354078	.	+	1	
# 3   x TACTA							 
Adh	calypso	tandemrepeat	1354064	1354078	.	+	1	
# 3   x TACTA							 
Adh	calypso	tandemrepeat	1354064	1354078	.	+	1	
# 3   x TACTA							 
Adh	calypso	tandemrepeat	1354064	1354078	.	+	1	
# 3   x TACTA							 
Adh	calypso	tandemrepeat	1360180	1360197	.	+	0	
# 3   x CAGATA							 
Adh	calypso	tandemrepeat	1360180	1360197	.	+	0	
# 3   x CAGATA							 
Adh	calypso	tandemrepeat	1361643	1361657	.	+	2	
# 3   x TTATT							 
Adh	calypso	tandemrepeat	1361643	1361657	.	+	2	
# 3   x TTATT							 
Adh	calypso	tandemrepeat	1364975	1364992	.	+	1	
# 3   x TGCTGT							 
Adh	calypso	tandemrepeat	1364975	1364992	.	+	1	
# 3   x TGCTGT							 
Adh	calypso	tandemrepeat	1367583	1367606	.	+	2	
# 24  x T							 
Adh	calypso	tandemrepeat	1367583	1367606	.	+	2	
# 24  x T							 
Adh	calypso	tandemrepeat	1379673	1379696	.	+	2	
# 24  x T							 
Adh	calypso	tandemrepeat	1379673	1379696	.	+	2	
# 24  x T							 
Adh	calypso	tandemrepeat	1383109	1383132	.	+	0	
# 12  x CA							 
Adh	calypso	tandemrepeat	1383109	1383132	.	+	0	
# 12  x CA							 
Adh	calypso	tandemrepeat	1388183	1388207	.	+	1	
# 25  x T							 
Adh	calypso	tandemrepeat	1388183	1388207	.	+	1	
# 25  x T							 
Adh	calypso	tandemrepeat	1391263	1391278	.	+	0	
# 4   x CATA							 
Adh	calypso	tandemrepeat	1391263	1391278	.	+	0	
# 4   x CATA							 
Adh	calypso	tandemrepeat	1391416	1391431	.	+	0	
# 8   x CA							 
Adh	calypso	tandemrepeat	1391416	1391431	.	+	0	
# 8   x CA							 
Adh	calypso	tandemrepeat	1392437	1392456	.	+	1	
# 4   x TTTCG							 
Adh	calypso	tandemrepeat	1392437	1392456	.	+	1	
# 4   x TTTCG							 
Adh	calypso	tandemrepeat	1395819	1395837	.	+	2	
# 19  x C							 
Adh	calypso	tandemrepeat	1395819	1395837	.	+	2	
# 19  x C							 
Adh	calypso	tandemrepeat	1395819	1395837	.	+	2	
# 19  x C							 
Adh	calypso	tandemrepeat	1395819	1395837	.	+	2	
# 19  x C							 
Adh	calypso	tandemrepeat	1399035	1399051	.	+	2	
# 17  x T							 
Adh	calypso	tandemrepeat	1399035	1399051	.	+	2	
# 17  x T							 
Adh	calypso	tandemrepeat	1399035	1399051	.	+	2	
# 17  x T							 
Adh	calypso	tandemrepeat	1399035	1399051	.	+	2	
# 17  x T							 
Adh	calypso	tandemrepeat	1401995	1402009	.	+	1	
# 3   x GATTG							 
Adh	calypso	tandemrepeat	1401995	1402009	.	+	1	
# 3   x GATTG							 
Adh	calypso	tandemrepeat	1404251	1404268	.	+	1	
# 9   x GT							 
Adh	calypso	tandemrepeat	1404251	1404268	.	+	1	
# 9   x GT							 
Adh	calypso	tandemrepeat	1406009	1406029	.	+	1	
# 7   x AGC							 
Adh	calypso	tandemrepeat	1406009	1406029	.	+	1	
# 7   x AGC							 
Adh	calypso	tandemrepeat	1408221	1408235	.	+	2	
# 3   x ACAAG							 
Adh	calypso	tandemrepeat	1408221	1408235	.	+	2	
# 3   x ACAAG							 
Adh	calypso	tandemrepeat	1410789	1410806	.	+	2	
# 3   x GCAGTG							 
Adh	calypso	tandemrepeat	1410789	1410806	.	+	2	
# 3   x GCAGTG							 
Adh	calypso	tandemrepeat	1410848	1410865	.	+	1	
# 6   x TCA							 
Adh	calypso	tandemrepeat	1410848	1410865	.	+	1	
# 6   x TCA							 
Adh	calypso	tandemrepeat	1424247	1424264	.	+	2	
# 3   x GTTCTG							 
Adh	calypso	tandemrepeat	1424247	1424264	.	+	2	
# 3   x GTTCTG							 
Adh	calypso	tandemrepeat	1424790	1424804	.	+	2	
# 15  x C							 
Adh	calypso	tandemrepeat	1424790	1424804	.	+	2	
# 15  x C							 
Adh	calypso	tandemrepeat	1425005	1425020	.	+	1	
# 4   x TGGA							 
Adh	calypso	tandemrepeat	1425005	1425020	.	+	1	
# 4   x TGGA							 
Adh	calypso	tandemrepeat	1426058	1426079	.	+	1	
# 11  x TG							 
Adh	calypso	tandemrepeat	1426058	1426079	.	+	1	
# 11  x TG							 
Adh	calypso	tandemrepeat	1427823	1427838	.	+	2	
# 4   x GTAT							 
Adh	calypso	tandemrepeat	1427823	1427838	.	+	2	
# 4   x GTAT							 
Adh	calypso	tandemrepeat	1429907	1429921	.	+	1	
# 15  x T							 
Adh	calypso	tandemrepeat	1429907	1429921	.	+	1	
# 15  x T							 
Adh	calypso	tandemrepeat	1434683	1434698	.	+	1	
# 16  x T							 
Adh	calypso	tandemrepeat	1434683	1434698	.	+	1	
# 16  x T							 
Adh	calypso	tandemrepeat	1449707	1449722	.	+	1	
# 16  x T							 
Adh	calypso	tandemrepeat	1449707	1449722	.	+	1	
# 16  x T							 
Adh	calypso	tandemrepeat	1453167	1453186	.	+	2	
# 10  x TA							 
Adh	calypso	tandemrepeat	1453167	1453186	.	+	2	
# 10  x TA							 
Adh	calypso	tandemrepeat	1454595	1454609	.	+	2	
# 5   x ATA							 
Adh	calypso	tandemrepeat	1454595	1454609	.	+	2	
# 5   x ATA							 
Adh	calypso	tandemrepeat	1461482	1461497	.	+	1	
# 8   x AC							 
Adh	calypso	tandemrepeat	1461482	1461497	.	+	1	
# 8   x AC							 
Adh	calypso	tandemrepeat	1463470	1463494	.	+	0	
# 5   x TTCAG							 
Adh	calypso	tandemrepeat	1463470	1463494	.	+	0	
# 5   x TTCAG							 
Adh	calypso	tandemrepeat	1463496	1463510	.	+	2	
# 3   x CAATG							 
Adh	calypso	tandemrepeat	1463496	1463510	.	+	2	
# 3   x CAATG							 
Adh	calypso	tandemrepeat	1463860	1463874	.	+	0	
# 3   x TATTT							 
Adh	calypso	tandemrepeat	1463860	1463874	.	+	0	
# 3   x TATTT							 
Adh	calypso	tandemrepeat	1472445	1472460	.	+	2	
# 4   x AGTG							 
Adh	calypso	tandemrepeat	1472445	1472460	.	+	2	
# 4   x AGTG							 
Adh	calypso	tandemrepeat	1474088	1474113	.	+	1	
# 13  x TA							 
Adh	calypso	tandemrepeat	1474088	1474113	.	+	1	
# 13  x TA							 
Adh	calypso	tandemrepeat	1480217	1480252	.	+	1	
# 36  x A							 
Adh	calypso	tandemrepeat	1480217	1480252	.	+	1	
# 36  x A							 
Adh	calypso	tandemrepeat	1484215	1484229	.	+	0	
# 5   x TGC							 
Adh	calypso	tandemrepeat	1484215	1484229	.	+	0	
# 5   x TGC							 
Adh	calypso	tandemrepeat	1484928	1484942	.	+	2	
# 5   x AAT							 
Adh	calypso	tandemrepeat	1484928	1484942	.	+	2	
# 5   x AAT							 
Adh	calypso	tandemrepeat	1485335	1485356	.	+	1	
# 11  x TC							 
Adh	calypso	tandemrepeat	1485335	1485356	.	+	1	
# 11  x TC							 
Adh	calypso	tandemrepeat	1485335	1485356	.	+	1	
# 11  x TC							 
Adh	calypso	tandemrepeat	1485335	1485356	.	+	1	
# 11  x TC							 
Adh	calypso	tandemrepeat	1497539	1497554	.	+	1	
# 4   x GTTT							 
Adh	calypso	tandemrepeat	1497539	1497554	.	+	1	
# 4   x GTTT							 
Adh	calypso	tandemrepeat	1502345	1502360	.	+	1	
# 8   x AC							 
Adh	calypso	tandemrepeat	1502345	1502360	.	+	1	
# 8   x AC							 
Adh	calypso	tandemrepeat	1503315	1503342	.	+	2	
# 14  x TC							 
Adh	calypso	tandemrepeat	1503315	1503342	.	+	2	
# 14  x TC							 
Adh	calypso	tandemrepeat	1503409	1503424	.	+	0	
# 8   x GT							 
Adh	calypso	tandemrepeat	1503409	1503424	.	+	0	
# 8   x GT							 
Adh	calypso	tandemrepeat	1506742	1506759	.	+	0	
# 6   x AAC							 
Adh	calypso	tandemrepeat	1506742	1506759	.	+	0	
# 6   x AAC							 
Adh	calypso	tandemrepeat	1506997	1507014	.	+	0	
# 6   x AAC							 
Adh	calypso	tandemrepeat	1506997	1507014	.	+	0	
# 6   x AAC							 
Adh	calypso	tandemrepeat	1507601	1507615	.	+	1	
# 3   x AGTGA							 
Adh	calypso	tandemrepeat	1507601	1507615	.	+	1	
# 3   x AGTGA							 
Adh	calypso	tandemrepeat	1510453	1510476	.	+	0	
# 4   x TTTTGG							 
Adh	calypso	tandemrepeat	1510453	1510476	.	+	0	
# 4   x TTTTGG							 
Adh	calypso	tandemrepeat	1510600	1510623	.	+	0	
# 4   x TATTTG							 
Adh	calypso	tandemrepeat	1510600	1510623	.	+	0	
# 4   x TATTTG							 
Adh	calypso	tandemrepeat	1511544	1511561	.	+	2	
# 3   x GGCTGG							 
Adh	calypso	tandemrepeat	1511544	1511561	.	+	2	
# 3   x GGCTGG							 
Adh	calypso	tandemrepeat	1512918	1512937	.	+	2	
# 4   x TGGTC							 
Adh	calypso	tandemrepeat	1512918	1512937	.	+	2	
# 4   x TGGTC							 
Adh	calypso	tandemrepeat	1512943	1512962	.	+	0	
# 4   x AGTTC							 
Adh	calypso	tandemrepeat	1512943	1512962	.	+	0	
# 4   x AGTTC							 
Adh	calypso	tandemrepeat	1514284	1514299	.	+	0	
# 4   x GTAT							 
Adh	calypso	tandemrepeat	1514284	1514299	.	+	0	
# 4   x GTAT							 
Adh	calypso	tandemrepeat	1523467	1523482	.	+	0	
# 4   x TCAC							 
Adh	calypso	tandemrepeat	1523467	1523482	.	+	0	
# 4   x TCAC							 
Adh	calypso	tandemrepeat	1529451	1529465	.	+	2	
# 5   x CAA							 
Adh	calypso	tandemrepeat	1529451	1529465	.	+	2	
# 5   x CAA							 
Adh	calypso	tandemrepeat	1529795	1529809	.	+	1	
# 5   x CAG							 
Adh	calypso	tandemrepeat	1529795	1529809	.	+	1	
# 5   x CAG							 
Adh	calypso	tandemrepeat	1529810	1529827	.	+	1	
# 6   x CAA							 
Adh	calypso	tandemrepeat	1529810	1529827	.	+	1	
# 6   x CAA							 
Adh	calypso	tandemrepeat	1530718	1530733	.	+	0	
# 4   x TCTG							 
Adh	calypso	tandemrepeat	1530718	1530733	.	+	0	
# 4   x TCTG							 
Adh	calypso	tandemrepeat	1530718	1530733	.	+	0	
# 4   x TCTG							 
Adh	calypso	tandemrepeat	1530718	1530733	.	+	0	
# 4   x TCTG							 
Adh	calypso	tandemrepeat	1532513	1532528	.	+	1	
# 4   x ACAT							 
Adh	calypso	tandemrepeat	1532513	1532528	.	+	1	
# 4   x ACAT							 
Adh	calypso	tandemrepeat	1532513	1532528	.	+	1	
# 4   x ACAT							 
Adh	calypso	tandemrepeat	1532513	1532528	.	+	1	
# 4   x ACAT							 
Adh	calypso	tandemrepeat	1562132	1562146	.	+	1	
# 5   x AAT							 
Adh	calypso	tandemrepeat	1562132	1562146	.	+	1	
# 5   x AAT							 
Adh	calypso	tandemrepeat	1575182	1575199	.	+	1	
# 3   x GATTTG							 
Adh	calypso	tandemrepeat	1575182	1575199	.	+	1	
# 3   x GATTTG							 
Adh	calypso	tandemrepeat	1575182	1575199	.	+	1	
# 3   x GATTTG							 
Adh	calypso	tandemrepeat	1575182	1575199	.	+	1	
# 3   x GATTTG							 
Adh	calypso	tandemrepeat	1587202	1587216	.	+	0	
# 3   x TTTTC							 
Adh	calypso	tandemrepeat	1587202	1587216	.	+	0	
# 3   x TTTTC							 
Adh	calypso	tandemrepeat	1587379	1587396	.	+	0	
# 3   x CGTCAT							 
Adh	calypso	tandemrepeat	1587379	1587396	.	+	0	
# 3   x CGTCAT							 
Adh	calypso	tandemrepeat	1588087	1588102	.	+	0	
# 16  x A							 
Adh	calypso	tandemrepeat	1588087	1588102	.	+	0	
# 16  x A							 
Adh	calypso	tandemrepeat	1588215	1588229	.	+	2	
# 5   x GAT							 
Adh	calypso	tandemrepeat	1588215	1588229	.	+	2	
# 5   x GAT							 
Adh	calypso	tandemrepeat	1588231	1588245	.	+	0	
# 5   x ATG							 
Adh	calypso	tandemrepeat	1588231	1588245	.	+	0	
# 5   x ATG							 
Adh	calypso	tandemrepeat	1590481	1590498	.	+	0	
# 3   x AACTGC							 
Adh	calypso	tandemrepeat	1590481	1590498	.	+	0	
# 3   x AACTGC							 
Adh	calypso	tandemrepeat	1590793	1590809	.	+	0	
# 17  x T							 
Adh	calypso	tandemrepeat	1590793	1590809	.	+	0	
# 17  x T							 
Adh	calypso	tandemrepeat	1591791	1591808	.	+	2	
# 9   x AT							 
Adh	calypso	tandemrepeat	1591791	1591808	.	+	2	
# 9   x AT							 
Adh	calypso	tandemrepeat	1592540	1592554	.	+	1	
# 3   x ACTTA							 
Adh	calypso	tandemrepeat	1592540	1592554	.	+	1	
# 3   x ACTTA							 
Adh	calypso	tandemrepeat	1597043	1597060	.	+	1	
# 3   x GGAGAT							 
Adh	calypso	tandemrepeat	1597043	1597060	.	+	1	
# 3   x GGAGAT							 
Adh	calypso	tandemrepeat	1598225	1598239	.	+	1	
# 3   x CTTTA							 
Adh	calypso	tandemrepeat	1598225	1598239	.	+	1	
# 3   x CTTTA							 
Adh	calypso	tandemrepeat	1609960	1609980	.	+	0	
# 7   x ACG							 
Adh	calypso	tandemrepeat	1609960	1609980	.	+	0	
# 7   x ACG							 
Adh	calypso	tandemrepeat	1611748	1611763	.	+	0	
# 4   x GCTA							 
Adh	calypso	tandemrepeat	1611748	1611763	.	+	0	
# 4   x GCTA							 
Adh	calypso	tandemrepeat	1612282	1612299	.	+	0	
# 3   x TATATG							 
Adh	calypso	tandemrepeat	1612282	1612299	.	+	0	
# 3   x TATATG							 
Adh	calypso	tandemrepeat	1613364	1613381	.	+	2	
# 18  x A							 
Adh	calypso	tandemrepeat	1613364	1613381	.	+	2	
# 18  x A							 
Adh	calypso	tandemrepeat	1614603	1614627	.	+	2	
# 5   x CTGTT							 
Adh	calypso	tandemrepeat	1614603	1614627	.	+	2	
# 5   x CTGTT							 
Adh	calypso	tandemrepeat	1626935	1626952	.	+	1	
# 3   x GAATGA							 
Adh	calypso	tandemrepeat	1626935	1626952	.	+	1	
# 3   x GAATGA							 
Adh	calypso	tandemrepeat	1627854	1627869	.	+	2	
# 8   x TG							 
Adh	calypso	tandemrepeat	1627854	1627869	.	+	2	
# 8   x TG							 
Adh	calypso	tandemrepeat	1628087	1628104	.	+	1	
# 9   x GT							 
Adh	calypso	tandemrepeat	1628087	1628104	.	+	1	
# 9   x GT							 
Adh	calypso	tandemrepeat	1632832	1632847	.	+	0	
# 4   x ATTT							 
Adh	calypso	tandemrepeat	1632832	1632847	.	+	0	
# 4   x ATTT							 
Adh	calypso	tandemrepeat	1637135	1637150	.	+	1	
# 4   x AGAC							 
Adh	calypso	tandemrepeat	1637135	1637150	.	+	1	
# 4   x AGAC							 
Adh	calypso	tandemrepeat	1638662	1638679	.	+	1	
# 9   x CA							 
Adh	calypso	tandemrepeat	1638662	1638679	.	+	1	
# 9   x CA							 
Adh	calypso	tandemrepeat	1643978	1643993	.	+	1	
# 8   x GT							 
Adh	calypso	tandemrepeat	1643978	1643993	.	+	1	
# 8   x GT							 
Adh	calypso	tandemrepeat	1646755	1646772	.	+	0	
# 3   x GGTTCT							 
Adh	calypso	tandemrepeat	1646755	1646772	.	+	0	
# 3   x GGTTCT							 
Adh	calypso	tandemrepeat	1647252	1647266	.	+	2	
# 3   x ATATT							 
Adh	calypso	tandemrepeat	1647252	1647266	.	+	2	
# 3   x ATATT							 
Adh	calypso	tandemrepeat	1648409	1648424	.	+	1	
# 8   x TG							 
Adh	calypso	tandemrepeat	1648409	1648424	.	+	1	
# 8   x TG							 
Adh	calypso	tandemrepeat	1661973	1661993	.	+	2	
# 21  x A							 
Adh	calypso	tandemrepeat	1661973	1661993	.	+	2	
# 21  x A							 
Adh	calypso	tandemrepeat	1662717	1662731	.	+	2	
# 3   x TTTTG							 
Adh	calypso	tandemrepeat	1662717	1662731	.	+	2	
# 3   x TTTTG							 
Adh	calypso	tandemrepeat	1666164	1666181	.	+	2	
# 9   x TA							 
Adh	calypso	tandemrepeat	1666164	1666181	.	+	2	
# 9   x TA							 
Adh	calypso	tandemrepeat	1666164	1666181	.	+	2	
# 9   x TA							 
Adh	calypso	tandemrepeat	1666164	1666181	.	+	2	
# 9   x TA							 
Adh	calypso	tandemrepeat	1667283	1667297	.	+	2	
# 3   x AAAAT							 
Adh	calypso	tandemrepeat	1667283	1667297	.	+	2	
# 3   x AAAAT							 
Adh	calypso	tandemrepeat	1667283	1667297	.	+	2	
# 3   x AAAAT							 
Adh	calypso	tandemrepeat	1667283	1667297	.	+	2	
# 3   x AAAAT							 
Adh	calypso	tandemrepeat	1671293	1671310	.	+	1	
# 3   x TGCTCC							 
Adh	calypso	tandemrepeat	1671293	1671310	.	+	1	
# 3   x TGCTCC							 
Adh	calypso	tandemrepeat	1676142	1676159	.	+	2	
# 9   x TA							 
Adh	calypso	tandemrepeat	1676142	1676159	.	+	2	
# 9   x TA							 
Adh	calypso	tandemrepeat	1679001	1679016	.	+	2	
# 16  x T							 
Adh	calypso	tandemrepeat	1679001	1679016	.	+	2	
# 16  x T							 
Adh	calypso	tandemrepeat	1681584	1681598	.	+	2	
# 3   x CGAAT							 
Adh	calypso	tandemrepeat	1681584	1681598	.	+	2	
# 3   x CGAAT							 
Adh	calypso	tandemrepeat	1685275	1685294	.	+	0	
# 10  x GT							 
Adh	calypso	tandemrepeat	1685275	1685294	.	+	0	
# 10  x GT							 
Adh	calypso	tandemrepeat	1691044	1691058	.	+	0	
# 3   x TTCGT							 
Adh	calypso	tandemrepeat	1691044	1691058	.	+	0	
# 3   x TTCGT							 
Adh	calypso	tandemrepeat	1693348	1693362	.	+	0	
# 3   x AATAA							 
Adh	calypso	tandemrepeat	1693348	1693362	.	+	0	
# 3   x AATAA							 
Adh	calypso	tandemrepeat	1693841	1693860	.	+	1	
# 4   x TTATA							 
Adh	calypso	tandemrepeat	1693841	1693860	.	+	1	
# 4   x TTATA							 
Adh	calypso	tandemrepeat	1698019	1698038	.	+	0	
# 5   x ACCA							 
Adh	calypso	tandemrepeat	1698019	1698038	.	+	0	
# 5   x ACCA							 
Adh	calypso	tandemrepeat	1702142	1702156	.	+	1	
# 3   x ATGAG							 
Adh	calypso	tandemrepeat	1702142	1702156	.	+	1	
# 3   x ATGAG							 
Adh	calypso	tandemrepeat	1703828	1703843	.	+	1	
# 4   x TTTG							 
Adh	calypso	tandemrepeat	1703828	1703843	.	+	1	
# 4   x TTTG							 
Adh	calypso	tandemrepeat	1703927	1703948	.	+	1	
# 11  x CA							 
Adh	calypso	tandemrepeat	1703927	1703948	.	+	1	
# 11  x CA							 
Adh	calypso	tandemrepeat	1709366	1709383	.	+	1	
# 3   x ACTCCC							 
Adh	calypso	tandemrepeat	1709366	1709383	.	+	1	
# 3   x ACTCCC							 
Adh	calypso	tandemrepeat	1710698	1710717	.	+	1	
# 5   x TATG							 
Adh	calypso	tandemrepeat	1710698	1710717	.	+	1	
# 5   x TATG							 
Adh	calypso	tandemrepeat	1710698	1710717	.	+	1	
# 5   x TATG							 
Adh	calypso	tandemrepeat	1710698	1710717	.	+	1	
# 5   x TATG							 
Adh	calypso	tandemrepeat	1711879	1711900	.	+	0	
# 11  x GT							 
Adh	calypso	tandemrepeat	1711879	1711900	.	+	0	
# 11  x GT							 
Adh	calypso	tandemrepeat	1711879	1711900	.	+	0	
# 11  x GT							 
Adh	calypso	tandemrepeat	1711879	1711900	.	+	0	
# 11  x GT							 
Adh	calypso	tandemrepeat	1716209	1716223	.	+	1	
# 15  x A							 
Adh	calypso	tandemrepeat	1716209	1716223	.	+	1	
# 15  x A							 
Adh	calypso	tandemrepeat	1719118	1719132	.	+	0	
# 3   x TCTGG							 
Adh	calypso	tandemrepeat	1719118	1719132	.	+	0	
# 3   x TCTGG							 
Adh	calypso	tandemrepeat	1720833	1720847	.	+	2	
# 5   x GCA							 
Adh	calypso	tandemrepeat	1720833	1720847	.	+	2	
# 5   x GCA							 
Adh	calypso	tandemrepeat	1721342	1721361	.	+	1	
# 5   x ACCG							 
Adh	calypso	tandemrepeat	1721342	1721361	.	+	1	
# 5   x ACCG							 
Adh	calypso	tandemrepeat	1728633	1728653	.	+	2	
# 7   x GCA							 
Adh	calypso	tandemrepeat	1728633	1728653	.	+	2	
# 7   x GCA							 
Adh	calypso	tandemrepeat	1728651	1728668	.	+	2	
# 3   x GCAACA							 
Adh	calypso	tandemrepeat	1728651	1728668	.	+	2	
# 3   x GCAACA							 
Adh	calypso	tandemrepeat	1728691	1728708	.	+	0	
# 3   x AACAGA							 
Adh	calypso	tandemrepeat	1728691	1728708	.	+	0	
# 3   x AACAGA							 
Adh	calypso	tandemrepeat	1731915	1731930	.	+	2	
# 16  x T							 
Adh	calypso	tandemrepeat	1731915	1731930	.	+	2	
# 16  x T							 
Adh	calypso	tandemrepeat	1732055	1732070	.	+	1	
# 4   x TGGT							 
Adh	calypso	tandemrepeat	1732055	1732070	.	+	1	
# 4   x TGGT							 
Adh	calypso	tandemrepeat	1732939	1732956	.	+	0	
# 3   x ACTGCA							 
Adh	calypso	tandemrepeat	1732939	1732956	.	+	0	
# 3   x ACTGCA							 
Adh	calypso	tandemrepeat	1733238	1733257	.	+	2	
# 20  x G							 
Adh	calypso	tandemrepeat	1733238	1733257	.	+	2	
# 20  x G							 
Adh	calypso	tandemrepeat	1743287	1743301	.	+	1	
# 3   x GAAAA							 
Adh	calypso	tandemrepeat	1743287	1743301	.	+	1	
# 3   x GAAAA							 
Adh	calypso	tandemrepeat	1744323	1744346	.	+	2	
# 12  x CA							 
Adh	calypso	tandemrepeat	1744323	1744346	.	+	2	
# 12  x CA							 
Adh	calypso	tandemrepeat	1748374	1748393	.	+	0	
# 10  x AT							 
Adh	calypso	tandemrepeat	1748374	1748393	.	+	0	
# 10  x AT							 
Adh	calypso	tandemrepeat	1748763	1748780	.	+	2	
# 6   x GCT							 
Adh	calypso	tandemrepeat	1748763	1748780	.	+	2	
# 6   x GCT							 
Adh	calypso	tandemrepeat	1749219	1749233	.	+	2	
# 3   x TTTCA							 
Adh	calypso	tandemrepeat	1749219	1749233	.	+	2	
# 3   x TTTCA							 
Adh	calypso	tandemrepeat	1750669	1750684	.	+	0	
# 8   x AT							 
Adh	calypso	tandemrepeat	1750669	1750684	.	+	0	
# 8   x AT							 
Adh	calypso	tandemrepeat	1759771	1759785	.	+	0	
# 5   x CTC							 
Adh	calypso	tandemrepeat	1759771	1759785	.	+	0	
# 5   x CTC							 
Adh	calypso	tandemrepeat	1759771	1759785	.	+	0	
# 5   x CTC							 
Adh	calypso	tandemrepeat	1759771	1759785	.	+	0	
# 5   x CTC							 
Adh	calypso	tandemrepeat	1768537	1768551	.	+	0	
# 3   x ATTGA							 
Adh	calypso	tandemrepeat	1768537	1768551	.	+	0	
# 3   x ATTGA							 
Adh	calypso	tandemrepeat	1768850	1768864	.	+	1	
# 3   x GTCCC							 
Adh	calypso	tandemrepeat	1768850	1768864	.	+	1	
# 3   x GTCCC							 
Adh	calypso	tandemrepeat	1771355	1771369	.	+	1	
# 15  x A							 
Adh	calypso	tandemrepeat	1771355	1771369	.	+	1	
# 15  x A							 
Adh	calypso	tandemrepeat	1773901	1773924	.	+	0	
# 4   x CAACTG							 
Adh	calypso	tandemrepeat	1773901	1773924	.	+	0	
# 4   x CAACTG							 
Adh	calypso	tandemrepeat	1780460	1780477	.	+	1	
# 3   x CCTGCT							 
Adh	calypso	tandemrepeat	1780460	1780477	.	+	1	
# 3   x CCTGCT							 
Adh	calypso	tandemrepeat	1782835	1782850	.	+	0	
# 16  x A							 
Adh	calypso	tandemrepeat	1782835	1782850	.	+	0	
# 16  x A							 
Adh	calypso	tandemrepeat	1783221	1783244	.	+	2	
# 4   x GTCCCA							 
Adh	calypso	tandemrepeat	1783221	1783244	.	+	2	
# 4   x GTCCCA							 
Adh	calypso	tandemrepeat	1784347	1784361	.	+	0	
# 3   x ATCCC							 
Adh	calypso	tandemrepeat	1784347	1784361	.	+	0	
# 3   x ATCCC							 
Adh	calypso	tandemrepeat	1789748	1789765	.	+	1	
# 9   x AT							 
Adh	calypso	tandemrepeat	1789748	1789765	.	+	1	
# 9   x AT							 
Adh	calypso	tandemrepeat	1790342	1790359	.	+	1	
# 3   x CCCGAT							 
Adh	calypso	tandemrepeat	1790342	1790359	.	+	1	
# 3   x CCCGAT							 
Adh	calypso	tandemrepeat	1792295	1792309	.	+	1	
# 3   x GGATT							 
Adh	calypso	tandemrepeat	1792295	1792309	.	+	1	
# 3   x GGATT							 
Adh	calypso	tandemrepeat	1795954	1795969	.	+	0	
# 8   x AT							 
Adh	calypso	tandemrepeat	1795954	1795969	.	+	0	
# 8   x AT							 
Adh	calypso	tandemrepeat	1804501	1804521	.	+	0	
# 7   x GCA							 
Adh	calypso	tandemrepeat	1804501	1804521	.	+	0	
# 7   x GCA							 
Adh	calypso	tandemrepeat	1804501	1804521	.	+	0	
# 7   x GCA							 
Adh	calypso	tandemrepeat	1804501	1804521	.	+	0	
# 7   x GCA							 
Adh	calypso	tandemrepeat	1809576	1809591	.	+	2	
# 8   x AC							 
Adh	calypso	tandemrepeat	1809576	1809591	.	+	2	
# 8   x AC							 
Adh	calypso	tandemrepeat	1810147	1810161	.	+	0	
# 5   x CAT							 
Adh	calypso	tandemrepeat	1810147	1810161	.	+	0	
# 5   x CAT							 
Adh	calypso	tandemrepeat	1811857	1811871	.	+	0	
# 5   x GAT							 
Adh	calypso	tandemrepeat	1811857	1811871	.	+	0	
# 5   x GAT							 
Adh	calypso	tandemrepeat	1819458	1819475	.	+	2	
# 3   x GTCCAT							 
Adh	calypso	tandemrepeat	1819458	1819475	.	+	2	
# 3   x GTCCAT							 
Adh	calypso	tandemrepeat	1819551	1819565	.	+	2	
# 15  x T							 
Adh	calypso	tandemrepeat	1819551	1819565	.	+	2	
# 15  x T							 
Adh	calypso	tandemrepeat	1826722	1826741	.	+	0	
# 4   x GAAAC							 
Adh	calypso	tandemrepeat	1826722	1826741	.	+	0	
# 4   x GAAAC							 
Adh	calypso	tandemrepeat	1827715	1827729	.	+	0	
# 3   x TTATT							 
Adh	calypso	tandemrepeat	1827715	1827729	.	+	0	
# 3   x TTATT							 
Adh	calypso	tandemrepeat	1836335	1836352	.	+	1	
# 3   x GCCAAT							 
Adh	calypso	tandemrepeat	1836335	1836352	.	+	1	
# 3   x GCCAAT							 
Adh	calypso	tandemrepeat	1836793	1836810	.	+	0	
# 3   x TGGAGC							 
Adh	calypso	tandemrepeat	1836793	1836810	.	+	0	
# 3   x TGGAGC							 
Adh	calypso	tandemrepeat	1837499	1837513	.	+	1	
# 3   x ATTCG							 
Adh	calypso	tandemrepeat	1837499	1837513	.	+	1	
# 3   x ATTCG							 
Adh	calypso	tandemrepeat	1838248	1838265	.	+	0	
# 6   x TCA							 
Adh	calypso	tandemrepeat	1838248	1838265	.	+	0	
# 6   x TCA							 
Adh	calypso	tandemrepeat	1840936	1840956	.	+	0	
# 7   x GTA							 
Adh	calypso	tandemrepeat	1840936	1840956	.	+	0	
# 7   x GTA							 
Adh	calypso	tandemrepeat	1853377	1853391	.	+	0	
# 3   x TGAAG							 
Adh	calypso	tandemrepeat	1853377	1853391	.	+	0	
# 3   x TGAAG							 
Adh	calypso	tandemrepeat	1869690	1869707	.	+	2	
# 6   x ATC							 
Adh	calypso	tandemrepeat	1869690	1869707	.	+	2	
# 6   x ATC							 
Adh	calypso	tandemrepeat	1872408	1872425	.	+	2	
# 6   x TCA							 
Adh	calypso	tandemrepeat	1872408	1872425	.	+	2	
# 6   x TCA							 
Adh	calypso	tandemrepeat	1875472	1875489	.	+	0	
# 3   x GTCTCA							 
Adh	calypso	tandemrepeat	1875472	1875489	.	+	0	
# 3   x GTCTCA							 
Adh	calypso	tandemrepeat	1883451	1883465	.	+	2	
# 3   x TAATT							 
Adh	calypso	tandemrepeat	1883451	1883465	.	+	2	
# 3   x TAATT							 
Adh	calypso	tandemrepeat	1897863	1897877	.	+	2	
# 5   x ATG							 
Adh	calypso	tandemrepeat	1897863	1897877	.	+	2	
# 5   x ATG							 
Adh	calypso	tandemrepeat	1899801	1899818	.	+	2	
# 6   x GAT							 
Adh	calypso	tandemrepeat	1899801	1899818	.	+	2	
# 6   x GAT							 
Adh	calypso	tandemrepeat	1900746	1900763	.	+	2	
# 3   x GCAATT							 
Adh	calypso	tandemrepeat	1900746	1900763	.	+	2	
# 3   x GCAATT							 
Adh	calypso	tandemrepeat	1910604	1910619	.	+	2	
# 8   x TG							 
Adh	calypso	tandemrepeat	1910604	1910619	.	+	2	
# 8   x TG							 
Adh	calypso	tandemrepeat	1919272	1919295	.	+	0	
# 8   x GAG							 
Adh	calypso	tandemrepeat	1919272	1919295	.	+	0	
# 8   x GAG							 
Adh	calypso	tandemrepeat	1923052	1923068	.	+	0	
# 17  x A							 
Adh	calypso	tandemrepeat	1923052	1923068	.	+	0	
# 17  x A							 
Adh	calypso	tandemrepeat	1928694	1928708	.	+	2	
# 15  x T							 
Adh	calypso	tandemrepeat	1928694	1928708	.	+	2	
# 15  x T							 
Adh	calypso	tandemrepeat	1933624	1933638	.	+	0	
# 15  x T							 
Adh	calypso	tandemrepeat	1933624	1933638	.	+	0	
# 15  x T							 
Adh	calypso	tandemrepeat	1935928	1935945	.	+	0	
# 9   x CT							 
Adh	calypso	tandemrepeat	1935928	1935945	.	+	0	
# 9   x CT							 
Adh	calypso	tandemrepeat	1935928	1935945	.	+	0	
# 9   x CT							 
Adh	calypso	tandemrepeat	1935928	1935945	.	+	0	
# 9   x CT							 
Adh	calypso	tandemrepeat	1942940	1942957	.	+	1	
# 9   x CT							 
Adh	calypso	tandemrepeat	1942940	1942957	.	+	1	
# 9   x CT							 
Adh	calypso	tandemrepeat	1946191	1946208	.	+	0	
# 6   x TTA							 
Adh	calypso	tandemrepeat	1946191	1946208	.	+	0	
# 6   x TTA							 
Adh	calypso	tandemrepeat	1949060	1949077	.	+	1	
# 3   x AGACCC							 
Adh	calypso	tandemrepeat	1949060	1949077	.	+	1	
# 3   x AGACCC							 
Adh	calypso	tandemrepeat	1949721	1949738	.	+	2	
# 3   x GATACA							 
Adh	calypso	tandemrepeat	1949721	1949738	.	+	2	
# 3   x GATACA							 
Adh	calypso	tandemrepeat	1952050	1952064	.	+	0	
# 3   x GAGCT							 
Adh	calypso	tandemrepeat	1952050	1952064	.	+	0	
# 3   x GAGCT							 
Adh	calypso	tandemrepeat	1958417	1958431	.	+	1	
# 5   x CAA							 
Adh	calypso	tandemrepeat	1958417	1958431	.	+	1	
# 5   x CAA							 
Adh	calypso	tandemrepeat	1961718	1961733	.	+	2	
# 8   x TA							 
Adh	calypso	tandemrepeat	1961718	1961733	.	+	2	
# 8   x TA							 
Adh	calypso	tandemrepeat	1963456	1963470	.	+	0	
# 3   x ATGCG							 
Adh	calypso	tandemrepeat	1963456	1963470	.	+	0	
# 3   x ATGCG							 
Adh	calypso	tandemrepeat	1963928	1963951	.	+	1	
# 8   x TCC							 
Adh	calypso	tandemrepeat	1963928	1963951	.	+	1	
# 8   x TCC							 
Adh	calypso	tandemrepeat	1968103	1968120	.	+	0	
# 9   x CT							 
Adh	calypso	tandemrepeat	1968103	1968120	.	+	0	
# 9   x CT							 
Adh	calypso	tandemrepeat	1971709	1971723	.	+	0	
# 15  x A							 
Adh	calypso	tandemrepeat	1971709	1971723	.	+	0	
# 15  x A							 
Adh	calypso	tandemrepeat	1978481	1978498	.	+	1	
# 3   x AATGCA							 
Adh	calypso	tandemrepeat	1978481	1978498	.	+	1	
# 3   x AATGCA							 
Adh	calypso	tandemrepeat	2006358	2006381	.	+	2	
# 12  x CA							 
Adh	calypso	tandemrepeat	2006358	2006381	.	+	2	
# 12  x CA							 
Adh	calypso	tandemrepeat	2010735	2010749	.	+	2	
# 15  x A							 
Adh	calypso	tandemrepeat	2010735	2010749	.	+	2	
# 15  x A							 
Adh	calypso	tandemrepeat	2016529	2016545	.	+	0	
# 17  x A							 
Adh	calypso	tandemrepeat	2016529	2016545	.	+	0	
# 17  x A							 
Adh	calypso	tandemrepeat	2020365	2020384	.	+	2	
# 20  x T							 
Adh	calypso	tandemrepeat	2020365	2020384	.	+	2	
# 20  x T							 
Adh	calypso	tandemrepeat	2025530	2025544	.	+	1	
# 3   x CATTT							 
Adh	calypso	tandemrepeat	2025530	2025544	.	+	1	
# 3   x CATTT							 
Adh	calypso	tandemrepeat	2025530	2025544	.	+	1	
# 3   x CATTT							 
Adh	calypso	tandemrepeat	2025530	2025544	.	+	1	
# 3   x CATTT							 
Adh	calypso	tandemrepeat	2028920	2028937	.	+	1	
# 9   x AT							 
Adh	calypso	tandemrepeat	2028920	2028937	.	+	1	
# 9   x AT							 
Adh	calypso	tandemrepeat	2028920	2028937	.	+	1	
# 9   x AT							 
Adh	calypso	tandemrepeat	2028920	2028937	.	+	1	
# 9   x AT							 
Adh	calypso	tandemrepeat	2042609	2042624	.	+	1	
# 4   x AAAT							 
Adh	calypso	tandemrepeat	2042609	2042624	.	+	1	
# 4   x AAAT							 
Adh	calypso	tandemrepeat	2044384	2044398	.	+	0	
# 5   x GCA							 
Adh	calypso	tandemrepeat	2044384	2044398	.	+	0	
# 5   x GCA							 
Adh	calypso	tandemrepeat	2057669	2057683	.	+	1	
# 3   x CGTTT							 
Adh	calypso	tandemrepeat	2057669	2057683	.	+	1	
# 3   x CGTTT							 
Adh	calypso	tandemrepeat	2064384	2064398	.	+	2	
# 3   x ATATT							 
Adh	calypso	tandemrepeat	2064384	2064398	.	+	2	
# 3   x ATATT							 
Adh	calypso	tandemrepeat	2084139	2084153	.	+	2	
# 3   x GTATA							 
Adh	calypso	tandemrepeat	2084139	2084153	.	+	2	
# 3   x GTATA							 
Adh	calypso	tandemrepeat	2085093	2085110	.	+	2	
# 9   x TA							 
Adh	calypso	tandemrepeat	2085093	2085110	.	+	2	
# 9   x TA							 
Adh	calypso	tandemrepeat	2087717	2087731	.	+	1	
# 15  x T							 
Adh	calypso	tandemrepeat	2087717	2087731	.	+	1	
# 15  x T							 
Adh	calypso	tandemrepeat	2089161	2089175	.	+	2	
# 3   x CATTT							 
Adh	calypso	tandemrepeat	2089161	2089175	.	+	2	
# 3   x CATTT							 
Adh	calypso	tandemrepeat	2089530	2089547	.	+	2	
# 3   x CAACAT							 
Adh	calypso	tandemrepeat	2089530	2089547	.	+	2	
# 3   x CAACAT							 
Adh	calypso	tandemrepeat	2097990	2098011	.	+	2	
# 11  x TG							 
Adh	calypso	tandemrepeat	2097990	2098011	.	+	2	
# 11  x TG							 
Adh	calypso	tandemrepeat	2098669	2098686	.	+	0	
# 9   x TC							 
Adh	calypso	tandemrepeat	2098669	2098686	.	+	0	
# 9   x TC							 
Adh	calypso	tandemrepeat	2111586	2111601	.	+	2	
# 8   x CA							 
Adh	calypso	tandemrepeat	2111586	2111601	.	+	2	
# 8   x CA							 
Adh	calypso	tandemrepeat	2118089	2118103	.	+	1	
# 15  x T							 
Adh	calypso	tandemrepeat	2118089	2118103	.	+	1	
# 15  x T							 
Adh	calypso	tandemrepeat	2118089	2118103	.	+	1	
# 15  x T							 
Adh	calypso	tandemrepeat	2123067	2123082	.	+	2	
# 4   x CTAT							 
Adh	calypso	tandemrepeat	2123067	2123082	.	+	2	
# 4   x CTAT							 
Adh	calypso	tandemrepeat	2128235	2128252	.	+	1	
# 6   x CAG							 
Adh	calypso	tandemrepeat	2128235	2128252	.	+	1	
# 6   x CAG							 
Adh	calypso	tandemrepeat	2141813	2141827	.	+	1	
# 3   x ATAAA							 
Adh	calypso	tandemrepeat	2141813	2141827	.	+	1	
# 3   x ATAAA							 
Adh	calypso	tandemrepeat	2144259	2144274	.	+	2	
# 16  x A							 
Adh	calypso	tandemrepeat	2144259	2144274	.	+	2	
# 16  x A							 
Adh	calypso	tandemrepeat	2144485	2144502	.	+	0	
# 3   x GTATGG							 
Adh	calypso	tandemrepeat	2144485	2144502	.	+	0	
# 3   x GTATGG							 
Adh	calypso	tandemrepeat	2144514	2144531	.	+	2	
# 3   x GGTCTG							 
Adh	calypso	tandemrepeat	2144514	2144531	.	+	2	
# 3   x GGTCTG							 
Adh	calypso	tandemrepeat	2146666	2146680	.	+	0	
# 3   x GATGC							 
Adh	calypso	tandemrepeat	2146666	2146680	.	+	0	
# 3   x GATGC							 
Adh	calypso	tandemrepeat	2146796	2146813	.	+	1	
# 3   x GCAGGG							 
Adh	calypso	tandemrepeat	2146796	2146813	.	+	1	
# 3   x GCAGGG							 
Adh	calypso	tandemrepeat	2154241	2154261	.	+	0	
# 7   x CAG							 
Adh	calypso	tandemrepeat	2154241	2154261	.	+	0	
# 7   x CAG							 
Adh	calypso	tandemrepeat	2159937	2159962	.	+	2	
# 13  x CA							 
Adh	calypso	tandemrepeat	2159937	2159962	.	+	2	
# 13  x CA							 
Adh	calypso	tandemrepeat	2160363	2160377	.	+	2	
# 3   x ATATT							 
Adh	calypso	tandemrepeat	2160363	2160377	.	+	2	
# 3   x ATATT							 
Adh	calypso	tandemrepeat	2160363	2160377	.	+	2	
# 3   x ATATT							 
Adh	calypso	tandemrepeat	2160363	2160377	.	+	2	
# 3   x ATATT							 
Adh	calypso	tandemrepeat	2162285	2162300	.	+	1	
# 4   x TCGC							 
Adh	calypso	tandemrepeat	2162285	2162300	.	+	1	
# 4   x TCGC							 
Adh	calypso	tandemrepeat	2162285	2162300	.	+	1	
# 4   x TCGC							 
Adh	calypso	tandemrepeat	2162285	2162300	.	+	1	
# 4   x TCGC							 
Adh	calypso	tandemrepeat	2163052	2163069	.	+	0	
# 9   x AC							 
Adh	calypso	tandemrepeat	2163052	2163069	.	+	0	
# 9   x AC							 
Adh	calypso	tandemrepeat	2163052	2163069	.	+	0	
# 9   x AC							 
Adh	calypso	tandemrepeat	2163052	2163069	.	+	0	
# 9   x AC							 
Adh	calypso	tandemrepeat	2168181	2168200	.	+	2	
# 10  x AT							 
Adh	calypso	tandemrepeat	2168181	2168200	.	+	2	
# 10  x AT							 
Adh	calypso	tandemrepeat	2168525	2168542	.	+	1	
# 3   x CTCGAA							 
Adh	calypso	tandemrepeat	2168525	2168542	.	+	1	
# 3   x CTCGAA							 
Adh	calypso	tandemrepeat	2168789	2168808	.	+	1	
# 5   x AAGA							 
Adh	calypso	tandemrepeat	2168789	2168808	.	+	1	
# 5   x AAGA							 
Adh	calypso	tandemrepeat	2168860	2168877	.	+	0	
# 3   x CCCCCT							 
Adh	calypso	tandemrepeat	2168860	2168877	.	+	0	
# 3   x CCCCCT							 
Adh	calypso	tandemrepeat	2169754	2169771	.	+	0	
# 9   x CA							 
Adh	calypso	tandemrepeat	2169754	2169771	.	+	0	
# 9   x CA							 
Adh	calypso	tandemrepeat	2170312	2170326	.	+	0	
# 3   x AAAAT							 
Adh	calypso	tandemrepeat	2170312	2170326	.	+	0	
# 3   x AAAAT							 
Adh	calypso	tandemrepeat	2170345	2170360	.	+	0	
# 8   x CA							 
Adh	calypso	tandemrepeat	2170345	2170360	.	+	0	
# 8   x CA							 
Adh	calypso	tandemrepeat	2170565	2170582	.	+	1	
# 3   x TGTGAG							 
Adh	calypso	tandemrepeat	2170565	2170582	.	+	1	
# 3   x TGTGAG							 
Adh	calypso	tandemrepeat	2180401	2180416	.	+	0	
# 8   x TA							 
Adh	calypso	tandemrepeat	2180401	2180416	.	+	0	
# 8   x TA							 
Adh	calypso	tandemrepeat	2183371	2183385	.	+	0	
# 5   x GTT							 
Adh	calypso	tandemrepeat	2183371	2183385	.	+	0	
# 5   x GTT							 
Adh	calypso	tandemrepeat	2185062	2185076	.	+	2	
# 15  x T							 
Adh	calypso	tandemrepeat	2185062	2185076	.	+	2	
# 15  x T							 
Adh	calypso	tandemrepeat	2185203	2185220	.	+	2	
# 3   x AATGAA							 
Adh	calypso	tandemrepeat	2185203	2185220	.	+	2	
# 3   x AATGAA							 
Adh	calypso	tandemrepeat	2190034	2190048	.	+	0	
# 15  x T							 
Adh	calypso	tandemrepeat	2190034	2190048	.	+	0	
# 15  x T							 
Adh	calypso	tandemrepeat	2190264	2190281	.	+	2	
# 3   x GGAAAT							 
Adh	calypso	tandemrepeat	2190264	2190281	.	+	2	
# 3   x GGAAAT							 
Adh	calypso	tandemrepeat	2191532	2191555	.	+	1	
# 8   x TGA							 
Adh	calypso	tandemrepeat	2191532	2191555	.	+	1	
# 8   x TGA							 
Adh	calypso	tandemrepeat	2192530	2192544	.	+	0	
# 3   x AAATT							 
Adh	calypso	tandemrepeat	2192530	2192544	.	+	0	
# 3   x AAATT							 
Adh	calypso	tandemrepeat	2198374	2198388	.	+	0	
# 5   x TCG							 
Adh	calypso	tandemrepeat	2198374	2198388	.	+	0	
# 5   x TCG							 
Adh	calypso	tandemrepeat	2214823	2214837	.	+	0	
# 5   x AAT							 
Adh	calypso	tandemrepeat	2214823	2214837	.	+	0	
# 5   x AAT							 
Adh	calypso	tandemrepeat	2214859	2214876	.	+	0	
# 6   x AAT							 
Adh	calypso	tandemrepeat	2214859	2214876	.	+	0	
# 6   x AAT							 
Adh	calypso	tandemrepeat	2215406	2215437	.	+	1	
# 8   x GATG							 
Adh	calypso	tandemrepeat	2215406	2215437	.	+	1	
# 8   x GATG							 
Adh	calypso	tandemrepeat	2215825	2215845	.	+	0	
# 7   x TAA							 
Adh	calypso	tandemrepeat	2215825	2215845	.	+	0	
# 7   x TAA							 
Adh	calypso	tandemrepeat	2215861	2215875	.	+	0	
# 5   x TAA							 
Adh	calypso	tandemrepeat	2215861	2215875	.	+	0	
# 5   x TAA							 
Adh	calypso	tandemrepeat	2230139	2230156	.	+	1	
# 9   x AC							 
Adh	calypso	tandemrepeat	2230139	2230156	.	+	1	
# 9   x AC							 
Adh	calypso	tandemrepeat	2230365	2230382	.	+	2	
# 9   x GT							 
Adh	calypso	tandemrepeat	2230365	2230382	.	+	2	
# 9   x GT							 
Adh	calypso	tandemrepeat	2231181	2231198	.	+	2	
# 6   x TCA							 
Adh	calypso	tandemrepeat	2231181	2231198	.	+	2	
# 6   x TCA							 
Adh	calypso	tandemrepeat	2232468	2232482	.	+	2	
# 3   x ACAAA							 
Adh	calypso	tandemrepeat	2232468	2232482	.	+	2	
# 3   x ACAAA							 
Adh	calypso	tandemrepeat	2234024	2234038	.	+	1	
# 15  x T							 
Adh	calypso	tandemrepeat	2234024	2234038	.	+	1	
# 15  x T							 
Adh	calypso	tandemrepeat	2242794	2242816	.	+	2	
# 23  x A							 
Adh	calypso	tandemrepeat	2242794	2242816	.	+	2	
# 23  x A							 
Adh	calypso	tandemrepeat	2248183	2248197	.	+	0	
# 5   x TGA							 
Adh	calypso	tandemrepeat	2248183	2248197	.	+	0	
# 5   x TGA							 
Adh	calypso	tandemrepeat	2259378	2259392	.	+	2	
# 5   x TTA							 
Adh	calypso	tandemrepeat	2259378	2259392	.	+	2	
# 5   x TTA							 
Adh	calypso	tandemrepeat	2267417	2267434	.	+	1	
# 9   x AT							 
Adh	calypso	tandemrepeat	2267417	2267434	.	+	1	
# 9   x AT							 
Adh	calypso	tandemrepeat	2277326	2277340	.	+	1	
# 5   x AGC							 
Adh	calypso	tandemrepeat	2277326	2277340	.	+	1	
# 5   x AGC							 
Adh	calypso	tandemrepeat	2279921	2279936	.	+	1	
# 4   x AATA							 
Adh	calypso	tandemrepeat	2279921	2279936	.	+	1	
# 4   x AATA							 
Adh	calypso	tandemrepeat	2280187	2280208	.	+	0	
# 22  x A							 
Adh	calypso	tandemrepeat	2280187	2280208	.	+	0	
# 22  x A							 
Adh	calypso	tandemrepeat	2298057	2298071	.	+	2	
# 15  x A							 
Adh	calypso	tandemrepeat	2298057	2298071	.	+	2	
# 15  x A							 
Adh	calypso	tandemrepeat	2298057	2298071	.	+	2	
# 15  x A							 
Adh	calypso	tandemrepeat	2298057	2298071	.	+	2	
# 15  x A							 
Adh	calypso	tandemrepeat	2301737	2301756	.	+	1	
# 10  x CA							 
Adh	calypso	tandemrepeat	2301737	2301756	.	+	1	
# 10  x CA							 
Adh	calypso	tandemrepeat	2302523	2302543	.	+	1	
# 7   x AGC							 
Adh	calypso	tandemrepeat	2302523	2302543	.	+	1	
# 7   x AGC							 
Adh	calypso	tandemrepeat	2321002	2321024	.	+	0	
# 23  x A							 
Adh	calypso	tandemrepeat	2321002	2321024	.	+	0	
# 23  x A							 
Adh	calypso	tandemrepeat	2324093	2324107	.	+	1	
# 15  x A							 
Adh	calypso	tandemrepeat	2324093	2324107	.	+	1	
# 15  x A							 
Adh	calypso	tandemrepeat	2348152	2348171	.	+	0	
# 4   x ATACC							 
Adh	calypso	tandemrepeat	2348152	2348171	.	+	0	
# 4   x ATACC							 
Adh	calypso	tandemrepeat	2348301	2348315	.	+	2	
# 15  x G							 
Adh	calypso	tandemrepeat	2348301	2348315	.	+	2	
# 15  x G							 
Adh	calypso	tandemrepeat	2356498	2356512	.	+	0	
# 3   x AACAG							 
Adh	calypso	tandemrepeat	2356498	2356512	.	+	0	
# 3   x AACAG							 
Adh	calypso	tandemrepeat	2363903	2363918	.	+	1	
# 8   x TA							 
Adh	calypso	tandemrepeat	2363903	2363918	.	+	1	
# 8   x TA							 
Adh	calypso	tandemrepeat	2365560	2365574	.	+	2	
# 15  x A							 
Adh	calypso	tandemrepeat	2365560	2365574	.	+	2	
# 15  x A							 
Adh	calypso	tandemrepeat	2373664	2373679	.	+	0	
# 4   x AATA							 
Adh	calypso	tandemrepeat	2373664	2373679	.	+	0	
# 4   x AATA							 
Adh	calypso	tandemrepeat	2379370	2379385	.	+	0	
# 16  x A							 
Adh	calypso	tandemrepeat	2379370	2379385	.	+	0	
# 16  x A							 
Adh	calypso	tandemrepeat	2382389	2382404	.	+	1	
# 8   x AC							 
Adh	calypso	tandemrepeat	2382389	2382404	.	+	1	
# 8   x AC							 
Adh	calypso	tandemrepeat	2400669	2400683	.	+	2	
# 5   x TGT							 
Adh	calypso	tandemrepeat	2400669	2400683	.	+	2	
# 5   x TGT							 
Adh	calypso	tandemrepeat	2401208	2401225	.	+	1	
# 9   x AT							 
Adh	calypso	tandemrepeat	2401208	2401225	.	+	1	
# 9   x AT							 
Adh	calypso	tandemrepeat	2401610	2401629	.	+	1	
# 4   x ATAAT							 
Adh	calypso	tandemrepeat	2401610	2401629	.	+	1	
# 4   x ATAAT							 
Adh	calypso	tandemrepeat	2405966	2405981	.	+	1	
# 8   x AT							 
Adh	calypso	tandemrepeat	2405966	2405981	.	+	1	
# 8   x AT							 
Adh	calypso	tandemrepeat	2414339	2414356	.	+	1	
# 6   x CAA							 
Adh	calypso	tandemrepeat	2414339	2414356	.	+	1	
# 6   x CAA							 
Adh	calypso	tandemrepeat	2418287	2418302	.	+	1	
# 4   x GTGC							 
Adh	calypso	tandemrepeat	2418287	2418302	.	+	1	
# 4   x GTGC							 
Adh	calypso	tandemrepeat	2421556	2421570	.	+	0	
# 5   x TGG							 
Adh	calypso	tandemrepeat	2421556	2421570	.	+	0	
# 5   x TGG							 
Adh	calypso	tandemrepeat	2421891	2421906	.	+	2	
# 4   x ATAC							 
Adh	calypso	tandemrepeat	2421891	2421906	.	+	2	
# 4   x ATAC							 
Adh	calypso	tandemrepeat	2425056	2425079	.	+	2	
# 6   x ACTG							 
Adh	calypso	tandemrepeat	2425056	2425079	.	+	2	
# 6   x ACTG							 
Adh	calypso	tandemrepeat	2425105	2425122	.	+	0	
# 9   x GT							 
Adh	calypso	tandemrepeat	2425105	2425122	.	+	0	
# 9   x GT							 
Adh	calypso	tandemrepeat	2427790	2427807	.	+	0	
# 9   x TA							 
Adh	calypso	tandemrepeat	2427790	2427807	.	+	0	
# 9   x TA							 
Adh	calypso	tandemrepeat	2435576	2435590	.	+	1	
# 15  x A							 
Adh	calypso	tandemrepeat	2435576	2435590	.	+	1	
# 15  x A							 
Adh	calypso	tandemrepeat	2439263	2439278	.	+	1	
# 8   x TG							 
Adh	calypso	tandemrepeat	2439263	2439278	.	+	1	
# 8   x TG							 
Adh	calypso	tandemrepeat	2439509	2439523	.	+	1	
# 3   x GTAAT							 
Adh	calypso	tandemrepeat	2439509	2439523	.	+	1	
# 3   x GTAAT							 
Adh	calypso	tandemrepeat	2441087	2441104	.	+	1	
# 3   x ACGCAC							 
Adh	calypso	tandemrepeat	2441087	2441104	.	+	1	
# 3   x ACGCAC							 
Adh	calypso	tandemrepeat	2444339	2444362	.	+	1	
# 12  x GT							 
Adh	calypso	tandemrepeat	2444339	2444362	.	+	1	
# 12  x GT							 
Adh	calypso	tandemrepeat	2455870	2455885	.	+	0	
# 16  x A							 
Adh	calypso	tandemrepeat	2455870	2455885	.	+	0	
# 16  x A							 
Adh	calypso	tandemrepeat	2456271	2456288	.	+	2	
# 3   x CATATA							 
Adh	calypso	tandemrepeat	2456271	2456288	.	+	2	
# 3   x CATATA							 
Adh	calypso	tandemrepeat	2467970	2467987	.	+	1	
# 3   x AATGCG							 
Adh	calypso	tandemrepeat	2467970	2467987	.	+	1	
# 3   x AATGCG							 
Adh	calypso	tandemrepeat	2475185	2475199	.	+	1	
# 3   x TAGAA							 
Adh	calypso	tandemrepeat	2475185	2475199	.	+	1	
# 3   x TAGAA							 
Adh	calypso	tandemrepeat	2475185	2475199	.	+	1	
# 3   x TAGAA							 
Adh	calypso	tandemrepeat	2475185	2475199	.	+	1	
# 3   x TAGAA							 
Adh	calypso	tandemrepeat	2481905	2481922	.	+	1	
# 3   x TGGATA							 
Adh	calypso	tandemrepeat	2481905	2481922	.	+	1	
# 3   x TGGATA							 
Adh	calypso	tandemrepeat	2483605	2483620	.	+	0	
# 4   x TACA							 
Adh	calypso	tandemrepeat	2483605	2483620	.	+	0	
# 4   x TACA							 
Adh	calypso	tandemrepeat	2488498	2488512	.	+	0	
# 5   x TGA							 
Adh	calypso	tandemrepeat	2488498	2488512	.	+	0	
# 5   x TGA							 
Adh	calypso	tandemrepeat	2493288	2493302	.	+	2	
# 5   x ATC							 
Adh	calypso	tandemrepeat	2493288	2493302	.	+	2	
# 5   x ATC							 
Adh	calypso	tandemrepeat	2499108	2499123	.	+	2	
# 8   x CT							 
Adh	calypso	tandemrepeat	2499108	2499123	.	+	2	
# 8   x CT							 
Adh	calypso	tandemrepeat	2500796	2500822	.	+	1	
# 9   x GGA							 
Adh	calypso	tandemrepeat	2500796	2500822	.	+	1	
# 9   x GGA							 
Adh	calypso	tandemrepeat	2503704	2503721	.	+	2	
# 9   x TG							 
Adh	calypso	tandemrepeat	2503704	2503721	.	+	2	
# 9   x TG							 
Adh	calypso	tandemrepeat	2504989	2505006	.	+	0	
# 3   x CATCCC							 
Adh	calypso	tandemrepeat	2504989	2505006	.	+	0	
# 3   x CATCCC							 
Adh	calypso	tandemrepeat	2512367	2512389	.	+	1	
# 23  x T							 
Adh	calypso	tandemrepeat	2512367	2512389	.	+	1	
# 23  x T							 
Adh	calypso	tandemrepeat	2512599	2512613	.	+	2	
# 3   x GACCT							 
Adh	calypso	tandemrepeat	2512599	2512613	.	+	2	
# 3   x GACCT							 
Adh	calypso	tandemrepeat	2512614	2512633	.	+	2	
# 4   x GAACT							 
Adh	calypso	tandemrepeat	2512614	2512633	.	+	2	
# 4   x GAACT							 
Adh	calypso	tandemrepeat	2515812	2515828	.	+	2	
# 17  x T							 
Adh	calypso	tandemrepeat	2515812	2515828	.	+	2	
# 17  x T							 
Adh	calypso	tandemrepeat	2518426	2518441	.	+	0	
# 8   x AC							 
Adh	calypso	tandemrepeat	2518426	2518441	.	+	0	
# 8   x AC							 
Adh	calypso	tandemrepeat	2528405	2528420	.	+	1	
# 8   x AC							 
Adh	calypso	tandemrepeat	2528405	2528420	.	+	1	
# 8   x AC							 
Adh	calypso	tandemrepeat	2542285	2542304	.	+	0	
# 5   x AACA							 
Adh	calypso	tandemrepeat	2542285	2542304	.	+	0	
# 5   x AACA							 
Adh	calypso	tandemrepeat	2561483	2561499	.	+	1	
# 17  x A							 
Adh	calypso	tandemrepeat	2561483	2561499	.	+	1	
# 17  x A							 
Adh	calypso	tandemrepeat	2562377	2562391	.	+	1	
# 3   x TGCAC							 
Adh	calypso	tandemrepeat	2562377	2562391	.	+	1	
# 3   x TGCAC							 
Adh	calypso	tandemrepeat	2562544	2562559	.	+	0	
# 8   x GA							 
Adh	calypso	tandemrepeat	2562544	2562559	.	+	0	
# 8   x GA							 
Adh	calypso	tandemrepeat	2562999	2563013	.	+	2	
# 3   x TTTGT							 
Adh	calypso	tandemrepeat	2562999	2563013	.	+	2	
# 3   x TTTGT							 
Adh	calypso	tandemrepeat	2564121	2564135	.	+	2	
# 3   x TTGAC							 
Adh	calypso	tandemrepeat	2564121	2564135	.	+	2	
# 3   x TTGAC							 
Adh	calypso	tandemrepeat	2570414	2570441	.	+	1	
# 14  x AC							 
Adh	calypso	tandemrepeat	2570414	2570441	.	+	1	
# 14  x AC							 
Adh	calypso	tandemrepeat	2579771	2579796	.	+	1	
# 13  x TA							 
Adh	calypso	tandemrepeat	2579771	2579796	.	+	1	
# 13  x TA							 
Adh	calypso	tandemrepeat	2581725	2581745	.	+	2	
# 21  x T							 
Adh	calypso	tandemrepeat	2581725	2581745	.	+	2	
# 21  x T							 
Adh	calypso	tandemrepeat	2582249	2582264	.	+	1	
# 8   x AC							 
Adh	calypso	tandemrepeat	2582249	2582264	.	+	1	
# 8   x AC							 
Adh	calypso	tandemrepeat	2590705	2590720	.	+	0	
# 4   x TATT							 
Adh	calypso	tandemrepeat	2590705	2590720	.	+	0	
# 4   x TATT							 
Adh	calypso	tandemrepeat	2595578	2595593	.	+	1	
# 4   x TATT							 
Adh	calypso	tandemrepeat	2595578	2595593	.	+	1	
# 4   x TATT							 
Adh	calypso	tandemrepeat	2596019	2596036	.	+	1	
# 3   x TCGTCC							 
Adh	calypso	tandemrepeat	2596019	2596036	.	+	1	
# 3   x TCGTCC							 
Adh	calypso	tandemrepeat	2597900	2597919	.	+	1	
# 4   x TTCCG							 
Adh	calypso	tandemrepeat	2597900	2597919	.	+	1	
# 4   x TTCCG							 
Adh	calypso	tandemrepeat	2613229	2613243	.	+	0	
# 3   x AAAAT							 
Adh	calypso	tandemrepeat	2613229	2613243	.	+	0	
# 3   x AAAAT							 
Adh	calypso	tandemrepeat	2613229	2613243	.	+	0	
# 3   x AAAAT							 
Adh	calypso	tandemrepeat	2613229	2613243	.	+	0	
# 3   x AAAAT							 
Adh	calypso	tandemrepeat	2627807	2627824	.	+	1	
# 9   x TA							 
Adh	calypso	tandemrepeat	2627807	2627824	.	+	1	
# 9   x TA							 
Adh	calypso	tandemrepeat	2637495	2637509	.	+	2	
# 3   x CTTTT							 
Adh	calypso	tandemrepeat	2637495	2637509	.	+	2	
# 3   x CTTTT							 
Adh	calypso	tandemrepeat	2640286	2640300	.	+	0	
# 5   x AGC							 
Adh	calypso	tandemrepeat	2640286	2640300	.	+	0	
# 5   x AGC							 
Adh	calypso	tandemrepeat	2648139	2648156	.	+	2	
# 18  x T							 
Adh	calypso	tandemrepeat	2648139	2648156	.	+	2	
# 18  x T							 
Adh	calypso	tandemrepeat	2653285	2653300	.	+	0	
# 8   x CA							 
Adh	calypso	tandemrepeat	2653285	2653300	.	+	0	
# 8   x CA							 
Adh	calypso	tandemrepeat	2658749	2658763	.	+	1	
# 3   x TTTCA							 
Adh	calypso	tandemrepeat	2658749	2658763	.	+	1	
# 3   x TTTCA							 
Adh	calypso	tandemrepeat	2658749	2658763	.	+	1	
# 3   x TTTCA							 
Adh	calypso	tandemrepeat	2658749	2658763	.	+	1	
# 3   x TTTCA							 
Adh	calypso	tandemrepeat	2660137	2660156	.	+	0	
# 20  x T							 
Adh	calypso	tandemrepeat	2660137	2660156	.	+	0	
# 20  x T							 
Adh	calypso	tandemrepeat	2660166	2660183	.	+	2	
# 3   x TTTTTG							 
Adh	calypso	tandemrepeat	2660166	2660183	.	+	2	
# 3   x TTTTTG							 
Adh	calypso	tandemrepeat	2662362	2662381	.	+	2	
# 5   x ATTT							 
Adh	calypso	tandemrepeat	2662362	2662381	.	+	2	
# 5   x ATTT							 
Adh	calypso	tandemrepeat	2664163	2664180	.	+	0	
# 3   x TGGTGA							 
Adh	calypso	tandemrepeat	2664163	2664180	.	+	0	
# 3   x TGGTGA							 
Adh	calypso	tandemrepeat	2664737	2664751	.	+	1	
# 15  x T							 
Adh	calypso	tandemrepeat	2664737	2664751	.	+	1	
# 15  x T							 
Adh	calypso	tandemrepeat	2665008	2665025	.	+	2	
# 9   x AC							 
Adh	calypso	tandemrepeat	2665008	2665025	.	+	2	
# 9   x AC							 
Adh	calypso	tandemrepeat	2666920	2666934	.	+	0	
# 3   x TGTGT							 
Adh	calypso	tandemrepeat	2666920	2666934	.	+	0	
# 3   x TGTGT							 
Adh	calypso	tandemrepeat	2667144	2667163	.	+	2	
# 4   x TTTCG							 
Adh	calypso	tandemrepeat	2667144	2667163	.	+	2	
# 4   x TTTCG							 
Adh	calypso	tandemrepeat	2671441	2671459	.	+	0	
# 19  x A							 
Adh	calypso	tandemrepeat	2671441	2671459	.	+	0	
# 19  x A							 
Adh	calypso	tandemrepeat	2674620	2674640	.	+	2	
# 7   x TGA							 
Adh	calypso	tandemrepeat	2674620	2674640	.	+	2	
# 7   x TGA							 
Adh	calypso	tandemrepeat	2680817	2680834	.	+	1	
# 9   x CA							 
Adh	calypso	tandemrepeat	2680817	2680834	.	+	1	
# 9   x CA							 
Adh	calypso	tandemrepeat	2681867	2681882	.	+	1	
# 4   x TTTA							 
Adh	calypso	tandemrepeat	2681867	2681882	.	+	1	
# 4   x TTTA							 
Adh	calypso	tandemrepeat	2683317	2683334	.	+	2	
# 9   x AT							 
Adh	calypso	tandemrepeat	2683317	2683334	.	+	2	
# 9   x AT							 
Adh	calypso	tandemrepeat	2689260	2689281	.	+	2	
# 11  x AT							 
Adh	calypso	tandemrepeat	2689260	2689281	.	+	2	
# 11  x AT							 
Adh	calypso	tandemrepeat	2698422	2698439	.	+	2	
# 3   x ATAAAT							 
Adh	calypso	tandemrepeat	2698422	2698439	.	+	2	
# 3   x ATAAAT							 
Adh	calypso	tandemrepeat	2702531	2702545	.	+	1	
# 15  x T							 
Adh	calypso	tandemrepeat	2702531	2702545	.	+	1	
# 15  x T							 
Adh	calypso	tandemrepeat	2702531	2702545	.	+	1	
# 15  x T							 
Adh	calypso	tandemrepeat	2702531	2702545	.	+	1	
# 15  x T							 
Adh	calypso	tandemrepeat	2703085	2703102	.	+	0	
# 3   x ATAGAT							 
Adh	calypso	tandemrepeat	2703085	2703102	.	+	0	
# 3   x ATAGAT							 
Adh	calypso	tandemrepeat	2703085	2703102	.	+	0	
# 3   x ATAGAT							 
Adh	calypso	tandemrepeat	2703085	2703102	.	+	0	
# 3   x ATAGAT							 
Adh	calypso	tandemrepeat	2704032	2704048	.	+	2	
# 17  x A							 
Adh	calypso	tandemrepeat	2704032	2704048	.	+	2	
# 17  x A							 
Adh	calypso	tandemrepeat	2704032	2704048	.	+	2	
# 17  x A							 
Adh	calypso	tandemrepeat	2704032	2704048	.	+	2	
# 17  x A							 
Adh	calypso	tandemrepeat	2713535	2713554	.	+	1	
# 10  x AT							 
Adh	calypso	tandemrepeat	2713535	2713554	.	+	1	
# 10  x AT							 
Adh	calypso	tandemrepeat	2713677	2713696	.	+	2	
# 4   x TTTTG							 
Adh	calypso	tandemrepeat	2713677	2713696	.	+	2	
# 4   x TTTTG							 
Adh	calypso	tandemrepeat	2714256	2714271	.	+	2	
# 4   x TGTA							 
Adh	calypso	tandemrepeat	2714256	2714271	.	+	2	
# 4   x TGTA							 
Adh	calypso	tandemrepeat	2717410	2717425	.	+	0	
# 8   x CT							 
Adh	calypso	tandemrepeat	2717410	2717425	.	+	0	
# 8   x CT							 
Adh	calypso	tandemrepeat	2718928	2718945	.	+	0	
# 9   x CT							 
Adh	calypso	tandemrepeat	2718928	2718945	.	+	0	
# 9   x CT							 
Adh	calypso	tandemrepeat	2725501	2725550	.	+	0	
# 25  x TA							 
Adh	calypso	tandemrepeat	2725501	2725550	.	+	0	
# 25  x TA							 
Adh	calypso	tandemrepeat	2726451	2726468	.	+	2	
# 6   x GTT							 
Adh	calypso	tandemrepeat	2726451	2726468	.	+	2	
# 6   x GTT							 
Adh	calypso	tandemrepeat	2733177	2733192	.	+	2	
# 16  x A							 
Adh	calypso	tandemrepeat	2733177	2733192	.	+	2	
# 16  x A							 
Adh	calypso	tandemrepeat	2733666	2733683	.	+	2	
# 18  x A							 
Adh	calypso	tandemrepeat	2733666	2733683	.	+	2	
# 18  x A							 
Adh	calypso	tandemrepeat	2736698	2736713	.	+	1	
# 8   x AG							 
Adh	calypso	tandemrepeat	2736698	2736713	.	+	1	
# 8   x AG							 
Adh	calypso	tandemrepeat	2738053	2738076	.	+	0	
# 8   x AGG							 
Adh	calypso	tandemrepeat	2738053	2738076	.	+	0	
# 8   x AGG							 
Adh	calypso	tandemrepeat	2738077	2738091	.	+	0	
# 5   x TGG							 
Adh	calypso	tandemrepeat	2738077	2738091	.	+	0	
# 5   x TGG							 
Adh	calypso	tandemrepeat	2742532	2742546	.	+	0	
# 5   x CTC							 
Adh	calypso	tandemrepeat	2742532	2742546	.	+	0	
# 5   x CTC							 
Adh	calypso	tandemrepeat	2748916	2748931	.	+	0	
# 8   x CT							 
Adh	calypso	tandemrepeat	2748916	2748931	.	+	0	
# 8   x CT							 
Adh	calypso	tandemrepeat	2748916	2748931	.	+	0	
# 8   x CT							 
Adh	calypso	tandemrepeat	2748916	2748931	.	+	0	
# 8   x CT							 
Adh	calypso	tandemrepeat	2750506	2750520	.	+	0	
# 5   x GAT							 
Adh	calypso	tandemrepeat	2750506	2750520	.	+	0	
# 5   x GAT							 
Adh	calypso	tandemrepeat	2751945	2751962	.	+	2	
# 3   x AAAAAC							 
Adh	calypso	tandemrepeat	2751945	2751962	.	+	2	
# 3   x AAAAAC							 
Adh	calypso	tandemrepeat	2761103	2761117	.	+	1	
# 3   x CTTTT							 
Adh	calypso	tandemrepeat	2761103	2761117	.	+	1	
# 3   x CTTTT							 
Adh	calypso	tandemrepeat	2768806	2768823	.	+	0	
# 6   x CTA							 
Adh	calypso	tandemrepeat	2768806	2768823	.	+	0	
# 6   x CTA							 
Adh	calypso	tandemrepeat	2792876	2792890	.	+	1	
# 3   x ATTTA							 
Adh	calypso	tandemrepeat	2792876	2792890	.	+	1	
# 3   x ATTTA							 
Adh	calypso	tandemrepeat	2792876	2792890	.	+	1	
# 3   x ATTTA							 
Adh	calypso	tandemrepeat	2792876	2792890	.	+	1	
# 3   x ATTTA							 
Adh	calypso	tandemrepeat	2808106	2808120	.	+	0	
# 15  x T							 
Adh	calypso	tandemrepeat	2808106	2808120	.	+	0	
# 15  x T							 
Adh	calypso	tandemrepeat	2809579	2809596	.	+	0	
# 9   x TG							 
Adh	calypso	tandemrepeat	2809579	2809596	.	+	0	
# 9   x TG							 
Adh	calypso	tandemrepeat	2816555	2816570	.	+	1	
# 4   x CATA							 
Adh	calypso	tandemrepeat	2816555	2816570	.	+	1	
# 4   x CATA							 
Adh	calypso	tandemrepeat	2820882	2820899	.	+	2	
# 6   x GTC							 
Adh	calypso	tandemrepeat	2820882	2820899	.	+	2	
# 6   x GTC							 
Adh	calypso	tandemrepeat	2827525	2827540	.	+	0	
# 8   x AC							 
Adh	calypso	tandemrepeat	2827525	2827540	.	+	0	
# 8   x AC							 
Adh	calypso	tandemrepeat	2835091	2835108	.	+	0	
# 18  x T							 
Adh	calypso	tandemrepeat	2835091	2835108	.	+	0	
# 18  x T							 
Adh	calypso	tandemrepeat	2835091	2835108	.	+	0	
# 18  x T							 
Adh	calypso	tandemrepeat	2835091	2835108	.	+	0	
# 18  x T							 
Adh	calypso	tandemrepeat	2837281	2837300	.	+	0	
# 5   x CAGC							 
Adh	calypso	tandemrepeat	2837281	2837300	.	+	0	
# 5   x CAGC							 
Adh	calypso	tandemrepeat	2837281	2837300	.	+	0	
# 5   x CAGC							 
Adh	calypso	tandemrepeat	2837281	2837300	.	+	0	
# 5   x CAGC							 
Adh	calypso	tandemrepeat	2850284	2850307	.	+	1	
# 4   x AGTGCA							 
Adh	calypso	tandemrepeat	2850284	2850307	.	+	1	
# 4   x AGTGCA							 
Adh	calypso	tandemrepeat	2856339	2856363	.	+	2	
# 5   x GGTAT							 
Adh	calypso	tandemrepeat	2856339	2856363	.	+	2	
# 5   x GGTAT							 
Adh	calypso	tandemrepeat	2862930	2862950	.	+	2	
# 7   x CAA							 
Adh	calypso	tandemrepeat	2862930	2862950	.	+	2	
# 7   x CAA							 
Adh	calypso	tandemrepeat	2879944	2879958	.	+	0	
# 3   x TGGGG							 
Adh	calypso	tandemrepeat	2879944	2879958	.	+	0	
# 3   x TGGGG							 
Adh	calypso	tandemrepeat	2880477	2880492	.	+	2	
# 4   x TATG							 
Adh	calypso	tandemrepeat	2880477	2880492	.	+	2	
# 4   x TATG							 
Adh	calypso	tandemrepeat	2880477	2880492	.	+	2	
# 4   x TATG							 
Adh	calypso	tandemrepeat	2880477	2880492	.	+	2	
# 4   x TATG							 
Adh	calypso	tandemrepeat	2884248	2884267	.	+	2	
# 4   x AAGTT							 
Adh	calypso	tandemrepeat	2884248	2884267	.	+	2	
# 4   x AAGTT							 
Adh	calypso	tandemrepeat	2884248	2884267	.	+	2	
# 4   x AAGTT							 
Adh	calypso	tandemrepeat	2884248	2884267	.	+	2	
# 4   x AAGTT							 
Adh	calypso	tandemrepeat	2887608	2887625	.	+	2	
# 9   x TA							 
Adh	calypso	tandemrepeat	2887608	2887625	.	+	2	
# 9   x TA							 
Adh	calypso	tandemrepeat	2888564	2888578	.	+	1	
# 3   x TGAAC							 
Adh	calypso	tandemrepeat	2888564	2888578	.	+	1	
# 3   x TGAAC							 
Adh	calypso	tandemrepeat	2888711	2888726	.	+	1	
# 8   x GT							 
Adh	calypso	tandemrepeat	2888711	2888726	.	+	1	
# 8   x GT							 
Adh	calypso	tandemrepeat	2892926	2892940	.	+	1	
# 3   x GTATT							 
Adh	calypso	tandemrepeat	2892926	2892940	.	+	1	
# 3   x GTATT							 
Adh	calypso	tandemrepeat	2907781	2907795	.	+	0	
# 15  x A							 
Adh	calypso	tandemrepeat	2907781	2907795	.	+	0	
# 15  x A							 
Adh	calypso	tandemrepeat	2913083	2913097	.	+	1	
# 5   x CAA							 
Adh	calypso	tandemrepeat	2913083	2913097	.	+	1	
# 5   x CAA							 
Adh	calypso	tandemrepeat	2913104	2913121	.	+	1	
# 6   x CAA							 
Adh	calypso	tandemrepeat	2913104	2913121	.	+	1	
# 6   x CAA							 
Adh	calypso	tandemrepeat	2914705	2914728	.	+	0	
# 12  x AT							 
##gff-version 2
##source-version GH-fudged-GFF 1.0
# Thu Jul 22 11:59:08 1999
#
####
#
# compfly: 1. exon feature removed Jul 8 (MR)
#          2. 5 extra genes removed to 38 genes Jan 19 (MR)
#
#
Adh	std1	stop_codon	133458	133460	.	-	.	transcript  "LD13077.con"
Adh	std1	CDS	133458	133548	.	-	.	transcript  "LD13077.con"
Adh	std1	CDS	133612	134233	.	-	.	transcript  "LD13077.con"
Adh	std1	CDS	134862	134967	.	-	.	transcript  "LD13077.con"
Adh	std1	start_codon	134965	134967	.	-	.	transcript  "LD13077.con"
#
####
####
#
Adh	std1	start_codon	264992	264994	.	+	.	transcript  "LD32761"
Adh	std1	CDS	264992	264997	.	+	.	transcript  "LD32761"
Adh	std1	CDS	265088	266322	.	+	.	transcript  "LD32761"
Adh	std1	CDS	266392	266619	.	+	.	transcript  "LD32761"
Adh	std1	CDS	266684	266867	.	+	.	transcript  "LD32761"
Adh	std1	CDS	266935	267073	.	+	.	transcript  "LD32761"
Adh	std1	CDS	267134	267234	.	+	.	transcript  "LD32761"
Adh	std1	stop_codon	267232	267234	.	+	.	transcript  "LD32761"
#
####
####
#
Adh	std1	start_codon	327175	327177	.	+	.	transcript  "LD09978-ADH.con"
Adh	std1	CDS	327175	328002	.	+	.	transcript  "LD09978-ADH.con"
Adh	std1	stop_codon	328000	328002	.	+	.	transcript  "LD09978-ADH.con"
#
####
####
#
Adh	std1	start_codon	341713	341715	.	+	.	transcript  "LP05733.con"
Adh	std1	CDS	341713	341857	.	+	.	transcript  "LP05733.con"
Adh	std1	CDS	342003	342751	.	+	.	transcript  "LP05733.con"
Adh	std1	stop_codon	342749	342751	.	+	.	transcript  "LP05733.con"
#
####
####
#
Adh	std1	start_codon	373286	373288	.	+	.	transcript  "LD11783"
Adh	std1	CDS	373286	373457	.	+	.	transcript  "LD11783"
Adh	std1	CDS	385051	385283	.	+	.	transcript  "LD11783"
Adh	std1	CDS	388780	388921	.	+	.	transcript  "LD11783"
Adh	std1	CDS	389006	389140	.	+	.	transcript  "LD11783"
Adh	std1	CDS	389208	390491	.	+	.	transcript  "LD11783"
Adh	std1	CDS	390556	390673	.	+	.	transcript  "LD11783"
Adh	std1	CDS	390737	391112	.	+	.	transcript  "LD11783"
Adh	std1	CDS	391177	391500	.	+	.	transcript  "LD11783"
Adh	std1	stop_codon	391498	391500	.	+	.	transcript  "LD11783"
#
####
####
#
Adh	std1	CDS	393573	393814	.	-	.	transcript  "LD02558"
Adh	std1	stop_codon	393573	393575	.	-	.	transcript  "LD02558"
Adh	std1	CDS	393894	394052	.	-	.	transcript  "LD02558"
Adh	std1	CDS	394383	395732	.	-	.	transcript  "LD02558"
Adh	std1	CDS	395826	397468	.	-	.	transcript  "LD02558"
Adh	std1	CDS	397532	397671	.	-	.	transcript  "LD02558"
Adh	std1	start_codon	397669	397671	.	-	.	transcript  "LD02558"
#
####
####
#
Adh	std1	stop_codon	438979	438981	.	-	.	transcript  "HL02234"
Adh	std1	CDS	438979	439800	.	-	.	transcript  "HL02234"
Adh	std1	CDS	440839	440850	.	-	.	transcript  "HL02234"
Adh	std1	start_codon	440848	440850	.	-	.	transcript  "HL02234"
#
####
####
#
Adh	std1	stop_codon	458837	458839	.	-	.	transcript  "HL01444"
Adh	std1	CDS	458837	459146	.	-	.	transcript  "HL01444"
Adh	std1	CDS	459225	459761	.	-	.	transcript  "HL01444"
Adh	std1	CDS	460256	460674	.	-	.	transcript  "HL01444"
Adh	std1	start_codon	460672	460674	.	-	.	transcript  "HL01444"
#
####
####
#
Adh	std1	stop_codon	462092	462094	.	-	.	transcript  "CK00536.con"
Adh	std1	CDS	462092	462584	.	-	.	transcript  "CK00536.con"
Adh	std1	CDS	462646	463209	.	-	.	transcript  "CK00536.con"
Adh	std1	CDS	463368	463657	.	-	.	transcript  "CK00536.con"
Adh	std1	start_codon	463655	463657	.	-	.	transcript  "CK00536.con"
#
####
####
#
Adh	std1	CDS	467979	469628	.	-	.	transcript  "LP05465"
Adh	std1	stop_codon	467979	467981	.	-	.	transcript  "LP05465"
Adh	std1	CDS	470226	470438	.	-	.	transcript  "LP05465"
Adh	std1	start_codon	470436	470438	.	-	.	transcript  "LP05465"
#
####
####
#
Adh	std1	start_codon	509545	509547	.	+	.	transcript  "LD10778"
Adh	std1	CDS	509545	509783	.	+	.	transcript  "LD10778"
Adh	std1	CDS	509881	510226	.	+	.	transcript  "LD10778"
Adh	std1	CDS	510287	510786	.	+	.	transcript  "LD10778"
Adh	std1	CDS	511784	512375	.	+	.	transcript  "LD10778"
Adh	std1	CDS	512435	512758	.	+	.	transcript  "LD10778"
Adh	std1	stop_codon	512756	512758	.	+	.	transcript  "LD10778"
#
####
####
#
Adh	std1	CDS	601945	602889	.	-	.	transcript  "HL03474"
Adh	std1	stop_codon	601945	601947	.	-	.	transcript  "HL03474"
Adh	std1	CDS	602944	603000	.	-	.	transcript  "HL03474"
Adh	std1	start_codon	602998	603000	.	-	.	transcript  "HL03474"
#
####
####
#
Adh	std1	stop_codon	846397	846399	.	-	.	transcript  "LD09509"
Adh	std1	CDS	846397	847372	.	-	.	transcript  "LD09509"
Adh	std1	CDS	847433	848154	.	-	.	transcript  "LD09509"
Adh	std1	CDS	848208	848609	.	-	.	transcript  "LD09509"
Adh	std1	CDS	848668	848733	.	-	.	transcript  "LD09509"
Adh	std1	start_codon	848731	848733	.	-	.	transcript  "LD09509"
#
####
####
#
Adh	std1	start_codon	851085	851087	.	+	.	transcript  "LD03340"
Adh	std1	CDS	851085	851190	.	+	.	transcript  "LD03340"
Adh	std1	CDS	851256	851436	.	+	.	transcript  "LD03340"
Adh	std1	CDS	851491	851673	.	+	.	transcript  "LD03340"
Adh	std1	CDS	851742	851919	.	+	.	transcript  "LD03340"
Adh	std1	stop_codon	851917	851919	.	+	.	transcript  "LD03340"
#
####
####
#
Adh	std1	start_codon	853116	853118	.	+	.	transcript  "LD24449"
Adh	std1	CDS	853116	855014	.	+	.	transcript  "LD24449"
Adh	std1	stop_codon	855012	855014	.	+	.	transcript  "LD24449"
#
####
####
#
Adh	std1	CDS	1231127	1231384	.	-	.	transcript  "LP03565"
Adh	std1	stop_codon	1231127	1231129	.	-	.	transcript  "LP03565"
Adh	std1	CDS	1231452	1231463	.	-	.	transcript  "LP03565"
Adh	std1	start_codon	1231461	1231463	.	-	.	transcript  "LP03565"
#
####
####
#
Adh	std1	CDS	1496304	1496815	.	-	.	transcript  "LD17234"
Adh	std1	stop_codon	1496304	1496306	.	-	.	transcript  "LD17234"
Adh	std1	CDS	1496865	1497000	.	-	.	transcript  "LD17234"
Adh	std1	start_codon	1496998	1497000	.	-	.	transcript  "LD17234"
#
####
####
#
Adh	std1	start_codon	1499670	1499672	.	+	.	transcript  "LD09819"
Adh	std1	CDS	1499670	1500870	.	+	.	transcript  "LD09819"
Adh	std1	CDS	1500928	1501010	.	+	.	transcript  "LD09819"
Adh	std1	stop_codon	1501008	1501010	.	+	.	transcript  "LD09819"
#
####
####
#
Adh	std1	stop_codon	1554085	1554087	.	-	.	transcript  "LD07162.con"
Adh	std1	CDS	1554085	1554599	.	-	.	transcript  "LD07162.con"
Adh	std1	CDS	1554841	1555107	.	-	.	transcript  "LD07162.con"
Adh	std1	CDS	1556588	1557278	.	-	.	transcript  "LD07162.con"
Adh	std1	start_codon	1557276	1557278	.	-	.	transcript  "LD07162.con"
#
####
####
#
Adh	std1	stop_codon	1744620	1744622	.	-	.	transcript  "LD09767"
Adh	std1	CDS	1744620	1745915	.	-	.	transcript  "LD09767"
Adh	std1	start_codon	1745913	1745915	.	-	.	transcript  "LD09767"
#
####
####
#
Adh	std1	CDS	1752891	1753316	.	-	.	transcript  "GH14032"
Adh	std1	stop_codon	1752891	1752893	.	-	.	transcript  "GH14032"
Adh	std1	CDS	1753422	1753778	.	-	.	transcript  "GH14032"
Adh	std1	start_codon	1753776	1753778	.	-	.	transcript  "GH14032"
#
####
####
#
Adh	std1	stop_codon	1763921	1763923	.	-	.	transcript  "GM01181"
Adh	std1	CDS	1763921	1764042	.	-	.	transcript  "GM01181"
Adh	std1	CDS	1764272	1764501	.	-	.	transcript  "GM01181"
Adh	std1	CDS	1764574	1764638	.	-	.	transcript  "GM01181"
Adh	std1	start_codon	1764636	1764638	.	-	.	transcript  "GM01181"
#
####
####
#
Adh	std1	start_codon	1988872	1988874	.	+	.	transcript  "LD17449"
Adh	std1	CDS	1988872	1989075	.	+	.	transcript  "LD17449"
Adh	std1	CDS	1991768	1992877	.	+	.	transcript  "LD17449"
Adh	std1	CDS	1992942	1993204	.	+	.	transcript  "LD17449"
Adh	std1	CDS	1993350	1993566	.	+	.	transcript  "LD17449"
Adh	std1	stop_codon	1993564	1993566	.	+	.	transcript  "LD17449"
#
####
####
#
Adh	std1	start_codon	2119874	2119876	.	+	.	transcript  "LP11031"
Adh	std1	CDS	2120382	2121269	.	+	.	transcript  "LP11031"
Adh	std1	CDS	2121336	2121745	.	+	.	transcript  "LP11031"
Adh	std1	stop_codon	2121743	2121745	.	+	.	transcript  "LP11031"
#
####
####
#
Adh	std1	stop_codon	2201422	2201424	.	-	.	transcript  "GH01660-ADH.con"
Adh	std1	CDS	2201426	2201677	.	-	.	transcript  "GH01660-ADH.con"
Adh	std1	CDS	2202376	2202477	.	-	.	transcript  "GH01660-ADH.con"
Adh	std1	CDS	2202548	2202802	.	-	.	transcript  "GH01660-ADH.con"
Adh	std1	start_codon	2202800	2202802	.	-	.	transcript  "GH01660-ADH.con"
#
####
####
#
Adh	std1	start_codon	2216202	2216204	.	+	.	transcript  "LD08227"
Adh	std1	CDS	2216202	2216447	.	+	.	transcript  "LD08227"
Adh	std1	CDS	2216609	2217034	.	+	.	transcript  "LD08227"
Adh	std1	CDS	2217099	2217403	.	+	.	transcript  "LD08227"
Adh	std1	CDS	2217501	2217537	.	+	.	transcript  "LD08227"
Adh	std1	stop_codon	2217535	2217537	.	+	.	transcript  "LD08227"
#
####
####
#
Adh	std1	stop_codon	2218461	2218463	.	-	.	transcript  "LD02957"
Adh	std1	CDS	2218461	2218494	.	-	.	transcript  "LD02957"
Adh	std1	CDS	2218559	2218905	.	-	.	transcript  "LD02957"
Adh	std1	CDS	2218966	2219841	.	-	.	transcript  "LD02957"
Adh	std1	start_codon	2219839	2219841	.	-	.	transcript  "LD02957"
#
####
####
#
Adh	std1	start_codon	2544295	2544297	.	+	.	transcript  "GH09478"
Adh	std1	CDS	2544295	2545201	.	+	.	transcript  "GH09478"
Adh	std1	stop_codon	2545201	2545203	.	+	.	transcript  "GH09478"
#
####
####
#
Adh	std1	stop_codon	2696335	2696337	.	-	.	transcript  "LD12894"
Adh	std1	CDS	2696335	2696446	.	-	.	transcript  "LD12894"
Adh	std1	CDS	2696513	2696644	.	-	.	transcript  "LD12894"
Adh	std1	CDS	2697862	2698028	.	-	.	transcript  "LD12894"
Adh	std1	CDS	2698091	2698210	.	-	.	transcript  "LD12894"
Adh	std1	start_codon	2698208	2698210	.	-	.	transcript  "LD12894"
#
####
####
#
Adh	std1	stop_codon	2751337	2751339	.	-	.	transcript  "GMF"
Adh	std1	CDS	2751337	2751465	.	-	.	transcript  "GMF"
Adh	std1	CDS	2751521	2751711	.	-	.	transcript  "GMF"
Adh	std1	CDS	2751778	2751871	.	-	.	transcript  "GMF"
Adh	std1	start_codon	2752031	2752033	.	-	.	transcript  "GMF"
Adh	std1	CDS	2752031	2752033	.	-	.	transcript  "GMF"
#
####
####
#
Adh	std1	stop_codon	2755219	2755221	.	-	.	transcript  "anon-35Fa"
Adh	std1	CDS	2755219	2755580	.	-	.	transcript  "anon-35Fa"
Adh	std1	CDS	2755775	2755883	.	-	.	transcript  "anon-35Fa"
Adh	std1	CDS	2755954	2756092	.	-	.	transcript  "anon-35Fa"
Adh	std1	CDS	2756201	2756274	.	-	.	transcript  "anon-35Fa"
Adh	std1	start_codon	2756272	2756274	.	-	.	transcript  "anon-35Fa"
#
####
####
#
Adh	std1	start_codon	2776417	2776419	.	+	.	transcript  "anon-35F-36A"
Adh	std1	CDS	2776417	2777295	.	+	.	transcript  "anon-35F-36A"
Adh	std1	stop_codon	2777293	2777295	.	+	.	transcript  "anon-35F-36A"
#
####
####
#
Adh	std1	CDS	2777390	2777609	.	-	.	transcript  "RPL4.FRAGA"
Adh	std1	stop_codon	2777390	2777392	.	-	.	transcript  "RPL4.FRAGA"
Adh	std1	CDS	2777672	2778342	.	-	.	transcript  "RPL4.FRAGA"
Adh	std1	start_codon	2778340	2778342	.	-	.	transcript  "RPL4.FRAGA"
#
####
####
#
Adh	std1	start_codon	2802355	2802357	.	+	.	transcript  "LD12474"
Adh	std1	CDS	2802355	2802394	.	+	.	transcript  "LD12474"
Adh	std1	CDS	2802473	2802813	.	+	.	transcript  "LD12474"
Adh	std1	stop_codon	2802811	2802813	.	+	.	transcript  "LD12474"
#
####
####
#
Adh	std1	CDS	2804442	2805730	.	-	.	transcript  "LD05503"
Adh	std1	stop_codon	2804442	2804444	.	-	.	transcript  "LD05503"
Adh	std1	CDS	2805800	2805812	.	-	.	transcript  "LD05503"
Adh	std1	start_codon	2805810	2805812	.	-	.	transcript  "LD05503"
#
####
####
#
Adh	std1	stop_codon	2849759	2849761	.	-	.	transcript  "CK01518.con"
Adh	std1	CDS	2849759	2849784	.	-	.	transcript  "CK01518.con"
Adh	std1	CDS	2853744	2854099	.	-	.	transcript  "CK01518.con"
Adh	std1	CDS	2854197	2854973	.	-	.	transcript  "CK01518.con"
Adh	std1	start_codon	2855180	2855182	.	-	.	transcript  "CK01518.con"
#
####
####
#
Adh	std1	start_codon	2896655	2896657	.	+	.	transcript  "GH12581"
Adh	std1	CDS	2896655	2896763	.	+	.	transcript  "GH12581"
Adh	std1	CDS	2898444	2899001	.	+	.	transcript  "GH12581"
Adh	std1	CDS	2899061	2899716	.	+	.	transcript  "GH12581"
Adh	std1	stop_codon	2899714	2899716	.	+	.	transcript  "GH12581"
#
####
####
#
Adh	std1	start_codon	2900448	2900450	.	+	.	transcript  "CK00436.con"
Adh	std1	CDS	2900448	2900565	.	+	.	transcript  "CK00436.con"
Adh	std1	CDS	2900634	2901185	.	+	.	transcript  "CK00436.con"
Adh	std1	CDS	2901452	2902107	.	+	.	transcript  "CK00436.con"
Adh	std1	stop_codon	2902105	2902107	.	+	.	transcript  "CK00436.con"
#
####

##gff-version 2
##source-version GH-fudged-GFF 1.0
# Thu Jul 22 11:55:54 1999
#
###
#
#
# compfly: 1. exon feature removed Jul 8 (MR)
#
#
Adh	std3	start_codon	2582975	2582977	.	+	.	transcript  "BG:DS04095.2"
Adh	std3	stop_codon	2583545	2583547	.	+	.	transcript  "BG:DS04095.2"
Adh	std3	CDS	2582975	2583547	.	+	.	transcript  "BG:DS04095.2"
#
#
###
###
#
#
Adh	std3	start_codon	2544295	2544297	.	+	.	transcript  "BG:DS04095.1"
Adh	std3	stop_codon	2545201	2545203	.	+	.	transcript  "BG:DS04095.1"
Adh	std3	CDS	2544295	2545203	.	+	.	transcript  "BG:DS04095.1"
#
#
###
###
#
#
Adh	std3	start_codon	1484701	1484703	.	+	.	transcript  "BG:DS00929.16"
Adh	std3	stop_codon	1489832	1489834	.	+	.	transcript  "BG:DS00929.16"
Adh	std3	CDS	1484701	1484782	.	+	.	transcript  "BG:DS00929.16"
Adh	std3	CDS	1487158	1487326	.	+	.	transcript  "BG:DS00929.16"
Adh	std3	CDS	1488069	1488120	.	+	.	transcript  "BG:DS00929.16"
Adh	std3	CDS	1489262	1489834	.	+	.	transcript  "BG:DS00929.16"
#
#
###
###
#
#
Adh	std3	start_codon	1493680	1493682	.	+	.	transcript  "BG:DS00929.1"
Adh	std3	stop_codon	1496196	1496198	.	+	.	transcript  "BG:DS00929.1"
Adh	std3	CDS	1493680	1493718	.	+	.	transcript  "BG:DS00929.1"
Adh	std3	CDS	1495620	1496198	.	+	.	transcript  "BG:DS00929.1"
#
#
###
###
#
#
Adh	std3	start_codon	1496998	1497000	.	-	.	transcript  "BG:DS00929.2"
Adh	std3	stop_codon	1496304	1496306	.	-	.	transcript  "BG:DS00929.2"
Adh	std3	CDS	1496304	1496815	.	-	.	transcript  "BG:DS00929.2"
Adh	std3	CDS	1496865	1497000	.	-	.	transcript  "BG:DS00929.2"
#
#
###
###
#
#
Adh	std3	start_codon	1497576	1497578	.	+	.	transcript  "BG:DS00929.3"
Adh	std3	stop_codon	1498119	1498121	.	+	.	transcript  "BG:DS00929.3"
Adh	std3	CDS	1497576	1498121	.	+	.	transcript  "BG:DS00929.3"
#
#
###
###
#
#
Adh	std3	start_codon	1499247	1499249	.	-	.	transcript  "BG:DS00929.4"
Adh	std3	stop_codon	1498334	1498336	.	-	.	transcript  "BG:DS00929.4"
Adh	std3	CDS	1498334	1499046	.	-	.	transcript  "BG:DS00929.4"
Adh	std3	CDS	1499102	1499249	.	-	.	transcript  "BG:DS00929.4"
#
#
###
###
#
#
Adh	std3	start_codon	1499670	1499672	.	+	.	transcript  "l.2.35Bd"
Adh	std3	stop_codon	1501008	1501010	.	+	.	transcript  "l.2.35Bd"
Adh	std3	CDS	1499670	1500870	.	+	.	transcript  "l.2.35Bd"
Adh	std3	CDS	1500928	1501010	.	+	.	transcript  "l.2.35Bd"
#
#
###
###
#
#
Adh	std3	start_codon	1506022	1506024	.	+	.	transcript  "BG:DS00929.6"
Adh	std3	stop_codon	1521840	1521842	.	+	.	transcript  "BG:DS00929.6"
Adh	std3	CDS	1506022	1506086	.	+	.	transcript  "BG:DS00929.6"
Adh	std3	CDS	1506161	1506204	.	+	.	transcript  "BG:DS00929.6"
Adh	std3	CDS	1506806	1507048	.	+	.	transcript  "BG:DS00929.6"
Adh	std3	CDS	1508779	1508852	.	+	.	transcript  "BG:DS00929.6"
Adh	std3	CDS	1510744	1510998	.	+	.	transcript  "BG:DS00929.6"
Adh	std3	CDS	1515041	1515175	.	+	.	transcript  "BG:DS00929.6"
Adh	std3	CDS	1515266	1515436	.	+	.	transcript  "BG:DS00929.6"
Adh	std3	CDS	1515498	1515714	.	+	.	transcript  "BG:DS00929.6"
Adh	std3	CDS	1515807	1516279	.	+	.	transcript  "BG:DS00929.6"
Adh	std3	CDS	1516339	1516488	.	+	.	transcript  "BG:DS00929.6"
Adh	std3	CDS	1516560	1519039	.	+	.	transcript  "BG:DS00929.6"
Adh	std3	CDS	1519441	1519564	.	+	.	transcript  "BG:DS00929.6"
Adh	std3	CDS	1519897	1520023	.	+	.	transcript  "BG:DS00929.6"
Adh	std3	CDS	1520081	1520337	.	+	.	transcript  "BG:DS00929.6"
Adh	std3	CDS	1520398	1520535	.	+	.	transcript  "BG:DS00929.6"
Adh	std3	CDS	1521654	1521842	.	+	.	transcript  "BG:DS00929.6"
#
#
###
###
#
#
Adh	std3	start_codon	1521369	1521371	.	-	.	transcript  "BG:DS00929.7"
Adh	std3	stop_codon	1520808	1520810	.	-	.	transcript  "BG:DS00929.7"
Adh	std3	CDS	1520808	1521371	.	-	.	transcript  "BG:DS00929.7"
#
#
###
###
#
#
Adh	std3	start_codon	1525230	1525232	.	+	.	transcript  "BG:DS00929.8"
Adh	std3	stop_codon	1527377	1527379	.	+	.	transcript  "BG:DS00929.8"
Adh	std3	CDS	1525230	1525447	.	+	.	transcript  "BG:DS00929.8"
Adh	std3	CDS	1526237	1526642	.	+	.	transcript  "BG:DS00929.8"
Adh	std3	CDS	1526702	1527379	.	+	.	transcript  "BG:DS00929.8"
#
#
###
###
#
#
Adh	std3	start_codon	1528424	1528426	.	-	.	transcript  "l.2.35Bg"
Adh	std3	stop_codon	1527523	1527525	.	-	.	transcript  "l.2.35Bg"
Adh	std3	CDS	1527523	1527636	.	-	.	transcript  "l.2.35Bg"
Adh	std3	CDS	1527705	1528201	.	-	.	transcript  "l.2.35Bg"
Adh	std3	CDS	1528291	1528426	.	-	.	transcript  "l.2.35Bg"
#
#
###
###
#
#
Adh	std3	start_codon	1529588	1529590	.	+	.	transcript  "Su.H"
Adh	std3	stop_codon	1532267	1532269	.	+	.	transcript  "Su.H"
Adh	std3	CDS	1529588	1529971	.	+	.	transcript  "Su.H"
Adh	std3	CDS	1530746	1531626	.	+	.	transcript  "Su.H"
Adh	std3	CDS	1531685	1531892	.	+	.	transcript  "Su.H"
Adh	std3	CDS	1531958	1532269	.	+	.	transcript  "Su.H"
#
#
###
###
#
#
Adh	std3	start_codon	1543080	1543082	.	-	.	transcript  "ck"
Adh	std3	stop_codon	1535065	1535067	.	-	.	transcript  "ck"
Adh	std3	CDS	1535065	1535271	.	-	.	transcript  "ck"
Adh	std3	CDS	1535341	1535461	.	-	.	transcript  "ck"
Adh	std3	CDS	1535530	1535676	.	-	.	transcript  "ck"
Adh	std3	CDS	1535739	1536304	.	-	.	transcript  "ck"
Adh	std3	CDS	1536364	1537150	.	-	.	transcript  "ck"
Adh	std3	CDS	1537212	1538662	.	-	.	transcript  "ck"
Adh	std3	CDS	1538719	1541113	.	-	.	transcript  "ck"
Adh	std3	CDS	1541178	1541378	.	-	.	transcript  "ck"
Adh	std3	CDS	1541445	1541794	.	-	.	transcript  "ck"
Adh	std3	CDS	1542125	1542385	.	-	.	transcript  "ck"
Adh	std3	CDS	1543065	1543082	.	-	.	transcript  "ck"
#
#
###
###
#
#
Adh	std3	start_codon	1549931	1549933	.	-	.	transcript  "TfIIS"
Adh	std3	stop_codon	1549142	1549144	.	-	.	transcript  "TfIIS"
Adh	std3	CDS	1549142	1549933	.	-	.	transcript  "TfIIS"
#
#
###
###
#
#
Adh	std3	start_codon	1557276	1557278	.	-	.	transcript  "vig"
Adh	std3	stop_codon	1554085	1554087	.	-	.	transcript  "vig"
Adh	std3	CDS	1554085	1554599	.	-	.	transcript  "vig"
Adh	std3	CDS	1554841	1555107	.	-	.	transcript  "vig"
Adh	std3	CDS	1556588	1557278	.	-	.	transcript  "vig"
#
#
###
###
#
#
Adh	std3	start_codon	1558915	1558917	.	+	.	transcript  "BG:DS00929.15"
Adh	std3	stop_codon	1561692	1561694	.	+	.	transcript  "BG:DS00929.15"
Adh	std3	CDS	1558915	1559747	.	+	.	transcript  "BG:DS00929.15"
Adh	std3	CDS	1560074	1561694	.	+	.	transcript  "BG:DS00929.15"
#
#
###
###
#
#
Adh	std3	start_codon	1042686	1042688	.	-	.	transcript  "BG:DS04641.8"
Adh	std3	stop_codon	1041376	1041378	.	-	.	transcript  "BG:DS04641.8"
Adh	std3	CDS	1041376	1041530	.	-	.	transcript  "BG:DS04641.8"
Adh	std3	CDS	1041602	1041989	.	-	.	transcript  "BG:DS04641.8"
Adh	std3	CDS	1042386	1042688	.	-	.	transcript  "BG:DS04641.8"
#
#
###
###
#
#
Adh	std3	start_codon	984981	984983	.	+	.	transcript  "noc"
Adh	std3	stop_codon	986894	986896	.	+	.	transcript  "noc"
Adh	std3	CDS	984981	985070	.	+	.	transcript  "noc"
Adh	std3	CDS	985373	986896	.	+	.	transcript  "noc"
#
#
###
###
#
#
Adh	std3	start_codon	2619967	2619969	.	+	.	transcript  "Ca-alpha1D"
Adh	std3	stop_codon	2639004	2639006	.	+	.	transcript  "Ca-alpha1D"
Adh	std3	CDS	2619967	2620307	.	+	.	transcript  "Ca-alpha1D"
Adh	std3	CDS	2621231	2622507	.	+	.	transcript  "Ca-alpha1D"
Adh	std3	CDS	2622578	2622803	.	+	.	transcript  "Ca-alpha1D"
Adh	std3	CDS	2622977	2623082	.	+	.	transcript  "Ca-alpha1D"
Adh	std3	CDS	2623316	2623455	.	+	.	transcript  "Ca-alpha1D"
Adh	std3	CDS	2623675	2623781	.	+	.	transcript  "Ca-alpha1D"
Adh	std3	CDS	2624114	2624266	.	+	.	transcript  "Ca-alpha1D"
Adh	std3	CDS	2624694	2624875	.	+	.	transcript  "Ca-alpha1D"
Adh	std3	CDS	2624976	2625495	.	+	.	transcript  "Ca-alpha1D"
Adh	std3	CDS	2625559	2625784	.	+	.	transcript  "Ca-alpha1D"
Adh	std3	CDS	2625851	2626061	.	+	.	transcript  "Ca-alpha1D"
Adh	std3	CDS	2626124	2626333	.	+	.	transcript  "Ca-alpha1D"
Adh	std3	CDS	2626392	2626510	.	+	.	transcript  "Ca-alpha1D"
Adh	std3	CDS	2626595	2626653	.	+	.	transcript  "Ca-alpha1D"
Adh	std3	CDS	2627634	2627751	.	+	.	transcript  "Ca-alpha1D"
Adh	std3	CDS	2628166	2628295	.	+	.	transcript  "Ca-alpha1D"
Adh	std3	CDS	2628460	2628626	.	+	.	transcript  "Ca-alpha1D"
Adh	std3	CDS	2628718	2628805	.	+	.	transcript  "Ca-alpha1D"
Adh	std3	CDS	2629398	2629505	.	+	.	transcript  "Ca-alpha1D"
Adh	std3	CDS	2632038	2632090	.	+	.	transcript  "Ca-alpha1D"
Adh	std3	CDS	2632152	2632298	.	+	.	transcript  "Ca-alpha1D"
Adh	std3	CDS	2632363	2632834	.	+	.	transcript  "Ca-alpha1D"
Adh	std3	CDS	2632889	2632972	.	+	.	transcript  "Ca-alpha1D"
Adh	std3	CDS	2633028	2633093	.	+	.	transcript  "Ca-alpha1D"
Adh	std3	CDS	2633149	2633337	.	+	.	transcript  "Ca-alpha1D"
Adh	std3	CDS	2633397	2633645	.	+	.	transcript  "Ca-alpha1D"
Adh	std3	CDS	2633706	2634365	.	+	.	transcript  "Ca-alpha1D"
Adh	std3	CDS	2634452	2634885	.	+	.	transcript  "Ca-alpha1D"
Adh	std3	CDS	2635370	2635410	.	+	.	transcript  "Ca-alpha1D"
Adh	std3	CDS	2638284	2638414	.	+	.	transcript  "Ca-alpha1D"
Adh	std3	CDS	2638470	2639006	.	+	.	transcript  "Ca-alpha1D"
#
#
###
###
#
#
Adh	std3	start_codon	2660848	2660850	.	+	.	transcript  "BG:DS02795.3"
Adh	std3	stop_codon	2662317	2662319	.	+	.	transcript  "BG:DS02795.3"
Adh	std3	CDS	2660848	2661318	.	+	.	transcript  "BG:DS02795.3"
Adh	std3	CDS	2661378	2662319	.	+	.	transcript  "BG:DS02795.3"
#
#
###
###
#
#
Adh	std3	start_codon	29477	29479	.	-	.	transcript  "BG:BACR48E02.1"
Adh	std3	stop_codon	29156	29158	.	-	.	transcript  "BG:BACR48E02.1"
Adh	std3	CDS	29156	29479	.	-	.	transcript  "BG:BACR48E02.1"
#
#
###
###
#
#
Adh	std3	start_codon	32232	32234	.	+	.	transcript  "BG:BACR48E02.2"
Adh	std3	stop_codon	35769	35771	.	+	.	transcript  "BG:BACR48E02.2"
Adh	std3	CDS	32232	32319	.	+	.	transcript  "BG:BACR48E02.2"
Adh	std3	CDS	34532	34822	.	+	.	transcript  "BG:BACR48E02.2"
Adh	std3	CDS	34857	35107	.	+	.	transcript  "BG:BACR48E02.2"
Adh	std3	CDS	35161	35502	.	+	.	transcript  "BG:BACR48E02.2"
Adh	std3	CDS	35547	35771	.	+	.	transcript  "BG:BACR48E02.2"
#
#
###
###
#
#
Adh	std3	start_codon	36410	36412	.	+	.	transcript  "BG:BACR48E02.3"
Adh	std3	stop_codon	37313	37315	.	+	.	transcript  "BG:BACR48E02.3"
Adh	std3	CDS	36410	37315	.	+	.	transcript  "BG:BACR48E02.3"
#
#
###
###
#
#
Adh	std3	start_codon	45358	45360	.	+	.	transcript  "kuz"
Adh	std3	stop_codon	130399	130401	.	+	.	transcript  "kuz"
Adh	std3	CDS	45358	45425	.	+	.	transcript  "kuz"
Adh	std3	CDS	103520	103739	.	+	.	transcript  "kuz"
Adh	std3	CDS	103808	104330	.	+	.	transcript  "kuz"
Adh	std3	CDS	124458	124936	.	+	.	transcript  "kuz"
Adh	std3	CDS	127146	127292	.	+	.	transcript  "kuz"
Adh	std3	CDS	127771	127931	.	+	.	transcript  "kuz"
Adh	std3	CDS	127991	128225	.	+	.	transcript  "kuz"
Adh	std3	CDS	128296	129342	.	+	.	transcript  "kuz"
Adh	std3	CDS	129401	129965	.	+	.	transcript  "kuz"
Adh	std3	CDS	130136	130401	.	+	.	transcript  "kuz"
#
#
###
###
#
#
Adh	std3	start_codon	90664	90666	.	-	.	transcript  "BG:DS07660.1"
Adh	std3	stop_codon	89305	89307	.	-	.	transcript  "BG:DS07660.1"
Adh	std3	CDS	89305	90666	.	-	.	transcript  "BG:DS07660.1"
#
#
###
###
#
#
Adh	std3	start_codon	134965	134967	.	-	.	transcript  "BG:BACR48E02.4"
Adh	std3	stop_codon	133458	133460	.	-	.	transcript  "BG:BACR48E02.4"
Adh	std3	CDS	133458	133548	.	-	.	transcript  "BG:BACR48E02.4"
Adh	std3	CDS	133612	134233	.	-	.	transcript  "BG:BACR48E02.4"
Adh	std3	CDS	134862	134967	.	-	.	transcript  "BG:BACR48E02.4"
#
#
###
###
#
#
Adh	std3	start_codon	2101334	2101336	.	-	.	transcript  "BG:BACR44L22.1"
Adh	std3	stop_codon	2100551	2100553	.	-	.	transcript  "BG:BACR44L22.1"
Adh	std3	CDS	2100551	2101336	.	-	.	transcript  "BG:BACR44L22.1"
#
#
###
###
#
#
Adh	std3	start_codon	2102975	2102977	.	-	.	transcript  "BG:BACR44L22.8"
Adh	std3	stop_codon	2102169	2102171	.	-	.	transcript  "BG:BACR44L22.8"
Adh	std3	CDS	2102169	2102752	.	-	.	transcript  "BG:BACR44L22.8"
Adh	std3	CDS	2102776	2102977	.	-	.	transcript  "BG:BACR44L22.8"
#
#
###
###
#
#
Adh	std3	start_codon	2104440	2104442	.	-	.	transcript  "BG:BACR44L22.2"
Adh	std3	stop_codon	2103622	2103624	.	-	.	transcript  "BG:BACR44L22.2"
Adh	std3	CDS	2103622	2104169	.	-	.	transcript  "BG:BACR44L22.2"
Adh	std3	CDS	2104226	2104442	.	-	.	transcript  "BG:BACR44L22.2"
#
#
###
###
#
#
Adh	std3	start_codon	2105982	2105984	.	-	.	transcript  "BG:BACR44L22.3"
Adh	std3	stop_codon	2105170	2105172	.	-	.	transcript  "BG:BACR44L22.3"
Adh	std3	CDS	2105170	2105720	.	-	.	transcript  "BG:BACR44L22.3"
Adh	std3	CDS	2105774	2105984	.	-	.	transcript  "BG:BACR44L22.3"
#
#
###
###
#
#
Adh	std3	start_codon	2106653	2106655	.	+	.	transcript  "BG:BACR44L22.4"
Adh	std3	stop_codon	2107443	2107445	.	+	.	transcript  "BG:BACR44L22.4"
Adh	std3	CDS	2106653	2106860	.	+	.	transcript  "BG:BACR44L22.4"
Adh	std3	CDS	2106931	2107445	.	+	.	transcript  "BG:BACR44L22.4"
#
#
###
###
#
#
Adh	std3	start_codon	2113207	2113209	.	-	.	transcript  "BG:BACR44L22.5"
Adh	std3	stop_codon	2109315	2109317	.	-	.	transcript  "BG:BACR44L22.5"
Adh	std3	CDS	2109315	2109407	.	-	.	transcript  "BG:BACR44L22.5"
Adh	std3	CDS	2111897	2112079	.	-	.	transcript  "BG:BACR44L22.5"
Adh	std3	CDS	2112328	2113209	.	-	.	transcript  "BG:BACR44L22.5"
#
#
###
###
#
#
Adh	std3	start_codon	2118335	2118337	.	+	.	transcript  "BG:BACR44L22.6"
Adh	std3	stop_codon	2119159	2119161	.	+	.	transcript  "BG:BACR44L22.6"
Adh	std3	CDS	2118335	2118551	.	+	.	transcript  "BG:BACR44L22.6"
Adh	std3	CDS	2118614	2119161	.	+	.	transcript  "BG:BACR44L22.6"
#
#
###
###
#
#
Adh	std3	start_codon	2119874	2119876	.	+	.	transcript  "BG:DS07108.4"
Adh	std3	stop_codon	2121743	2121745	.	+	.	transcript  "BG:DS07108.4"
Adh	std3	CDS	2119874	2120025	.	+	.	transcript  "BG:DS07108.4"
Adh	std3	CDS	2120092	2120194	.	+	.	transcript  "BG:DS07108.4"
Adh	std3	CDS	2120312	2121269	.	+	.	transcript  "BG:DS07108.4"
Adh	std3	CDS	2121336	2121745	.	+	.	transcript  "BG:DS07108.4"
#
#
###
###
#
#
Adh	std3	start_codon	602998	603000	.	-	.	transcript  "BG:DS01759.2"
Adh	std3	stop_codon	601945	601947	.	-	.	transcript  "BG:DS01759.2"
Adh	std3	CDS	601945	602889	.	-	.	transcript  "BG:DS01759.2"
Adh	std3	CDS	602944	603000	.	-	.	transcript  "BG:DS01759.2"
#
#
###
###
#
#
Adh	std3	start_codon	598403	598405	.	+	.	transcript  "BG:DS01759.1"
Adh	std3	stop_codon	600431	600433	.	+	.	transcript  "BG:DS01759.1"
Adh	std3	CDS	598403	598796	.	+	.	transcript  "BG:DS01759.1"
Adh	std3	CDS	598857	599119	.	+	.	transcript  "BG:DS01759.1"
Adh	std3	CDS	599219	600433	.	+	.	transcript  "BG:DS01759.1"
#
#
###
###
#
#
Adh	std3	start_codon	1823746	1823748	.	+	.	transcript  "esg"
Adh	std3	stop_codon	1825156	1825158	.	+	.	transcript  "esg"
Adh	std3	CDS	1823746	1825158	.	+	.	transcript  "esg"
#
#
###
###
#
#
Adh	std3	start_codon	1809556	1809558	.	-	.	transcript  "BG:DS07851.6"
Adh	std3	stop_codon	1807761	1807763	.	-	.	transcript  "BG:DS07851.6"
Adh	std3	CDS	1807761	1808476	.	-	.	transcript  "BG:DS07851.6"
Adh	std3	CDS	1809495	1809558	.	-	.	transcript  "BG:DS07851.6"
#
#
###
###
#
#
Adh	std3	start_codon	1787599	1787601	.	+	.	transcript  "BG:DS07851.5"
Adh	std3	stop_codon	1788913	1788915	.	+	.	transcript  "BG:DS07851.5"
Adh	std3	CDS	1787599	1788915	.	+	.	transcript  "BG:DS07851.5"
#
#
###
###
#
#
Adh	std3	start_codon	1786407	1786409	.	-	.	transcript  "ms.2.35Ci"
Adh	std3	stop_codon	1782412	1782414	.	-	.	transcript  "ms.2.35Ci"
Adh	std3	CDS	1782412	1782827	.	-	.	transcript  "ms.2.35Ci"
Adh	std3	CDS	1783140	1783286	.	-	.	transcript  "ms.2.35Ci"
Adh	std3	CDS	1783610	1783696	.	-	.	transcript  "ms.2.35Ci"
Adh	std3	CDS	1784926	1785036	.	-	.	transcript  "ms.2.35Ci"
Adh	std3	CDS	1785511	1785654	.	-	.	transcript  "ms.2.35Ci"
Adh	std3	CDS	1786132	1786291	.	-	.	transcript  "ms.2.35Ci"
Adh	std3	CDS	1786326	1786409	.	-	.	transcript  "ms.2.35Ci"
#
#
###
###
#
#
Adh	std3	start_codon	1781823	1781825	.	-	.	transcript  "BG:DS07851.8"
Adh	std3	stop_codon	1780341	1780343	.	-	.	transcript  "BG:DS07851.8"
Adh	std3	CDS	1780341	1780496	.	-	.	transcript  "BG:DS07851.8"
Adh	std3	CDS	1781148	1781825	.	-	.	transcript  "BG:DS07851.8"
#
#
###
###
#
#
Adh	std3	start_codon	1774679	1774681	.	+	.	transcript  "BG:DS07851.4"
Adh	std3	stop_codon	1775555	1775557	.	+	.	transcript  "BG:DS07851.4"
Adh	std3	CDS	1774679	1775557	.	+	.	transcript  "BG:DS07851.4"
#
#
###
###
#
#
Adh	std3	start_codon	1764636	1764638	.	-	.	transcript  "BG:DS07851.3"
Adh	std3	stop_codon	1763921	1763923	.	-	.	transcript  "BG:DS07851.3"
Adh	std3	CDS	1763921	1764042	.	-	.	transcript  "BG:DS07851.3"
Adh	std3	CDS	1764272	1764501	.	-	.	transcript  "BG:DS07851.3"
Adh	std3	CDS	1764574	1764638	.	-	.	transcript  "BG:DS07851.3"
#
#
###
###
#
#
Adh	std3	start_codon	1760614	1760616	.	-	.	transcript  "gft"
Adh	std3	stop_codon	1756026	1756028	.	-	.	transcript  "gft"
Adh	std3	CDS	1756026	1756178	.	-	.	transcript  "gft"
Adh	std3	CDS	1756248	1756386	.	-	.	transcript  "gft"
Adh	std3	CDS	1756448	1756671	.	-	.	transcript  "gft"
Adh	std3	CDS	1756797	1756939	.	-	.	transcript  "gft"
Adh	std3	CDS	1757005	1757119	.	-	.	transcript  "gft"
Adh	std3	CDS	1757182	1757352	.	-	.	transcript  "gft"
Adh	std3	CDS	1757415	1757585	.	-	.	transcript  "gft"
Adh	std3	CDS	1757648	1758409	.	-	.	transcript  "gft"
Adh	std3	CDS	1758473	1758856	.	-	.	transcript  "gft"
Adh	std3	CDS	1760557	1760616	.	-	.	transcript  "gft"
#
#
###
###
#
#
Adh	std3	start_codon	1753776	1753778	.	-	.	transcript  "BG:DS07851.11"
Adh	std3	stop_codon	1752891	1752893	.	-	.	transcript  "BG:DS07851.11"
Adh	std3	CDS	1752891	1753316	.	-	.	transcript  "BG:DS07851.11"
Adh	std3	CDS	1753422	1753778	.	-	.	transcript  "BG:DS07851.11"
#
#
###
###
#
#
Adh	std3	start_codon	1432221	1432223	.	-	.	transcript  "BG:DS01219.3"
Adh	std3	stop_codon	1421921	1421923	.	-	.	transcript  "BG:DS01219.3"
Adh	std3	CDS	1421921	1422143	.	-	.	transcript  "BG:DS01219.3"
Adh	std3	CDS	1422176	1422320	.	-	.	transcript  "BG:DS01219.3"
Adh	std3	CDS	1424531	1424676	.	-	.	transcript  "BG:DS01219.3"
Adh	std3	CDS	1424907	1425003	.	-	.	transcript  "BG:DS01219.3"
Adh	std3	CDS	1425549	1425752	.	-	.	transcript  "BG:DS01219.3"
Adh	std3	CDS	1426168	1426281	.	-	.	transcript  "BG:DS01219.3"
Adh	std3	CDS	1426393	1426486	.	-	.	transcript  "BG:DS01219.3"
Adh	std3	CDS	1428573	1428690	.	-	.	transcript  "BG:DS01219.3"
Adh	std3	CDS	1431180	1431306	.	-	.	transcript  "BG:DS01219.3"
Adh	std3	CDS	1432142	1432223	.	-	.	transcript  "BG:DS01219.3"
#
#
###
###
#
#
Adh	std3	start_codon	2182861	2182863	.	-	.	transcript  "CycE-type1"
Adh	std3	stop_codon	2180707	2180709	.	-	.	transcript  "CycE-type1"
Adh	std3	CDS	2180707	2180982	.	-	.	transcript  "CycE-type1"
Adh	std3	CDS	2181100	2181325	.	-	.	transcript  "CycE-type1"
Adh	std3	CDS	2181392	2182662	.	-	.	transcript  "CycE-type1"
Adh	std3	CDS	2182828	2182863	.	-	.	transcript  "CycE-type1"
#
#
###
###
#
#
Adh	std3	start_codon	2158476	2158478	.	+	.	transcript  "BG:DS07108.5"
Adh	std3	stop_codon	2159458	2159460	.	+	.	transcript  "BG:DS07108.5"
Adh	std3	CDS	2158476	2158559	.	+	.	transcript  "BG:DS07108.5"
Adh	std3	CDS	2158660	2159460	.	+	.	transcript  "BG:DS07108.5"
#
#
###
###
#
#
Adh	std3	start_codon	2149283	2149285	.	+	.	transcript  "BG:DS07108.1"
Adh	std3	stop_codon	2150905	2150907	.	+	.	transcript  "BG:DS07108.1"
Adh	std3	CDS	2149283	2149510	.	+	.	transcript  "BG:DS07108.1"
Adh	std3	CDS	2149741	2150907	.	+	.	transcript  "BG:DS07108.1"
#
#
###
###
#
#
Adh	std3	start_codon	2146971	2146973	.	-	.	transcript  "BG:DS07108.2"
Adh	std3	stop_codon	2137486	2137488	.	-	.	transcript  "BG:DS07108.2"
Adh	std3	CDS	2137486	2137679	.	-	.	transcript  "BG:DS07108.2"
Adh	std3	CDS	2137746	2137902	.	-	.	transcript  "BG:DS07108.2"
Adh	std3	CDS	2137961	2138116	.	-	.	transcript  "BG:DS07108.2"
Adh	std3	CDS	2138186	2138671	.	-	.	transcript  "BG:DS07108.2"
Adh	std3	CDS	2138733	2138994	.	-	.	transcript  "BG:DS07108.2"
Adh	std3	CDS	2139065	2139169	.	-	.	transcript  "BG:DS07108.2"
Adh	std3	CDS	2139824	2140056	.	-	.	transcript  "BG:DS07108.2"
Adh	std3	CDS	2140199	2140353	.	-	.	transcript  "BG:DS07108.2"
Adh	std3	CDS	2140417	2140630	.	-	.	transcript  "BG:DS07108.2"
Adh	std3	CDS	2140705	2141412	.	-	.	transcript  "BG:DS07108.2"
Adh	std3	CDS	2141468	2141749	.	-	.	transcript  "BG:DS07108.2"
Adh	std3	CDS	2141998	2142471	.	-	.	transcript  "BG:DS07108.2"
Adh	std3	CDS	2146632	2146973	.	-	.	transcript  "BG:DS07108.2"
#
#
###
###
#
#
Adh	std3	start_codon	568986	568988	.	+	.	transcript  "BG:DS05899.4"
Adh	std3	stop_codon	575531	575533	.	+	.	transcript  "BG:DS05899.4"
Adh	std3	CDS	568986	569222	.	+	.	transcript  "BG:DS05899.4"
Adh	std3	CDS	570329	570621	.	+	.	transcript  "BG:DS05899.4"
Adh	std3	CDS	570790	570947	.	+	.	transcript  "BG:DS05899.4"
Adh	std3	CDS	574289	574483	.	+	.	transcript  "BG:DS05899.4"
Adh	std3	CDS	575409	575533	.	+	.	transcript  "BG:DS05899.4"
#
#
###
###
#
#
Adh	std3	start_codon	555360	555362	.	+	.	transcript  "BG:DS05899.5"
Adh	std3	stop_codon	556628	556630	.	+	.	transcript  "BG:DS05899.5"
Adh	std3	CDS	555360	555824	.	+	.	transcript  "BG:DS05899.5"
Adh	std3	CDS	555920	556630	.	+	.	transcript  "BG:DS05899.5"
#
#
###
###
#
#
Adh	std3	start_codon	541380	541382	.	+	.	transcript  "BG:DS05899.3"
Adh	std3	stop_codon	542511	542513	.	+	.	transcript  "BG:DS05899.3"
Adh	std3	CDS	541380	542513	.	+	.	transcript  "BG:DS05899.3"
#
#
###
###
#
#
Adh	std3	start_codon	536911	536913	.	-	.	transcript  "BG:DS05899.6"
Adh	std3	stop_codon	533592	533594	.	-	.	transcript  "BG:DS05899.6"
Adh	std3	CDS	533592	533994	.	-	.	transcript  "BG:DS05899.6"
Adh	std3	CDS	534017	534188	.	-	.	transcript  "BG:DS05899.6"
Adh	std3	CDS	534467	534571	.	-	.	transcript  "BG:DS05899.6"
Adh	std3	CDS	536670	536913	.	-	.	transcript  "BG:DS05899.6"
#
#
###
###
#
#
Adh	std3	start_codon	525281	525283	.	-	.	transcript  "BG:DS05899.7"
Adh	std3	stop_codon	523395	523397	.	-	.	transcript  "BG:DS05899.7"
Adh	std3	CDS	523395	523601	.	-	.	transcript  "BG:DS05899.7"
Adh	std3	CDS	523660	524253	.	-	.	transcript  "BG:DS05899.7"
Adh	std3	CDS	524438	525283	.	-	.	transcript  "BG:DS05899.7"
#
#
###
###
#
#
Adh	std3	start_codon	520781	520783	.	+	.	transcript  "BG:DS05899.1"
Adh	std3	stop_codon	522986	522988	.	+	.	transcript  "BG:DS05899.1"
Adh	std3	CDS	520781	521850	.	+	.	transcript  "BG:DS05899.1"
Adh	std3	CDS	522013	522988	.	+	.	transcript  "BG:DS05899.1"
#
#
###
###
#
#
Adh	std3	start_codon	1628242	1628244	.	+	.	transcript  "BG:DS03192.3"
Adh	std3	stop_codon	1628410	1628412	.	+	.	transcript  "BG:DS03192.3"
Adh	std3	CDS	1628242	1628412	.	+	.	transcript  "BG:DS03192.3"
#
#
###
###
#
#
Adh	std3	start_codon	1667968	1667970	.	-	.	transcript  "BG:DS03192.2"
Adh	std3	stop_codon	1653146	1653148	.	-	.	transcript  "BG:DS03192.2"
Adh	std3	CDS	1653146	1653412	.	-	.	transcript  "BG:DS03192.2"
Adh	std3	CDS	1653857	1657133	.	-	.	transcript  "BG:DS03192.2"
Adh	std3	CDS	1657232	1657342	.	-	.	transcript  "BG:DS03192.2"
Adh	std3	CDS	1661045	1661189	.	-	.	transcript  "BG:DS03192.2"
Adh	std3	CDS	1661787	1661932	.	-	.	transcript  "BG:DS03192.2"
Adh	std3	CDS	1665755	1665947	.	-	.	transcript  "BG:DS03192.2"
Adh	std3	CDS	1667694	1667970	.	-	.	transcript  "BG:DS03192.2"
#
#
###
###
#
#
Adh	std3	start_codon	1663161	1663163	.	-	.	transcript  "BG:DS03192.4"
Adh	std3	stop_codon	1663026	1663028	.	-	.	transcript  "BG:DS03192.4"
Adh	std3	CDS	1663026	1663163	.	-	.	transcript  "BG:DS03192.4"
#
#
###
###
#
#
Adh	std3	start_codon	1737244	1737246	.	-	.	transcript  "BG:DS07295.1"
Adh	std3	stop_codon	1718580	1718582	.	-	.	transcript  "BG:DS07295.1"
Adh	std3	CDS	1718580	1718725	.	-	.	transcript  "BG:DS07295.1"
Adh	std3	CDS	1719195	1719342	.	-	.	transcript  "BG:DS07295.1"
Adh	std3	CDS	1719504	1720005	.	-	.	transcript  "BG:DS07295.1"
Adh	std3	CDS	1726256	1726435	.	-	.	transcript  "BG:DS07295.1"
Adh	std3	CDS	1730116	1730236	.	-	.	transcript  "BG:DS07295.1"
Adh	std3	CDS	1731062	1731172	.	-	.	transcript  "BG:DS07295.1"
Adh	std3	CDS	1735826	1736004	.	-	.	transcript  "BG:DS07295.1"
Adh	std3	CDS	1737215	1737246	.	-	.	transcript  "BG:DS07295.1"
#
#
###
###
#
#
Adh	std3	start_codon	1721863	1721865	.	+	.	transcript  "BG:DS07295.4"
Adh	std3	stop_codon	1728734	1728736	.	+	.	transcript  "BG:DS07295.4"
Adh	std3	CDS	1721863	1721967	.	+	.	transcript  "BG:DS07295.4"
Adh	std3	CDS	1722243	1722408	.	+	.	transcript  "BG:DS07295.4"
Adh	std3	CDS	1722493	1722656	.	+	.	transcript  "BG:DS07295.4"
Adh	std3	CDS	1724226	1724372	.	+	.	transcript  "BG:DS07295.4"
Adh	std3	CDS	1725680	1726192	.	+	.	transcript  "BG:DS07295.4"
Adh	std3	CDS	1726279	1726480	.	+	.	transcript  "BG:DS07295.4"
Adh	std3	CDS	1727221	1727390	.	+	.	transcript  "BG:DS07295.4"
Adh	std3	CDS	1728458	1728736	.	+	.	transcript  "BG:DS07295.4"
#
#
###
###
#
#
Adh	std3	start_codon	1738791	1738793	.	+	.	transcript  "BG:DS07295.2"
Adh	std3	stop_codon	1743191	1743193	.	+	.	transcript  "BG:DS07295.2"
Adh	std3	CDS	1738791	1739218	.	+	.	transcript  "BG:DS07295.2"
Adh	std3	CDS	1740300	1740540	.	+	.	transcript  "BG:DS07295.2"
Adh	std3	CDS	1740659	1740939	.	+	.	transcript  "BG:DS07295.2"
Adh	std3	CDS	1740995	1742042	.	+	.	transcript  "BG:DS07295.2"
Adh	std3	CDS	1742104	1742446	.	+	.	transcript  "BG:DS07295.2"
Adh	std3	CDS	1742886	1743193	.	+	.	transcript  "BG:DS07295.2"
#
#
###
###
#
#
Adh	std3	start_codon	1745913	1745915	.	-	.	transcript  "BG:DS07295.3"
Adh	std3	stop_codon	1744620	1744622	.	-	.	transcript  "BG:DS07295.3"
Adh	std3	CDS	1744620	1745915	.	-	.	transcript  "BG:DS07295.3"
#
#
###
###
#
#
Adh	std3	start_codon	1746303	1746305	.	+	.	transcript  "BG:DS07295.5"
Adh	std3	stop_codon	1746840	1746842	.	+	.	transcript  "BG:DS07295.5"
Adh	std3	CDS	1746303	1746349	.	+	.	transcript  "BG:DS07295.5"
Adh	std3	CDS	1746401	1746842	.	+	.	transcript  "BG:DS07295.5"
#
#
###
###
#
#
Adh	std3	start_codon	1250633	1250635	.	+	.	transcript  "BG:DS06874.1"
Adh	std3	stop_codon	1251419	1251421	.	+	.	transcript  "BG:DS06874.1"
Adh	std3	CDS	1250633	1251421	.	+	.	transcript  "BG:DS06874.1"
#
#
###
###
#
#
Adh	std3	start_codon	1252544	1252546	.	+	.	transcript  "BG:DS06874.2"
Adh	std3	stop_codon	1253615	1253617	.	+	.	transcript  "BG:DS06874.2"
Adh	std3	CDS	1252544	1253617	.	+	.	transcript  "BG:DS06874.2"
#
#
###
###
#
#
Adh	std3	start_codon	1255669	1255671	.	+	.	transcript  "BG:DS06874.3"
Adh	std3	stop_codon	1256821	1256823	.	+	.	transcript  "BG:DS06874.3"
Adh	std3	CDS	1255669	1256823	.	+	.	transcript  "BG:DS06874.3"
#
#
###
###
#
#
Adh	std3	start_codon	1276357	1276359	.	-	.	transcript  "BG:DS06874.4"
Adh	std3	stop_codon	1271377	1271379	.	-	.	transcript  "BG:DS06874.4"
Adh	std3	CDS	1271377	1272140	.	-	.	transcript  "BG:DS06874.4"
Adh	std3	CDS	1272217	1272395	.	-	.	transcript  "BG:DS06874.4"
Adh	std3	CDS	1273203	1273596	.	-	.	transcript  "BG:DS06874.4"
Adh	std3	CDS	1273652	1273822	.	-	.	transcript  "BG:DS06874.4"
Adh	std3	CDS	1274014	1274154	.	-	.	transcript  "BG:DS06874.4"
Adh	std3	CDS	1276206	1276359	.	-	.	transcript  "BG:DS06874.4"
#
#
###
###
#
#
Adh	std3	start_codon	1286197	1286199	.	-	.	transcript  "BG:DS06874.6"
Adh	std3	stop_codon	1285030	1285032	.	-	.	transcript  "BG:DS06874.6"
Adh	std3	CDS	1285030	1285502	.	-	.	transcript  "BG:DS06874.6"
Adh	std3	CDS	1285595	1285746	.	-	.	transcript  "BG:DS06874.6"
Adh	std3	CDS	1285814	1285859	.	-	.	transcript  "BG:DS06874.6"
Adh	std3	CDS	1285971	1286199	.	-	.	transcript  "BG:DS06874.6"
#
#
###
###
#
#
Adh	std3	start_codon	1300469	1300471	.	+	.	transcript  "BG:DS06874.7"
Adh	std3	stop_codon	1315920	1315922	.	+	.	transcript  "BG:DS06874.7"
Adh	std3	CDS	1300469	1300474	.	+	.	transcript  "BG:DS06874.7"
Adh	std3	CDS	1300535	1302030	.	+	.	transcript  "BG:DS06874.7"
Adh	std3	CDS	1303048	1303240	.	+	.	transcript  "BG:DS06874.7"
Adh	std3	CDS	1306976	1307130	.	+	.	transcript  "BG:DS06874.7"
Adh	std3	CDS	1312765	1312941	.	+	.	transcript  "BG:DS06874.7"
Adh	std3	CDS	1315829	1315922	.	+	.	transcript  "BG:DS06874.7"
#
#
###
###
#
#
Adh	std3	start_codon	264992	264994	.	+	.	transcript  "BG:DS00797.1"
Adh	std3	stop_codon	267232	267234	.	+	.	transcript  "BG:DS00797.1"
Adh	std3	CDS	264992	264997	.	+	.	transcript  "BG:DS00797.1"
Adh	std3	CDS	265088	266322	.	+	.	transcript  "BG:DS00797.1"
Adh	std3	CDS	266392	266619	.	+	.	transcript  "BG:DS00797.1"
Adh	std3	CDS	266684	266867	.	+	.	transcript  "BG:DS00797.1"
Adh	std3	CDS	266935	267073	.	+	.	transcript  "BG:DS00797.1"
Adh	std3	CDS	267134	267234	.	+	.	transcript  "BG:DS00797.1"
#
#
###
###
#
#
Adh	std3	start_codon	273481	273483	.	-	.	transcript  "BG:DS00797.2"
Adh	std3	stop_codon	268751	268753	.	-	.	transcript  "BG:DS00797.2"
Adh	std3	CDS	268751	268798	.	-	.	transcript  "BG:DS00797.2"
Adh	std3	CDS	269006	269157	.	-	.	transcript  "BG:DS00797.2"
Adh	std3	CDS	269222	269559	.	-	.	transcript  "BG:DS00797.2"
Adh	std3	CDS	269629	269785	.	-	.	transcript  "BG:DS00797.2"
Adh	std3	CDS	269849	269907	.	-	.	transcript  "BG:DS00797.2"
Adh	std3	CDS	271522	271573	.	-	.	transcript  "BG:DS00797.2"
Adh	std3	CDS	273396	273483	.	-	.	transcript  "BG:DS00797.2"
#
#
###
###
#
#
Adh	std3	start_codon	274751	274753	.	+	.	transcript  "p38b"
Adh	std3	stop_codon	275846	275848	.	+	.	transcript  "p38b"
Adh	std3	CDS	274751	275110	.	+	.	transcript  "p38b"
Adh	std3	CDS	275123	275848	.	+	.	transcript  "p38b"
#
#
###
###
#
#
Adh	std3	start_codon	277186	277188	.	-	.	transcript  "BG:DS00797.4"
Adh	std3	stop_codon	276361	276363	.	-	.	transcript  "BG:DS00797.4"
Adh	std3	CDS	276361	276696	.	-	.	transcript  "BG:DS00797.4"
Adh	std3	CDS	276748	277188	.	-	.	transcript  "BG:DS00797.4"
#
#
###
###
#
#
Adh	std3	start_codon	281649	281651	.	+	.	transcript  "BG:DS00797.5"
Adh	std3	stop_codon	284050	284052	.	+	.	transcript  "BG:DS00797.5"
Adh	std3	CDS	281649	281787	.	+	.	transcript  "BG:DS00797.5"
Adh	std3	CDS	281848	282471	.	+	.	transcript  "BG:DS00797.5"
Adh	std3	CDS	282539	283541	.	+	.	transcript  "BG:DS00797.5"
Adh	std3	CDS	283608	284052	.	+	.	transcript  "BG:DS00797.5"
#
#
###
###
#
#
Adh	std3	start_codon	284779	284781	.	+	.	transcript  "BG:DS00797.6"
Adh	std3	stop_codon	286884	286886	.	+	.	transcript  "BG:DS00797.6"
Adh	std3	CDS	284779	284915	.	+	.	transcript  "BG:DS00797.6"
Adh	std3	CDS	284969	285346	.	+	.	transcript  "BG:DS00797.6"
Adh	std3	CDS	285416	286886	.	+	.	transcript  "BG:DS00797.6"
#
#
###
###
#
#
Adh	std3	start_codon	287599	287601	.	+	.	transcript  "BG:DS00797.7"
Adh	std3	stop_codon	292894	292896	.	+	.	transcript  "BG:DS00797.7"
Adh	std3	CDS	287599	288374	.	+	.	transcript  "BG:DS00797.7"
Adh	std3	CDS	288642	292689	.	+	.	transcript  "BG:DS00797.7"
Adh	std3	CDS	292759	292896	.	+	.	transcript  "BG:DS00797.7"
#
#
###
###
#
#
Adh	std3	start_codon	2505534	2505536	.	+	.	transcript  "beat"
Adh	std3	stop_codon	2530154	2530156	.	+	.	transcript  "beat"
Adh	std3	CDS	2505534	2505597	.	+	.	transcript  "beat"
Adh	std3	CDS	2524357	2524565	.	+	.	transcript  "beat"
Adh	std3	CDS	2525929	2526064	.	+	.	transcript  "beat"
Adh	std3	CDS	2527415	2527548	.	+	.	transcript  "beat"
Adh	std3	CDS	2529073	2529195	.	+	.	transcript  "beat"
Adh	std3	CDS	2529260	2529455	.	+	.	transcript  "beat"
Adh	std3	CDS	2529735	2530156	.	+	.	transcript  "beat"
#
#
###
###
#
#
Adh	std3	start_codon	2493314	2493316	.	+	.	transcript  "BicC"
Adh	std3	stop_codon	2497462	2497464	.	+	.	transcript  "BicC"
Adh	std3	CDS	2493314	2493620	.	+	.	transcript  "BicC"
Adh	std3	CDS	2493682	2493731	.	+	.	transcript  "BicC"
Adh	std3	CDS	2494047	2494116	.	+	.	transcript  "BicC"
Adh	std3	CDS	2494180	2494259	.	+	.	transcript  "BicC"
Adh	std3	CDS	2494325	2494651	.	+	.	transcript  "BicC"
Adh	std3	CDS	2495100	2495225	.	+	.	transcript  "BicC"
Adh	std3	CDS	2495286	2495667	.	+	.	transcript  "BicC"
Adh	std3	CDS	2495861	2496988	.	+	.	transcript  "BicC"
Adh	std3	CDS	2497217	2497464	.	+	.	transcript  "BicC"
#
#
###
###
#
#
Adh	std3	start_codon	1923109	1923111	.	+	.	transcript  "BG:DS03023.2"
Adh	std3	stop_codon	1924561	1924563	.	+	.	transcript  "BG:DS03023.2"
Adh	std3	CDS	1923109	1924563	.	+	.	transcript  "BG:DS03023.2"
#
#
###
###
#
#
Adh	std3	start_codon	1914946	1914948	.	-	.	transcript  "wor"
Adh	std3	stop_codon	1913374	1913376	.	-	.	transcript  "wor"
Adh	std3	CDS	1913374	1914948	.	-	.	transcript  "wor"
#
#
###
###
#
#
Adh	std3	start_codon	1895877	1895879	.	-	.	transcript  "BG:DS03023.4"
Adh	std3	stop_codon	1875987	1875989	.	-	.	transcript  "BG:DS03023.4"
Adh	std3	CDS	1875987	1876447	.	-	.	transcript  "BG:DS03023.4"
Adh	std3	CDS	1878988	1879161	.	-	.	transcript  "BG:DS03023.4"
Adh	std3	CDS	1881548	1881779	.	-	.	transcript  "BG:DS03023.4"
Adh	std3	CDS	1883261	1883385	.	-	.	transcript  "BG:DS03023.4"
Adh	std3	CDS	1883560	1883683	.	-	.	transcript  "BG:DS03023.4"
Adh	std3	CDS	1884195	1884559	.	-	.	transcript  "BG:DS03023.4"
Adh	std3	CDS	1885049	1885269	.	-	.	transcript  "BG:DS03023.4"
Adh	std3	CDS	1885421	1885599	.	-	.	transcript  "BG:DS03023.4"
Adh	std3	CDS	1886301	1886582	.	-	.	transcript  "BG:DS03023.4"
Adh	std3	CDS	1889969	1890043	.	-	.	transcript  "BG:DS03023.4"
Adh	std3	CDS	1891514	1891654	.	-	.	transcript  "BG:DS03023.4"
Adh	std3	CDS	1891981	1892047	.	-	.	transcript  "BG:DS03023.4"
Adh	std3	CDS	1893271	1893751	.	-	.	transcript  "BG:DS03023.4"
Adh	std3	CDS	1895585	1895879	.	-	.	transcript  "BG:DS03023.4"
#
#
###
###
#
#
Adh	std3	start_codon	343169	343171	.	+	.	transcript  "BG:DS00941.15"
Adh	std3	stop_codon	343982	343984	.	+	.	transcript  "BG:DS00941.15"
Adh	std3	CDS	343169	343368	.	+	.	transcript  "BG:DS00941.15"
Adh	std3	CDS	343432	343984	.	+	.	transcript  "BG:DS00941.15"
#
#
###
###
#
#
Adh	std3	start_codon	341713	341715	.	+	.	transcript  "BG:DS00941.14"
Adh	std3	stop_codon	342749	342751	.	+	.	transcript  "BG:DS00941.14"
Adh	std3	CDS	341713	341857	.	+	.	transcript  "BG:DS00941.14"
Adh	std3	CDS	342003	342751	.	+	.	transcript  "BG:DS00941.14"
#
#
###
###
#
#
Adh	std3	start_codon	340529	340531	.	+	.	transcript  "BG:DS00941.13"
Adh	std3	stop_codon	341551	341553	.	+	.	transcript  "BG:DS00941.13"
Adh	std3	CDS	340529	340634	.	+	.	transcript  "BG:DS00941.13"
Adh	std3	CDS	340705	340870	.	+	.	transcript  "BG:DS00941.13"
Adh	std3	CDS	340926	341551	.	+	.	transcript  "BG:DS00941.13"
#
#
###
###
#
#
Adh	std3	start_codon	339011	339013	.	-	.	transcript  "BG:DS00941.12"
Adh	std3	stop_codon	338167	338169	.	-	.	transcript  "BG:DS00941.12"
Adh	std3	CDS	338167	338879	.	-	.	transcript  "BG:DS00941.12"
Adh	std3	CDS	338944	339013	.	-	.	transcript  "BG:DS00941.12"
#
#
###
###
#
#
Adh	std3	start_codon	337455	337457	.	-	.	transcript  "BG:DS00941.11"
Adh	std3	stop_codon	334589	334591	.	-	.	transcript  "BG:DS00941.11"
Adh	std3	CDS	334589	335125	.	-	.	transcript  "BG:DS00941.11"
Adh	std3	CDS	336758	337317	.	-	.	transcript  "BG:DS00941.11"
Adh	std3	CDS	337379	337457	.	-	.	transcript  "BG:DS00941.11"
#
#
###
###
#
#
Adh	std3	start_codon	327175	327177	.	+	.	transcript  "RpII33"
Adh	std3	stop_codon	328000	328002	.	+	.	transcript  "RpII33"
Adh	std3	CDS	327175	328002	.	+	.	transcript  "RpII33"
#
#
###
###
#
#
Adh	std3	start_codon	326377	326379	.	-	.	transcript  "MtPolB"
Adh	std3	stop_codon	325240	325242	.	-	.	transcript  "MtPolB"
Adh	std3	CDS	325240	325634	.	-	.	transcript  "MtPolB"
Adh	std3	CDS	325689	326379	.	-	.	transcript  "MtPolB"
#
#
###
###
#
#
Adh	std3	start_codon	323788	323790	.	+	.	transcript  "Orc5"
Adh	std3	stop_codon	325221	325223	.	+	.	transcript  "Orc5"
Adh	std3	CDS	323788	324885	.	+	.	transcript  "Orc5"
Adh	std3	CDS	324939	325223	.	+	.	transcript  "Orc5"
#
#
###
###
#
#
Adh	std3	start_codon	323167	323169	.	-	.	transcript  "Sop2"
Adh	std3	stop_codon	321967	321969	.	-	.	transcript  "Sop2"
Adh	std3	CDS	321967	323027	.	-	.	transcript  "Sop2"
Adh	std3	CDS	323097	323169	.	-	.	transcript  "Sop2"
#
#
###
###
#
#
Adh	std3	start_codon	321440	321442	.	-	.	transcript  "tamas"
Adh	std3	stop_codon	317891	317893	.	-	.	transcript  "tamas"
Adh	std3	CDS	317891	318548	.	-	.	transcript  "tamas"
Adh	std3	CDS	318608	319430	.	-	.	transcript  "tamas"
Adh	std3	CDS	319486	321442	.	-	.	transcript  "tamas"
#
#
###
###
#
#
Adh	std3	start_codon	315138	315140	.	+	.	transcript  "b"
Adh	std3	stop_codon	317460	317462	.	+	.	transcript  "b"
Adh	std3	CDS	315138	315899	.	+	.	transcript  "b"
Adh	std3	CDS	316433	316800	.	+	.	transcript  "b"
Adh	std3	CDS	316865	317462	.	+	.	transcript  "b"
#
#
###
###
#
#
Adh	std3	start_codon	307965	307967	.	+	.	transcript  "Sos"
Adh	std3	stop_codon	313127	313129	.	+	.	transcript  "Sos"
Adh	std3	CDS	307965	309056	.	+	.	transcript  "Sos"
Adh	std3	CDS	309110	309467	.	+	.	transcript  "Sos"
Adh	std3	CDS	309530	310452	.	+	.	transcript  "Sos"
Adh	std3	CDS	310517	311365	.	+	.	transcript  "Sos"
Adh	std3	CDS	311428	312318	.	+	.	transcript  "Sos"
Adh	std3	CDS	312387	313020	.	+	.	transcript  "Sos"
Adh	std3	CDS	313086	313129	.	+	.	transcript  "Sos"
#
#
###
###
#
#
Adh	std3	start_codon	305396	305398	.	+	.	transcript  "BG:DS00941.3"
Adh	std3	stop_codon	306383	306385	.	+	.	transcript  "BG:DS00941.3"
Adh	std3	CDS	305396	305516	.	+	.	transcript  "BG:DS00941.3"
Adh	std3	CDS	305577	305737	.	+	.	transcript  "BG:DS00941.3"
Adh	std3	CDS	305803	306108	.	+	.	transcript  "BG:DS00941.3"
Adh	std3	CDS	306230	306385	.	+	.	transcript  "BG:DS00941.3"
#
#
###
###
#
#
Adh	std3	start_codon	305199	305201	.	-	.	transcript  "BG:DS00941.2"
Adh	std3	stop_codon	303960	303962	.	-	.	transcript  "BG:DS00941.2"
Adh	std3	CDS	303960	304272	.	-	.	transcript  "BG:DS00941.2"
Adh	std3	CDS	304330	305201	.	-	.	transcript  "BG:DS00941.2"
#
#
###
###
#
#
Adh	std3	start_codon	297680	297682	.	+	.	transcript  "BG:DS00941.1"
Adh	std3	stop_codon	303403	303405	.	+	.	transcript  "BG:DS00941.1"
Adh	std3	CDS	297680	297713	.	+	.	transcript  "BG:DS00941.1"
Adh	std3	CDS	302560	302718	.	+	.	transcript  "BG:DS00941.1"
Adh	std3	CDS	302786	303405	.	+	.	transcript  "BG:DS00941.1"
#
#
###
###
#
#
Adh	std3	start_codon	1565296	1565298	.	+	.	transcript  "BG:DS04929.1"
Adh	std3	stop_codon	1585378	1585380	.	+	.	transcript  "BG:DS04929.1"
Adh	std3	CDS	1565296	1565530	.	+	.	transcript  "BG:DS04929.1"
Adh	std3	CDS	1576691	1576943	.	+	.	transcript  "BG:DS04929.1"
Adh	std3	CDS	1577036	1577406	.	+	.	transcript  "BG:DS04929.1"
Adh	std3	CDS	1577568	1577860	.	+	.	transcript  "BG:DS04929.1"
Adh	std3	CDS	1577926	1578081	.	+	.	transcript  "BG:DS04929.1"
Adh	std3	CDS	1580550	1580685	.	+	.	transcript  "BG:DS04929.1"
Adh	std3	CDS	1580750	1580880	.	+	.	transcript  "BG:DS04929.1"
Adh	std3	CDS	1580946	1581227	.	+	.	transcript  "BG:DS04929.1"
Adh	std3	CDS	1581294	1581623	.	+	.	transcript  "BG:DS04929.1"
Adh	std3	CDS	1581774	1582136	.	+	.	transcript  "BG:DS04929.1"
Adh	std3	CDS	1582201	1582292	.	+	.	transcript  "BG:DS04929.1"
Adh	std3	CDS	1582550	1582687	.	+	.	transcript  "BG:DS04929.1"
Adh	std3	CDS	1583070	1583334	.	+	.	transcript  "BG:DS04929.1"
Adh	std3	CDS	1583785	1583883	.	+	.	transcript  "BG:DS04929.1"
Adh	std3	CDS	1584330	1584828	.	+	.	transcript  "BG:DS04929.1"
Adh	std3	CDS	1584949	1585094	.	+	.	transcript  "BG:DS04929.1"
Adh	std3	CDS	1585153	1585380	.	+	.	transcript  "BG:DS04929.1"
#
#
###
###
#
#
Adh	std3	start_codon	1599236	1599238	.	+	.	transcript  "BG:DS04929.3"
Adh	std3	stop_codon	1602563	1602565	.	+	.	transcript  "BG:DS04929.3"
Adh	std3	CDS	1599236	1600177	.	+	.	transcript  "BG:DS04929.3"
Adh	std3	CDS	1601744	1602565	.	+	.	transcript  "BG:DS04929.3"
#
#
###
###
#
#
Adh	std3	start_codon	1603541	1603543	.	+	.	transcript  "stc"
Adh	std3	stop_codon	1607304	1607306	.	+	.	transcript  "stc"
Adh	std3	CDS	1603541	1603885	.	+	.	transcript  "stc"
Adh	std3	CDS	1603951	1605404	.	+	.	transcript  "stc"
Adh	std3	CDS	1605651	1606718	.	+	.	transcript  "stc"
Adh	std3	CDS	1606791	1607142	.	+	.	transcript  "stc"
Adh	std3	CDS	1607205	1607306	.	+	.	transcript  "stc"
#
#
###
###
#
#
Adh	std3	start_codon	2040123	2040125	.	+	.	transcript  "BG:DS04862.2"
Adh	std3	stop_codon	2052899	2052901	.	+	.	transcript  "BG:DS04862.2"
Adh	std3	CDS	2040123	2040280	.	+	.	transcript  "BG:DS04862.2"
Adh	std3	CDS	2040432	2040689	.	+	.	transcript  "BG:DS04862.2"
Adh	std3	CDS	2041374	2041494	.	+	.	transcript  "BG:DS04862.2"
Adh	std3	CDS	2044388	2044681	.	+	.	transcript  "BG:DS04862.2"
Adh	std3	CDS	2049236	2049415	.	+	.	transcript  "BG:DS04862.2"
Adh	std3	CDS	2050204	2050341	.	+	.	transcript  "BG:DS04862.2"
Adh	std3	CDS	2052716	2052901	.	+	.	transcript  "BG:DS04862.2"
#
#
###
###
#
#
Adh	std3	start_codon	2068604	2068606	.	+	.	transcript  "kek3"
Adh	std3	stop_codon	2072675	2072677	.	+	.	transcript  "kek3"
Adh	std3	CDS	2068604	2070501	.	+	.	transcript  "kek3"
Adh	std3	CDS	2071510	2072677	.	+	.	transcript  "kek3"
#
#
###
###
#
#
Adh	std3	start_codon	646068	646070	.	+	.	transcript  "BG:DS01523.1"
Adh	std3	stop_codon	652822	652824	.	+	.	transcript  "BG:DS01523.1"
Adh	std3	CDS	646068	646145	.	+	.	transcript  "BG:DS01523.1"
Adh	std3	CDS	650611	651153	.	+	.	transcript  "BG:DS01523.1"
Adh	std3	CDS	651278	651478	.	+	.	transcript  "BG:DS01523.1"
Adh	std3	CDS	651583	652282	.	+	.	transcript  "BG:DS01523.1"
Adh	std3	CDS	652397	652824	.	+	.	transcript  "BG:DS01523.1"
#
#
###
###
#
#
Adh	std3	start_codon	667103	667105	.	-	.	transcript  "BG:DS01523.2"
Adh	std3	stop_codon	654984	654986	.	-	.	transcript  "BG:DS01523.2"
Adh	std3	CDS	654984	656897	.	-	.	transcript  "BG:DS01523.2"
Adh	std3	CDS	656952	657179	.	-	.	transcript  "BG:DS01523.2"
Adh	std3	CDS	657772	658001	.	-	.	transcript  "BG:DS01523.2"
Adh	std3	CDS	658058	658265	.	-	.	transcript  "BG:DS01523.2"
Adh	std3	CDS	658326	658463	.	-	.	transcript  "BG:DS01523.2"
Adh	std3	CDS	658526	660852	.	-	.	transcript  "BG:DS01523.2"
Adh	std3	CDS	660917	661331	.	-	.	transcript  "BG:DS01523.2"
Adh	std3	CDS	662256	662303	.	-	.	transcript  "BG:DS01523.2"
Adh	std3	CDS	665700	665782	.	-	.	transcript  "BG:DS01523.2"
Adh	std3	CDS	667015	667105	.	-	.	transcript  "BG:DS01523.2"
#
#
###
###
#
#
Adh	std3	start_codon	2305038	2305040	.	+	.	transcript  "BG:DS02252.2"
Adh	std3	stop_codon	2306949	2306951	.	+	.	transcript  "BG:DS02252.2"
Adh	std3	CDS	2305038	2305397	.	+	.	transcript  "BG:DS02252.2"
Adh	std3	CDS	2305489	2305763	.	+	.	transcript  "BG:DS02252.2"
Adh	std3	CDS	2305829	2306951	.	+	.	transcript  "BG:DS02252.2"
#
#
###
###
#
#
Adh	std3	start_codon	2331308	2331310	.	-	.	transcript  "BG:DS00365.1"
Adh	std3	stop_codon	2328290	2328292	.	-	.	transcript  "BG:DS00365.1"
Adh	std3	CDS	2328290	2328403	.	-	.	transcript  "BG:DS00365.1"
Adh	std3	CDS	2328611	2329967	.	-	.	transcript  "BG:DS00365.1"
Adh	std3	CDS	2330026	2330181	.	-	.	transcript  "BG:DS00365.1"
Adh	std3	CDS	2330600	2330652	.	-	.	transcript  "BG:DS00365.1"
Adh	std3	CDS	2331101	2331310	.	-	.	transcript  "BG:DS00365.1"
#
#
###
###
#
#
Adh	std3	start_codon	2343907	2343909	.	-	.	transcript  "BG:DS00365.2"
Adh	std3	stop_codon	2339377	2339379	.	-	.	transcript  "BG:DS00365.2"
Adh	std3	CDS	2339377	2340420	.	-	.	transcript  "BG:DS00365.2"
Adh	std3	CDS	2340535	2341630	.	-	.	transcript  "BG:DS00365.2"
Adh	std3	CDS	2341725	2341808	.	-	.	transcript  "BG:DS00365.2"
Adh	std3	CDS	2342156	2342274	.	-	.	transcript  "BG:DS00365.2"
Adh	std3	CDS	2342341	2342602	.	-	.	transcript  "BG:DS00365.2"
Adh	std3	CDS	2342664	2343851	.	-	.	transcript  "BG:DS00365.2"
Adh	std3	CDS	2343893	2343909	.	-	.	transcript  "BG:DS00365.2"
#
#
###
###
#
#
Adh	std3	start_codon	2353050	2353052	.	-	.	transcript  "BG:DS00365.3"
Adh	std3	stop_codon	2348982	2348984	.	-	.	transcript  "BG:DS00365.3"
Adh	std3	CDS	2348982	2349115	.	-	.	transcript  "BG:DS00365.3"
Adh	std3	CDS	2349968	2350879	.	-	.	transcript  "BG:DS00365.3"
Adh	std3	CDS	2352080	2353052	.	-	.	transcript  "BG:DS00365.3"
#
#
###
###
#
#
Adh	std3	start_codon	2202800	2202802	.	-	.	transcript  "BG:DS09217.1"
Adh	std3	stop_codon	2201422	2201424	.	-	.	transcript  "BG:DS09217.1"
Adh	std3	CDS	2201424	2201677	.	-	.	transcript  "BG:DS09217.1"
Adh	std3	CDS	2202376	2202477	.	-	.	transcript  "BG:DS09217.1"
Adh	std3	CDS	2202548	2202802	.	-	.	transcript  "BG:DS09217.1"
#
#
###
###
#
#
Adh	std3	start_codon	2204183	2204185	.	+	.	transcript  "l.2.35Df"
Adh	std3	stop_codon	2207401	2207403	.	+	.	transcript  "l.2.35Df"
Adh	std3	CDS	2204183	2205278	.	+	.	transcript  "l.2.35Df"
Adh	std3	CDS	2205332	2207403	.	+	.	transcript  "l.2.35Df"
#
#
###
###
#
#
Adh	std3	start_codon	2212392	2212394	.	-	.	transcript  "Gli"
Adh	std3	stop_codon	2208922	2208924	.	-	.	transcript  "Gli"
Adh	std3	CDS	2208922	2209531	.	-	.	transcript  "Gli"
Adh	std3	CDS	2209593	2209904	.	-	.	transcript  "Gli"
Adh	std3	CDS	2209967	2211186	.	-	.	transcript  "Gli"
Adh	std3	CDS	2211243	2211671	.	-	.	transcript  "Gli"
Adh	std3	CDS	2212036	2212168	.	-	.	transcript  "Gli"
Adh	std3	CDS	2212228	2212394	.	-	.	transcript  "Gli"
#
#
###
###
#
#
Adh	std3	start_codon	2216202	2216204	.	+	.	transcript  "BG:DS09217.4"
Adh	std3	stop_codon	2217535	2217537	.	+	.	transcript  "BG:DS09217.4"
Adh	std3	CDS	2216202	2216447	.	+	.	transcript  "BG:DS09217.4"
Adh	std3	CDS	2216609	2217034	.	+	.	transcript  "BG:DS09217.4"
Adh	std3	CDS	2217099	2217403	.	+	.	transcript  "BG:DS09217.4"
Adh	std3	CDS	2217501	2217537	.	+	.	transcript  "BG:DS09217.4"
#
#
###
###
#
#
Adh	std3	start_codon	2219839	2219841	.	-	.	transcript  "l.2.35Ea"
Adh	std3	stop_codon	2218461	2218463	.	-	.	transcript  "l.2.35Ea"
Adh	std3	CDS	2218461	2218494	.	-	.	transcript  "l.2.35Ea"
Adh	std3	CDS	2218559	2218905	.	-	.	transcript  "l.2.35Ea"
Adh	std3	CDS	2218966	2219841	.	-	.	transcript  "l.2.35Ea"
#
#
###
###
#
#
Adh	std3	start_codon	2224365	2224367	.	-	.	transcript  "BG:DS09217.6"
Adh	std3	stop_codon	2220563	2220565	.	-	.	transcript  "BG:DS09217.6"
Adh	std3	CDS	2220565	2222197	.	-	.	transcript  "BG:DS09217.6"
Adh	std3	CDS	2222257	2222379	.	-	.	transcript  "BG:DS09217.6"
Adh	std3	CDS	2222435	2222667	.	-	.	transcript  "BG:DS09217.6"
Adh	std3	CDS	2222723	2222818	.	-	.	transcript  "BG:DS09217.6"
Adh	std3	CDS	2223403	2223577	.	-	.	transcript  "BG:DS09217.6"
Adh	std3	CDS	2223854	2224229	.	-	.	transcript  "BG:DS09217.6"
Adh	std3	CDS	2224289	2224367	.	-	.	transcript  "BG:DS09217.6"
#
#
###
###
#
#
Adh	std3	start_codon	2707374	2707376	.	+	.	transcript  "BG:DS07473.2"
Adh	std3	stop_codon	2708520	2708522	.	+	.	transcript  "BG:DS07473.2"
Adh	std3	CDS	2707374	2707439	.	+	.	transcript  "BG:DS07473.2"
Adh	std3	CDS	2707509	2708522	.	+	.	transcript  "BG:DS07473.2"
#
#
###
###
#
#
Adh	std3	start_codon	2698208	2698210	.	-	.	transcript  "PRL-1"
Adh	std3	stop_codon	2696335	2696337	.	-	.	transcript  "PRL-1"
Adh	std3	CDS	2696335	2696446	.	-	.	transcript  "PRL-1"
Adh	std3	CDS	2696513	2696644	.	-	.	transcript  "PRL-1"
Adh	std3	CDS	2697862	2698028	.	-	.	transcript  "PRL-1"
Adh	std3	CDS	2698091	2698210	.	-	.	transcript  "PRL-1"
#
#
###
###
#
#
Adh	std3	start_codon	2683427	2683429	.	+	.	transcript  "BG:DS07473.1"
Adh	std3	stop_codon	2694717	2694719	.	+	.	transcript  "BG:DS07473.1"
Adh	std3	CDS	2683427	2683473	.	+	.	transcript  "BG:DS07473.1"
Adh	std3	CDS	2684880	2686209	.	+	.	transcript  "BG:DS07473.1"
Adh	std3	CDS	2686394	2686570	.	+	.	transcript  "BG:DS07473.1"
Adh	std3	CDS	2686628	2686705	.	+	.	transcript  "BG:DS07473.1"
Adh	std3	CDS	2686770	2687146	.	+	.	transcript  "BG:DS07473.1"
Adh	std3	CDS	2687211	2687359	.	+	.	transcript  "BG:DS07473.1"
Adh	std3	CDS	2687415	2687794	.	+	.	transcript  "BG:DS07473.1"
Adh	std3	CDS	2687988	2688204	.	+	.	transcript  "BG:DS07473.1"
Adh	std3	CDS	2688462	2688883	.	+	.	transcript  "BG:DS07473.1"
Adh	std3	CDS	2691203	2694219	.	+	.	transcript  "BG:DS07473.1"
Adh	std3	CDS	2694277	2694414	.	+	.	transcript  "BG:DS07473.1"
Adh	std3	CDS	2694479	2694719	.	+	.	transcript  "BG:DS07473.1"
#
#
###
###
#
#
Adh	std3	start_codon	2855180	2855182	.	-	.	transcript  "BG:DS02780.1"
Adh	std3	stop_codon	2849759	2849761	.	-	.	transcript  "BG:DS02780.1"
Adh	std3	CDS	2849759	2849784	.	-	.	transcript  "BG:DS02780.1"
Adh	std3	CDS	2853744	2854099	.	-	.	transcript  "BG:DS02780.1"
Adh	std3	CDS	2854197	2855182	.	-	.	transcript  "BG:DS02780.1"
#
#
###
###
#
#
Adh	std3	start_codon	2894587	2894589	.	+	.	transcript  "Idgf1"
Adh	std3	stop_codon	2895975	2895977	.	+	.	transcript  "Idgf1"
Adh	std3	CDS	2894587	2895247	.	+	.	transcript  "Idgf1"
Adh	std3	CDS	2895319	2895977	.	+	.	transcript  "Idgf1"
#
#
###
###
#
#
Adh	std3	start_codon	2896655	2896657	.	+	.	transcript  "Idgf2"
Adh	std3	stop_codon	2899714	2899716	.	+	.	transcript  "Idgf2"
Adh	std3	CDS	2896655	2896763	.	+	.	transcript  "Idgf2"
Adh	std3	CDS	2898444	2899001	.	+	.	transcript  "Idgf2"
Adh	std3	CDS	2899061	2899716	.	+	.	transcript  "Idgf2"
#
#
###
###
#
#
Adh	std3	start_codon	2900448	2900450	.	+	.	transcript  "Idgf3"
Adh	std3	stop_codon	2902105	2902107	.	+	.	transcript  "Idgf3"
Adh	std3	CDS	2900448	2900565	.	+	.	transcript  "Idgf3"
Adh	std3	CDS	2900634	2901185	.	+	.	transcript  "Idgf3"
Adh	std3	CDS	2901452	2902107	.	+	.	transcript  "Idgf3"
#
#
###
###
#
#
Adh	std3	start_codon	1152128	1152130	.	+	.	transcript  "BG:DS07721.1"
Adh	std3	stop_codon	1152383	1152385	.	+	.	transcript  "BG:DS07721.1"
Adh	std3	CDS	1152128	1152385	.	+	.	transcript  "BG:DS07721.1"
#
#
###
###
#
#
Adh	std3	start_codon	1205439	1205441	.	+	.	transcript  "BG:DS07721.3"
Adh	std3	stop_codon	1213323	1213325	.	+	.	transcript  "BG:DS07721.3"
Adh	std3	CDS	1205439	1205597	.	+	.	transcript  "BG:DS07721.3"
Adh	std3	CDS	1206614	1206790	.	+	.	transcript  "BG:DS07721.3"
Adh	std3	CDS	1207666	1207906	.	+	.	transcript  "BG:DS07721.3"
Adh	std3	CDS	1209000	1209064	.	+	.	transcript  "BG:DS07721.3"
Adh	std3	CDS	1211030	1211110	.	+	.	transcript  "BG:DS07721.3"
Adh	std3	CDS	1213212	1213325	.	+	.	transcript  "BG:DS07721.3"
#
#
###
###
#
#
Adh	std3	start_codon	1225740	1225742	.	-	.	transcript  "BG:DS07721.6"
Adh	std3	stop_codon	1216389	1216391	.	-	.	transcript  "BG:DS07721.6"
Adh	std3	CDS	1216389	1216489	.	-	.	transcript  "BG:DS07721.6"
Adh	std3	CDS	1218654	1220253	.	-	.	transcript  "BG:DS07721.6"
Adh	std3	CDS	1220453	1221762	.	-	.	transcript  "BG:DS07721.6"
Adh	std3	CDS	1222288	1222395	.	-	.	transcript  "BG:DS07721.6"
Adh	std3	CDS	1222483	1223742	.	-	.	transcript  "BG:DS07721.6"
Adh	std3	CDS	1225056	1225291	.	-	.	transcript  "BG:DS07721.6"
Adh	std3	CDS	1225603	1225742	.	-	.	transcript  "BG:DS07721.6"
#
#
###
###
#
#
Adh	std3	start_codon	498520	498522	.	+	.	transcript  "BG:DS01514.3"
Adh	std3	stop_codon	507579	507581	.	+	.	transcript  "BG:DS01514.3"
Adh	std3	CDS	498520	498979	.	+	.	transcript  "BG:DS01514.3"
Adh	std3	CDS	499082	499159	.	+	.	transcript  "BG:DS01514.3"
Adh	std3	CDS	499280	499563	.	+	.	transcript  "BG:DS01514.3"
Adh	std3	CDS	507216	507581	.	+	.	transcript  "BG:DS01514.3"
#
#
###
###
#
#
Adh	std3	start_codon	473959	473961	.	+	.	transcript  "BG:DS00180.14"
Adh	std3	stop_codon	476387	476389	.	+	.	transcript  "BG:DS00180.14"
Adh	std3	CDS	473959	474023	.	+	.	transcript  "BG:DS00180.14"
Adh	std3	CDS	474365	475283	.	+	.	transcript  "BG:DS00180.14"
Adh	std3	CDS	475427	476389	.	+	.	transcript  "BG:DS00180.14"
#
#
###
###
#
#
Adh	std3	start_codon	471109	471111	.	+	.	transcript  "BG:DS00180.11"
Adh	std3	stop_codon	473126	473128	.	+	.	transcript  "BG:DS00180.11"
Adh	std3	CDS	471109	471296	.	+	.	transcript  "BG:DS00180.11"
Adh	std3	CDS	471441	471687	.	+	.	transcript  "BG:DS00180.11"
Adh	std3	CDS	471752	471856	.	+	.	transcript  "BG:DS00180.11"
Adh	std3	CDS	471944	472490	.	+	.	transcript  "BG:DS00180.11"
Adh	std3	CDS	472557	472823	.	+	.	transcript  "BG:DS00180.11"
Adh	std3	CDS	472965	473128	.	+	.	transcript  "BG:DS00180.11"
#
#
###
###
#
#
Adh	std3	start_codon	470436	470438	.	-	.	transcript  "BG:DS00180.10"
Adh	std3	stop_codon	467979	467981	.	-	.	transcript  "BG:DS00180.10"
Adh	std3	CDS	467979	469628	.	-	.	transcript  "BG:DS00180.10"
Adh	std3	CDS	470226	470438	.	-	.	transcript  "BG:DS00180.10"
#
#
###
###
#
#
Adh	std3	start_codon	464308	464310	.	+	.	transcript  "BG:DS00180.9"
Adh	std3	stop_codon	465432	465434	.	+	.	transcript  "BG:DS00180.9"
Adh	std3	CDS	464308	464615	.	+	.	transcript  "BG:DS00180.9"
Adh	std3	CDS	464888	465434	.	+	.	transcript  "BG:DS00180.9"
#
#
###
###
#
#
Adh	std3	start_codon	463655	463657	.	-	.	transcript  "BG:DS00180.8"
Adh	std3	stop_codon	462092	462094	.	-	.	transcript  "BG:DS00180.8"
Adh	std3	CDS	462092	462584	.	-	.	transcript  "BG:DS00180.8"
Adh	std3	CDS	462646	463209	.	-	.	transcript  "BG:DS00180.8"
Adh	std3	CDS	463368	463657	.	-	.	transcript  "BG:DS00180.8"
#
#
###
###
#
#
Adh	std3	start_codon	460672	460674	.	-	.	transcript  "BG:DS00180.7"
Adh	std3	stop_codon	458837	458839	.	-	.	transcript  "BG:DS00180.7"
Adh	std3	CDS	458837	459146	.	-	.	transcript  "BG:DS00180.7"
Adh	std3	CDS	459225	459761	.	-	.	transcript  "BG:DS00180.7"
Adh	std3	CDS	460256	460674	.	-	.	transcript  "BG:DS00180.7"
#
#
###
###
#
#
Adh	std3	start_codon	457298	457300	.	+	.	transcript  "BG:DS00180.12"
Adh	std3	stop_codon	458800	458802	.	+	.	transcript  "BG:DS00180.12"
Adh	std3	CDS	457298	457488	.	+	.	transcript  "BG:DS00180.12"
Adh	std3	CDS	457649	458206	.	+	.	transcript  "BG:DS00180.12"
Adh	std3	CDS	458285	458488	.	+	.	transcript  "BG:DS00180.12"
Adh	std3	CDS	458547	458802	.	+	.	transcript  "BG:DS00180.12"
#
#
###
###
#
#
Adh	std3	start_codon	445189	445191	.	+	.	transcript  "BG:DS00180.5"
Adh	std3	stop_codon	456315	456317	.	+	.	transcript  "BG:DS00180.5"
Adh	std3	CDS	445189	445277	.	+	.	transcript  "BG:DS00180.5"
Adh	std3	CDS	446294	446429	.	+	.	transcript  "BG:DS00180.5"
Adh	std3	CDS	446732	447001	.	+	.	transcript  "BG:DS00180.5"
Adh	std3	CDS	448492	448607	.	+	.	transcript  "BG:DS00180.5"
Adh	std3	CDS	449015	449247	.	+	.	transcript  "BG:DS00180.5"
Adh	std3	CDS	451744	451902	.	+	.	transcript  "BG:DS00180.5"
Adh	std3	CDS	452734	452909	.	+	.	transcript  "BG:DS00180.5"
Adh	std3	CDS	455021	455702	.	+	.	transcript  "BG:DS00180.5"
Adh	std3	CDS	455974	456317	.	+	.	transcript  "BG:DS00180.5"
#
#
###
###
#
#
Adh	std3	start_codon	440848	440850	.	-	.	transcript  "BG:DS00180.3"
Adh	std3	stop_codon	438979	438981	.	-	.	transcript  "BG:DS00180.3"
Adh	std3	CDS	438979	439800	.	-	.	transcript  "BG:DS00180.3"
Adh	std3	CDS	440839	440850	.	-	.	transcript  "BG:DS00180.3"
#
#
###
###
#
#
Adh	std3	start_codon	417109	417111	.	-	.	transcript  "BG:DS00180.2"
Adh	std3	stop_codon	415576	415578	.	-	.	transcript  "BG:DS00180.2"
Adh	std3	CDS	415576	416211	.	-	.	transcript  "BG:DS00180.2"
Adh	std3	CDS	416276	416749	.	-	.	transcript  "BG:DS00180.2"
Adh	std3	CDS	417100	417111	.	-	.	transcript  "BG:DS00180.2"
#
#
###
###
#
#
Adh	std3	start_codon	405952	405954	.	+	.	transcript  "Acyp"
Adh	std3	stop_codon	406312	406314	.	+	.	transcript  "Acyp"
Adh	std3	CDS	405952	406314	.	+	.	transcript  "Acyp"
#
#
###
###
#
#
Adh	std3	start_codon	185613	185615	.	-	.	transcript  "BG:DS08249.1"
Adh	std3	stop_codon	172106	172108	.	-	.	transcript  "BG:DS08249.1"
Adh	std3	CDS	172106	172869	.	-	.	transcript  "BG:DS08249.1"
Adh	std3	CDS	177956	178015	.	-	.	transcript  "BG:DS08249.1"
Adh	std3	CDS	178136	178300	.	-	.	transcript  "BG:DS08249.1"
Adh	std3	CDS	179847	179900	.	-	.	transcript  "BG:DS08249.1"
Adh	std3	CDS	181272	181409	.	-	.	transcript  "BG:DS08249.1"
Adh	std3	CDS	183107	183235	.	-	.	transcript  "BG:DS08249.1"
Adh	std3	CDS	183341	183496	.	-	.	transcript  "BG:DS08249.1"
Adh	std3	CDS	183596	183635	.	-	.	transcript  "BG:DS08249.1"
Adh	std3	CDS	183835	184040	.	-	.	transcript  "BG:DS08249.1"
Adh	std3	CDS	184241	184282	.	-	.	transcript  "BG:DS08249.1"
Adh	std3	CDS	185558	185615	.	-	.	transcript  "BG:DS08249.1"
#
#
###
###
#
#
Adh	std3	start_codon	159578	159580	.	+	.	transcript  "BG:DS01368.1"
Adh	std3	stop_codon	163525	163527	.	+	.	transcript  "BG:DS01368.1"
Adh	std3	CDS	159578	159874	.	+	.	transcript  "BG:DS01368.1"
Adh	std3	CDS	161727	162105	.	+	.	transcript  "BG:DS01368.1"
Adh	std3	CDS	162442	162557	.	+	.	transcript  "BG:DS01368.1"
Adh	std3	CDS	162616	163137	.	+	.	transcript  "BG:DS01368.1"
Adh	std3	CDS	163297	163527	.	+	.	transcript  "BG:DS01368.1"
#
#
###
###
#
#
Adh	std3	start_codon	1233087	1233089	.	+	.	transcript  "BG:DS00810.3"
Adh	std3	stop_codon	1233291	1233293	.	+	.	transcript  "BG:DS00810.3"
Adh	std3	CDS	1233087	1233293	.	+	.	transcript  "BG:DS00810.3"
#
#
###
###
#
#
Adh	std3	start_codon	1231461	1231463	.	-	.	transcript  "BG:DS00810.2"
Adh	std3	stop_codon	1231127	1231129	.	-	.	transcript  "BG:DS00810.2"
Adh	std3	CDS	1231127	1231384	.	-	.	transcript  "BG:DS00810.2"
Adh	std3	CDS	1231452	1231463	.	-	.	transcript  "BG:DS00810.2"
#
#
###
###
#
#
Adh	std3	start_codon	1229684	1229686	.	+	.	transcript  "BG:DS00810.1"
Adh	std3	stop_codon	1230731	1230733	.	+	.	transcript  "BG:DS00810.1"
Adh	std3	CDS	1229684	1230733	.	+	.	transcript  "BG:DS00810.1"
#
#
###
###
#
#
Adh	std3	start_codon	874868	874870	.	-	.	transcript  "ppk"
Adh	std3	stop_codon	872557	872559	.	-	.	transcript  "ppk"
Adh	std3	CDS	872557	872818	.	-	.	transcript  "ppk"
Adh	std3	CDS	872891	873131	.	-	.	transcript  "ppk"
Adh	std3	CDS	873191	873321	.	-	.	transcript  "ppk"
Adh	std3	CDS	873388	873527	.	-	.	transcript  "ppk"
Adh	std3	CDS	873583	874093	.	-	.	transcript  "ppk"
Adh	std3	CDS	874278	874541	.	-	.	transcript  "ppk"
Adh	std3	CDS	874599	874870	.	-	.	transcript  "ppk"
#
#
###
###
#
#
Adh	std3	start_codon	901493	901495	.	-	.	transcript  "elB"
Adh	std3	stop_codon	880859	880861	.	-	.	transcript  "elB"
Adh	std3	CDS	880859	881091	.	-	.	transcript  "elB"
Adh	std3	CDS	883002	883191	.	-	.	transcript  "elB"
Adh	std3	CDS	884810	884937	.	-	.	transcript  "elB"
Adh	std3	CDS	885047	885736	.	-	.	transcript  "elB"
Adh	std3	CDS	885967	886798	.	-	.	transcript  "elB"
Adh	std3	CDS	888067	888286	.	-	.	transcript  "elB"
Adh	std3	CDS	901332	901495	.	-	.	transcript  "elB"
#
#
###
###
#
#
Adh	std3	start_codon	918867	918869	.	-	.	transcript  "BG:DS06238.4"
Adh	std3	stop_codon	918151	918153	.	-	.	transcript  "BG:DS06238.4"
Adh	std3	CDS	918151	918795	.	-	.	transcript  "BG:DS06238.4"
Adh	std3	CDS	918858	918869	.	-	.	transcript  "BG:DS06238.4"
#
#
###
###
#
#
Adh	std3	start_codon	853116	853118	.	+	.	transcript  "l.2.35Aa"
Adh	std3	stop_codon	855012	855014	.	+	.	transcript  "l.2.35Aa"
Adh	std3	CDS	853116	855014	.	+	.	transcript  "l.2.35Aa"
#
#
###
###
#
#
Adh	std3	start_codon	851085	851087	.	+	.	transcript  "Rab14"
Adh	std3	stop_codon	851917	851919	.	+	.	transcript  "Rab14"
Adh	std3	CDS	851085	851190	.	+	.	transcript  "Rab14"
Adh	std3	CDS	851256	851436	.	+	.	transcript  "Rab14"
Adh	std3	CDS	851491	851673	.	+	.	transcript  "Rab14"
Adh	std3	CDS	851742	851919	.	+	.	transcript  "Rab14"
#
#
###
###
#
#
Adh	std3	start_codon	848731	848733	.	-	.	transcript  "BG:DS01068.6"
Adh	std3	stop_codon	846397	846399	.	-	.	transcript  "BG:DS01068.6"
Adh	std3	CDS	846397	847372	.	-	.	transcript  "BG:DS01068.6"
Adh	std3	CDS	847433	848154	.	-	.	transcript  "BG:DS01068.6"
Adh	std3	CDS	848208	848609	.	-	.	transcript  "BG:DS01068.6"
Adh	std3	CDS	848668	848733	.	-	.	transcript  "BG:DS01068.6"
#
#
###
###
#
#
Adh	std3	start_codon	843514	843516	.	-	.	transcript  "BG:DS01068.5"
Adh	std3	stop_codon	842968	842970	.	-	.	transcript  "BG:DS01068.5"
Adh	std3	CDS	842968	843375	.	-	.	transcript  "BG:DS01068.5"
Adh	std3	CDS	843445	843516	.	-	.	transcript  "BG:DS01068.5"
#
#
###
###
#
#
Adh	std3	start_codon	842440	842442	.	-	.	transcript  "BG:DS01068.4"
Adh	std3	stop_codon	841091	841093	.	-	.	transcript  "BG:DS01068.4"
Adh	std3	CDS	841091	841333	.	-	.	transcript  "BG:DS01068.4"
Adh	std3	CDS	841389	841969	.	-	.	transcript  "BG:DS01068.4"
Adh	std3	CDS	842034	842442	.	-	.	transcript  "BG:DS01068.4"
#
#
###
###
#
#
Adh	std3	start_codon	840388	840390	.	-	.	transcript  "BG:DS01068.10"
Adh	std3	stop_codon	839671	839673	.	-	.	transcript  "BG:DS01068.10"
Adh	std3	CDS	839671	840390	.	-	.	transcript  "BG:DS01068.10"
#
#
###
###
#
#
Adh	std3	start_codon	835092	835094	.	+	.	transcript  "BG:DS01068.2"
Adh	std3	stop_codon	839074	839076	.	+	.	transcript  "BG:DS01068.2"
Adh	std3	CDS	835092	835312	.	+	.	transcript  "BG:DS01068.2"
Adh	std3	CDS	836514	837106	.	+	.	transcript  "BG:DS01068.2"
Adh	std3	CDS	837173	837428	.	+	.	transcript  "BG:DS01068.2"
Adh	std3	CDS	837486	837859	.	+	.	transcript  "BG:DS01068.2"
Adh	std3	CDS	837919	838152	.	+	.	transcript  "BG:DS01068.2"
Adh	std3	CDS	838217	839076	.	+	.	transcript  "BG:DS01068.2"
#
#
###
###
#
#
Adh	std3	start_codon	828047	828049	.	+	.	transcript  "BG:DS01068.11"
Adh	std3	stop_codon	833670	833672	.	+	.	transcript  "BG:DS01068.11"
Adh	std3	CDS	828047	828306	.	+	.	transcript  "BG:DS01068.11"
Adh	std3	CDS	832073	833672	.	+	.	transcript  "BG:DS01068.11"
#
#
###
###
#
#
Adh	std3	start_codon	822205	822207	.	+	.	transcript  "BG:DS01068.1"
Adh	std3	stop_codon	827509	827511	.	+	.	transcript  "BG:DS01068.1"
Adh	std3	CDS	822205	822454	.	+	.	transcript  "BG:DS01068.1"
Adh	std3	CDS	822511	822848	.	+	.	transcript  "BG:DS01068.1"
Adh	std3	CDS	822874	824011	.	+	.	transcript  "BG:DS01068.1"
Adh	std3	CDS	824074	824822	.	+	.	transcript  "BG:DS01068.1"
Adh	std3	CDS	824885	825688	.	+	.	transcript  "BG:DS01068.1"
Adh	std3	CDS	825804	826423	.	+	.	transcript  "BG:DS01068.1"
Adh	std3	CDS	826499	826653	.	+	.	transcript  "BG:DS01068.1"
Adh	std3	CDS	826714	826921	.	+	.	transcript  "BG:DS01068.1"
Adh	std3	CDS	826980	827087	.	+	.	transcript  "BG:DS01068.1"
Adh	std3	CDS	827148	827511	.	+	.	transcript  "BG:DS01068.1"
#
#
###
###
#
#
Adh	std3	start_codon	801894	801896	.	+	.	transcript  "BG:DS03792.2"
Adh	std3	stop_codon	804733	804735	.	+	.	transcript  "BG:DS03792.2"
Adh	std3	CDS	801894	802914	.	+	.	transcript  "BG:DS03792.2"
Adh	std3	CDS	803148	803203	.	+	.	transcript  "BG:DS03792.2"
Adh	std3	CDS	804010	804157	.	+	.	transcript  "BG:DS03792.2"
Adh	std3	CDS	804584	804735	.	+	.	transcript  "BG:DS03792.2"
#
#
###
###
#
#
Adh	std3	start_codon	202128	202130	.	+	.	transcript  "BG:DS08249.2"
Adh	std3	stop_codon	204197	204199	.	+	.	transcript  "BG:DS08249.2"
Adh	std3	CDS	202128	202646	.	+	.	transcript  "BG:DS08249.2"
Adh	std3	CDS	202700	204199	.	+	.	transcript  "BG:DS08249.2"
#
#
###
###
#
#
Adh	std3	start_codon	217186	217188	.	-	.	transcript  "BG:DS08249.3"
Adh	std3	stop_codon	213507	213509	.	-	.	transcript  "BG:DS08249.3"
Adh	std3	CDS	213507	213602	.	-	.	transcript  "BG:DS08249.3"
Adh	std3	CDS	216171	216761	.	-	.	transcript  "BG:DS08249.3"
Adh	std3	CDS	216820	217188	.	-	.	transcript  "BG:DS08249.3"
#
#
###
###
#
#
Adh	std3	start_codon	227121	227123	.	+	.	transcript  "BG:DS08249.4"
Adh	std3	stop_codon	230460	230462	.	+	.	transcript  "BG:DS08249.4"
Adh	std3	CDS	227121	227312	.	+	.	transcript  "BG:DS08249.4"
Adh	std3	CDS	227793	227992	.	+	.	transcript  "BG:DS08249.4"
Adh	std3	CDS	229661	230462	.	+	.	transcript  "BG:DS08249.4"
#
#
###
###
#
#
Adh	std3	start_codon	240150	240152	.	-	.	transcript  "BG:DS08249.5"
Adh	std3	stop_codon	230985	230987	.	-	.	transcript  "BG:DS08249.5"
Adh	std3	CDS	230985	231322	.	-	.	transcript  "BG:DS08249.5"
Adh	std3	CDS	231417	231549	.	-	.	transcript  "BG:DS08249.5"
Adh	std3	CDS	234442	234563	.	-	.	transcript  "BG:DS08249.5"
Adh	std3	CDS	235723	235990	.	-	.	transcript  "BG:DS08249.5"
Adh	std3	CDS	236859	236980	.	-	.	transcript  "BG:DS08249.5"
Adh	std3	CDS	237092	237123	.	-	.	transcript  "BG:DS08249.5"
Adh	std3	CDS	239944	240152	.	-	.	transcript  "BG:DS08249.5"
#
#
###
###
#
#
Adh	std3	start_codon	514048	514050	.	-	.	transcript  "l.2.34Fa"
Adh	std3	stop_codon	513238	513240	.	-	.	transcript  "l.2.34Fa"
Adh	std3	CDS	513238	514050	.	-	.	transcript  "l.2.34Fa"
#
#
###
###
#
#
Adh	std3	start_codon	944596	944598	.	-	.	transcript  "BG:DS08340.1"
Adh	std3	stop_codon	941115	941117	.	-	.	transcript  "BG:DS08340.1"
Adh	std3	CDS	941115	941176	.	-	.	transcript  "BG:DS08340.1"
Adh	std3	CDS	941646	941731	.	-	.	transcript  "BG:DS08340.1"
Adh	std3	CDS	942328	942612	.	-	.	transcript  "BG:DS08340.1"
Adh	std3	CDS	943030	943151	.	-	.	transcript  "BG:DS08340.1"
Adh	std3	CDS	944233	944598	.	-	.	transcript  "BG:DS08340.1"
#
#
###
###
#
#
Adh	std3	start_codon	1752778	1752780	.	-	.	transcript  "BG:DS05639.1"
Adh	std3	stop_codon	1747063	1747065	.	-	.	transcript  "BG:DS05639.1"
Adh	std3	CDS	1747065	1747238	.	-	.	transcript  "BG:DS05639.1"
Adh	std3	CDS	1747451	1747757	.	-	.	transcript  "BG:DS05639.1"
Adh	std3	CDS	1747825	1748093	.	-	.	transcript  "BG:DS05639.1"
Adh	std3	CDS	1748156	1748361	.	-	.	transcript  "BG:DS05639.1"
Adh	std3	CDS	1748434	1748590	.	-	.	transcript  "BG:DS05639.1"
Adh	std3	CDS	1748671	1748943	.	-	.	transcript  "BG:DS05639.1"
Adh	std3	CDS	1751370	1751492	.	-	.	transcript  "BG:DS05639.1"
Adh	std3	CDS	1751564	1751664	.	-	.	transcript  "BG:DS05639.1"
Adh	std3	CDS	1751722	1751956	.	-	.	transcript  "BG:DS05639.1"
Adh	std3	CDS	1752027	1752278	.	-	.	transcript  "BG:DS05639.1"
Adh	std3	CDS	1752622	1752780	.	-	.	transcript  "BG:DS05639.1"
#
#
###
###
#
#
Adh	std3	start_codon	2815178	2815180	.	+	.	transcript  "BG:DS09218.5"
Adh	std3	stop_codon	2820924	2820926	.	+	.	transcript  "BG:DS09218.5"
Adh	std3	CDS	2815178	2815829	.	+	.	transcript  "BG:DS09218.5"
Adh	std3	CDS	2815894	2816001	.	+	.	transcript  "BG:DS09218.5"
Adh	std3	CDS	2820072	2820194	.	+	.	transcript  "BG:DS09218.5"
Adh	std3	CDS	2820862	2820926	.	+	.	transcript  "BG:DS09218.5"
#
#
###
###
#
#
Adh	std3	start_codon	2805810	2805812	.	-	.	transcript  "BG:DS09218.4"
Adh	std3	stop_codon	2804442	2804444	.	-	.	transcript  "BG:DS09218.4"
Adh	std3	CDS	2804442	2805730	.	-	.	transcript  "BG:DS09218.4"
Adh	std3	CDS	2805800	2805812	.	-	.	transcript  "BG:DS09218.4"
#
#
###
###
#
#
Adh	std3	start_codon	2802355	2802357	.	+	.	transcript  "BG:DS09218.3"
Adh	std3	stop_codon	2802811	2802813	.	+	.	transcript  "BG:DS09218.3"
Adh	std3	CDS	2802355	2802394	.	+	.	transcript  "BG:DS09218.3"
Adh	std3	CDS	2802473	2802813	.	+	.	transcript  "BG:DS09218.3"
#
#
###
###
#
#
Adh	std3	start_codon	2798711	2798713	.	-	.	transcript  "chif"
Adh	std3	stop_codon	2793626	2793628	.	-	.	transcript  "chif"
Adh	std3	CDS	2793626	2798713	.	-	.	transcript  "chif"
#
#
###
###
#
#
Adh	std3	start_codon	2792599	2792601	.	-	.	transcript  "BG:DS09218.1"
Adh	std3	stop_codon	2791866	2791868	.	-	.	transcript  "BG:DS09218.1"
Adh	std3	CDS	2791866	2792011	.	-	.	transcript  "BG:DS09218.1"
Adh	std3	CDS	2792082	2792601	.	-	.	transcript  "BG:DS09218.1"
#
#
###
###
#
#
Adh	std3	start_codon	2791501	2791503	.	-	.	transcript  "BG:DS02740.19"
Adh	std3	stop_codon	2787421	2787423	.	-	.	transcript  "BG:DS02740.19"
Adh	std3	CDS	2787421	2787885	.	-	.	transcript  "BG:DS02740.19"
Adh	std3	CDS	2787948	2788316	.	-	.	transcript  "BG:DS02740.19"
Adh	std3	CDS	2788569	2788684	.	-	.	transcript  "BG:DS02740.19"
Adh	std3	CDS	2788808	2789082	.	-	.	transcript  "BG:DS02740.19"
Adh	std3	CDS	2789143	2789471	.	-	.	transcript  "BG:DS02740.19"
Adh	std3	CDS	2789812	2791503	.	-	.	transcript  "BG:DS02740.19"
#
#
###
###
#
#
Adh	std3	start_codon	2787065	2787067	.	-	.	transcript  "BG:DS02740.18"
Adh	std3	stop_codon	2779883	2779885	.	-	.	transcript  "BG:DS02740.18"
Adh	std3	CDS	2779883	2785491	.	-	.	transcript  "BG:DS02740.18"
Adh	std3	CDS	2785552	2786722	.	-	.	transcript  "BG:DS02740.18"
Adh	std3	CDS	2786999	2787067	.	-	.	transcript  "BG:DS02740.18"
#
#
###
###
#
#
Adh	std3	start_codon	2778340	2778342	.	-	.	transcript  "l.2.35Fe"
Adh	std3	stop_codon	2777390	2777392	.	-	.	transcript  "l.2.35Fe"
Adh	std3	CDS	2777390	2777609	.	-	.	transcript  "l.2.35Fe"
Adh	std3	CDS	2777672	2778342	.	-	.	transcript  "l.2.35Fe"
#
#
###
###
#
#
Adh	std3	start_codon	2776417	2776419	.	+	.	transcript  "anon-35F.36A"
Adh	std3	stop_codon	2777293	2777295	.	+	.	transcript  "anon-35F.36A"
Adh	std3	CDS	2776417	2777295	.	+	.	transcript  "anon-35F.36A"
#
#
###
###
#
#
Adh	std3	start_codon	2774285	2774287	.	-	.	transcript  "cact"
Adh	std3	stop_codon	2762639	2762641	.	-	.	transcript  "cact"
Adh	std3	CDS	2762639	2762710	.	-	.	transcript  "cact"
Adh	std3	CDS	2763711	2763968	.	-	.	transcript  "cact"
Adh	std3	CDS	2764030	2764118	.	-	.	transcript  "cact"
Adh	std3	CDS	2772220	2772430	.	-	.	transcript  "cact"
Adh	std3	CDS	2772600	2772777	.	-	.	transcript  "cact"
Adh	std3	CDS	2773593	2774287	.	-	.	transcript  "cact"
#
#
###
###
#
#
Adh	std3	start_codon	2760361	2760363	.	+	.	transcript  "fzy"
Adh	std3	stop_codon	2762085	2762087	.	+	.	transcript  "fzy"
Adh	std3	CDS	2760361	2760672	.	+	.	transcript  "fzy"
Adh	std3	CDS	2760766	2761087	.	+	.	transcript  "fzy"
Adh	std3	CDS	2761141	2762087	.	+	.	transcript  "fzy"
#
#
###
###
#
#
Adh	std3	start_codon	2759848	2759850	.	-	.	transcript  "cni"
Adh	std3	stop_codon	2759163	2759165	.	-	.	transcript  "cni"
Adh	std3	CDS	2759163	2759190	.	-	.	transcript  "cni"
Adh	std3	CDS	2759260	2759403	.	-	.	transcript  "cni"
Adh	std3	CDS	2759527	2759639	.	-	.	transcript  "cni"
Adh	std3	CDS	2759701	2759850	.	-	.	transcript  "cni"
#
#
###
###
#
#
Adh	std3	start_codon	2757391	2757393	.	+	.	transcript  "Sed5"
Adh	std3	stop_codon	2758388	2758390	.	+	.	transcript  "Sed5"
Adh	std3	CDS	2757391	2757589	.	+	.	transcript  "Sed5"
Adh	std3	CDS	2757658	2758388	.	+	.	transcript  "Sed5"
#
#
###
###
#
#
Adh	std3	start_codon	2756272	2756274	.	-	.	transcript  "anon-35Fa"
Adh	std3	stop_codon	2755219	2755221	.	-	.	transcript  "anon-35Fa"
Adh	std3	CDS	2755219	2755580	.	-	.	transcript  "anon-35Fa"
Adh	std3	CDS	2755775	2755883	.	-	.	transcript  "anon-35Fa"
Adh	std3	CDS	2755954	2756092	.	-	.	transcript  "anon-35Fa"
Adh	std3	CDS	2756201	2756274	.	-	.	transcript  "anon-35Fa"
#
#
###
###
#
#
Adh	std3	start_codon	2752612	2752614	.	+	.	transcript  "BG:DS02740.10"
Adh	std3	stop_codon	2754737	2754739	.	+	.	transcript  "BG:DS02740.10"
Adh	std3	CDS	2752612	2752742	.	+	.	transcript  "BG:DS02740.10"
Adh	std3	CDS	2752822	2752985	.	+	.	transcript  "BG:DS02740.10"
Adh	std3	CDS	2753042	2753322	.	+	.	transcript  "BG:DS02740.10"
Adh	std3	CDS	2753382	2753565	.	+	.	transcript  "BG:DS02740.10"
Adh	std3	CDS	2753620	2753995	.	+	.	transcript  "BG:DS02740.10"
Adh	std3	CDS	2754057	2754364	.	+	.	transcript  "BG:DS02740.10"
Adh	std3	CDS	2754423	2754557	.	+	.	transcript  "BG:DS02740.10"
Adh	std3	CDS	2754615	2754739	.	+	.	transcript  "BG:DS02740.10"
#
#
###
###
#
#
Adh	std3	start_codon	2752031	2752033	.	-	.	transcript  "BG:DS02740.9"
Adh	std3	stop_codon	2751337	2751339	.	-	.	transcript  "BG:DS02740.9"
Adh	std3	CDS	2751337	2751465	.	-	.	transcript  "BG:DS02740.9"
Adh	std3	CDS	2751521	2751711	.	-	.	transcript  "BG:DS02740.9"
Adh	std3	CDS	2751778	2751871	.	-	.	transcript  "BG:DS02740.9"
Adh	std3	CDS	2752031	2752033	.	-	.	transcript  "BG:DS02740.9"
#
#
###
###
#
#
Adh	std3	start_codon	2749571	2749573	.	+	.	transcript  "BG:DS02740.8"
Adh	std3	stop_codon	2750866	2750868	.	+	.	transcript  "BG:DS02740.8"
Adh	std3	CDS	2749571	2749699	.	+	.	transcript  "BG:DS02740.8"
Adh	std3	CDS	2749753	2750868	.	+	.	transcript  "BG:DS02740.8"
#
#
###
###
#
#
Adh	std3	start_codon	2748570	2748572	.	-	.	transcript  "heix"
Adh	std3	stop_codon	2746815	2746817	.	-	.	transcript  "heix"
Adh	std3	CDS	2746815	2747453	.	-	.	transcript  "heix"
Adh	std3	CDS	2748132	2748572	.	-	.	transcript  "heix"
#
#
###
###
#
#
Adh	std3	start_codon	2743611	2743613	.	+	.	transcript  "l.2.35Fb"
Adh	std3	stop_codon	2745120	2745122	.	+	.	transcript  "l.2.35Fb"
Adh	std3	CDS	2743611	2745122	.	+	.	transcript  "l.2.35Fb"
#
#
###
###
#
#
Adh	std3	start_codon	2740542	2740544	.	+	.	transcript  "BG:DS02740.5"
Adh	std3	stop_codon	2741088	2741090	.	+	.	transcript  "BG:DS02740.5"
Adh	std3	CDS	2740542	2741090	.	+	.	transcript  "BG:DS02740.5"
#
#
###
###
#
#
Adh	std3	start_codon	2737704	2737706	.	+	.	transcript  "BG:DS02740.4"
Adh	std3	stop_codon	2740037	2740039	.	+	.	transcript  "BG:DS02740.4"
Adh	std3	CDS	2737704	2737731	.	+	.	transcript  "BG:DS02740.4"
Adh	std3	CDS	2737860	2738132	.	+	.	transcript  "BG:DS02740.4"
Adh	std3	CDS	2738403	2739461	.	+	.	transcript  "BG:DS02740.4"
Adh	std3	CDS	2739531	2740039	.	+	.	transcript  "BG:DS02740.4"
#
#
###
###
#
#
Adh	std3	start_codon	2736447	2736449	.	-	.	transcript  "crp"
Adh	std3	stop_codon	2714362	2714364	.	-	.	transcript  "crp"
Adh	std3	CDS	2714362	2714383	.	-	.	transcript  "crp"
Adh	std3	CDS	2714899	2716277	.	-	.	transcript  "crp"
Adh	std3	CDS	2728123	2728429	.	-	.	transcript  "crp"
Adh	std3	CDS	2736358	2736449	.	-	.	transcript  "crp"
#
#
###
###
#
#
Adh	std3	start_codon	2711460	2711462	.	+	.	transcript  "BG:DS02740.2"
Adh	std3	stop_codon	2712644	2712646	.	+	.	transcript  "BG:DS02740.2"
Adh	std3	CDS	2711460	2711538	.	+	.	transcript  "BG:DS02740.2"
Adh	std3	CDS	2711599	2711717	.	+	.	transcript  "BG:DS02740.2"
Adh	std3	CDS	2711781	2711853	.	+	.	transcript  "BG:DS02740.2"
Adh	std3	CDS	2711910	2712440	.	+	.	transcript  "BG:DS02740.2"
Adh	std3	CDS	2712522	2712646	.	+	.	transcript  "BG:DS02740.2"
#
#
###
###
#
#
Adh	std3	start_codon	2710763	2710765	.	-	.	transcript  "twe"
Adh	std3	stop_codon	2709485	2709487	.	-	.	transcript  "twe"
Adh	std3	CDS	2709485	2710765	.	-	.	transcript  "twe"
#
#
###
###
#
#
Adh	std3	start_codon	397669	397671	.	-	.	transcript  "anon-34Ea"
Adh	std3	stop_codon	393573	393575	.	-	.	transcript  "anon-34Ea"
Adh	std3	CDS	393573	393814	.	-	.	transcript  "anon-34Ea"
Adh	std3	CDS	393894	394052	.	-	.	transcript  "anon-34Ea"
Adh	std3	CDS	394383	395732	.	-	.	transcript  "anon-34Ea"
Adh	std3	CDS	395826	397468	.	-	.	transcript  "anon-34Ea"
Adh	std3	CDS	397532	397671	.	-	.	transcript  "anon-34Ea"
#
#
###
###
#
#
Adh	std3	start_codon	1988872	1988874	.	+	.	transcript  "lace"
Adh	std3	stop_codon	1993564	1993566	.	+	.	transcript  "lace"
Adh	std3	CDS	1988872	1989075	.	+	.	transcript  "lace"
Adh	std3	CDS	1991768	1992877	.	+	.	transcript  "lace"
Adh	std3	CDS	1992942	1993204	.	+	.	transcript  "lace"
Adh	std3	CDS	1993350	1993566	.	+	.	transcript  "lace"
#
#
###
###
#
#
Adh	std3	start_codon	1974488	1974490	.	+	.	transcript  "Tim17"
Adh	std3	stop_codon	1983853	1983855	.	+	.	transcript  "Tim17"
Adh	std3	CDS	1974488	1974989	.	+	.	transcript  "Tim17"
Adh	std3	CDS	1975874	1976154	.	+	.	transcript  "Tim17"
Adh	std3	CDS	1980350	1980517	.	+	.	transcript  "Tim17"
Adh	std3	CDS	1983142	1983399	.	+	.	transcript  "Tim17"
Adh	std3	CDS	1983628	1983855	.	+	.	transcript  "Tim17"
#
#
###
###
#
#
Adh	std3	start_codon	1967756	1967758	.	-	.	transcript  "sna"
Adh	std3	stop_codon	1966586	1966588	.	-	.	transcript  "sna"
Adh	std3	CDS	1966586	1967758	.	-	.	transcript  "sna"
#
#
###
###
#
#
Adh	std3	start_codon	2236081	2236083	.	+	.	transcript  "BG:DS02252.3"
Adh	std3	stop_codon	2241874	2241876	.	+	.	transcript  "BG:DS02252.3"
Adh	std3	CDS	2236081	2241876	.	+	.	transcript  "BG:DS02252.3"
#
#
###
###
#
#
Adh	std3	start_codon	2287431	2287433	.	-	.	transcript  "BG:DS02252.4"
Adh	std3	stop_codon	2286435	2286437	.	-	.	transcript  "BG:DS02252.4"
Adh	std3	CDS	2286435	2287433	.	-	.	transcript  "BG:DS02252.4"
#
#
###
###
#
#
Adh	std3	start_codon	2303448	2303450	.	+	.	transcript  "BG:DS02252.1"
Adh	std3	stop_codon	2304639	2304641	.	+	.	transcript  "BG:DS02252.1"
Adh	std3	CDS	2303448	2304641	.	+	.	transcript  "BG:DS02252.1"
#
#
###
###
#
#
Adh	std3	start_codon	1149062	1149064	.	-	.	transcript  "BG:DS09219.1"
Adh	std3	stop_codon	1146799	1146801	.	-	.	transcript  "BG:DS09219.1"
Adh	std3	CDS	1146799	1147106	.	-	.	transcript  "BG:DS09219.1"
Adh	std3	CDS	1147866	1148064	.	-	.	transcript  "BG:DS09219.1"
Adh	std3	CDS	1148478	1148530	.	-	.	transcript  "BG:DS09219.1"
Adh	std3	CDS	1148830	1149064	.	-	.	transcript  "BG:DS09219.1"
#
#
###
###
#
#
Adh	std3	start_codon	1414397	1414399	.	+	.	transcript  "BG:DS03323.1"
Adh	std3	stop_codon	1419916	1419918	.	+	.	transcript  "BG:DS03323.1"
Adh	std3	CDS	1414397	1418081	.	+	.	transcript  "BG:DS03323.1"
Adh	std3	CDS	1418142	1419321	.	+	.	transcript  "BG:DS03323.1"
Adh	std3	CDS	1419378	1419918	.	+	.	transcript  "BG:DS03323.1"
#
#
###
###
#
#
Adh	std3	start_codon	2428833	2428835	.	+	.	transcript  "BG:DS07486.2"
Adh	std3	stop_codon	2429379	2429381	.	+	.	transcript  "BG:DS07486.2"
Adh	std3	CDS	2428833	2429381	.	+	.	transcript  "BG:DS07486.2"
#
#
###
###
#
#
Adh	std3	start_codon	2398367	2398369	.	+	.	transcript  "BG:DS07486.5"
Adh	std3	stop_codon	2410392	2410394	.	+	.	transcript  "BG:DS07486.5"
Adh	std3	CDS	2398367	2398380	.	+	.	transcript  "BG:DS07486.5"
Adh	std3	CDS	2406425	2406634	.	+	.	transcript  "BG:DS07486.5"
Adh	std3	CDS	2407447	2407845	.	+	.	transcript  "BG:DS07486.5"
Adh	std3	CDS	2407960	2408288	.	+	.	transcript  "BG:DS07486.5"
Adh	std3	CDS	2410246	2410394	.	+	.	transcript  "BG:DS07486.5"
#
#
###
###
#
#
Adh	std3	start_codon	2392181	2392183	.	+	.	transcript  "BG:DS07486.4"
Adh	std3	stop_codon	2395321	2395323	.	+	.	transcript  "BG:DS07486.4"
Adh	std3	CDS	2392181	2392737	.	+	.	transcript  "BG:DS07486.4"
Adh	std3	CDS	2392800	2393095	.	+	.	transcript  "BG:DS07486.4"
Adh	std3	CDS	2393155	2393333	.	+	.	transcript  "BG:DS07486.4"
Adh	std3	CDS	2395174	2395323	.	+	.	transcript  "BG:DS07486.4"
#
#
###
###
#
#
Adh	std3	start_codon	2374085	2374087	.	+	.	transcript  "BG:DS07486.3"
Adh	std3	stop_codon	2376715	2376717	.	+	.	transcript  "BG:DS07486.3"
Adh	std3	CDS	2374085	2374294	.	+	.	transcript  "BG:DS07486.3"
Adh	std3	CDS	2374356	2376450	.	+	.	transcript  "BG:DS07486.3"
Adh	std3	CDS	2376677	2376717	.	+	.	transcript  "BG:DS07486.3"
#
#
###
###
#
#
Adh	std3	start_codon	1338783	1338785	.	-	.	transcript  "BG:DS03431.1"
Adh	std3	stop_codon	1334780	1334782	.	-	.	transcript  "BG:DS03431.1"
Adh	std3	CDS	1334780	1335024	.	-	.	transcript  "BG:DS03431.1"
Adh	std3	CDS	1335080	1335356	.	-	.	transcript  "BG:DS03431.1"
Adh	std3	CDS	1335416	1336157	.	-	.	transcript  "BG:DS03431.1"
Adh	std3	CDS	1336453	1336680	.	-	.	transcript  "BG:DS03431.1"
Adh	std3	CDS	1337668	1338007	.	-	.	transcript  "BG:DS03431.1"
Adh	std3	CDS	1338337	1338640	.	-	.	transcript  "BG:DS03431.1"
Adh	std3	CDS	1338702	1338785	.	-	.	transcript  "BG:DS03431.1"
#
#
###
###
#
#
Adh	std3	start_codon	1369280	1369282	.	-	.	transcript  "Mst35Ba"
Adh	std3	stop_codon	1368793	1368795	.	-	.	transcript  "Mst35Ba"
Adh	std3	CDS	1368793	1368852	.	-	.	transcript  "Mst35Ba"
Adh	std3	CDS	1368902	1369282	.	-	.	transcript  "Mst35Ba"
#
#
###
###
#
#
Adh	std3	start_codon	1372349	1372351	.	-	.	transcript  "Mst35Bb"
Adh	std3	stop_codon	1371813	1371815	.	-	.	transcript  "Mst35Bb"
Adh	std3	CDS	1371813	1371921	.	-	.	transcript  "Mst35Bb"
Adh	std3	CDS	1372020	1372351	.	-	.	transcript  "Mst35Bb"
#
#
###
###
#
#
Adh	std3	start_codon	1413065	1413067	.	-	.	transcript  "BG:DS03144.1"
Adh	std3	stop_codon	1398183	1398185	.	-	.	transcript  "BG:DS03144.1"
Adh	std3	CDS	1398183	1398833	.	-	.	transcript  "BG:DS03144.1"
Adh	std3	CDS	1401633	1401874	.	-	.	transcript  "BG:DS03144.1"
Adh	std3	CDS	1402535	1402643	.	-	.	transcript  "BG:DS03144.1"
Adh	std3	CDS	1402808	1402995	.	-	.	transcript  "BG:DS03144.1"
Adh	std3	CDS	1403930	1404111	.	-	.	transcript  "BG:DS03144.1"
Adh	std3	CDS	1405762	1405903	.	-	.	transcript  "BG:DS03144.1"
Adh	std3	CDS	1406801	1406882	.	-	.	transcript  "BG:DS03144.1"
Adh	std3	CDS	1407035	1407146	.	-	.	transcript  "BG:DS03144.1"
Adh	std3	CDS	1408830	1408932	.	-	.	transcript  "BG:DS03144.1"
Adh	std3	CDS	1411600	1411759	.	-	.	transcript  "BG:DS03144.1"
Adh	std3	CDS	1412611	1412741	.	-	.	transcript  "BG:DS03144.1"
Adh	std3	CDS	1413022	1413067	.	-	.	transcript  "BG:DS03144.1"
#
#
###
###
#
#
Adh	std3	start_codon	1111283	1111285	.	+	.	transcript  "Adhr"
Adh	std3	stop_codon	1112575	1112577	.	+	.	transcript  "Adhr"
Adh	std3	CDS	1111283	1111378	.	+	.	transcript  "Adhr"
Adh	std3	CDS	1111805	1112209	.	+	.	transcript  "Adhr"
Adh	std3	CDS	1112231	1112575	.	+	.	transcript  "Adhr"
#
#
###
###
#
#
Adh	std3	start_codon	1110074	1110076	.	+	.	transcript  "Adh"
Adh	std3	stop_codon	1110976	1110978	.	+	.	transcript  "Adh"
Adh	std3	CDS	1110074	1110172	.	+	.	transcript  "Adh"
Adh	std3	CDS	1110241	1110642	.	+	.	transcript  "Adh"
Adh	std3	CDS	1110713	1110976	.	+	.	transcript  "Adh"
#
#
###
###
#
#
Adh	std3	start_codon	1098516	1098518	.	-	.	transcript  "osp-LD14119"
Adh	std3	stop_codon	1094605	1094607	.	-	.	transcript  "osp-LD14119"
Adh	std3	CDS	1094605	1094610	.	-	.	transcript  "osp-LD14119"
Adh	std3	CDS	1095422	1095533	.	-	.	transcript  "osp-LD14119"
Adh	std3	CDS	1095586	1095735	.	-	.	transcript  "osp-LD14119"
Adh	std3	CDS	1095848	1095987	.	-	.	transcript  "osp-LD14119"
Adh	std3	CDS	1096062	1096196	.	-	.	transcript  "osp-LD14119"
Adh	std3	CDS	1096326	1098518	.	-	.	transcript  "osp-LD14119"
#
#
###
###
#
#
Adh	std3	start_codon	1057312	1057314	.	-	.	transcript  "BG:DS01486.1"
Adh	std3	stop_codon	1051748	1051750	.	-	.	transcript  "BG:DS01486.1"
Adh	std3	CDS	1051748	1051953	.	-	.	transcript  "BG:DS01486.1"
Adh	std3	CDS	1056915	1057314	.	-	.	transcript  "BG:DS01486.1"
#
#
###
###
#
#
Adh	std3	start_codon	855885	855887	.	+	.	transcript  "spel1"
Adh	std3	stop_codon	858964	858966	.	+	.	transcript  "spel1"
Adh	std3	CDS	855885	855923	.	+	.	transcript  "spel1"
Adh	std3	CDS	855983	855997	.	+	.	transcript  "spel1"
Adh	std3	CDS	855999	856031	.	+	.	transcript  "spel1"
Adh	std3	CDS	856092	856876	.	+	.	transcript  "spel1"
Adh	std3	CDS	856942	858028	.	+	.	transcript  "spel1"
Adh	std3	CDS	858108	858341	.	+	.	transcript  "spel1"
Adh	std3	CDS	858346	858966	.	+	.	transcript  "spel1"
#
#
###
###
#
#
Adh	std3	start_codon	2199762	2199764	.	-	.	transcript  "CycE-type2"
Adh	std3	stop_codon	2182498	2182500	.	-	.	transcript  "CycE-type2"
Adh	std3	CDS	2182500	2182662	.	-	.	transcript  "CycE-type2"
Adh	std3	CDS	2189454	2189790	.	-	.	transcript  "CycE-type2"
Adh	std3	CDS	2192599	2192735	.	-	.	transcript  "CycE-type2"
Adh	std3	CDS	2199660	2199764	.	-	.	transcript  "CycE-type2"
#
#
###
###
#
#
Adh	std3	start_codon	2918518	2918520	.	-	.	transcript  "dac-3prime"
Adh	std3	stop_codon	2916879	2916881	.	-	.	transcript  "dac-3prime"
Adh	std3	CDS	2916879	2917012	.	-	.	transcript  "dac-3prime"
Adh	std3	CDS	2917311	2917504	.	-	.	transcript  "dac-3prime"
Adh	std3	CDS	2917751	2917988	.	-	.	transcript  "dac-3prime"
Adh	std3	CDS	2918253	2918520	.	-	.	transcript  "dac-3prime"
#
#
###
###
#
#
Adh	std3	start_codon	1558057	1558059	.	+	.	transcript  "vas"
Adh	std3	stop_codon	1563812	1563814	.	+	.	transcript  "vas"
Adh	std3	CDS	1558057	1558080	.	+	.	transcript  "vas"
Adh	std3	CDS	1558134	1558526	.	+	.	transcript  "vas"
Adh	std3	CDS	1561988	1562050	.	+	.	transcript  "vas"
Adh	std3	CDS	1562027	1562278	.	+	.	transcript  "vas"
Adh	std3	CDS	1562338	1563081	.	+	.	transcript  "vas"
Adh	std3	CDS	1563140	1563353	.	+	.	transcript  "vas"
Adh	std3	CDS	1563418	1563689	.	+	.	transcript  "vas"
Adh	std3	CDS	1563761	1563814	.	+	.	transcript  "vas"
#
#
###
###
#
#
Adh	std3	start_codon	2390106	2390108	.	-	.	transcript  "beat-B"
Adh	std3	stop_codon	2356352	2356354	.	-	.	transcript  "beat-B"
Adh	std3	CDS	2356352	2356488	.	-	.	transcript  "beat-B"
Adh	std3	CDS	2356993	2357164	.	-	.	transcript  "beat-B"
Adh	std3	CDS	2357224	2357480	.	-	.	transcript  "beat-B"
Adh	std3	CDS	2357539	2357674	.	-	.	transcript  "beat-B"
Adh	std3	CDS	2358742	2358950	.	-	.	transcript  "beat-B"
Adh	std3	CDS	2390039	2390108	.	-	.	transcript  "beat-B"
#
#
###
###
#
#
Adh	std3	start_codon	2463394	2463396	.	+	.	transcript  "beat-C"
Adh	std3	stop_codon	2488787	2488789	.	+	.	transcript  "beat-C"
Adh	std3	CDS	2463394	2463547	.	+	.	transcript  "beat-C"
Adh	std3	CDS	2481639	2481850	.	+	.	transcript  "beat-C"
Adh	std3	CDS	2483447	2483582	.	+	.	transcript  "beat-C"
Adh	std3	CDS	2483839	2483972	.	+	.	transcript  "beat-C"
Adh	std3	CDS	2486400	2486522	.	+	.	transcript  "beat-C"
Adh	std3	CDS	2486596	2486785	.	+	.	transcript  "beat-C"
Adh	std3	CDS	2488134	2488789	.	+	.	transcript  "beat-C"
#
#
###
###
#
#
Adh	std3	start_codon	1182413	1182415	.	-	.	transcript  "osp"
Adh	std3	stop_codon	1094414	1094416	.	-	.	transcript  "osp"
Adh	std3	CDS	1094414	1094610	.	-	.	transcript  "osp"
Adh	std3	CDS	1094867	1095215	.	-	.	transcript  "osp"
Adh	std3	CDS	1095422	1095533	.	-	.	transcript  "osp"
Adh	std3	CDS	1095586	1095735	.	-	.	transcript  "osp"
Adh	std3	CDS	1095848	1095987	.	-	.	transcript  "osp"
Adh	std3	CDS	1096062	1096196	.	-	.	transcript  "osp"
Adh	std3	CDS	1096326	1098979	.	-	.	transcript  "osp"
Adh	std3	CDS	1104419	1104995	.	-	.	transcript  "osp"
Adh	std3	CDS	1105586	1105651	.	-	.	transcript  "osp"
Adh	std3	CDS	1129815	1129900	.	-	.	transcript  "osp"
Adh	std3	CDS	1182202	1182415	.	-	.	transcript  "osp"
#
#
###
###
#
#
Adh	std3	start_codon	691414	691416	.	-	.	transcript  "smi35A"
Adh	std3	stop_codon	679874	679876	.	-	.	transcript  "smi35A"
Adh	std3	CDS	679874	680889	.	-	.	transcript  "smi35A"
Adh	std3	CDS	682600	682771	.	-	.	transcript  "smi35A"
Adh	std3	CDS	682831	682969	.	-	.	transcript  "smi35A"
Adh	std3	CDS	689469	689746	.	-	.	transcript  "smi35A"
Adh	std3	CDS	689811	689983	.	-	.	transcript  "smi35A"
Adh	std3	CDS	690663	691029	.	-	.	transcript  "smi35A"
Adh	std3	CDS	691393	691416	.	-	.	transcript  "smi35A"
#
#
###
###
#
#
Adh	std3	start_codon	373286	373288	.	+	.	transcript  "BG:DS08220.1"
Adh	std3	stop_codon	391498	391500	.	+	.	transcript  "BG:DS08220.1"
Adh	std3	CDS	373286	373457	.	+	.	transcript  "BG:DS08220.1"
Adh	std3	CDS	385048	385283	.	+	.	transcript  "BG:DS08220.1"
Adh	std3	CDS	388780	388921	.	+	.	transcript  "BG:DS08220.1"
Adh	std3	CDS	389006	389140	.	+	.	transcript  "BG:DS08220.1"
Adh	std3	CDS	389208	390491	.	+	.	transcript  "BG:DS08220.1"
Adh	std3	CDS	390556	390673	.	+	.	transcript  "BG:DS08220.1"
Adh	std3	CDS	390737	391112	.	+	.	transcript  "BG:DS08220.1"
Adh	std3	CDS	391177	391500	.	+	.	transcript  "BG:DS08220.1"
#
#
###
###
#
#
Adh	std3	start_codon	509545	509547	.	+	.	transcript  "BG:DS01514.2"
Adh	std3	stop_codon	512756	512758	.	+	.	transcript  "BG:DS01514.2"
Adh	std3	CDS	509545	509783	.	+	.	transcript  "BG:DS01514.2"
Adh	std3	CDS	509881	510226	.	+	.	transcript  "BG:DS01514.2"
Adh	std3	CDS	510287	510786	.	+	.	transcript  "BG:DS01514.2"
Adh	std3	CDS	511784	512375	.	+	.	transcript  "BG:DS01514.2"
Adh	std3	CDS	512435	512758	.	+	.	transcript  "BG:DS01514.2"
#
#
###
###
#
#
Adh	std3	start_codon	1473633	1473635	.	-	.	transcript  "BG:DS01219.1"
Adh	std3	stop_codon	1465977	1465979	.	-	.	transcript  "BG:DS01219.1"
Adh	std3	CDS	1465977	1466019	.	-	.	transcript  "BG:DS01219.1"
Adh	std3	CDS	1466153	1466744	.	-	.	transcript  "BG:DS01219.1"
Adh	std3	CDS	1466876	1467307	.	-	.	transcript  "BG:DS01219.1"
Adh	std3	CDS	1473611	1473635	.	-	.	transcript  "BG:DS01219.1"
#
#
###
###
#
#
Adh	std3	start_codon	400338	400340	.	+	.	transcript  "Ance"
Adh	std3	stop_codon	402858	402860	.	+	.	transcript  "Ance"
Adh	std3	CDS	400338	400922	.	+	.	transcript  "Ance"
Adh	std3	CDS	401343	401713	.	+	.	transcript  "Ance"
Adh	std3	CDS	401775	402341	.	+	.	transcript  "Ance"
Adh	std3	CDS	402399	402539	.	+	.	transcript  "Ance"
Adh	std3	CDS	402607	402779	.	+	.	transcript  "Ance"
Adh	std3	CDS	402844	402860	.	+	.	transcript  "Ance"
#
#
###
###
#
#
Adh	std3	start_codon	7016	7018	.	-	.	transcript  "B4-5prime"
Adh	std3	stop_codon	-1	1	.	-	.	transcript  "B4-5prime"
Adh	std3	CDS	1	441	.	-	.	transcript  "B4-5prime"
Adh	std3	CDS	2379	2862	.	-	.	transcript  "B4-5prime"
Adh	std3	CDS	3225	3550	.	-	.	transcript  "B4-5prime"
Adh	std3	CDS	6718	7018	.	-	.	transcript  "B4-5prime"
#
#
###
###
#
#
Adh	std3	start_codon	757457	757459	.	+	.	transcript  "wb"
Adh	std3	stop_codon	821485	821487	.	+	.	transcript  "wb"
Adh	std3	CDS	757457	757859	.	+	.	transcript  "wb"
Adh	std3	CDS	771955	772295	.	+	.	transcript  "wb"
Adh	std3	CDS	779692	781583	.	+	.	transcript  "wb"
Adh	std3	CDS	781886	782694	.	+	.	transcript  "wb"
Adh	std3	CDS	813291	814650	.	+	.	transcript  "wb"
Adh	std3	CDS	814726	814981	.	+	.	transcript  "wb"
Adh	std3	CDS	815046	815442	.	+	.	transcript  "wb"
Adh	std3	CDS	815528	817215	.	+	.	transcript  "wb"
Adh	std3	CDS	817273	818025	.	+	.	transcript  "wb"
Adh	std3	CDS	818086	818367	.	+	.	transcript  "wb"
Adh	std3	CDS	818447	818574	.	+	.	transcript  "wb"
Adh	std3	CDS	818633	819290	.	+	.	transcript  "wb"
Adh	std3	CDS	820171	820789	.	+	.	transcript  "wb"
Adh	std3	CDS	820846	820979	.	+	.	transcript  "wb"
Adh	std3	CDS	821037	821265	.	+	.	transcript  "wb"
Adh	std3	CDS	821333	821487	.	+	.	transcript  "wb"
#
#
###
###
#
#
Adh	std3	start_codon	487234	487236	.	-	.	transcript  "rk"
Adh	std3	stop_codon	477171	477173	.	-	.	transcript  "rk"
Adh	std3	CDS	477171	477490	.	-	.	transcript  "rk"
Adh	std3	CDS	477548	479329	.	-	.	transcript  "rk"
Adh	std3	CDS	479386	479783	.	-	.	transcript  "rk"
Adh	std3	CDS	479815	479958	.	-	.	transcript  "rk"
Adh	std3	CDS	480147	480287	.	-	.	transcript  "rk"
Adh	std3	CDS	480343	480480	.	-	.	transcript  "rk"
Adh	std3	CDS	481570	481638	.	-	.	transcript  "rk"
Adh	std3	CDS	483386	483457	.	-	.	transcript  "rk"
Adh	std3	CDS	484195	484338	.	-	.	transcript  "rk"
Adh	std3	CDS	484664	484806	.	-	.	transcript  "rk"
Adh	std3	CDS	486685	487236	.	-	.	transcript  "rk"
#
#
###


#
# compfly: 1. Only grailexp CDSes extracted Jul 5 (MR)
#          2. grailexp "exons" renamed to "CDS" Jul 5 (MR)
#
Adh	grailexp	CDS	2	441	0.97	-	2	transcript "286"
Adh	grailexp	CDS	2379	2862	0.99	-	0	transcript "286"
Adh	grailexp	CDS	3225	3550	0.99	-	2	transcript "286"
Adh	grailexp	CDS	6718	7051	0.10	-	0	transcript "286"
Adh	grailexp	CDS	10137	10220	0.24	-	2	transcript "285"
Adh	grailexp	CDS	12308	12333	0.14	-	2	transcript "285"
Adh	grailexp	CDS	28665	28784	1.00	-	0	transcript "285"
Adh	grailexp	CDS	40669	40919	1.00	-	0	transcript "285"
Adh	grailexp	CDS	41509	41534	0.88	-	1	transcript "285"
Adh	grailexp	CDS	43919	44175	0.93	+	1	transcript "1"
Adh	grailexp	CDS	50851	50863	0.23	+	0	transcript "2"
Adh	grailexp	CDS	52555	52587	0.92	+	0	transcript "2"
Adh	grailexp	CDS	103543	103739	1.00	+	2	transcript "2"
Adh	grailexp	CDS	103808	104330	0.99	+	0	transcript "2"
Adh	grailexp	CDS	124458	124936	0.96	+	2	transcript "2"
Adh	grailexp	CDS	127146	127292	0.99	+	2	transcript "2"
Adh	grailexp	CDS	127771	127931	0.94	+	1	transcript "2"
Adh	grailexp	CDS	127991	128225	0.98	+	2	transcript "2"
Adh	grailexp	CDS	128296	129342	1.08	+	2	transcript "2"
Adh	grailexp	CDS	129401	129965	0.95	+	0	transcript "2"
Adh	grailexp	CDS	130136	130595	0.99	+	1	transcript "2"
Adh	grailexp	CDS	130996	131248	0.25	+	2	transcript "2"
Adh	grailexp	CDS	133608	134233	0.96	-	2	transcript "284"
Adh	grailexp	CDS	134862	134967	0.90	-	0	transcript "284"
Adh	grailexp	CDS	144038	144192	0.44	-	0	transcript "283"
Adh	grailexp	CDS	152142	152293	0.11	-	1	transcript "283"
Adh	grailexp	CDS	159578	160063	0.39	+	2	transcript "3"
Adh	grailexp	CDS	161881	162105	0.45	+	2	transcript "4"
Adh	grailexp	CDS	162442	162557	0.47	+	2	transcript "4"
Adh	grailexp	CDS	162616	163137	0.91	+	2	transcript "4"
Adh	grailexp	CDS	164190	164417	0.84	+	2	transcript "4"
Adh	grailexp	CDS	165423	165438	0.27	+	0	transcript "5"
Adh	grailexp	CDS	172385	172503	0.01	+	2	transcript "5"
Adh	grailexp	CDS	177956	178015	0.46	-	0	transcript "282"
Adh	grailexp	CDS	178136	178300	0.09	-	0	transcript "282"
Adh	grailexp	CDS	181272	181409	0.47	-	0	transcript "282"
Adh	grailexp	CDS	182855	182865	0.39	-	1	transcript "282"
Adh	grailexp	CDS	183099	183496	0.15	-	2	transcript "281"
Adh	grailexp	CDS	183596	183635	0.47	-	0	transcript "281"
Adh	grailexp	CDS	183699	183764	0.47	-	2	transcript "281"
Adh	grailexp	CDS	183835	184040	0.47	-	2	transcript "281"
Adh	grailexp	CDS	184241	184282	0.47	-	0	transcript "281"
Adh	grailexp	CDS	197142	197159	0.00	+	2	transcript "6"
Adh	grailexp	CDS	198043	198089	0.00	+	1	transcript "6"
Adh	grailexp	CDS	199993	200101	0.14	+	2	transcript "6"
Adh	grailexp	CDS	202128	202655	0.40	+	2	transcript "7"
Adh	grailexp	CDS	203783	204199	0.18	+	2	transcript "8"
Adh	grailexp	CDS	207689	207889	0.23	-	2	transcript "280"
Adh	grailexp	CDS	216144	216781	0.35	-	2	transcript "279"
Adh	grailexp	CDS	216896	217226	0.98	-	0	transcript "279"
Adh	grailexp	CDS	224554	224563	0.42	+	0	transcript "9"
Adh	grailexp	CDS	228521	228608	0.01	+	1	transcript "9"
Adh	grailexp	CDS	229799	230462	0.41	+	2	transcript "9"
Adh	grailexp	CDS	233922	233943	0.04	+	0	transcript "10"
Adh	grailexp	CDS	235893	235948	0.40	+	2	transcript "10"
Adh	grailexp	CDS	236671	236983	0.38	+	0	transcript "11"
Adh	grailexp	CDS	240124	240236	0.13	+	2	transcript "11"
Adh	grailexp	CDS	260540	260687	0.27	+	0	transcript "12"
Adh	grailexp	CDS	264891	264997	0.98	+	2	transcript "12"
Adh	grailexp	CDS	265088	265825	0.93	+	2	transcript "12"
Adh	grailexp	CDS	265946	266322	0.93	+	1	transcript "13"
Adh	grailexp	CDS	266392	266619	0.93	+	1	transcript "13"
Adh	grailexp	CDS	266684	266876	0.01	+	2	transcript "13"
Adh	grailexp	CDS	267633	267650	0.21	+	2	transcript "14"
Adh	grailexp	CDS	274487	274515	0.90	+	1	transcript "14"
Adh	grailexp	CDS	274618	275276	0.98	+	0	transcript "14"
Adh	grailexp	CDS	276806	276954	0.17	+	2	transcript "14"
Adh	grailexp	CDS	277921	278103	0.14	+	2	transcript "15"
Adh	grailexp	CDS	278222	278345	0.40	+	0	transcript "15"
Adh	grailexp	CDS	278537	278737	0.46	+	0	transcript "15"
Adh	grailexp	CDS	278802	279280	0.00	+	2	transcript "15"
Adh	grailexp	CDS	280043	280339	0.34	+	2	transcript "16"
Adh	grailexp	CDS	280420	280610	0.10	+	1	transcript "17"
Adh	grailexp	CDS	280674	280986	0.47	+	2	transcript "17"
Adh	grailexp	CDS	281550	281787	0.46	+	0	transcript "17"
Adh	grailexp	CDS	281848	282471	0.90	+	0	transcript "17"
Adh	grailexp	CDS	282539	283030	0.88	+	0	transcript "17"
Adh	grailexp	CDS	283112	283545	0.21	+	2	transcript "17"
Adh	grailexp	CDS	283609	284052	0.43	+	2	transcript "18"
Adh	grailexp	CDS	285426	286886	1.28	+	2	transcript "19"
Adh	grailexp	CDS	287629	288379	0.81	+	0	transcript "20"
Adh	grailexp	CDS	288647	292689	1.47	+	2	transcript "20"
Adh	grailexp	CDS	292759	292896	0.20	+	2	transcript "20"
Adh	grailexp	CDS	302782	303519	0.85	-	2	transcript "278"
Adh	grailexp	CDS	304326	305201	1.26	-	2	transcript "277"
Adh	grailexp	CDS	305782	306108	0.41	+	2	transcript "21"
Adh	grailexp	CDS	306230	306385	0.40	+	2	transcript "21"
Adh	grailexp	CDS	307965	309056	0.98	+	2	transcript "22"
Adh	grailexp	CDS	309110	309467	0.98	+	0	transcript "22"
Adh	grailexp	CDS	309530	310452	1.19	+	2	transcript "22"
Adh	grailexp	CDS	310517	311365	1.19	+	2	transcript "22"
Adh	grailexp	CDS	311428	312318	1.19	+	2	transcript "22"
Adh	grailexp	CDS	312387	313020	0.98	+	0	transcript "22"
Adh	grailexp	CDS	313086	313533	0.99	+	1	transcript "22"
Adh	grailexp	CDS	315138	315899	1.14	+	2	transcript "23"
Adh	grailexp	CDS	316433	316800	1.00	+	1	transcript "23"
Adh	grailexp	CDS	316865	317645	0.99	+	2	transcript "23"
Adh	grailexp	CDS	317891	318548	0.40	-	2	transcript "276"
Adh	grailexp	CDS	318608	319430	1.46	-	1	transcript "276"
Adh	grailexp	CDS	319486	321442	1.41	-	0	transcript "276"
Adh	grailexp	CDS	321967	323027	1.09	-	2	transcript "275"
Adh	grailexp	CDS	323097	323169	0.85	-	0	transcript "275"
Adh	grailexp	CDS	323788	324885	1.19	+	2	transcript "24"
Adh	grailexp	CDS	324939	325181	0.97	+	2	transcript "24"
Adh	grailexp	CDS	325801	326007	0.01	+	2	transcript "24"
Adh	grailexp	CDS	327175	328002	1.46	+	2	transcript "25"
Adh	grailexp	CDS	328076	328279	0.34	+	2	transcript "26"
Adh	grailexp	CDS	328788	328808	0.15	+	2	transcript "27"
Adh	grailexp	CDS	329781	330245	0.34	+	2	transcript "27"
Adh	grailexp	CDS	334589	334786	0.96	-	2	transcript "274"
Adh	grailexp	CDS	334847	335125	0.94	-	2	transcript "274"
Adh	grailexp	CDS	335195	335261	0.94	-	2	transcript "274"
Adh	grailexp	CDS	336668	337323	0.41	-	2	transcript "273"
Adh	grailexp	CDS	337379	337457	0.35	-	0	transcript "273"
Adh	grailexp	CDS	338167	338879	0.94	-	2	transcript "272"
Adh	grailexp	CDS	338944	339013	0.83	-	0	transcript "272"
Adh	grailexp	CDS	340529	340634	0.97	+	0	transcript "28"
Adh	grailexp	CDS	340705	340870	0.99	+	1	transcript "28"
Adh	grailexp	CDS	340926	341235	0.99	+	2	transcript "28"
Adh	grailexp	CDS	341311	341517	0.01	+	2	transcript "29"
Adh	grailexp	CDS	341713	341857	0.96	+	0	transcript "30"
Adh	grailexp	CDS	342003	342751	0.94	+	2	transcript "30"
Adh	grailexp	CDS	343169	343368	0.97	+	1	transcript "31"
Adh	grailexp	CDS	343432	343984	0.91	+	2	transcript "31"
Adh	grailexp	CDS	360105	360259	0.29	-	2	transcript "271"
Adh	grailexp	CDS	366840	366849	0.27	-	0	transcript "271"
Adh	grailexp	CDS	373286	373501	0.25	+	2	transcript "32"
Adh	grailexp	CDS	379118	379228	0.43	+	2	transcript "33"
Adh	grailexp	CDS	384164	384285	0.00	+	1	transcript "33"
Adh	grailexp	CDS	385067	385283	0.42	+	2	transcript "33"
Adh	grailexp	CDS	388780	388921	0.47	+	0	transcript "33"
Adh	grailexp	CDS	389006	389140	0.42	+	0	transcript "33"
Adh	grailexp	CDS	389208	390491	1.44	+	0	transcript "33"
Adh	grailexp	CDS	390556	390673	0.47	+	1	transcript "33"
Adh	grailexp	CDS	390737	391112	0.94	+	2	transcript "33"
Adh	grailexp	CDS	391177	391500	0.97	+	2	transcript "33"
Adh	grailexp	CDS	393573	393814	0.26	-	2	transcript "270"
Adh	grailexp	CDS	393894	394052	0.47	-	0	transcript "270"
Adh	grailexp	CDS	394383	395732	1.47	-	0	transcript "270"
Adh	grailexp	CDS	396240	397468	0.88	-	0	transcript "270"
Adh	grailexp	CDS	397532	397682	0.99	-	1	transcript "270"
Adh	grailexp	CDS	398149	398170	0.86	-	0	transcript "270"
Adh	grailexp	CDS	399405	399469	0.94	+	2	transcript "34"
Adh	grailexp	CDS	400317	400923	1.00	+	0	transcript "34"
Adh	grailexp	CDS	401350	401713	0.98	+	1	transcript "34"
Adh	grailexp	CDS	401775	402341	0.98	+	1	transcript "34"
Adh	grailexp	CDS	402399	402539	0.98	+	1	transcript "34"
Adh	grailexp	CDS	402607	402779	0.99	+	0	transcript "34"
Adh	grailexp	CDS	402844	402923	0.96	+	2	transcript "34"
Adh	grailexp	CDS	403468	404414	1.45	+	1	transcript "35"
Adh	grailexp	CDS	404467	405027	0.45	+	1	transcript "35"
Adh	grailexp	CDS	405085	405391	0.41	+	2	transcript "35"
Adh	grailexp	CDS	405952	406314	0.38	+	2	transcript "36"
Adh	grailexp	CDS	408759	409001	0.17	+	2	transcript "37"
Adh	grailexp	CDS	409150	409656	0.20	+	2	transcript "37"
Adh	grailexp	CDS	410157	410315	0.47	+	2	transcript "37"
Adh	grailexp	CDS	410372	410612	0.46	+	0	transcript "37"
Adh	grailexp	CDS	410677	411479	0.24	+	2	transcript "37"
Adh	grailexp	CDS	415576	416211	0.41	-	2	transcript "269"
Adh	grailexp	CDS	416276	416749	0.44	-	2	transcript "269"
Adh	grailexp	CDS	417100	417111	0.39	-	2	transcript "269"
Adh	grailexp	CDS	426746	427525	1.52	-	2	transcript "268"
Adh	grailexp	CDS	438979	439790	1.10	-	2	transcript "267"
Adh	grailexp	CDS	440839	440877	0.93	-	0	transcript "267"
Adh	grailexp	CDS	441148	441210	0.94	-	0	transcript "267"
Adh	grailexp	CDS	448467	448607	0.46	+	1	transcript "38"
Adh	grailexp	CDS	449015	449330	0.41	+	2	transcript "38"
Adh	grailexp	CDS	451600	451902	0.43	+	2	transcript "39"
Adh	grailexp	CDS	454581	454771	0.15	+	1	transcript "39"
Adh	grailexp	CDS	454999	455702	0.46	+	0	transcript "39"
Adh	grailexp	CDS	455870	456267	0.40	+	2	transcript "39"
Adh	grailexp	CDS	457298	457488	0.97	+	1	transcript "40"
Adh	grailexp	CDS	457649	458210	0.94	+	2	transcript "40"
Adh	grailexp	CDS	458837	459146	0.94	-	2	transcript "266"
Adh	grailexp	CDS	459225	459761	0.97	-	1	transcript "266"
Adh	grailexp	CDS	460256	460674	0.96	-	1	transcript "266"
Adh	grailexp	CDS	462092	462584	0.41	-	2	transcript "265"
Adh	grailexp	CDS	462646	463209	0.87	-	1	transcript "265"
Adh	grailexp	CDS	463368	463710	0.99	-	1	transcript "265"
Adh	grailexp	CDS	464878	465028	0.02	-	0	transcript "265"
Adh	grailexp	CDS	466308	466360	0.40	-	2	transcript "264"
Adh	grailexp	CDS	467993	469610	1.40	-	0	transcript "264"
Adh	grailexp	CDS	471217	471296	0.95	+	1	transcript "41"
Adh	grailexp	CDS	471441	471687	1.00	+	2	transcript "41"
Adh	grailexp	CDS	471752	471856	0.98	+	2	transcript "41"
Adh	grailexp	CDS	471944	472072	0.93	+	2	transcript "41"
Adh	grailexp	CDS	472557	472823	0.47	+	0	transcript "41"
Adh	grailexp	CDS	472965	473128	0.41	+	2	transcript "41"
Adh	grailexp	CDS	474097	474189	0.43	+	2	transcript "42"
Adh	grailexp	CDS	474251	474306	0.42	+	1	transcript "42"
Adh	grailexp	CDS	474365	475283	1.44	+	2	transcript "42"
Adh	grailexp	CDS	475427	476389	1.41	+	2	transcript "42"
Adh	grailexp	CDS	477516	479329	1.25	-	2	transcript "263"
Adh	grailexp	CDS	479386	479753	0.43	-	0	transcript "263"
Adh	grailexp	CDS	479815	479958	0.47	-	1	transcript "263"
Adh	grailexp	CDS	480147	480287	0.23	-	1	transcript "263"
Adh	grailexp	CDS	480343	480480	0.20	-	1	transcript "263"
Adh	grailexp	CDS	481570	481638	0.47	-	1	transcript "263"
Adh	grailexp	CDS	484191	484338	0.40	-	2	transcript "262"
Adh	grailexp	CDS	484664	484807	0.07	-	1	transcript "262"
Adh	grailexp	CDS	485391	485462	0.43	-	1	transcript "262"
Adh	grailexp	CDS	486686	487236	0.43	-	1	transcript "262"
Adh	grailexp	CDS	497485	497503	0.12	+	0	transcript "43"
Adh	grailexp	CDS	498635	499041	0.20	+	2	transcript "43"
Adh	grailexp	CDS	510550	510756	0.11	-	2	transcript "261"
Adh	grailexp	CDS	511962	512174	0.35	-	2	transcript "260"
Adh	grailexp	CDS	513238	514050	1.44	-	2	transcript "259"
Adh	grailexp	CDS	520781	521854	1.43	+	2	transcript "44"
Adh	grailexp	CDS	522083	522988	1.46	+	2	transcript "45"
Adh	grailexp	CDS	523495	523560	0.01	+	2	transcript "46"
Adh	grailexp	CDS	528139	528231	0.14	+	2	transcript "46"
Adh	grailexp	CDS	533735	533935	0.32	-	2	transcript "258"
Adh	grailexp	CDS	541380	542513	0.68	+	2	transcript "47"
Adh	grailexp	CDS	550841	550865	0.10	+	0	transcript "48"
Adh	grailexp	CDS	555313	555854	0.33	+	2	transcript "48"
Adh	grailexp	CDS	555938	556001	0.85	+	1	transcript "49"
Adh	grailexp	CDS	558033	558061	0.82	+	0	transcript "49"
Adh	grailexp	CDS	562333	562460	0.01	+	2	transcript "49"
Adh	grailexp	CDS	566659	566706	0.10	+	2	transcript "50"
Adh	grailexp	CDS	570329	570745	0.81	+	2	transcript "50"
Adh	grailexp	CDS	574810	574871	0.45	+	1	transcript "51"
Adh	grailexp	CDS	575409	575495	0.46	+	0	transcript "51"
Adh	grailexp	CDS	593768	594158	0.17	+	1	transcript "51"
Adh	grailexp	CDS	596802	596826	0.20	+	2	transcript "51"
Adh	grailexp	CDS	598466	598796	0.17	+	0	transcript "51"
Adh	grailexp	CDS	598857	599119	0.07	+	2	transcript "51"
Adh	grailexp	CDS	599219	600433	1.26	+	2	transcript "51"
Adh	grailexp	CDS	602240	602541	0.99	-	1	transcript "257"
Adh	grailexp	CDS	602686	602889	1.00	-	2	transcript "257"
Adh	grailexp	CDS	602944	603000	0.80	-	2	transcript "257"
Adh	grailexp	CDS	603442	604269	0.26	-	2	transcript "256"
Adh	grailexp	CDS	607042	607320	0.10	-	2	transcript "256"
Adh	grailexp	CDS	615930	615946	0.14	+	1	transcript "52"
Adh	grailexp	CDS	618724	618820	0.29	+	2	transcript "52"
Adh	grailexp	CDS	635696	636034	0.35	-	2	transcript "255"
Adh	grailexp	CDS	639175	639609	0.35	+	2	transcript "53"
Adh	grailexp	CDS	650611	651153	0.47	+	2	transcript "54"
Adh	grailexp	CDS	651278	651478	0.46	+	2	transcript "54"
Adh	grailexp	CDS	651583	652290	0.41	+	2	transcript "54"
Adh	grailexp	CDS	652417	652824	0.46	+	2	transcript "55"
Adh	grailexp	CDS	657691	658001	0.41	-	2	transcript "254"
Adh	grailexp	CDS	658058	658265	0.47	-	0	transcript "254"
Adh	grailexp	CDS	658326	658463	0.47	-	2	transcript "254"
Adh	grailexp	CDS	658526	660852	1.47	-	2	transcript "254"
Adh	grailexp	CDS	660917	661331	0.18	-	0	transcript "254"
Adh	grailexp	CDS	679874	680889	1.40	-	2	transcript "253"
Adh	grailexp	CDS	682600	682771	0.89	-	0	transcript "253"
Adh	grailexp	CDS	682831	682969	0.99	-	2	transcript "253"
Adh	grailexp	CDS	689469	689746	0.98	-	1	transcript "253"
Adh	grailexp	CDS	689811	689983	0.47	-	2	transcript "253"
Adh	grailexp	CDS	690663	691029	0.12	-	0	transcript "253"
Adh	grailexp	CDS	692030	692155	0.36	-	2	transcript "253"
Adh	grailexp	CDS	704015	704227	0.35	-	2	transcript "252"
Adh	grailexp	CDS	753588	753630	0.00	+	0	transcript "56"
Adh	grailexp	CDS	754035	754129	0.17	+	2	transcript "56"
Adh	grailexp	CDS	756663	756872	0.25	+	2	transcript "56"
Adh	grailexp	CDS	757457	757873	0.45	+	2	transcript "57"
Adh	grailexp	CDS	761650	761710	0.15	+	0	transcript "58"
Adh	grailexp	CDS	771955	772295	0.47	+	2	transcript "58"
Adh	grailexp	CDS	779692	781583	1.47	+	1	transcript "58"
Adh	grailexp	CDS	781886	782694	1.47	+	0	transcript "58"
Adh	grailexp	CDS	784197	784313	0.17	+	2	transcript "58"
Adh	grailexp	CDS	788837	788917	0.24	-	2	transcript "251"
Adh	grailexp	CDS	793158	793275	0.01	-	2	transcript "251"
Adh	grailexp	CDS	796518	796758	0.12	-	0	transcript "251"
Adh	grailexp	CDS	801924	802961	1.42	+	2	transcript "59"
Adh	grailexp	CDS	813257	814650	1.41	+	1	transcript "60"
Adh	grailexp	CDS	814726	814981	0.17	+	2	transcript "60"
Adh	grailexp	CDS	815046	815442	0.43	+	0	transcript "60"
Adh	grailexp	CDS	815528	817215	1.47	+	2	transcript "60"
Adh	grailexp	CDS	817273	818025	0.47	+	2	transcript "60"
Adh	grailexp	CDS	818086	818367	0.47	+	2	transcript "60"
Adh	grailexp	CDS	818424	818574	0.47	+	1	transcript "60"
Adh	grailexp	CDS	818633	819290	0.47	+	2	transcript "60"
Adh	grailexp	CDS	820237	820789	0.17	+	0	transcript "60"
Adh	grailexp	CDS	820846	820979	0.47	+	2	transcript "60"
Adh	grailexp	CDS	821037	821265	0.43	+	0	transcript "60"
Adh	grailexp	CDS	821333	821487	0.33	+	2	transcript "60"
Adh	grailexp	CDS	822205	822454	0.17	+	0	transcript "61"
Adh	grailexp	CDS	822511	822848	0.47	+	2	transcript "61"
Adh	grailexp	CDS	822907	824011	1.15	+	0	transcript "61"
Adh	grailexp	CDS	824074	824822	1.29	+	2	transcript "61"
Adh	grailexp	CDS	824885	825688	0.35	+	2	transcript "61"
Adh	grailexp	CDS	825804	826427	0.40	+	2	transcript "61"
Adh	grailexp	CDS	826905	826921	0.13	+	1	transcript "62"
Adh	grailexp	CDS	827148	827511	0.40	+	2	transcript "62"
Adh	grailexp	CDS	828047	828306	0.45	+	1	transcript "63"
Adh	grailexp	CDS	832925	832961	0.76	+	2	transcript "63"
Adh	grailexp	CDS	833184	833672	0.09	+	2	transcript "63"
Adh	grailexp	CDS	835107	835316	0.04	+	2	transcript "64"
Adh	grailexp	CDS	836389	837106	0.43	+	0	transcript "65"
Adh	grailexp	CDS	837173	837428	0.45	+	1	transcript "65"
Adh	grailexp	CDS	837486	837859	0.98	+	0	transcript "65"
Adh	grailexp	CDS	837919	838152	0.99	+	0	transcript "65"
Adh	grailexp	CDS	838217	839076	1.15	+	2	transcript "65"
Adh	grailexp	CDS	842968	843225	0.09	-	2	transcript "250"
Adh	grailexp	CDS	843445	843518	0.45	-	2	transcript "250"
Adh	grailexp	CDS	843799	843808	0.43	-	0	transcript "250"
Adh	grailexp	CDS	846397	847365	1.46	-	2	transcript "249"
Adh	grailexp	CDS	847429	848154	0.41	-	2	transcript "248"
Adh	grailexp	CDS	848208	848609	0.99	-	2	transcript "248"
Adh	grailexp	CDS	848668	848733	0.83	-	2	transcript "248"
Adh	grailexp	CDS	848914	849209	0.99	+	0	transcript "66"
Adh	grailexp	CDS	851077	851190	0.98	+	0	transcript "66"
Adh	grailexp	CDS	851256	851436	0.98	+	1	transcript "66"
Adh	grailexp	CDS	851491	851673	0.98	+	1	transcript "66"
Adh	grailexp	CDS	851742	851919	0.91	+	2	transcript "66"
Adh	grailexp	CDS	853119	855014	1.46	+	2	transcript "67"
Adh	grailexp	CDS	855874	855922	0.86	+	0	transcript "68"
Adh	grailexp	CDS	855982	856031	0.93	+	2	transcript "68"
Adh	grailexp	CDS	856092	856876	0.99	+	1	transcript "68"
Adh	grailexp	CDS	856942	858029	1.19	+	0	transcript "68"
Adh	grailexp	CDS	858109	858395	0.84	+	2	transcript "68"
Adh	grailexp	CDS	872557	872818	1.00	-	2	transcript "247"
Adh	grailexp	CDS	872891	873131	0.99	-	1	transcript "247"
Adh	grailexp	CDS	873191	873321	0.97	-	0	transcript "247"
Adh	grailexp	CDS	873388	873527	0.93	-	1	transcript "247"
Adh	grailexp	CDS	873583	874093	0.98	-	2	transcript "247"
Adh	grailexp	CDS	874278	874541	1.00	-	1	transcript "247"
Adh	grailexp	CDS	875601	875650	0.40	-	1	transcript "247"
Adh	grailexp	CDS	884916	885806	1.20	-	2	transcript "246"
Adh	grailexp	CDS	885881	886798	1.31	-	2	transcript "245"
Adh	grailexp	CDS	905992	906071	0.35	-	1	transcript "245"
Adh	grailexp	CDS	910874	911134	0.36	+	2	transcript "69"
Adh	grailexp	CDS	918151	918795	0.41	-	2	transcript "244"
Adh	grailexp	CDS	924200	924223	0.16	-	2	transcript "244"
Adh	grailexp	CDS	934224	934243	0.00	+	1	transcript "70"
Adh	grailexp	CDS	939589	939736	0.23	+	2	transcript "70"
Adh	grailexp	CDS	944218	944493	0.80	-	2	transcript "243"
Adh	grailexp	CDS	977804	978046	0.18	-	2	transcript "242"
Adh	grailexp	CDS	984981	985070	0.82	+	2	transcript "71"
Adh	grailexp	CDS	985373	986896	1.11	+	2	transcript "71"
Adh	grailexp	CDS	1002359	1002471	0.28	-	2	transcript "241"
Adh	grailexp	CDS	1003293	1003371	0.38	-	0	transcript "241"
Adh	grailexp	CDS	1008067	1008249	0.10	-	2	transcript "240"
Adh	grailexp	CDS	1015766	1015937	0.43	-	0	transcript "240"
Adh	grailexp	CDS	1027037	1027195	0.14	-	2	transcript "239"
Adh	grailexp	CDS	1029588	1029621	0.44	-	0	transcript "239"
Adh	grailexp	CDS	1037169	1037252	0.15	-	2	transcript "238"
Adh	grailexp	CDS	1041564	1041989	0.46	-	2	transcript "238"
Adh	grailexp	CDS	1042386	1042688	0.45	-	2	transcript "238"
Adh	grailexp	CDS	1043593	1043695	0.34	-	2	transcript "237"
Adh	grailexp	CDS	1050773	1050821	0.01	-	0	transcript "237"
Adh	grailexp	CDS	1056874	1057139	0.43	+	1	transcript "72"
Adh	grailexp	CDS	1063610	1063766	0.04	+	2	transcript "72"
Adh	grailexp	CDS	1075064	1075169	0.26	+	0	transcript "73"
Adh	grailexp	CDS	1075573	1075695	0.02	+	0	transcript "73"
Adh	grailexp	CDS	1078475	1078592	0.34	+	1	transcript "73"
Adh	grailexp	CDS	1081755	1081896	0.06	+	2	transcript "73"
Adh	grailexp	CDS	1088388	1088588	0.12	+	2	transcript "73"
Adh	grailexp	CDS	1090024	1090389	0.27	+	2	transcript "73"
Adh	grailexp	CDS	1095422	1095533	0.47	-	2	transcript "236"
Adh	grailexp	CDS	1095586	1095735	0.43	-	1	transcript "236"
Adh	grailexp	CDS	1095848	1095987	0.47	-	1	transcript "236"
Adh	grailexp	CDS	1096326	1098971	1.47	-	2	transcript "236"
Adh	grailexp	CDS	1101376	1101526	0.41	-	1	transcript "236"
Adh	grailexp	CDS	1104419	1104995	0.46	-	0	transcript "236"
Adh	grailexp	CDS	1105586	1105651	0.47	-	2	transcript "236"
Adh	grailexp	CDS	1109286	1109378	0.98	+	2	transcript "74"
Adh	grailexp	CDS	1110038	1110172	0.99	+	2	transcript "74"
Adh	grailexp	CDS	1110238	1110642	0.99	+	2	transcript "74"
Adh	grailexp	CDS	1110713	1110979	0.41	+	2	transcript "74"
Adh	grailexp	CDS	1111805	1112209	0.97	+	2	transcript "75"
Adh	grailexp	CDS	1112261	1112578	0.95	+	2	transcript "75"
Adh	grailexp	CDS	1128664	1128863	0.25	-	2	transcript "235"
Adh	grailexp	CDS	1129815	1129895	0.46	-	2	transcript "235"
Adh	grailexp	CDS	1145411	1145429	0.45	+	0	transcript "76"
Adh	grailexp	CDS	1145597	1145940	0.19	+	2	transcript "76"
Adh	grailexp	CDS	1154838	1154848	0.41	+	1	transcript "77"
Adh	grailexp	CDS	1168731	1168947	0.23	+	2	transcript "77"
Adh	grailexp	CDS	1182164	1182430	0.01	-	2	transcript "234"
Adh	grailexp	CDS	1185401	1185439	0.12	-	2	transcript "234"
Adh	grailexp	CDS	1191250	1191269	0.36	+	1	transcript "78"
Adh	grailexp	CDS	1207666	1207953	0.41	+	2	transcript "78"
Adh	grailexp	CDS	1220426	1221762	1.41	-	2	transcript "233"
Adh	grailexp	CDS	1222288	1222395	0.07	-	0	transcript "233"
Adh	grailexp	CDS	1229684	1230733	1.41	+	2	transcript "79"
Adh	grailexp	CDS	1231115	1231348	0.86	+	2	transcript "80"
Adh	grailexp	CDS	1232958	1232969	0.81	+	2	transcript "81"
Adh	grailexp	CDS	1233044	1233280	0.95	+	2	transcript "81"
Adh	grailexp	CDS	1241714	1241776	0.38	-	2	transcript "232"
Adh	grailexp	CDS	1244068	1244083	0.29	-	0	transcript "232"
Adh	grailexp	CDS	1250633	1251421	0.88	+	2	transcript "82"
Adh	grailexp	CDS	1252523	1253617	1.42	+	2	transcript "83"
Adh	grailexp	CDS	1255669	1256823	1.43	+	2	transcript "84"
Adh	grailexp	CDS	1271377	1272140	0.18	-	2	transcript "231"
Adh	grailexp	CDS	1272217	1272395	0.46	-	0	transcript "231"
Adh	grailexp	CDS	1273008	1273498	0.14	-	1	transcript "231"
Adh	grailexp	CDS	1286168	1286225	0.26	+	0	transcript "85"
Adh	grailexp	CDS	1291182	1291348	0.10	+	2	transcript "85"
Adh	grailexp	CDS	1293718	1294187	0.98	-	1	transcript "230"
Adh	grailexp	CDS	1297137	1297250	0.98	-	2	transcript "230"
Adh	grailexp	CDS	1297317	1297352	0.90	-	2	transcript "230"
Adh	grailexp	CDS	1308376	1308414	0.22	-	2	transcript "230"
Adh	grailexp	CDS	1334780	1335024	0.92	-	2	transcript "229"
Adh	grailexp	CDS	1335080	1335356	0.37	-	0	transcript "229"
Adh	grailexp	CDS	1335416	1336157	0.45	-	2	transcript "229"
Adh	grailexp	CDS	1336482	1336720	0.99	-	2	transcript "229"
Adh	grailexp	CDS	1338337	1338640	0.93	-	0	transcript "229"
Adh	grailexp	CDS	1338702	1338804	0.96	-	2	transcript "229"
Adh	grailexp	CDS	1361484	1361548	0.12	-	1	transcript "229"
Adh	grailexp	CDS	1365101	1365361	0.06	-	2	transcript "228"
Adh	grailexp	CDS	1365421	1365611	0.26	-	2	transcript "228"
Adh	grailexp	CDS	1365666	1365762	0.46	-	0	transcript "228"
Adh	grailexp	CDS	1368707	1369303	0.94	-	2	transcript "228"
Adh	grailexp	CDS	1371200	1371270	0.91	-	2	transcript "228"
Adh	grailexp	CDS	1371783	1372372	0.98	-	0	transcript "228"
Adh	grailexp	CDS	1373266	1373367	0.98	-	1	transcript "228"
Adh	grailexp	CDS	1376588	1376598	0.39	-	1	transcript "228"
Adh	grailexp	CDS	1379912	1380009	0.74	+	2	transcript "86"
Adh	grailexp	CDS	1398183	1398911	0.42	-	2	transcript "227"
Adh	grailexp	CDS	1401594	1401874	0.02	-	2	transcript "226"
Adh	grailexp	CDS	1402451	1402460	0.40	-	0	transcript "226"
Adh	grailexp	CDS	1402512	1402643	0.32	-	2	transcript "225"
Adh	grailexp	CDS	1402808	1402995	0.06	-	2	transcript "225"
Adh	grailexp	CDS	1406801	1406882	0.46	-	0	transcript "225"
Adh	grailexp	CDS	1407035	1407146	0.01	-	2	transcript "225"
Adh	grailexp	CDS	1408830	1408924	0.40	-	1	transcript "225"
Adh	grailexp	CDS	1414397	1418081	1.41	+	0	transcript "87"
Adh	grailexp	CDS	1418142	1419321	1.46	+	1	transcript "87"
Adh	grailexp	CDS	1419378	1419918	0.39	+	2	transcript "87"
Adh	grailexp	CDS	1424156	1424376	0.16	-	1	transcript "224"
Adh	grailexp	CDS	1424531	1424676	0.47	-	2	transcript "224"
Adh	grailexp	CDS	1425549	1425752	0.36	-	0	transcript "224"
Adh	grailexp	CDS	1426168	1426281	0.42	-	0	transcript "224"
Adh	grailexp	CDS	1428573	1428690	0.37	-	2	transcript "224"
Adh	grailexp	CDS	1431180	1431306	0.37	-	1	transcript "224"
Adh	grailexp	CDS	1439418	1439478	0.43	-	0	transcript "224"
Adh	grailexp	CDS	1445532	1445710	0.46	+	2	transcript "88"
Adh	grailexp	CDS	1448592	1448623	0.18	+	0	transcript "88"
Adh	grailexp	CDS	1450916	1451020	0.45	+	0	transcript "88"
Adh	grailexp	CDS	1465981	1466019	0.47	-	1	transcript "223"
Adh	grailexp	CDS	1466153	1466744	0.91	-	1	transcript "223"
Adh	grailexp	CDS	1466876	1467307	0.91	-	0	transcript "223"
Adh	grailexp	CDS	1469347	1469359	0.39	-	0	transcript "223"
Adh	grailexp	CDS	1470304	1470339	0.10	-	1	transcript "222"
Adh	grailexp	CDS	1473611	1473745	0.99	-	1	transcript "222"
Adh	grailexp	CDS	1473857	1473914	0.94	-	1	transcript "222"
Adh	grailexp	CDS	1483558	1483694	0.99	-	0	transcript "222"
Adh	grailexp	CDS	1487171	1487198	0.90	-	1	transcript "222"
Adh	grailexp	CDS	1495402	1495535	1.00	+	2	transcript "89"
Adh	grailexp	CDS	1495620	1495919	0.99	+	2	transcript "89"
Adh	grailexp	CDS	1495977	1496171	0.46	+	2	transcript "89"
Adh	grailexp	CDS	1497570	1498121	0.93	+	2	transcript "89"
Adh	grailexp	CDS	1499670	1500914	1.12	+	2	transcript "90"
Adh	grailexp	CDS	1510747	1510998	0.43	+	2	transcript "91"
Adh	grailexp	CDS	1515041	1515175	0.46	+	2	transcript "91"
Adh	grailexp	CDS	1515266	1515436	0.38	+	2	transcript "91"
Adh	grailexp	CDS	1515498	1515714	0.20	+	0	transcript "91"
Adh	grailexp	CDS	1515807	1515972	0.47	+	1	transcript "91"
Adh	grailexp	CDS	1516036	1516279	0.32	+	2	transcript "91"
Adh	grailexp	CDS	1516339	1516527	0.29	+	2	transcript "91"
Adh	grailexp	CDS	1518399	1518939	0.14	+	0	transcript "92"
Adh	grailexp	CDS	1520081	1520337	0.30	+	2	transcript "92"
Adh	grailexp	CDS	1520398	1520535	0.47	+	2	transcript "92"
Adh	grailexp	CDS	1521654	1521834	0.47	+	0	transcript "92"
Adh	grailexp	CDS	1525228	1525447	0.98	+	1	transcript "92"
Adh	grailexp	CDS	1526237	1526669	0.95	+	2	transcript "92"
Adh	grailexp	CDS	1527062	1527379	0.03	+	2	transcript "93"
Adh	grailexp	CDS	1529846	1529971	0.91	+	2	transcript "94"
Adh	grailexp	CDS	1530746	1531626	0.93	+	1	transcript "94"
Adh	grailexp	CDS	1531685	1531910	0.85	+	2	transcript "94"
Adh	grailexp	CDS	1535341	1535461	0.40	-	2	transcript "221"
Adh	grailexp	CDS	1535530	1535642	0.32	-	1	transcript "221"
Adh	grailexp	CDS	1536067	1537150	1.35	-	2	transcript "220"
Adh	grailexp	CDS	1537212	1538662	1.46	-	1	transcript "220"
Adh	grailexp	CDS	1538719	1541113	1.47	-	2	transcript "220"
Adh	grailexp	CDS	1541178	1541378	0.47	-	1	transcript "220"
Adh	grailexp	CDS	1541445	1541794	0.89	-	1	transcript "220"
Adh	grailexp	CDS	1542125	1542385	0.98	-	2	transcript "220"
Adh	grailexp	CDS	1543067	1543173	0.98	-	2	transcript "220"
Adh	grailexp	CDS	1547319	1547461	0.98	-	0	transcript "220"
Adh	grailexp	CDS	1547681	1547715	0.40	-	1	transcript "220"
Adh	grailexp	CDS	1549142	1550017	1.15	-	2	transcript "219"
Adh	grailexp	CDS	1550084	1550149	0.76	-	2	transcript "219"
Adh	grailexp	CDS	1551361	1551433	0.94	+	1	transcript "95"
Adh	grailexp	CDS	1558033	1558080	0.94	+	1	transcript "95"
Adh	grailexp	CDS	1558134	1558572	0.90	+	2	transcript "95"
Adh	grailexp	CDS	1558642	1559747	1.37	+	1	transcript "96"
Adh	grailexp	CDS	1561989	1562278	0.93	+	2	transcript "96"
Adh	grailexp	CDS	1562338	1563081	0.94	+	2	transcript "96"
Adh	grailexp	CDS	1563140	1563353	0.99	+	0	transcript "96"
Adh	grailexp	CDS	1563418	1563689	0.98	+	2	transcript "96"
Adh	grailexp	CDS	1565272	1565547	0.33	+	2	transcript "97"
Adh	grailexp	CDS	1566588	1566621	0.33	+	0	transcript "98"
Adh	grailexp	CDS	1576691	1576943	0.47	+	1	transcript "98"
Adh	grailexp	CDS	1577036	1577406	0.47	+	0	transcript "98"
Adh	grailexp	CDS	1580846	1580880	0.15	+	2	transcript "98"
Adh	grailexp	CDS	1580946	1581227	0.20	+	2	transcript "98"
Adh	grailexp	CDS	1581294	1581623	0.26	+	2	transcript "98"
Adh	grailexp	CDS	1581774	1582136	0.46	+	2	transcript "98"
Adh	grailexp	CDS	1582201	1582292	0.47	+	1	transcript "98"
Adh	grailexp	CDS	1584621	1584828	0.43	+	0	transcript "98"
Adh	grailexp	CDS	1584949	1585094	0.47	+	2	transcript "98"
Adh	grailexp	CDS	1585153	1585380	0.40	+	2	transcript "98"
Adh	grailexp	CDS	1599218	1600177	1.45	+	2	transcript "99"
Adh	grailexp	CDS	1601744	1602565	1.35	+	2	transcript "99"
Adh	grailexp	CDS	1603706	1603885	0.82	+	2	transcript "100"
Adh	grailexp	CDS	1603951	1604326	1.00	+	0	transcript "100"
Adh	grailexp	CDS	1605059	1605404	0.15	+	1	transcript "100"
Adh	grailexp	CDS	1605651	1606718	1.19	+	1	transcript "100"
Adh	grailexp	CDS	1606791	1607142	0.98	+	2	transcript "100"
Adh	grailexp	CDS	1607205	1607306	0.86	+	2	transcript "100"
Adh	grailexp	CDS	1624417	1624528	0.43	+	0	transcript "101"
Adh	grailexp	CDS	1626928	1626998	0.26	+	2	transcript "101"
Adh	grailexp	CDS	1627913	1627973	0.00	-	2	transcript "218"
Adh	grailexp	CDS	1630351	1630487	0.43	-	1	transcript "218"
Adh	grailexp	CDS	1634224	1634411	0.01	-	2	transcript "217"
Adh	grailexp	CDS	1634782	1634821	0.43	-	0	transcript "217"
Adh	grailexp	CDS	1641652	1641718	0.42	+	1	transcript "102"
Adh	grailexp	CDS	1644188	1644362	0.31	+	2	transcript "102"
Adh	grailexp	CDS	1651072	1651167	0.40	-	2	transcript "216"
Adh	grailexp	CDS	1651337	1651403	0.41	-	2	transcript "216"
Adh	grailexp	CDS	1653232	1653414	0.40	-	2	transcript "215"
Adh	grailexp	CDS	1653857	1657133	1.47	-	2	transcript "215"
Adh	grailexp	CDS	1657232	1657441	0.47	-	1	transcript "215"
Adh	grailexp	CDS	1661045	1661184	0.32	-	1	transcript "215"
Adh	grailexp	CDS	1667548	1667970	0.45	-	2	transcript "214"
Adh	grailexp	CDS	1700818	1701162	0.09	-	2	transcript "213"
Adh	grailexp	CDS	1717339	1717472	0.01	-	2	transcript "212"
Adh	grailexp	CDS	1719195	1719342	0.47	-	0	transcript "212"
Adh	grailexp	CDS	1719504	1720005	0.46	-	2	transcript "212"
Adh	grailexp	CDS	1726256	1726435	0.92	-	1	transcript "212"
Adh	grailexp	CDS	1730116	1730236	0.92	-	1	transcript "212"
Adh	grailexp	CDS	1731062	1731172	0.99	-	0	transcript "212"
Adh	grailexp	CDS	1735826	1736004	0.99	-	0	transcript "212"
Adh	grailexp	CDS	1737215	1737294	0.95	-	1	transcript "212"
Adh	grailexp	CDS	1738791	1739218	0.92	+	1	transcript "103"
Adh	grailexp	CDS	1740300	1740540	0.46	+	2	transcript "103"
Adh	grailexp	CDS	1740659	1740939	0.47	+	1	transcript "103"
Adh	grailexp	CDS	1740995	1742042	1.47	+	2	transcript "103"
Adh	grailexp	CDS	1742104	1742487	0.36	+	2	transcript "103"
Adh	grailexp	CDS	1744620	1745915	1.46	-	2	transcript "211"
Adh	grailexp	CDS	1746561	1746743	0.01	-	2	transcript "210"
Adh	grailexp	CDS	1747451	1747777	0.45	-	2	transcript "210"
Adh	grailexp	CDS	1748111	1748361	0.36	-	2	transcript "209"
Adh	grailexp	CDS	1748434	1748590	0.00	-	0	transcript "209"
Adh	grailexp	CDS	1751370	1751492	0.45	-	2	transcript "209"
Adh	grailexp	CDS	1751564	1751652	0.18	-	2	transcript "209"
Adh	grailexp	CDS	1752053	1752278	0.10	-	0	transcript "209"
Adh	grailexp	CDS	1752622	1752780	0.47	-	2	transcript "209"
Adh	grailexp	CDS	1752984	1753054	0.00	-	2	transcript "209"
Adh	grailexp	CDS	1753136	1753316	0.85	-	0	transcript "209"
Adh	grailexp	CDS	1753422	1753778	0.95	-	2	transcript "209"
Adh	grailexp	CDS	1756026	1756178	0.41	-	2	transcript "208"
Adh	grailexp	CDS	1756248	1756386	0.47	-	2	transcript "208"
Adh	grailexp	CDS	1756448	1756671	0.21	-	1	transcript "208"
Adh	grailexp	CDS	1756788	1756939	0.05	-	2	transcript "207"
Adh	grailexp	CDS	1757005	1757119	0.46	-	0	transcript "207"
Adh	grailexp	CDS	1757182	1757352	0.46	-	2	transcript "207"
Adh	grailexp	CDS	1757415	1757585	0.47	-	2	transcript "207"
Adh	grailexp	CDS	1757648	1758409	1.00	-	2	transcript "207"
Adh	grailexp	CDS	1758473	1758856	0.99	-	2	transcript "207"
Adh	grailexp	CDS	1760557	1760795	0.99	-	2	transcript "207"
Adh	grailexp	CDS	1763921	1764042	0.94	-	2	transcript "206"
Adh	grailexp	CDS	1764272	1764501	0.97	-	0	transcript "206"
Adh	grailexp	CDS	1764574	1764638	0.82	-	1	transcript "206"
Adh	grailexp	CDS	1774679	1775557	1.40	+	2	transcript "104"
Adh	grailexp	CDS	1780341	1780544	0.10	-	2	transcript "205"
Adh	grailexp	CDS	1781148	1781825	0.39	-	2	transcript "205"
Adh	grailexp	CDS	1787599	1788915	1.40	+	2	transcript "105"
Adh	grailexp	CDS	1790433	1790449	0.38	+	1	transcript "106"
Adh	grailexp	CDS	1792246	1792331	0.10	+	0	transcript "106"
Adh	grailexp	CDS	1792606	1792631	0.43	+	1	transcript "107"
Adh	grailexp	CDS	1798592	1798702	0.35	+	2	transcript "107"
Adh	grailexp	CDS	1807761	1808498	0.44	-	2	transcript "204"
Adh	grailexp	CDS	1823746	1825158	1.45	+	2	transcript "108"
Adh	grailexp	CDS	1826351	1826373	0.13	+	1	transcript "109"
Adh	grailexp	CDS	1833915	1834002	0.12	+	2	transcript "109"
Adh	grailexp	CDS	1850930	1851241	0.06	+	2	transcript "110"
Adh	grailexp	CDS	1852974	1853126	0.01	+	2	transcript "110"
Adh	grailexp	CDS	1884141	1884464	0.03	-	2	transcript "203"
Adh	grailexp	CDS	1885049	1885144	0.43	-	2	transcript "203"
Adh	grailexp	CDS	1886301	1886571	0.19	-	2	transcript "203"
Adh	grailexp	CDS	1891981	1892003	0.45	-	1	transcript "203"
Adh	grailexp	CDS	1908356	1908441	0.24	-	2	transcript "202"
Adh	grailexp	CDS	1909292	1909323	0.02	-	0	transcript "202"
Adh	grailexp	CDS	1912285	1912316	0.38	-	1	transcript "202"
Adh	grailexp	CDS	1913374	1914932	1.02	-	2	transcript "201"
Adh	grailexp	CDS	1914995	1915082	0.43	-	0	transcript "201"
Adh	grailexp	CDS	1921206	1921230	0.42	+	0	transcript "111"
Adh	grailexp	CDS	1922996	1924563	1.15	+	2	transcript "111"
Adh	grailexp	CDS	1936726	1937031	0.35	+	2	transcript "112"
Adh	grailexp	CDS	1938049	1938118	0.77	+	0	transcript "113"
Adh	grailexp	CDS	1950791	1951201	0.32	-	2	transcript "200"
Adh	grailexp	CDS	1951455	1951541	0.12	-	2	transcript "200"
Adh	grailexp	CDS	1961881	1961901	0.32	+	2	transcript "114"
Adh	grailexp	CDS	1962476	1962516	0.41	+	2	transcript "114"
Adh	grailexp	CDS	1963364	1963651	0.31	+	2	transcript "115"
Adh	grailexp	CDS	1966586	1967758	1.40	-	2	transcript "199"
Adh	grailexp	CDS	1970601	1970641	0.30	+	1	transcript "116"
Adh	grailexp	CDS	1974454	1975018	0.34	+	2	transcript "116"
Adh	grailexp	CDS	1988872	1989075	0.87	+	2	transcript "117"
Adh	grailexp	CDS	1991768	1992688	0.92	+	2	transcript "117"
Adh	grailexp	CDS	1992942	1993204	0.22	+	1	transcript "117"
Adh	grailexp	CDS	1993350	1993566	0.41	+	2	transcript "117"
Adh	grailexp	CDS	2008029	2008162	0.14	-	2	transcript "198"
Adh	grailexp	CDS	2010059	2010091	0.33	-	2	transcript "198"
Adh	grailexp	CDS	2038745	2038806	0.17	+	1	transcript "118"
Adh	grailexp	CDS	2040432	2040693	0.14	+	2	transcript "118"
Adh	grailexp	CDS	2068604	2070501	1.45	+	1	transcript "119"
Adh	grailexp	CDS	2071510	2072677	1.41	+	2	transcript "119"
Adh	grailexp	CDS	2074630	2074665	0.38	+	2	transcript "120"
Adh	grailexp	CDS	2074911	2075113	0.01	+	2	transcript "120"
Adh	grailexp	CDS	2076918	2077326	0.85	+	0	transcript "121"
Adh	grailexp	CDS	2091428	2091590	0.38	+	0	transcript "121"
Adh	grailexp	CDS	2100551	2101336	0.42	-	2	transcript "197"
Adh	grailexp	CDS	2102169	2102647	0.15	-	2	transcript "196"
Adh	grailexp	CDS	2102776	2102797	0.10	-	0	transcript "196"
Adh	grailexp	CDS	2103622	2104169	0.39	-	2	transcript "195"
Adh	grailexp	CDS	2104226	2104442	0.20	-	0	transcript "195"
Adh	grailexp	CDS	2105170	2105720	0.41	-	2	transcript "194"
Adh	grailexp	CDS	2109817	2109901	0.26	-	0	transcript "194"
Adh	grailexp	CDS	2118483	2118551	0.43	+	2	transcript "122"
Adh	grailexp	CDS	2118614	2119161	0.41	+	2	transcript "122"
Adh	grailexp	CDS	2119844	2120025	0.19	+	1	transcript "123"
Adh	grailexp	CDS	2120092	2120194	0.47	+	2	transcript "123"
Adh	grailexp	CDS	2120312	2121269	1.47	+	0	transcript "123"
Adh	grailexp	CDS	2121336	2121745	0.41	+	2	transcript "123"
Adh	grailexp	CDS	2137486	2137679	0.39	-	2	transcript "193"
Adh	grailexp	CDS	2137746	2137902	0.47	-	0	transcript "193"
Adh	grailexp	CDS	2137961	2138116	0.17	-	2	transcript "193"
Adh	grailexp	CDS	2138186	2138671	0.42	-	2	transcript "193"
Adh	grailexp	CDS	2138733	2138994	0.35	-	2	transcript "193"
Adh	grailexp	CDS	2139065	2139169	0.47	-	1	transcript "193"
Adh	grailexp	CDS	2139824	2140056	0.06	-	1	transcript "193"
Adh	grailexp	CDS	2140148	2140353	0.15	-	2	transcript "193"
Adh	grailexp	CDS	2140417	2140630	0.43	-	0	transcript "193"
Adh	grailexp	CDS	2140705	2141412	0.41	-	2	transcript "192"
Adh	grailexp	CDS	2141468	2141749	0.43	-	2	transcript "192"
Adh	grailexp	CDS	2141998	2142465	0.41	-	2	transcript "192"
Adh	grailexp	CDS	2145807	2145957	0.12	+	0	transcript "124"
Adh	grailexp	CDS	2148796	2148854	0.17	+	2	transcript "124"
Adh	grailexp	CDS	2149292	2149510	0.13	+	2	transcript "125"
Adh	grailexp	CDS	2149741	2150907	1.41	+	2	transcript "125"
Adh	grailexp	CDS	2161195	2161276	0.00	-	2	transcript "191"
Adh	grailexp	CDS	2167365	2167477	0.38	-	1	transcript "191"
Adh	grailexp	CDS	2180707	2180982	0.41	-	2	transcript "190"
Adh	grailexp	CDS	2181100	2181325	0.98	-	2	transcript "190"
Adh	grailexp	CDS	2181392	2182662	1.19	-	1	transcript "190"
Adh	grailexp	CDS	2182828	2183604	0.97	-	2	transcript "190"
Adh	grailexp	CDS	2189454	2189790	0.92	-	2	transcript "190"
Adh	grailexp	CDS	2192598	2192725	0.99	-	1	transcript "190"
Adh	grailexp	CDS	2199659	2199945	0.97	-	2	transcript "190"
Adh	grailexp	CDS	2204183	2205278	1.37	+	0	transcript "126"
Adh	grailexp	CDS	2205332	2207403	1.28	+	2	transcript "126"
Adh	grailexp	CDS	2208830	2209531	0.99	-	1	transcript "189"
Adh	grailexp	CDS	2209593	2209904	0.98	-	1	transcript "189"
Adh	grailexp	CDS	2209967	2211186	1.19	-	1	transcript "189"
Adh	grailexp	CDS	2211243	2211671	0.98	-	2	transcript "189"
Adh	grailexp	CDS	2212036	2212168	0.94	-	2	transcript "189"
Adh	grailexp	CDS	2212228	2212400	1.00	-	1	transcript "189"
Adh	grailexp	CDS	2214395	2214568	0.97	-	2	transcript "189"
Adh	grailexp	CDS	2216396	2217064	0.46	-	2	transcript "188"
Adh	grailexp	CDS	2218461	2218494	0.40	-	2	transcript "187"
Adh	grailexp	CDS	2218559	2218905	0.47	-	1	transcript "187"
Adh	grailexp	CDS	2218966	2219871	0.98	-	2	transcript "187"
Adh	grailexp	CDS	2219932	2220057	0.89	-	2	transcript "187"
Adh	grailexp	CDS	2220565	2221536	1.44	-	2	transcript "186"
Adh	grailexp	CDS	2222253	2222379	0.34	-	2	transcript "185"
Adh	grailexp	CDS	2222435	2222667	0.21	-	1	transcript "185"
Adh	grailexp	CDS	2222723	2222818	0.43	-	2	transcript "185"
Adh	grailexp	CDS	2223403	2223577	0.46	-	2	transcript "185"
Adh	grailexp	CDS	2223854	2224248	0.43	-	1	transcript "185"
Adh	grailexp	CDS	2229177	2229218	0.44	-	2	transcript "185"
Adh	grailexp	CDS	2231491	2231742	0.35	-	2	transcript "184"
Adh	grailexp	CDS	2288700	2288778	0.23	-	2	transcript "183"
Adh	grailexp	CDS	2295145	2295194	0.41	-	1	transcript "183"
Adh	grailexp	CDS	2301891	2301939	0.15	+	0	transcript "127"
Adh	grailexp	CDS	2303428	2304641	1.32	+	2	transcript "127"
Adh	grailexp	CDS	2305038	2305397	0.95	+	2	transcript "128"
Adh	grailexp	CDS	2305489	2305763	0.92	+	1	transcript "128"
Adh	grailexp	CDS	2305829	2306951	1.41	+	2	transcript "128"
Adh	grailexp	CDS	2315767	2315925	0.22	-	2	transcript "182"
Adh	grailexp	CDS	2315991	2316098	0.07	-	2	transcript "182"
Adh	grailexp	CDS	2327989	2328098	0.40	-	2	transcript "181"
Adh	grailexp	CDS	2328611	2329261	0.20	-	2	transcript "181"
Adh	grailexp	CDS	2329400	2329967	0.01	-	2	transcript "181"
Adh	grailexp	CDS	2330026	2330181	0.21	-	1	transcript "181"
Adh	grailexp	CDS	2333741	2333787	0.01	-	1	transcript "181"
Adh	grailexp	CDS	2339377	2340420	1.41	-	2	transcript "180"
Adh	grailexp	CDS	2340535	2341630	1.38	-	2	transcript "180"
Adh	grailexp	CDS	2342664	2343851	1.41	-	1	transcript "180"
Adh	grailexp	CDS	2348069	2348214	0.26	-	1	transcript "180"
Adh	grailexp	CDS	2351716	2352026	0.36	-	2	transcript "179"
Adh	grailexp	CDS	2352080	2353052	1.45	-	0	transcript "179"
Adh	grailexp	CDS	2356272	2356488	0.30	-	2	transcript "178"
Adh	grailexp	CDS	2357535	2357674	0.44	-	1	transcript "178"
Adh	grailexp	CDS	2358742	2358953	0.46	-	2	transcript "178"
Adh	grailexp	CDS	2365992	2366304	0.30	-	0	transcript "178"
Adh	grailexp	CDS	2374085	2374294	0.99	+	2	transcript "129"
Adh	grailexp	CDS	2374356	2375075	0.84	+	2	transcript "129"
Adh	grailexp	CDS	2391780	2391944	0.04	+	2	transcript "129"
Adh	grailexp	CDS	2392181	2392737	0.41	+	1	transcript "130"
Adh	grailexp	CDS	2392800	2393095	0.21	+	0	transcript "130"
Adh	grailexp	CDS	2408036	2408288	0.34	+	0	transcript "131"
Adh	grailexp	CDS	2420842	2420985	0.28	+	2	transcript "131"
Adh	grailexp	CDS	2428833	2429381	0.45	+	2	transcript "132"
Adh	grailexp	CDS	2441963	2441976	0.40	+	1	transcript "133"
Adh	grailexp	CDS	2443533	2443755	0.38	+	2	transcript "133"
Adh	grailexp	CDS	2444164	2444213	0.43	+	1	transcript "134"
Adh	grailexp	CDS	2445792	2445848	0.47	+	1	transcript "134"
Adh	grailexp	CDS	2465772	2465965	0.43	+	1	transcript "135"
Adh	grailexp	CDS	2481639	2481850	0.47	+	2	transcript "135"
Adh	grailexp	CDS	2483447	2483582	0.46	+	0	transcript "135"
Adh	grailexp	CDS	2483839	2483972	0.17	+	2	transcript "135"
Adh	grailexp	CDS	2484693	2484860	0.14	+	2	transcript "135"
Adh	grailexp	CDS	2486400	2486522	0.43	+	2	transcript "135"
Adh	grailexp	CDS	2486596	2486808	0.36	+	2	transcript "135"
Adh	grailexp	CDS	2493314	2493620	0.44	+	0	transcript "136"
Adh	grailexp	CDS	2493682	2493731	0.46	+	2	transcript "136"
Adh	grailexp	CDS	2494047	2494116	0.23	+	0	transcript "136"
Adh	grailexp	CDS	2494568	2494651	0.82	+	2	transcript "137"
Adh	grailexp	CDS	2495100	2495225	0.99	+	2	transcript "137"
Adh	grailexp	CDS	2495286	2495667	0.99	+	0	transcript "137"
Adh	grailexp	CDS	2495783	2496988	1.23	+	0	transcript "137"
Adh	grailexp	CDS	2497217	2497464	0.41	+	2	transcript "137"
Adh	grailexp	CDS	2505511	2505601	0.97	+	0	transcript "138"
Adh	grailexp	CDS	2524357	2524565	0.96	+	2	transcript "138"
Adh	grailexp	CDS	2525929	2526064	1.00	+	0	transcript "138"
Adh	grailexp	CDS	2527415	2527548	0.97	+	2	transcript "138"
Adh	grailexp	CDS	2529073	2529195	0.99	+	2	transcript "138"
Adh	grailexp	CDS	2529260	2529455	0.97	+	0	transcript "138"
Adh	grailexp	CDS	2539877	2540172	0.02	+	2	transcript "138"
Adh	grailexp	CDS	2544295	2545203	1.16	+	2	transcript "139"
Adh	grailexp	CDS	2554306	2554403	0.36	+	1	transcript "140"
Adh	grailexp	CDS	2591868	2591903	0.90	+	1	transcript "140"
Adh	grailexp	CDS	2591970	2592084	0.98	+	2	transcript "140"
Adh	grailexp	CDS	2595035	2595504	0.97	+	1	transcript "140"
Adh	grailexp	CDS	2596999	2597040	0.26	+	2	transcript "141"
Adh	grailexp	CDS	2597544	2597725	0.10	+	2	transcript "141"
Adh	grailexp	CDS	2599727	2599883	0.18	+	0	transcript "142"
Adh	grailexp	CDS	2601492	2601517	0.46	+	2	transcript "142"
Adh	grailexp	CDS	2619911	2620307	0.99	+	1	transcript "142"
Adh	grailexp	CDS	2621231	2622507	1.19	+	0	transcript "142"
Adh	grailexp	CDS	2622578	2622803	0.99	+	1	transcript "142"
Adh	grailexp	CDS	2622977	2623082	0.99	+	2	transcript "142"
Adh	grailexp	CDS	2623316	2623455	0.98	+	1	transcript "142"
Adh	grailexp	CDS	2623675	2623781	0.91	+	0	transcript "142"
Adh	grailexp	CDS	2624114	2624266	0.95	+	0	transcript "142"
Adh	grailexp	CDS	2624694	2624875	1.00	+	2	transcript "142"
Adh	grailexp	CDS	2624976	2625495	0.98	+	0	transcript "142"
Adh	grailexp	CDS	2625559	2625784	0.98	+	1	transcript "142"
Adh	grailexp	CDS	2625851	2626065	0.99	+	0	transcript "142"
Adh	grailexp	CDS	2626124	2626333	0.99	+	2	transcript "142"
Adh	grailexp	CDS	2626392	2626510	0.93	+	1	transcript "142"
Adh	grailexp	CDS	2626595	2626653	0.89	+	0	transcript "142"
Adh	grailexp	CDS	2627634	2627751	1.00	+	1	transcript "142"
Adh	grailexp	CDS	2628166	2628295	0.90	+	2	transcript "142"
Adh	grailexp	CDS	2628460	2628626	0.99	+	1	transcript "142"
Adh	grailexp	CDS	2628718	2628805	0.97	+	2	transcript "142"
Adh	grailexp	CDS	2629398	2629505	1.00	+	2	transcript "142"
Adh	grailexp	CDS	2632038	2632090	0.94	+	1	transcript "142"
Adh	grailexp	CDS	2632152	2632298	0.99	+	1	transcript "142"
Adh	grailexp	CDS	2632363	2632834	0.99	+	2	transcript "142"
Adh	grailexp	CDS	2632889	2632972	0.97	+	2	transcript "142"
Adh	grailexp	CDS	2633028	2633337	0.98	+	0	transcript "142"
Adh	grailexp	CDS	2633397	2633645	0.98	+	2	transcript "142"
Adh	grailexp	CDS	2633706	2634365	0.98	+	2	transcript "142"
Adh	grailexp	CDS	2634452	2634885	0.98	+	1	transcript "142"
Adh	grailexp	CDS	2635370	2635410	0.93	+	0	transcript "142"
Adh	grailexp	CDS	2638284	2638414	0.99	+	2	transcript "142"
Adh	grailexp	CDS	2638470	2639006	0.92	+	2	transcript "142"
Adh	grailexp	CDS	2660848	2661318	0.43	+	2	transcript "143"
Adh	grailexp	CDS	2661378	2662319	1.41	+	2	transcript "143"
Adh	grailexp	CDS	2671764	2671896	0.20	+	0	transcript "144"
Adh	grailexp	CDS	2675909	2676030	0.06	+	2	transcript "144"
Adh	grailexp	CDS	2681334	2681494	0.33	+	1	transcript "145"
Adh	grailexp	CDS	2684880	2686209	1.47	+	2	transcript "145"
Adh	grailexp	CDS	2686394	2686570	0.42	+	2	transcript "145"
Adh	grailexp	CDS	2686628	2686705	0.01	+	2	transcript "145"
Adh	grailexp	CDS	2686770	2687146	0.47	+	1	transcript "145"
Adh	grailexp	CDS	2687211	2687359	0.10	+	0	transcript "145"
Adh	grailexp	CDS	2687415	2687920	0.33	+	2	transcript "145"
Adh	grailexp	CDS	2687988	2688296	0.17	+	2	transcript "145"
Adh	grailexp	CDS	2688464	2688913	0.39	+	2	transcript "146"
Adh	grailexp	CDS	2696335	2696446	1.00	-	2	transcript "177"
Adh	grailexp	CDS	2696513	2696644	0.98	-	1	transcript "177"
Adh	grailexp	CDS	2697858	2698028	0.88	-	2	transcript "177"
Adh	grailexp	CDS	2707300	2707439	1.00	+	2	transcript "147"
Adh	grailexp	CDS	2707509	2708522	1.10	+	2	transcript "147"
Adh	grailexp	CDS	2709485	2710765	1.12	-	2	transcript "176"
Adh	grailexp	CDS	2710851	2710951	0.98	-	2	transcript "176"
Adh	grailexp	CDS	2714781	2716277	1.41	-	2	transcript "175"
Adh	grailexp	CDS	2723585	2723607	0.27	-	1	transcript "175"
Adh	grailexp	CDS	2728054	2728418	0.30	-	2	transcript "174"
Adh	grailexp	CDS	2728802	2728830	0.38	-	0	transcript "174"
Adh	grailexp	CDS	2736358	2736953	0.98	-	1	transcript "174"
Adh	grailexp	CDS	2737860	2738132	0.99	+	0	transcript "148"
Adh	grailexp	CDS	2738403	2739055	0.88	+	2	transcript "148"
Adh	grailexp	CDS	2739266	2739461	0.03	+	0	transcript "148"
Adh	grailexp	CDS	2739531	2740039	0.41	+	2	transcript "148"
Adh	grailexp	CDS	2740542	2741090	0.45	+	2	transcript "149"
Adh	grailexp	CDS	2741907	2742007	0.39	+	1	transcript "150"
Adh	grailexp	CDS	2742269	2742500	0.21	+	2	transcript "150"
Adh	grailexp	CDS	2744187	2745122	1.46	+	2	transcript "151"
Adh	grailexp	CDS	2751337	2751465	0.83	-	2	transcript "173"
Adh	grailexp	CDS	2751521	2751711	0.99	-	2	transcript "173"
Adh	grailexp	CDS	2752612	2752742	0.93	+	1	transcript "152"
Adh	grailexp	CDS	2752822	2752985	1.00	+	0	transcript "152"
Adh	grailexp	CDS	2753042	2753322	0.85	+	2	transcript "152"
Adh	grailexp	CDS	2754205	2754364	0.00	+	0	transcript "152"
Adh	grailexp	CDS	2757391	2757589	0.91	+	0	transcript "153"
Adh	grailexp	CDS	2757658	2758391	0.98	+	2	transcript "153"
Adh	grailexp	CDS	2759770	2759892	0.00	+	2	transcript "154"
Adh	grailexp	CDS	2760394	2760672	0.87	+	2	transcript "154"
Adh	grailexp	CDS	2760766	2761087	0.98	+	0	transcript "154"
Adh	grailexp	CDS	2761141	2762087	1.41	+	2	transcript "154"
Adh	grailexp	CDS	2762287	2762710	0.99	-	0	transcript "172"
Adh	grailexp	CDS	2763711	2763968	0.99	-	2	transcript "172"
Adh	grailexp	CDS	2764030	2764118	0.97	-	2	transcript "172"
Adh	grailexp	CDS	2772220	2772430	0.99	-	0	transcript "172"
Adh	grailexp	CDS	2772600	2772777	0.99	-	2	transcript "172"
Adh	grailexp	CDS	2773593	2774314	1.00	-	1	transcript "172"
Adh	grailexp	CDS	2774754	2774927	0.99	-	2	transcript "172"
Adh	grailexp	CDS	2776641	2777045	0.37	-	2	transcript "171"
Adh	grailexp	CDS	2777390	2777609	0.41	-	2	transcript "170"
Adh	grailexp	CDS	2777672	2778309	0.94	-	1	transcript "170"
Adh	grailexp	CDS	2783806	2783886	0.28	-	2	transcript "170"
Adh	grailexp	CDS	2786756	2787069	0.20	-	2	transcript "169"
Adh	grailexp	CDS	2788407	2788454	0.12	-	0	transcript "169"
Adh	grailexp	CDS	2788808	2789066	0.40	-	0	transcript "169"
Adh	grailexp	CDS	2789139	2789567	0.38	-	2	transcript "168"
Adh	grailexp	CDS	2792074	2792601	0.18	-	2	transcript "167"
Adh	grailexp	CDS	2793626	2798713	1.37	-	2	transcript "166"
Adh	grailexp	CDS	2804442	2805730	1.08	-	2	transcript "165"
Adh	grailexp	CDS	2805800	2805903	0.98	-	0	transcript "165"
Adh	grailexp	CDS	2815178	2815845	0.41	+	1	transcript "155"
Adh	grailexp	CDS	2819863	2819929	0.40	+	2	transcript "155"
Adh	grailexp	CDS	2849428	2849790	0.96	+	1	transcript "156"
Adh	grailexp	CDS	2853764	2853994	0.97	+	1	transcript "156"
Adh	grailexp	CDS	2854193	2855213	1.29	-	2	transcript "164"
Adh	grailexp	CDS	2857635	2857663	0.17	-	1	transcript "164"
Adh	grailexp	CDS	2860250	2860510	0.14	-	2	transcript "163"
Adh	grailexp	CDS	2865306	2865339	0.32	-	0	transcript "163"
Adh	grailexp	CDS	2871295	2871404	0.38	+	1	transcript "157"
Adh	grailexp	CDS	2874237	2874469	0.18	+	0	transcript "157"
Adh	grailexp	CDS	2884684	2884926	0.36	-	2	transcript "162"
Adh	grailexp	CDS	2890670	2890686	0.45	+	1	transcript "158"
Adh	grailexp	CDS	2894625	2895247	0.93	+	0	transcript "158"
Adh	grailexp	CDS	2895319	2895977	0.92	+	2	transcript "158"
Adh	grailexp	CDS	2896655	2896763	0.92	+	0	transcript "158"
Adh	grailexp	CDS	2898444	2899001	0.98	+	0	transcript "158"
Adh	grailexp	CDS	2899061	2899716	0.96	+	2	transcript "158"
Adh	grailexp	CDS	2900448	2900565	0.94	+	0	transcript "159"
Adh	grailexp	CDS	2900634	2901185	0.97	+	0	transcript "159"
Adh	grailexp	CDS	2901452	2902107	0.93	+	2	transcript "159"
Adh	grailexp	CDS	2910098	2910173	0.04	-	0	transcript "161"
Adh	grailexp	CDS	2911759	2911898	0.45	-	2	transcript "161"
Adh	grailexp	CDS	2914999	2915119	0.43	-	0	transcript "161"
Adh	grailexp	CDS	2916879	2917012	0.41	-	2	transcript "160"
Adh	grailexp	CDS	2917311	2917504	0.47	-	0	transcript "160"
Adh	grailexp	CDS	2917751	2917988	0.98	-	1	transcript "160"
Adh	grailexp	CDS	2918253	2918513	0.98	-	0	transcript "160"
Adh	grailexp	CDS	2918684	2918711	0.33	-	0	transcript "160"
# GeneMarkHMM
Adh	GeneMarkHMM	CDS	54	441	.	-	.	transcript "1"
Adh	GeneMarkHMM	CDS	2379	2862	.	-	.	transcript "1"
Adh	GeneMarkHMM	CDS	3225	3550	.	-	.	transcript "1"
Adh	GeneMarkHMM	CDS	6718	7051	.	-	.	transcript "1"
Adh	GeneMarkHMM	stop_codon	7049	7051	.	-	.	transcript "1"
Adh	GeneMarkHMM	start_codon	21599	21601	.	+	.	transcript "2"
Adh	GeneMarkHMM	CDS	21599	21979	.	+	.	transcript "2"
Adh	GeneMarkHMM	CDS	22140	22295	.	+	.	transcript "2"
Adh	GeneMarkHMM	stop_codon	22293	22295	.	+	.	transcript "2"
Adh	GeneMarkHMM	stop_codon	29156	29158	.	-	.	transcript "3"
Adh	GeneMarkHMM	CDS	29156	29479	.	-	.	transcript "3"
Adh	GeneMarkHMM	stop_codon	29477	29479	.	-	.	transcript "3"
Adh	GeneMarkHMM	start_codon	34558	34560	.	+	.	transcript "4"
Adh	GeneMarkHMM	CDS	34558	34822	.	+	.	transcript "4"
Adh	GeneMarkHMM	CDS	34884	35332	.	+	.	transcript "4"
Adh	GeneMarkHMM	stop_codon	35330	35332	.	+	.	transcript "4"
Adh	GeneMarkHMM	stop_codon	35433	35435	.	-	.	transcript "5"
Adh	GeneMarkHMM	CDS	35433	35749	.	-	.	transcript "5"
Adh	GeneMarkHMM	CDS	35938	36226	.	-	.	transcript "5"
Adh	GeneMarkHMM	stop_codon	36224	36226	.	-	.	transcript "5"
Adh	GeneMarkHMM	start_codon	36410	36412	.	+	.	transcript "6"
Adh	GeneMarkHMM	CDS	36410	37315	.	+	.	transcript "6"
Adh	GeneMarkHMM	stop_codon	37313	37315	.	+	.	transcript "6"
Adh	GeneMarkHMM	start_codon	54448	54450	.	+	.	transcript "7"
Adh	GeneMarkHMM	CDS	54448	54572	.	+	.	transcript "7"
Adh	GeneMarkHMM	CDS	55155	55365	.	+	.	transcript "7"
Adh	GeneMarkHMM	CDS	55990	56083	.	+	.	transcript "7"
Adh	GeneMarkHMM	CDS	56155	56456	.	+	.	transcript "7"
Adh	GeneMarkHMM	CDS	56515	56520	.	+	.	transcript "7"
Adh	GeneMarkHMM	stop_codon	56518	56520	.	+	.	transcript "7"
Adh	GeneMarkHMM	stop_codon	89305	89307	.	-	.	transcript "8"
Adh	GeneMarkHMM	CDS	89305	90750	.	-	.	transcript "8"
Adh	GeneMarkHMM	stop_codon	90748	90750	.	-	.	transcript "8"
Adh	GeneMarkHMM	stop_codon	93123	93125	.	-	.	transcript "9"
Adh	GeneMarkHMM	CDS	93123	93999	.	-	.	transcript "9"
Adh	GeneMarkHMM	CDS	94266	94333	.	-	.	transcript "9"
Adh	GeneMarkHMM	stop_codon	94331	94333	.	-	.	transcript "9"
Adh	GeneMarkHMM	start_codon	103746	103748	.	+	.	transcript "10"
Adh	GeneMarkHMM	CDS	103746	103769	.	+	.	transcript "10"
Adh	GeneMarkHMM	CDS	103808	104330	.	+	.	transcript "10"
Adh	GeneMarkHMM	CDS	117406	117527	.	+	.	transcript "10"
Adh	GeneMarkHMM	stop_codon	117525	117527	.	+	.	transcript "10"
Adh	GeneMarkHMM	start_codon	124325	124327	.	+	.	transcript "11"
Adh	GeneMarkHMM	CDS	124325	124936	.	+	.	transcript "11"
Adh	GeneMarkHMM	CDS	127146	127292	.	+	.	transcript "11"
Adh	GeneMarkHMM	CDS	127771	127931	.	+	.	transcript "11"
Adh	GeneMarkHMM	CDS	127991	128225	.	+	.	transcript "11"
Adh	GeneMarkHMM	CDS	128296	129342	.	+	.	transcript "11"
Adh	GeneMarkHMM	CDS	129401	129965	.	+	.	transcript "11"
Adh	GeneMarkHMM	CDS	130136	130285	.	+	.	transcript "11"
Adh	GeneMarkHMM	CDS	131040	131248	.	+	.	transcript "11"
Adh	GeneMarkHMM	stop_codon	131246	131248	.	+	.	transcript "11"
Adh	GeneMarkHMM	stop_codon	133608	133610	.	-	.	transcript "12"
Adh	GeneMarkHMM	CDS	133608	134233	.	-	.	transcript "12"
Adh	GeneMarkHMM	CDS	134862	134967	.	-	.	transcript "12"
Adh	GeneMarkHMM	stop_codon	134965	134967	.	-	.	transcript "12"
Adh	GeneMarkHMM	start_codon	159578	159580	.	+	.	transcript "13"
Adh	GeneMarkHMM	CDS	159578	159799	.	+	.	transcript "13"
Adh	GeneMarkHMM	CDS	161727	162105	.	+	.	transcript "13"
Adh	GeneMarkHMM	CDS	162442	162557	.	+	.	transcript "13"
Adh	GeneMarkHMM	CDS	162616	163137	.	+	.	transcript "13"
Adh	GeneMarkHMM	CDS	163297	163527	.	+	.	transcript "13"
Adh	GeneMarkHMM	stop_codon	163525	163527	.	+	.	transcript "13"
Adh	GeneMarkHMM	start_codon	164127	164129	.	+	.	transcript "14"
Adh	GeneMarkHMM	CDS	164127	164381	.	+	.	transcript "14"
Adh	GeneMarkHMM	CDS	164602	164607	.	+	.	transcript "14"
Adh	GeneMarkHMM	stop_codon	164605	164607	.	+	.	transcript "14"
Adh	GeneMarkHMM	start_codon	168293	168295	.	+	.	transcript "15"
Adh	GeneMarkHMM	CDS	168293	168344	.	+	.	transcript "15"
Adh	GeneMarkHMM	CDS	168413	168503	.	+	.	transcript "15"
Adh	GeneMarkHMM	CDS	168559	168634	.	+	.	transcript "15"
Adh	GeneMarkHMM	stop_codon	168632	168634	.	+	.	transcript "15"
Adh	GeneMarkHMM	stop_codon	171963	171965	.	-	.	transcript "16"
Adh	GeneMarkHMM	CDS	171963	172056	.	-	.	transcript "16"
Adh	GeneMarkHMM	CDS	172369	172562	.	-	.	transcript "16"
Adh	GeneMarkHMM	stop_codon	172560	172562	.	-	.	transcript "16"
Adh	GeneMarkHMM	stop_codon	172620	172622	.	-	.	transcript "17"
Adh	GeneMarkHMM	CDS	172620	172706	.	-	.	transcript "17"
Adh	GeneMarkHMM	CDS	172829	172869	.	-	.	transcript "17"
Adh	GeneMarkHMM	CDS	177956	178015	.	-	.	transcript "17"
Adh	GeneMarkHMM	CDS	178136	178300	.	-	.	transcript "17"
Adh	GeneMarkHMM	CDS	181272	181409	.	-	.	transcript "17"
Adh	GeneMarkHMM	CDS	183107	183496	.	-	.	transcript "17"
Adh	GeneMarkHMM	CDS	183596	183635	.	-	.	transcript "17"
Adh	GeneMarkHMM	CDS	183699	183764	.	-	.	transcript "17"
Adh	GeneMarkHMM	CDS	183835	184040	.	-	.	transcript "17"
Adh	GeneMarkHMM	CDS	184241	184282	.	-	.	transcript "17"
Adh	GeneMarkHMM	CDS	185558	185615	.	-	.	transcript "17"
Adh	GeneMarkHMM	stop_codon	185613	185615	.	-	.	transcript "17"
Adh	GeneMarkHMM	start_codon	202128	202130	.	+	.	transcript "18"
Adh	GeneMarkHMM	CDS	202128	202349	.	+	.	transcript "18"
Adh	GeneMarkHMM	CDS	202410	202646	.	+	.	transcript "18"
Adh	GeneMarkHMM	CDS	202700	204199	.	+	.	transcript "18"
Adh	GeneMarkHMM	stop_codon	204197	204199	.	+	.	transcript "18"
Adh	GeneMarkHMM	stop_codon	214878	214880	.	-	.	transcript "19"
Adh	GeneMarkHMM	CDS	214878	214978	.	-	.	transcript "19"
Adh	GeneMarkHMM	CDS	216182	216761	.	-	.	transcript "19"
Adh	GeneMarkHMM	CDS	216820	217188	.	-	.	transcript "19"
Adh	GeneMarkHMM	stop_codon	217186	217188	.	-	.	transcript "19"
Adh	GeneMarkHMM	start_codon	223587	223589	.	+	.	transcript "20"
Adh	GeneMarkHMM	CDS	223587	223680	.	+	.	transcript "20"
Adh	GeneMarkHMM	CDS	227770	227992	.	+	.	transcript "20"
Adh	GeneMarkHMM	CDS	229841	230462	.	+	.	transcript "20"
Adh	GeneMarkHMM	stop_codon	230460	230462	.	+	.	transcript "20"
Adh	GeneMarkHMM	stop_codon	230999	231001	.	-	.	transcript "21"
Adh	GeneMarkHMM	CDS	230999	231160	.	-	.	transcript "21"
Adh	GeneMarkHMM	CDS	231210	231322	.	-	.	transcript "21"
Adh	GeneMarkHMM	CDS	231417	231549	.	-	.	transcript "21"
Adh	GeneMarkHMM	CDS	234442	234534	.	-	.	transcript "21"
Adh	GeneMarkHMM	CDS	235723	235785	.	-	.	transcript "21"
Adh	GeneMarkHMM	CDS	236646	236810	.	-	.	transcript "21"
Adh	GeneMarkHMM	stop_codon	236808	236810	.	-	.	transcript "21"
Adh	GeneMarkHMM	stop_codon	248109	248111	.	-	.	transcript "22"
Adh	GeneMarkHMM	CDS	248109	248276	.	-	.	transcript "22"
Adh	GeneMarkHMM	CDS	248697	248849	.	-	.	transcript "22"
Adh	GeneMarkHMM	stop_codon	248847	248849	.	-	.	transcript "22"
Adh	GeneMarkHMM	start_codon	264992	264994	.	+	.	transcript "23"
Adh	GeneMarkHMM	CDS	264992	264997	.	+	.	transcript "23"
Adh	GeneMarkHMM	CDS	265088	266322	.	+	.	transcript "23"
Adh	GeneMarkHMM	CDS	266392	266619	.	+	.	transcript "23"
Adh	GeneMarkHMM	CDS	266684	266795	.	+	.	transcript "23"
Adh	GeneMarkHMM	CDS	266856	266867	.	+	.	transcript "23"
Adh	GeneMarkHMM	CDS	266935	266945	.	+	.	transcript "23"
Adh	GeneMarkHMM	CDS	267003	267073	.	+	.	transcript "23"
Adh	GeneMarkHMM	CDS	267134	267234	.	+	.	transcript "23"
Adh	GeneMarkHMM	stop_codon	267232	267234	.	+	.	transcript "23"
Adh	GeneMarkHMM	stop_codon	268751	268753	.	-	.	transcript "24"
Adh	GeneMarkHMM	CDS	268751	268798	.	-	.	transcript "24"
Adh	GeneMarkHMM	CDS	268994	269157	.	-	.	transcript "24"
Adh	GeneMarkHMM	CDS	269222	269559	.	-	.	transcript "24"
Adh	GeneMarkHMM	CDS	269629	269907	.	-	.	transcript "24"
Adh	GeneMarkHMM	CDS	271522	271573	.	-	.	transcript "24"
Adh	GeneMarkHMM	CDS	273396	273483	.	-	.	transcript "24"
Adh	GeneMarkHMM	stop_codon	273481	273483	.	-	.	transcript "24"
Adh	GeneMarkHMM	start_codon	274763	274765	.	+	.	transcript "25"
Adh	GeneMarkHMM	CDS	274763	275848	.	+	.	transcript "25"
Adh	GeneMarkHMM	stop_codon	275846	275848	.	+	.	transcript "25"
Adh	GeneMarkHMM	stop_codon	276361	276363	.	-	.	transcript "26"
Adh	GeneMarkHMM	CDS	276361	276696	.	-	.	transcript "26"
Adh	GeneMarkHMM	CDS	276748	277188	.	-	.	transcript "26"
Adh	GeneMarkHMM	stop_codon	277186	277188	.	-	.	transcript "26"
Adh	GeneMarkHMM	start_codon	277921	277923	.	+	.	transcript "27"
Adh	GeneMarkHMM	CDS	277921	278103	.	+	.	transcript "27"
Adh	GeneMarkHMM	CDS	278222	278345	.	+	.	transcript "27"
Adh	GeneMarkHMM	CDS	278537	278737	.	+	.	transcript "27"
Adh	GeneMarkHMM	CDS	278802	279272	.	+	.	transcript "27"
Adh	GeneMarkHMM	CDS	279548	279726	.	+	.	transcript "27"
Adh	GeneMarkHMM	CDS	280031	280247	.	+	.	transcript "27"
Adh	GeneMarkHMM	CDS	280310	280610	.	+	.	transcript "27"
Adh	GeneMarkHMM	CDS	280674	280986	.	+	.	transcript "27"
Adh	GeneMarkHMM	CDS	281051	281202	.	+	.	transcript "27"
Adh	GeneMarkHMM	CDS	281264	281390	.	+	.	transcript "27"
Adh	GeneMarkHMM	CDS	281550	281787	.	+	.	transcript "27"
Adh	GeneMarkHMM	CDS	281848	282471	.	+	.	transcript "27"
Adh	GeneMarkHMM	CDS	282539	283541	.	+	.	transcript "27"
Adh	GeneMarkHMM	CDS	283608	284052	.	+	.	transcript "27"
Adh	GeneMarkHMM	stop_codon	284050	284052	.	+	.	transcript "27"
Adh	GeneMarkHMM	start_codon	284779	284781	.	+	.	transcript "28"
Adh	GeneMarkHMM	CDS	284779	284915	.	+	.	transcript "28"
Adh	GeneMarkHMM	CDS	284969	285346	.	+	.	transcript "28"
Adh	GeneMarkHMM	CDS	285416	286886	.	+	.	transcript "28"
Adh	GeneMarkHMM	stop_codon	286884	286886	.	+	.	transcript "28"
Adh	GeneMarkHMM	start_codon	287599	287601	.	+	.	transcript "29"
Adh	GeneMarkHMM	CDS	287599	288379	.	+	.	transcript "29"
Adh	GeneMarkHMM	CDS	288647	292689	.	+	.	transcript "29"
Adh	GeneMarkHMM	CDS	292759	292896	.	+	.	transcript "29"
Adh	GeneMarkHMM	stop_codon	292894	292896	.	+	.	transcript "29"
Adh	GeneMarkHMM	start_codon	297680	297682	.	+	.	transcript "30"
Adh	GeneMarkHMM	CDS	297680	297713	.	+	.	transcript "30"
Adh	GeneMarkHMM	CDS	302560	302718	.	+	.	transcript "30"
Adh	GeneMarkHMM	CDS	302786	303405	.	+	.	transcript "30"
Adh	GeneMarkHMM	stop_codon	303403	303405	.	+	.	transcript "30"
Adh	GeneMarkHMM	stop_codon	303960	303962	.	-	.	transcript "31"
Adh	GeneMarkHMM	CDS	303960	304272	.	-	.	transcript "31"
Adh	GeneMarkHMM	CDS	304330	305201	.	-	.	transcript "31"
Adh	GeneMarkHMM	stop_codon	305199	305201	.	-	.	transcript "31"
Adh	GeneMarkHMM	start_codon	305396	305398	.	+	.	transcript "32"
Adh	GeneMarkHMM	CDS	305396	305516	.	+	.	transcript "32"
Adh	GeneMarkHMM	CDS	305577	305737	.	+	.	transcript "32"
Adh	GeneMarkHMM	CDS	305803	306108	.	+	.	transcript "32"
Adh	GeneMarkHMM	CDS	306230	306385	.	+	.	transcript "32"
Adh	GeneMarkHMM	stop_codon	306383	306385	.	+	.	transcript "32"
Adh	GeneMarkHMM	stop_codon	306476	306478	.	-	.	transcript "33"
Adh	GeneMarkHMM	CDS	306476	306985	.	-	.	transcript "33"
Adh	GeneMarkHMM	stop_codon	306983	306985	.	-	.	transcript "33"
Adh	GeneMarkHMM	start_codon	307774	307776	.	+	.	transcript "34"
Adh	GeneMarkHMM	CDS	307774	307790	.	+	.	transcript "34"
Adh	GeneMarkHMM	CDS	307841	309056	.	+	.	transcript "34"
Adh	GeneMarkHMM	CDS	309110	309467	.	+	.	transcript "34"
Adh	GeneMarkHMM	CDS	309530	310452	.	+	.	transcript "34"
Adh	GeneMarkHMM	CDS	310517	311365	.	+	.	transcript "34"
Adh	GeneMarkHMM	CDS	311428	312318	.	+	.	transcript "34"
Adh	GeneMarkHMM	CDS	312387	313020	.	+	.	transcript "34"
Adh	GeneMarkHMM	CDS	313086	313091	.	+	.	transcript "34"
Adh	GeneMarkHMM	CDS	314121	314181	.	+	.	transcript "34"
Adh	GeneMarkHMM	CDS	315200	315899	.	+	.	transcript "34"
Adh	GeneMarkHMM	CDS	316433	316800	.	+	.	transcript "34"
Adh	GeneMarkHMM	CDS	316865	317462	.	+	.	transcript "34"
Adh	GeneMarkHMM	stop_codon	317460	317462	.	+	.	transcript "34"
Adh	GeneMarkHMM	stop_codon	317803	317805	.	-	.	transcript "35"
Adh	GeneMarkHMM	CDS	317803	317843	.	-	.	transcript "35"
Adh	GeneMarkHMM	CDS	317896	318548	.	-	.	transcript "35"
Adh	GeneMarkHMM	CDS	318608	319430	.	-	.	transcript "35"
Adh	GeneMarkHMM	CDS	319486	321443	.	-	.	transcript "35"
Adh	GeneMarkHMM	CDS	321968	323027	.	-	.	transcript "35"
Adh	GeneMarkHMM	CDS	323097	323169	.	-	.	transcript "35"
Adh	GeneMarkHMM	stop_codon	323167	323169	.	-	.	transcript "35"
Adh	GeneMarkHMM	start_codon	323788	323790	.	+	.	transcript "36"
Adh	GeneMarkHMM	CDS	323788	324885	.	+	.	transcript "36"
Adh	GeneMarkHMM	CDS	324939	325223	.	+	.	transcript "36"
Adh	GeneMarkHMM	stop_codon	325221	325223	.	+	.	transcript "36"
Adh	GeneMarkHMM	stop_codon	325240	325242	.	-	.	transcript "37"
Adh	GeneMarkHMM	CDS	325240	325634	.	-	.	transcript "37"
Adh	GeneMarkHMM	CDS	325689	326352	.	-	.	transcript "37"
Adh	GeneMarkHMM	CDS	326433	326822	.	-	.	transcript "37"
Adh	GeneMarkHMM	stop_codon	326820	326822	.	-	.	transcript "37"
Adh	GeneMarkHMM	start_codon	327175	327177	.	+	.	transcript "38"
Adh	GeneMarkHMM	CDS	327175	328002	.	+	.	transcript "38"
Adh	GeneMarkHMM	stop_codon	328000	328002	.	+	.	transcript "38"
Adh	GeneMarkHMM	stop_codon	328048	328050	.	-	.	transcript "39"
Adh	GeneMarkHMM	CDS	328048	328411	.	-	.	transcript "39"
Adh	GeneMarkHMM	CDS	328473	328634	.	-	.	transcript "39"
Adh	GeneMarkHMM	CDS	328690	328733	.	-	.	transcript "39"
Adh	GeneMarkHMM	stop_codon	328731	328733	.	-	.	transcript "39"
Adh	GeneMarkHMM	start_codon	329808	329810	.	+	.	transcript "40"
Adh	GeneMarkHMM	CDS	329808	330183	.	+	.	transcript "40"
Adh	GeneMarkHMM	CDS	330239	330252	.	+	.	transcript "40"
Adh	GeneMarkHMM	stop_codon	330250	330252	.	+	.	transcript "40"
Adh	GeneMarkHMM	stop_codon	331099	331101	.	-	.	transcript "41"
Adh	GeneMarkHMM	CDS	331099	331197	.	-	.	transcript "41"
Adh	GeneMarkHMM	CDS	334622	334786	.	-	.	transcript "41"
Adh	GeneMarkHMM	CDS	334847	335125	.	-	.	transcript "41"
Adh	GeneMarkHMM	CDS	335195	335202	.	-	.	transcript "41"
Adh	GeneMarkHMM	CDS	336703	337323	.	-	.	transcript "41"
Adh	GeneMarkHMM	CDS	337379	337457	.	-	.	transcript "41"
Adh	GeneMarkHMM	stop_codon	337455	337457	.	-	.	transcript "41"
Adh	GeneMarkHMM	stop_codon	338167	338169	.	-	.	transcript "42"
Adh	GeneMarkHMM	CDS	338167	338879	.	-	.	transcript "42"
Adh	GeneMarkHMM	CDS	338944	339013	.	-	.	transcript "42"
Adh	GeneMarkHMM	stop_codon	339011	339013	.	-	.	transcript "42"
Adh	GeneMarkHMM	start_codon	340529	340531	.	+	.	transcript "43"
Adh	GeneMarkHMM	CDS	340529	340634	.	+	.	transcript "43"
Adh	GeneMarkHMM	CDS	340705	340870	.	+	.	transcript "43"
Adh	GeneMarkHMM	CDS	340926	341517	.	+	.	transcript "43"
Adh	GeneMarkHMM	stop_codon	341515	341517	.	+	.	transcript "43"
Adh	GeneMarkHMM	start_codon	341713	341715	.	+	.	transcript "44"
Adh	GeneMarkHMM	CDS	341713	341857	.	+	.	transcript "44"
Adh	GeneMarkHMM	CDS	342003	342751	.	+	.	transcript "44"
Adh	GeneMarkHMM	stop_codon	342749	342751	.	+	.	transcript "44"
Adh	GeneMarkHMM	start_codon	343169	343171	.	+	.	transcript "45"
Adh	GeneMarkHMM	CDS	343169	343368	.	+	.	transcript "45"
Adh	GeneMarkHMM	CDS	343432	343984	.	+	.	transcript "45"
Adh	GeneMarkHMM	stop_codon	343982	343984	.	+	.	transcript "45"
Adh	GeneMarkHMM	stop_codon	354817	354819	.	-	.	transcript "46"
Adh	GeneMarkHMM	CDS	354817	354964	.	-	.	transcript "46"
Adh	GeneMarkHMM	CDS	359448	359547	.	-	.	transcript "46"
Adh	GeneMarkHMM	CDS	360189	360259	.	-	.	transcript "46"
Adh	GeneMarkHMM	CDS	360322	360383	.	-	.	transcript "46"
Adh	GeneMarkHMM	stop_codon	360381	360383	.	-	.	transcript "46"
Adh	GeneMarkHMM	start_codon	373286	373288	.	+	.	transcript "47"
Adh	GeneMarkHMM	CDS	373286	373457	.	+	.	transcript "47"
Adh	GeneMarkHMM	CDS	385051	385283	.	+	.	transcript "47"
Adh	GeneMarkHMM	CDS	388780	388921	.	+	.	transcript "47"
Adh	GeneMarkHMM	CDS	389006	389140	.	+	.	transcript "47"
Adh	GeneMarkHMM	CDS	389208	390491	.	+	.	transcript "47"
Adh	GeneMarkHMM	CDS	390556	390673	.	+	.	transcript "47"
Adh	GeneMarkHMM	CDS	390737	391112	.	+	.	transcript "47"
Adh	GeneMarkHMM	CDS	391177	391500	.	+	.	transcript "47"
Adh	GeneMarkHMM	stop_codon	391498	391500	.	+	.	transcript "47"
Adh	GeneMarkHMM	stop_codon	393573	393575	.	-	.	transcript "48"
Adh	GeneMarkHMM	CDS	393573	393814	.	-	.	transcript "48"
Adh	GeneMarkHMM	CDS	393894	394052	.	-	.	transcript "48"
Adh	GeneMarkHMM	CDS	394383	395732	.	-	.	transcript "48"
Adh	GeneMarkHMM	CDS	395826	397468	.	-	.	transcript "48"
Adh	GeneMarkHMM	CDS	397532	397671	.	-	.	transcript "48"
Adh	GeneMarkHMM	stop_codon	397669	397671	.	-	.	transcript "48"
Adh	GeneMarkHMM	start_codon	400338	400340	.	+	.	transcript "49"
Adh	GeneMarkHMM	CDS	400338	400923	.	+	.	transcript "49"
Adh	GeneMarkHMM	CDS	401350	401713	.	+	.	transcript "49"
Adh	GeneMarkHMM	CDS	401775	402341	.	+	.	transcript "49"
Adh	GeneMarkHMM	CDS	402399	402539	.	+	.	transcript "49"
Adh	GeneMarkHMM	CDS	402607	402779	.	+	.	transcript "49"
Adh	GeneMarkHMM	CDS	403234	403277	.	+	.	transcript "49"
Adh	GeneMarkHMM	CDS	403468	404414	.	+	.	transcript "49"
Adh	GeneMarkHMM	CDS	404467	405027	.	+	.	transcript "49"
Adh	GeneMarkHMM	CDS	405085	405391	.	+	.	transcript "49"
Adh	GeneMarkHMM	stop_codon	405389	405391	.	+	.	transcript "49"
Adh	GeneMarkHMM	start_codon	405952	405954	.	+	.	transcript "50"
Adh	GeneMarkHMM	CDS	405952	406314	.	+	.	transcript "50"
Adh	GeneMarkHMM	stop_codon	406312	406314	.	+	.	transcript "50"
Adh	GeneMarkHMM	start_codon	408759	408761	.	+	.	transcript "51"
Adh	GeneMarkHMM	CDS	408759	409001	.	+	.	transcript "51"
Adh	GeneMarkHMM	CDS	409150	409656	.	+	.	transcript "51"
Adh	GeneMarkHMM	CDS	410172	410315	.	+	.	transcript "51"
Adh	GeneMarkHMM	CDS	410372	410612	.	+	.	transcript "51"
Adh	GeneMarkHMM	CDS	410677	411401	.	+	.	transcript "51"
Adh	GeneMarkHMM	CDS	411728	411831	.	+	.	transcript "51"
Adh	GeneMarkHMM	CDS	411898	412000	.	+	.	transcript "51"
Adh	GeneMarkHMM	stop_codon	411998	412000	.	+	.	transcript "51"
Adh	GeneMarkHMM	stop_codon	414755	414757	.	-	.	transcript "52"
Adh	GeneMarkHMM	CDS	414755	414778	.	-	.	transcript "52"
Adh	GeneMarkHMM	CDS	414843	415055	.	-	.	transcript "52"
Adh	GeneMarkHMM	CDS	415401	415519	.	-	.	transcript "52"
Adh	GeneMarkHMM	CDS	415584	416211	.	-	.	transcript "52"
Adh	GeneMarkHMM	CDS	416276	416749	.	-	.	transcript "52"
Adh	GeneMarkHMM	CDS	417100	417111	.	-	.	transcript "52"
Adh	GeneMarkHMM	stop_codon	417109	417111	.	-	.	transcript "52"
Adh	GeneMarkHMM	stop_codon	426746	426748	.	-	.	transcript "53"
Adh	GeneMarkHMM	CDS	426746	427525	.	-	.	transcript "53"
Adh	GeneMarkHMM	stop_codon	427523	427525	.	-	.	transcript "53"
Adh	GeneMarkHMM	stop_codon	438979	438981	.	-	.	transcript "54"
Adh	GeneMarkHMM	CDS	438979	439800	.	-	.	transcript "54"
Adh	GeneMarkHMM	CDS	442718	442849	.	-	.	transcript "54"
Adh	GeneMarkHMM	stop_codon	442847	442849	.	-	.	transcript "54"
Adh	GeneMarkHMM	start_codon	448386	448388	.	+	.	transcript "55"
Adh	GeneMarkHMM	CDS	448386	448426	.	+	.	transcript "55"
Adh	GeneMarkHMM	CDS	448467	448607	.	+	.	transcript "55"
Adh	GeneMarkHMM	CDS	449015	449247	.	+	.	transcript "55"
Adh	GeneMarkHMM	CDS	451667	451902	.	+	.	transcript "55"
Adh	GeneMarkHMM	CDS	451945	452184	.	+	.	transcript "55"
Adh	GeneMarkHMM	stop_codon	452182	452184	.	+	.	transcript "55"
Adh	GeneMarkHMM	start_codon	454209	454211	.	+	.	transcript "56"
Adh	GeneMarkHMM	CDS	454209	454325	.	+	.	transcript "56"
Adh	GeneMarkHMM	CDS	454581	454755	.	+	.	transcript "56"
Adh	GeneMarkHMM	CDS	454814	454931	.	+	.	transcript "56"
Adh	GeneMarkHMM	CDS	454999	455702	.	+	.	transcript "56"
Adh	GeneMarkHMM	CDS	455870	456267	.	+	.	transcript "56"
Adh	GeneMarkHMM	stop_codon	456265	456267	.	+	.	transcript "56"
Adh	GeneMarkHMM	start_codon	457298	457300	.	+	.	transcript "57"
Adh	GeneMarkHMM	CDS	457298	457488	.	+	.	transcript "57"
Adh	GeneMarkHMM	CDS	457649	458206	.	+	.	transcript "57"
Adh	GeneMarkHMM	CDS	458285	458488	.	+	.	transcript "57"
Adh	GeneMarkHMM	CDS	458547	458802	.	+	.	transcript "57"
Adh	GeneMarkHMM	stop_codon	458800	458802	.	+	.	transcript "57"
Adh	GeneMarkHMM	stop_codon	458837	458839	.	-	.	transcript "58"
Adh	GeneMarkHMM	CDS	458837	459146	.	-	.	transcript "58"
Adh	GeneMarkHMM	CDS	459225	459761	.	-	.	transcript "58"
Adh	GeneMarkHMM	CDS	460256	460669	.	-	.	transcript "58"
Adh	GeneMarkHMM	CDS	461291	461443	.	-	.	transcript "58"
Adh	GeneMarkHMM	CDS	461500	461675	.	-	.	transcript "58"
Adh	GeneMarkHMM	CDS	462096	462110	.	-	.	transcript "58"
Adh	GeneMarkHMM	CDS	462179	462584	.	-	.	transcript "58"
Adh	GeneMarkHMM	CDS	462646	463209	.	-	.	transcript "58"
Adh	GeneMarkHMM	CDS	463368	463657	.	-	.	transcript "58"
Adh	GeneMarkHMM	stop_codon	463655	463657	.	-	.	transcript "58"
Adh	GeneMarkHMM	start_codon	464308	464310	.	+	.	transcript "59"
Adh	GeneMarkHMM	CDS	464308	464456	.	+	.	transcript "59"
Adh	GeneMarkHMM	CDS	464888	465434	.	+	.	transcript "59"
Adh	GeneMarkHMM	stop_codon	465432	465434	.	+	.	transcript "59"
Adh	GeneMarkHMM	stop_codon	466308	466310	.	-	.	transcript "60"
Adh	GeneMarkHMM	CDS	466308	466360	.	-	.	transcript "60"
Adh	GeneMarkHMM	CDS	467993	469610	.	-	.	transcript "60"
Adh	GeneMarkHMM	stop_codon	469608	469610	.	-	.	transcript "60"
Adh	GeneMarkHMM	start_codon	471109	471111	.	+	.	transcript "61"
Adh	GeneMarkHMM	CDS	471109	471296	.	+	.	transcript "61"
Adh	GeneMarkHMM	CDS	471441	471687	.	+	.	transcript "61"
Adh	GeneMarkHMM	CDS	471752	471856	.	+	.	transcript "61"
Adh	GeneMarkHMM	CDS	471944	472490	.	+	.	transcript "61"
Adh	GeneMarkHMM	CDS	472557	472823	.	+	.	transcript "61"
Adh	GeneMarkHMM	CDS	472965	473128	.	+	.	transcript "61"
Adh	GeneMarkHMM	stop_codon	473126	473128	.	+	.	transcript "61"
Adh	GeneMarkHMM	start_codon	474097	474099	.	+	.	transcript "62"
Adh	GeneMarkHMM	CDS	474097	474189	.	+	.	transcript "62"
Adh	GeneMarkHMM	CDS	474251	474306	.	+	.	transcript "62"
Adh	GeneMarkHMM	CDS	474365	475283	.	+	.	transcript "62"
Adh	GeneMarkHMM	CDS	475427	476389	.	+	.	transcript "62"
Adh	GeneMarkHMM	stop_codon	476387	476389	.	+	.	transcript "62"
Adh	GeneMarkHMM	stop_codon	477171	477173	.	-	.	transcript "63"
Adh	GeneMarkHMM	CDS	477171	477490	.	-	.	transcript "63"
Adh	GeneMarkHMM	CDS	477548	479329	.	-	.	transcript "63"
Adh	GeneMarkHMM	CDS	479386	479753	.	-	.	transcript "63"
Adh	GeneMarkHMM	CDS	479815	479958	.	-	.	transcript "63"
Adh	GeneMarkHMM	CDS	480016	480081	.	-	.	transcript "63"
Adh	GeneMarkHMM	CDS	480147	480287	.	-	.	transcript "63"
Adh	GeneMarkHMM	CDS	480343	480480	.	-	.	transcript "63"
Adh	GeneMarkHMM	CDS	481570	481638	.	-	.	transcript "63"
Adh	GeneMarkHMM	CDS	484195	484338	.	-	.	transcript "63"
Adh	GeneMarkHMM	CDS	484664	484807	.	-	.	transcript "63"
Adh	GeneMarkHMM	CDS	485391	485462	.	-	.	transcript "63"
Adh	GeneMarkHMM	CDS	486686	487143	.	-	.	transcript "63"
Adh	GeneMarkHMM	stop_codon	487141	487143	.	-	.	transcript "63"
Adh	GeneMarkHMM	start_codon	509545	509547	.	+	.	transcript "64"
Adh	GeneMarkHMM	CDS	509545	509783	.	+	.	transcript "64"
Adh	GeneMarkHMM	CDS	509881	510226	.	+	.	transcript "64"
Adh	GeneMarkHMM	CDS	510287	510786	.	+	.	transcript "64"
Adh	GeneMarkHMM	CDS	511784	512375	.	+	.	transcript "64"
Adh	GeneMarkHMM	CDS	512435	512758	.	+	.	transcript "64"
Adh	GeneMarkHMM	stop_codon	512756	512758	.	+	.	transcript "64"
Adh	GeneMarkHMM	stop_codon	513238	513240	.	-	.	transcript "65"
Adh	GeneMarkHMM	CDS	513238	513921	.	-	.	transcript "65"
Adh	GeneMarkHMM	stop_codon	513919	513921	.	-	.	transcript "65"
Adh	GeneMarkHMM	start_codon	520781	520783	.	+	.	transcript "66"
Adh	GeneMarkHMM	CDS	520781	521850	.	+	.	transcript "66"
Adh	GeneMarkHMM	CDS	522013	522988	.	+	.	transcript "66"
Adh	GeneMarkHMM	stop_codon	522986	522988	.	+	.	transcript "66"
Adh	GeneMarkHMM	stop_codon	523149	523151	.	-	.	transcript "67"
Adh	GeneMarkHMM	CDS	523149	523205	.	-	.	transcript "67"
Adh	GeneMarkHMM	CDS	523404	523601	.	-	.	transcript "67"
Adh	GeneMarkHMM	CDS	523660	524253	.	-	.	transcript "67"
Adh	GeneMarkHMM	CDS	524438	525283	.	-	.	transcript "67"
Adh	GeneMarkHMM	stop_codon	525281	525283	.	-	.	transcript "67"
Adh	GeneMarkHMM	start_codon	527046	527048	.	+	.	transcript "68"
Adh	GeneMarkHMM	CDS	527046	527116	.	+	.	transcript "68"
Adh	GeneMarkHMM	CDS	528099	528231	.	+	.	transcript "68"
Adh	GeneMarkHMM	stop_codon	528229	528231	.	+	.	transcript "68"
Adh	GeneMarkHMM	stop_codon	532974	532976	.	-	.	transcript "69"
Adh	GeneMarkHMM	CDS	532974	533068	.	-	.	transcript "69"
Adh	GeneMarkHMM	CDS	536670	536913	.	-	.	transcript "69"
Adh	GeneMarkHMM	stop_codon	536911	536913	.	-	.	transcript "69"
Adh	GeneMarkHMM	start_codon	541380	541382	.	+	.	transcript "70"
Adh	GeneMarkHMM	CDS	541380	542513	.	+	.	transcript "70"
Adh	GeneMarkHMM	stop_codon	542511	542513	.	+	.	transcript "70"
Adh	GeneMarkHMM	stop_codon	544950	544952	.	-	.	transcript "71"
Adh	GeneMarkHMM	CDS	544950	545051	.	-	.	transcript "71"
Adh	GeneMarkHMM	CDS	553888	554016	.	-	.	transcript "71"
Adh	GeneMarkHMM	stop_codon	554014	554016	.	-	.	transcript "71"
Adh	GeneMarkHMM	start_codon	555360	555362	.	+	.	transcript "72"
Adh	GeneMarkHMM	CDS	555360	555824	.	+	.	transcript "72"
Adh	GeneMarkHMM	CDS	555920	556168	.	+	.	transcript "72"
Adh	GeneMarkHMM	CDS	556228	556260	.	+	.	transcript "72"
Adh	GeneMarkHMM	stop_codon	556258	556260	.	+	.	transcript "72"
Adh	GeneMarkHMM	start_codon	570015	570017	.	+	.	transcript "73"
Adh	GeneMarkHMM	CDS	570015	570098	.	+	.	transcript "73"
Adh	GeneMarkHMM	CDS	570329	570703	.	+	.	transcript "73"
Adh	GeneMarkHMM	CDS	570872	570947	.	+	.	transcript "73"
Adh	GeneMarkHMM	CDS	574289	574465	.	+	.	transcript "73"
Adh	GeneMarkHMM	CDS	575409	575533	.	+	.	transcript "73"
Adh	GeneMarkHMM	stop_codon	575531	575533	.	+	.	transcript "73"
Adh	GeneMarkHMM	stop_codon	581722	581724	.	-	.	transcript "74"
Adh	GeneMarkHMM	CDS	581722	581866	.	-	.	transcript "74"
Adh	GeneMarkHMM	CDS	589628	589720	.	-	.	transcript "74"
Adh	GeneMarkHMM	CDS	590105	590169	.	-	.	transcript "74"
Adh	GeneMarkHMM	stop_codon	590167	590169	.	-	.	transcript "74"
Adh	GeneMarkHMM	start_codon	598403	598405	.	+	.	transcript "75"
Adh	GeneMarkHMM	CDS	598403	598796	.	+	.	transcript "75"
Adh	GeneMarkHMM	CDS	598857	599119	.	+	.	transcript "75"
Adh	GeneMarkHMM	CDS	599219	600433	.	+	.	transcript "75"
Adh	GeneMarkHMM	stop_codon	600431	600433	.	+	.	transcript "75"
Adh	GeneMarkHMM	stop_codon	601945	601947	.	-	.	transcript "76"
Adh	GeneMarkHMM	CDS	601945	602889	.	-	.	transcript "76"
Adh	GeneMarkHMM	CDS	602944	603029	.	-	.	transcript "76"
Adh	GeneMarkHMM	CDS	603477	604158	.	-	.	transcript "76"
Adh	GeneMarkHMM	stop_codon	604156	604158	.	-	.	transcript "76"
Adh	GeneMarkHMM	stop_codon	620744	620746	.	-	.	transcript "77"
Adh	GeneMarkHMM	CDS	620744	620960	.	-	.	transcript "77"
Adh	GeneMarkHMM	CDS	622933	623026	.	-	.	transcript "77"
Adh	GeneMarkHMM	CDS	623090	623174	.	-	.	transcript "77"
Adh	GeneMarkHMM	stop_codon	623172	623174	.	-	.	transcript "77"
Adh	GeneMarkHMM	start_codon	647744	647746	.	+	.	transcript "78"
Adh	GeneMarkHMM	CDS	647744	647830	.	+	.	transcript "78"
Adh	GeneMarkHMM	CDS	650611	651153	.	+	.	transcript "78"
Adh	GeneMarkHMM	CDS	651278	651478	.	+	.	transcript "78"
Adh	GeneMarkHMM	CDS	651583	652282	.	+	.	transcript "78"
Adh	GeneMarkHMM	CDS	652397	652824	.	+	.	transcript "78"
Adh	GeneMarkHMM	stop_codon	652822	652824	.	+	.	transcript "78"
Adh	GeneMarkHMM	stop_codon	654984	654986	.	-	.	transcript "79"
Adh	GeneMarkHMM	CDS	654984	656089	.	-	.	transcript "79"
Adh	GeneMarkHMM	CDS	656165	656741	.	-	.	transcript "79"
Adh	GeneMarkHMM	CDS	657724	658001	.	-	.	transcript "79"
Adh	GeneMarkHMM	CDS	658058	658265	.	-	.	transcript "79"
Adh	GeneMarkHMM	CDS	658326	658463	.	-	.	transcript "79"
Adh	GeneMarkHMM	CDS	658526	660852	.	-	.	transcript "79"
Adh	GeneMarkHMM	CDS	660917	661331	.	-	.	transcript "79"
Adh	GeneMarkHMM	CDS	662947	662971	.	-	.	transcript "79"
Adh	GeneMarkHMM	CDS	664035	664204	.	-	.	transcript "79"
Adh	GeneMarkHMM	stop_codon	664202	664204	.	-	.	transcript "79"
Adh	GeneMarkHMM	start_codon	672131	672133	.	+	.	transcript "80"
Adh	GeneMarkHMM	CDS	672131	672241	.	+	.	transcript "80"
Adh	GeneMarkHMM	CDS	672515	672520	.	+	.	transcript "80"
Adh	GeneMarkHMM	stop_codon	672518	672520	.	+	.	transcript "80"
Adh	GeneMarkHMM	stop_codon	679874	679876	.	-	.	transcript "81"
Adh	GeneMarkHMM	CDS	679874	680889	.	-	.	transcript "81"
Adh	GeneMarkHMM	CDS	681905	682015	.	-	.	transcript "81"
Adh	GeneMarkHMM	CDS	682600	682750	.	-	.	transcript "81"
Adh	GeneMarkHMM	CDS	682831	682969	.	-	.	transcript "81"
Adh	GeneMarkHMM	CDS	689469	689746	.	-	.	transcript "81"
Adh	GeneMarkHMM	CDS	689811	689983	.	-	.	transcript "81"
Adh	GeneMarkHMM	CDS	690663	691029	.	-	.	transcript "81"
Adh	GeneMarkHMM	CDS	691393	691416	.	-	.	transcript "81"
Adh	GeneMarkHMM	stop_codon	691414	691416	.	-	.	transcript "81"
Adh	GeneMarkHMM	start_codon	720335	720337	.	+	.	transcript "82"
Adh	GeneMarkHMM	CDS	720335	720408	.	+	.	transcript "82"
Adh	GeneMarkHMM	CDS	720479	720493	.	+	.	transcript "82"
Adh	GeneMarkHMM	CDS	720757	720823	.	+	.	transcript "82"
Adh	GeneMarkHMM	stop_codon	720821	720823	.	+	.	transcript "82"
Adh	GeneMarkHMM	start_codon	757457	757459	.	+	.	transcript "83"
Adh	GeneMarkHMM	CDS	757457	757859	.	+	.	transcript "83"
Adh	GeneMarkHMM	CDS	758124	758188	.	+	.	transcript "83"
Adh	GeneMarkHMM	stop_codon	758186	758188	.	+	.	transcript "83"
Adh	GeneMarkHMM	stop_codon	763773	763775	.	-	.	transcript "84"
Adh	GeneMarkHMM	CDS	763773	763859	.	-	.	transcript "84"
Adh	GeneMarkHMM	CDS	767649	767787	.	-	.	transcript "84"
Adh	GeneMarkHMM	CDS	767844	768100	.	-	.	transcript "84"
Adh	GeneMarkHMM	stop_codon	768098	768100	.	-	.	transcript "84"
Adh	GeneMarkHMM	start_codon	771216	771218	.	+	.	transcript "85"
Adh	GeneMarkHMM	CDS	771216	771615	.	+	.	transcript "85"
Adh	GeneMarkHMM	CDS	771955	772295	.	+	.	transcript "85"
Adh	GeneMarkHMM	CDS	779692	781583	.	+	.	transcript "85"
Adh	GeneMarkHMM	CDS	781886	782726	.	+	.	transcript "85"
Adh	GeneMarkHMM	stop_codon	782724	782726	.	+	.	transcript "85"
Adh	GeneMarkHMM	start_codon	801999	802001	.	+	.	transcript "86"
Adh	GeneMarkHMM	CDS	801999	802914	.	+	.	transcript "86"
Adh	GeneMarkHMM	CDS	813291	814650	.	+	.	transcript "86"
Adh	GeneMarkHMM	CDS	814726	814981	.	+	.	transcript "86"
Adh	GeneMarkHMM	CDS	815046	815442	.	+	.	transcript "86"
Adh	GeneMarkHMM	CDS	815528	817215	.	+	.	transcript "86"
Adh	GeneMarkHMM	CDS	817273	818025	.	+	.	transcript "86"
Adh	GeneMarkHMM	CDS	818086	818367	.	+	.	transcript "86"
Adh	GeneMarkHMM	CDS	818447	818574	.	+	.	transcript "86"
Adh	GeneMarkHMM	CDS	818633	819290	.	+	.	transcript "86"
Adh	GeneMarkHMM	CDS	820171	820789	.	+	.	transcript "86"
Adh	GeneMarkHMM	CDS	820846	820979	.	+	.	transcript "86"
Adh	GeneMarkHMM	CDS	821037	821265	.	+	.	transcript "86"
Adh	GeneMarkHMM	CDS	821333	821487	.	+	.	transcript "86"
Adh	GeneMarkHMM	stop_codon	821485	821487	.	+	.	transcript "86"
Adh	GeneMarkHMM	start_codon	822205	822207	.	+	.	transcript "87"
Adh	GeneMarkHMM	CDS	822205	822454	.	+	.	transcript "87"
Adh	GeneMarkHMM	CDS	822511	822848	.	+	.	transcript "87"
Adh	GeneMarkHMM	CDS	822907	824011	.	+	.	transcript "87"
Adh	GeneMarkHMM	CDS	824074	824822	.	+	.	transcript "87"
Adh	GeneMarkHMM	CDS	824885	825688	.	+	.	transcript "87"
Adh	GeneMarkHMM	CDS	825804	826423	.	+	.	transcript "87"
Adh	GeneMarkHMM	CDS	826499	826533	.	+	.	transcript "87"
Adh	GeneMarkHMM	CDS	826922	827087	.	+	.	transcript "87"
Adh	GeneMarkHMM	CDS	827148	827511	.	+	.	transcript "87"
Adh	GeneMarkHMM	stop_codon	827509	827511	.	+	.	transcript "87"
Adh	GeneMarkHMM	start_codon	828047	828049	.	+	.	transcript "88"
Adh	GeneMarkHMM	CDS	828047	828289	.	+	.	transcript "88"
Adh	GeneMarkHMM	CDS	828734	828739	.	+	.	transcript "88"
Adh	GeneMarkHMM	stop_codon	828737	828739	.	+	.	transcript "88"
Adh	GeneMarkHMM	start_codon	832137	832139	.	+	.	transcript "89"
Adh	GeneMarkHMM	CDS	832137	833668	.	+	.	transcript "89"
Adh	GeneMarkHMM	CDS	835043	835312	.	+	.	transcript "89"
Adh	GeneMarkHMM	CDS	836514	837106	.	+	.	transcript "89"
Adh	GeneMarkHMM	CDS	837173	837428	.	+	.	transcript "89"
Adh	GeneMarkHMM	CDS	837486	837859	.	+	.	transcript "89"
Adh	GeneMarkHMM	CDS	837919	838152	.	+	.	transcript "89"
Adh	GeneMarkHMM	CDS	838217	839076	.	+	.	transcript "89"
Adh	GeneMarkHMM	stop_codon	839074	839076	.	+	.	transcript "89"
Adh	GeneMarkHMM	stop_codon	839723	839725	.	-	.	transcript "90"
Adh	GeneMarkHMM	CDS	839723	839740	.	-	.	transcript "90"
Adh	GeneMarkHMM	CDS	839797	840448	.	-	.	transcript "90"
Adh	GeneMarkHMM	CDS	841061	841127	.	-	.	transcript "90"
Adh	GeneMarkHMM	CDS	841204	841333	.	-	.	transcript "90"
Adh	GeneMarkHMM	CDS	841389	841969	.	-	.	transcript "90"
Adh	GeneMarkHMM	CDS	842034	842419	.	-	.	transcript "90"
Adh	GeneMarkHMM	CDS	842972	843375	.	-	.	transcript "90"
Adh	GeneMarkHMM	CDS	843445	843516	.	-	.	transcript "90"
Adh	GeneMarkHMM	stop_codon	843514	843516	.	-	.	transcript "90"
Adh	GeneMarkHMM	start_codon	845892	845894	.	+	.	transcript "91"
Adh	GeneMarkHMM	CDS	845892	846081	.	+	.	transcript "91"
Adh	GeneMarkHMM	CDS	846134	846339	.	+	.	transcript "91"
Adh	GeneMarkHMM	stop_codon	846337	846339	.	+	.	transcript "91"
Adh	GeneMarkHMM	stop_codon	846397	846399	.	-	.	transcript "92"
Adh	GeneMarkHMM	CDS	846397	847372	.	-	.	transcript "92"
Adh	GeneMarkHMM	CDS	847433	848154	.	-	.	transcript "92"
Adh	GeneMarkHMM	CDS	848208	848609	.	-	.	transcript "92"
Adh	GeneMarkHMM	CDS	848668	848733	.	-	.	transcript "92"
Adh	GeneMarkHMM	stop_codon	848731	848733	.	-	.	transcript "92"
Adh	GeneMarkHMM	start_codon	850944	850946	.	+	.	transcript "93"
Adh	GeneMarkHMM	CDS	850944	851007	.	+	.	transcript "93"
Adh	GeneMarkHMM	CDS	851077	851190	.	+	.	transcript "93"
Adh	GeneMarkHMM	CDS	851256	851436	.	+	.	transcript "93"
Adh	GeneMarkHMM	CDS	851491	851673	.	+	.	transcript "93"
Adh	GeneMarkHMM	CDS	851742	851919	.	+	.	transcript "93"
Adh	GeneMarkHMM	stop_codon	851917	851919	.	+	.	transcript "93"
Adh	GeneMarkHMM	start_codon	853119	853121	.	+	.	transcript "94"
Adh	GeneMarkHMM	CDS	853119	855014	.	+	.	transcript "94"
Adh	GeneMarkHMM	stop_codon	855012	855014	.	+	.	transcript "94"
Adh	GeneMarkHMM	start_codon	855874	855876	.	+	.	transcript "95"
Adh	GeneMarkHMM	CDS	855874	855922	.	+	.	transcript "95"
Adh	GeneMarkHMM	CDS	855982	856031	.	+	.	transcript "95"
Adh	GeneMarkHMM	CDS	856092	856876	.	+	.	transcript "95"
Adh	GeneMarkHMM	CDS	856942	858029	.	+	.	transcript "95"
Adh	GeneMarkHMM	CDS	858109	858341	.	+	.	transcript "95"
Adh	GeneMarkHMM	CDS	858418	858966	.	+	.	transcript "95"
Adh	GeneMarkHMM	stop_codon	858964	858966	.	+	.	transcript "95"
Adh	GeneMarkHMM	stop_codon	870684	870686	.	-	.	transcript "96"
Adh	GeneMarkHMM	CDS	870684	870869	.	-	.	transcript "96"
Adh	GeneMarkHMM	CDS	872590	872818	.	-	.	transcript "96"
Adh	GeneMarkHMM	CDS	872891	873131	.	-	.	transcript "96"
Adh	GeneMarkHMM	CDS	873191	873321	.	-	.	transcript "96"
Adh	GeneMarkHMM	CDS	873388	873527	.	-	.	transcript "96"
Adh	GeneMarkHMM	CDS	873583	874124	.	-	.	transcript "96"
Adh	GeneMarkHMM	CDS	874273	874541	.	-	.	transcript "96"
Adh	GeneMarkHMM	CDS	874599	874870	.	-	.	transcript "96"
Adh	GeneMarkHMM	stop_codon	874868	874870	.	-	.	transcript "96"
Adh	GeneMarkHMM	stop_codon	880859	880861	.	-	.	transcript "97"
Adh	GeneMarkHMM	CDS	880859	881091	.	-	.	transcript "97"
Adh	GeneMarkHMM	CDS	883002	883306	.	-	.	transcript "97"
Adh	GeneMarkHMM	CDS	884917	885676	.	-	.	transcript "97"
Adh	GeneMarkHMM	CDS	885967	886798	.	-	.	transcript "97"
Adh	GeneMarkHMM	CDS	892142	892189	.	-	.	transcript "97"
Adh	GeneMarkHMM	stop_codon	892187	892189	.	-	.	transcript "97"
Adh	GeneMarkHMM	stop_codon	909825	909827	.	-	.	transcript "98"
Adh	GeneMarkHMM	CDS	909825	909970	.	-	.	transcript "98"
Adh	GeneMarkHMM	CDS	910577	910742	.	-	.	transcript "98"
Adh	GeneMarkHMM	CDS	910801	911055	.	-	.	transcript "98"
Adh	GeneMarkHMM	stop_codon	911053	911055	.	-	.	transcript "98"
Adh	GeneMarkHMM	stop_codon	918151	918153	.	-	.	transcript "99"
Adh	GeneMarkHMM	CDS	918151	918795	.	-	.	transcript "99"
Adh	GeneMarkHMM	CDS	918858	918869	.	-	.	transcript "99"
Adh	GeneMarkHMM	stop_codon	918867	918869	.	-	.	transcript "99"
Adh	GeneMarkHMM	stop_codon	944218	944220	.	-	.	transcript "100"
Adh	GeneMarkHMM	CDS	944218	944525	.	-	.	transcript "100"
Adh	GeneMarkHMM	CDS	951618	951760	.	-	.	transcript "100"
Adh	GeneMarkHMM	CDS	951813	951820	.	-	.	transcript "100"
Adh	GeneMarkHMM	stop_codon	951818	951820	.	-	.	transcript "100"
Adh	GeneMarkHMM	start_codon	984981	984983	.	+	.	transcript "101"
Adh	GeneMarkHMM	CDS	984981	985070	.	+	.	transcript "101"
Adh	GeneMarkHMM	CDS	985373	986896	.	+	.	transcript "101"
Adh	GeneMarkHMM	stop_codon	986894	986896	.	+	.	transcript "101"
Adh	GeneMarkHMM	start_codon	1004686	1004688	.	+	.	transcript "102"
Adh	GeneMarkHMM	CDS	1004686	1004817	.	+	.	transcript "102"
Adh	GeneMarkHMM	CDS	1004898	1005095	.	+	.	transcript "102"
Adh	GeneMarkHMM	CDS	1005165	1005281	.	+	.	transcript "102"
Adh	GeneMarkHMM	stop_codon	1005279	1005281	.	+	.	transcript "102"
Adh	GeneMarkHMM	start_codon	1034264	1034266	.	+	.	transcript "103"
Adh	GeneMarkHMM	CDS	1034264	1034416	.	+	.	transcript "103"
Adh	GeneMarkHMM	CDS	1035246	1035251	.	+	.	transcript "103"
Adh	GeneMarkHMM	stop_codon	1035249	1035251	.	+	.	transcript "103"
Adh	GeneMarkHMM	stop_codon	1041376	1041378	.	-	.	transcript "104"
Adh	GeneMarkHMM	CDS	1041376	1041530	.	-	.	transcript "104"
Adh	GeneMarkHMM	CDS	1041602	1041989	.	-	.	transcript "104"
Adh	GeneMarkHMM	CDS	1042386	1042688	.	-	.	transcript "104"
Adh	GeneMarkHMM	stop_codon	1042686	1042688	.	-	.	transcript "104"
Adh	GeneMarkHMM	stop_codon	1051748	1051750	.	-	.	transcript "105"
Adh	GeneMarkHMM	CDS	1051748	1051953	.	-	.	transcript "105"
Adh	GeneMarkHMM	CDS	1056915	1057314	.	-	.	transcript "105"
Adh	GeneMarkHMM	stop_codon	1057312	1057314	.	-	.	transcript "105"
Adh	GeneMarkHMM	start_codon	1070893	1070895	.	+	.	transcript "106"
Adh	GeneMarkHMM	CDS	1070893	1070904	.	+	.	transcript "106"
Adh	GeneMarkHMM	CDS	1071569	1071758	.	+	.	transcript "106"
Adh	GeneMarkHMM	CDS	1071980	1072023	.	+	.	transcript "106"
Adh	GeneMarkHMM	stop_codon	1072021	1072023	.	+	.	transcript "106"
Adh	GeneMarkHMM	start_codon	1078485	1078487	.	+	.	transcript "107"
Adh	GeneMarkHMM	CDS	1078485	1078612	.	+	.	transcript "107"
Adh	GeneMarkHMM	CDS	1079894	1080080	.	+	.	transcript "107"
Adh	GeneMarkHMM	stop_codon	1080078	1080080	.	+	.	transcript "107"
Adh	GeneMarkHMM	stop_codon	1080988	1080990	.	-	.	transcript "108"
Adh	GeneMarkHMM	CDS	1080988	1081079	.	-	.	transcript "108"
Adh	GeneMarkHMM	CDS	1081728	1081893	.	-	.	transcript "108"
Adh	GeneMarkHMM	CDS	1081958	1081969	.	-	.	transcript "108"
Adh	GeneMarkHMM	stop_codon	1081967	1081969	.	-	.	transcript "108"
Adh	GeneMarkHMM	stop_codon	1094414	1094416	.	-	.	transcript "109"
Adh	GeneMarkHMM	CDS	1094414	1094610	.	-	.	transcript "109"
Adh	GeneMarkHMM	CDS	1094867	1095215	.	-	.	transcript "109"
Adh	GeneMarkHMM	CDS	1095422	1095533	.	-	.	transcript "109"
Adh	GeneMarkHMM	CDS	1095586	1095735	.	-	.	transcript "109"
Adh	GeneMarkHMM	CDS	1095848	1095987	.	-	.	transcript "109"
Adh	GeneMarkHMM	CDS	1096062	1096196	.	-	.	transcript "109"
Adh	GeneMarkHMM	CDS	1096326	1098979	.	-	.	transcript "109"
Adh	GeneMarkHMM	CDS	1100157	1100179	.	-	.	transcript "109"
Adh	GeneMarkHMM	CDS	1101376	1101526	.	-	.	transcript "109"
Adh	GeneMarkHMM	CDS	1101584	1101748	.	-	.	transcript "109"
Adh	GeneMarkHMM	CDS	1102937	1102996	.	-	.	transcript "109"
Adh	GeneMarkHMM	CDS	1104419	1104995	.	-	.	transcript "109"
Adh	GeneMarkHMM	CDS	1105635	1105637	.	-	.	transcript "109"
Adh	GeneMarkHMM	stop_codon	1105635	1105637	.	-	.	transcript "109"
Adh	GeneMarkHMM	start_codon	1110074	1110076	.	+	.	transcript "110"
Adh	GeneMarkHMM	CDS	1110074	1110172	.	+	.	transcript "110"
Adh	GeneMarkHMM	CDS	1110238	1110642	.	+	.	transcript "110"
Adh	GeneMarkHMM	CDS	1110713	1110979	.	+	.	transcript "110"
Adh	GeneMarkHMM	stop_codon	1110977	1110979	.	+	.	transcript "110"
Adh	GeneMarkHMM	start_codon	1111283	1111285	.	+	.	transcript "111"
Adh	GeneMarkHMM	CDS	1111283	1111378	.	+	.	transcript "111"
Adh	GeneMarkHMM	CDS	1111805	1112209	.	+	.	transcript "111"
Adh	GeneMarkHMM	CDS	1112261	1112578	.	+	.	transcript "111"
Adh	GeneMarkHMM	stop_codon	1112576	1112578	.	+	.	transcript "111"
Adh	GeneMarkHMM	start_codon	1115048	1115050	.	+	.	transcript "112"
Adh	GeneMarkHMM	CDS	1115048	1115296	.	+	.	transcript "112"
Adh	GeneMarkHMM	CDS	1115816	1115885	.	+	.	transcript "112"
Adh	GeneMarkHMM	CDS	1116315	1116461	.	+	.	transcript "112"
Adh	GeneMarkHMM	CDS	1116582	1116646	.	+	.	transcript "112"
Adh	GeneMarkHMM	CDS	1117462	1117608	.	+	.	transcript "112"
Adh	GeneMarkHMM	stop_codon	1117606	1117608	.	+	.	transcript "112"
Adh	GeneMarkHMM	stop_codon	1144299	1144301	.	-	.	transcript "113"
Adh	GeneMarkHMM	CDS	1144299	1144446	.	-	.	transcript "113"
Adh	GeneMarkHMM	CDS	1146893	1146990	.	-	.	transcript "113"
Adh	GeneMarkHMM	stop_codon	1146988	1146990	.	-	.	transcript "113"
Adh	GeneMarkHMM	stop_codon	1182116	1182118	.	-	.	transcript "114"
Adh	GeneMarkHMM	CDS	1182116	1182130	.	-	.	transcript "114"
Adh	GeneMarkHMM	CDS	1182203	1182415	.	-	.	transcript "114"
Adh	GeneMarkHMM	stop_codon	1182413	1182415	.	-	.	transcript "114"
Adh	GeneMarkHMM	start_codon	1206476	1206478	.	+	.	transcript "115"
Adh	GeneMarkHMM	CDS	1206476	1206487	.	+	.	transcript "115"
Adh	GeneMarkHMM	CDS	1206559	1206786	.	+	.	transcript "115"
Adh	GeneMarkHMM	stop_codon	1206784	1206786	.	+	.	transcript "115"
Adh	GeneMarkHMM	start_codon	1207563	1207565	.	+	.	transcript "116"
Adh	GeneMarkHMM	CDS	1207563	1207574	.	+	.	transcript "116"
Adh	GeneMarkHMM	CDS	1207666	1207953	.	+	.	transcript "116"
Adh	GeneMarkHMM	stop_codon	1207951	1207953	.	+	.	transcript "116"
Adh	GeneMarkHMM	stop_codon	1217048	1217050	.	-	.	transcript "117"
Adh	GeneMarkHMM	CDS	1217048	1217096	.	-	.	transcript "117"
Adh	GeneMarkHMM	CDS	1218725	1220115	.	-	.	transcript "117"
Adh	GeneMarkHMM	CDS	1220188	1220253	.	-	.	transcript "117"
Adh	GeneMarkHMM	CDS	1220453	1221762	.	-	.	transcript "117"
Adh	GeneMarkHMM	CDS	1221977	1222023	.	-	.	transcript "117"
Adh	GeneMarkHMM	CDS	1222078	1222190	.	-	.	transcript "117"
Adh	GeneMarkHMM	CDS	1222250	1222395	.	-	.	transcript "117"
Adh	GeneMarkHMM	CDS	1222483	1222579	.	-	.	transcript "117"
Adh	GeneMarkHMM	stop_codon	1222577	1222579	.	-	.	transcript "117"
Adh	GeneMarkHMM	start_codon	1229684	1229686	.	+	.	transcript "118"
Adh	GeneMarkHMM	CDS	1229684	1230733	.	+	.	transcript "118"
Adh	GeneMarkHMM	stop_codon	1230731	1230733	.	+	.	transcript "118"
Adh	GeneMarkHMM	stop_codon	1231127	1231129	.	-	.	transcript "119"
Adh	GeneMarkHMM	CDS	1231127	1231384	.	-	.	transcript "119"
Adh	GeneMarkHMM	CDS	1231452	1231463	.	-	.	transcript "119"
Adh	GeneMarkHMM	stop_codon	1231461	1231463	.	-	.	transcript "119"
Adh	GeneMarkHMM	start_codon	1232958	1232960	.	+	.	transcript "120"
Adh	GeneMarkHMM	CDS	1232958	1232969	.	+	.	transcript "120"
Adh	GeneMarkHMM	CDS	1233044	1233280	.	+	.	transcript "120"
Adh	GeneMarkHMM	stop_codon	1233278	1233280	.	+	.	transcript "120"
Adh	GeneMarkHMM	start_codon	1250663	1250665	.	+	.	transcript "121"
Adh	GeneMarkHMM	CDS	1250663	1251421	.	+	.	transcript "121"
Adh	GeneMarkHMM	stop_codon	1251419	1251421	.	+	.	transcript "121"
Adh	GeneMarkHMM	start_codon	1252523	1252525	.	+	.	transcript "122"
Adh	GeneMarkHMM	CDS	1252523	1253617	.	+	.	transcript "122"
Adh	GeneMarkHMM	stop_codon	1253615	1253617	.	+	.	transcript "122"
Adh	GeneMarkHMM	start_codon	1255669	1255671	.	+	.	transcript "123"
Adh	GeneMarkHMM	CDS	1255669	1256823	.	+	.	transcript "123"
Adh	GeneMarkHMM	stop_codon	1256821	1256823	.	+	.	transcript "123"
Adh	GeneMarkHMM	stop_codon	1271377	1271379	.	-	.	transcript "124"
Adh	GeneMarkHMM	CDS	1271377	1272140	.	-	.	transcript "124"
Adh	GeneMarkHMM	CDS	1272217	1272395	.	-	.	transcript "124"
Adh	GeneMarkHMM	CDS	1273041	1273498	.	-	.	transcript "124"
Adh	GeneMarkHMM	stop_codon	1273496	1273498	.	-	.	transcript "124"
Adh	GeneMarkHMM	stop_codon	1294081	1294083	.	-	.	transcript "125"
Adh	GeneMarkHMM	CDS	1294081	1294458	.	-	.	transcript "125"
Adh	GeneMarkHMM	CDS	1295677	1296587	.	-	.	transcript "125"
Adh	GeneMarkHMM	CDS	1297137	1298310	.	-	.	transcript "125"
Adh	GeneMarkHMM	stop_codon	1298308	1298310	.	-	.	transcript "125"
Adh	GeneMarkHMM	start_codon	1301126	1301128	.	+	.	transcript "126"
Adh	GeneMarkHMM	CDS	1301126	1301581	.	+	.	transcript "126"
Adh	GeneMarkHMM	CDS	1301671	1301676	.	+	.	transcript "126"
Adh	GeneMarkHMM	stop_codon	1301674	1301676	.	+	.	transcript "126"
Adh	GeneMarkHMM	stop_codon	1333719	1333721	.	-	.	transcript "127"
Adh	GeneMarkHMM	CDS	1333719	1333789	.	-	.	transcript "127"
Adh	GeneMarkHMM	CDS	1334785	1335024	.	-	.	transcript "127"
Adh	GeneMarkHMM	CDS	1335080	1335356	.	-	.	transcript "127"
Adh	GeneMarkHMM	CDS	1335416	1336157	.	-	.	transcript "127"
Adh	GeneMarkHMM	CDS	1337668	1337917	.	-	.	transcript "127"
Adh	GeneMarkHMM	CDS	1338337	1338640	.	-	.	transcript "127"
Adh	GeneMarkHMM	CDS	1338702	1338785	.	-	.	transcript "127"
Adh	GeneMarkHMM	stop_codon	1338783	1338785	.	-	.	transcript "127"
Adh	GeneMarkHMM	stop_codon	1364968	1364970	.	-	.	transcript "128"
Adh	GeneMarkHMM	CDS	1364968	1364994	.	-	.	transcript "128"
Adh	GeneMarkHMM	CDS	1365170	1365361	.	-	.	transcript "128"
Adh	GeneMarkHMM	CDS	1365421	1365611	.	-	.	transcript "128"
Adh	GeneMarkHMM	CDS	1365666	1365732	.	-	.	transcript "128"
Adh	GeneMarkHMM	stop_codon	1365730	1365732	.	-	.	transcript "128"
Adh	GeneMarkHMM	stop_codon	1368793	1368795	.	-	.	transcript "129"
Adh	GeneMarkHMM	CDS	1368793	1368852	.	-	.	transcript "129"
Adh	GeneMarkHMM	CDS	1368902	1369282	.	-	.	transcript "129"
Adh	GeneMarkHMM	stop_codon	1369280	1369282	.	-	.	transcript "129"
Adh	GeneMarkHMM	stop_codon	1371868	1371870	.	-	.	transcript "130"
Adh	GeneMarkHMM	CDS	1371868	1371921	.	-	.	transcript "130"
Adh	GeneMarkHMM	CDS	1371971	1372351	.	-	.	transcript "130"
Adh	GeneMarkHMM	stop_codon	1372349	1372351	.	-	.	transcript "130"
Adh	GeneMarkHMM	stop_codon	1398183	1398185	.	-	.	transcript "131"
Adh	GeneMarkHMM	CDS	1398183	1398833	.	-	.	transcript "131"
Adh	GeneMarkHMM	CDS	1401633	1401874	.	-	.	transcript "131"
Adh	GeneMarkHMM	CDS	1402535	1402643	.	-	.	transcript "131"
Adh	GeneMarkHMM	CDS	1402808	1402995	.	-	.	transcript "131"
Adh	GeneMarkHMM	CDS	1403930	1404111	.	-	.	transcript "131"
Adh	GeneMarkHMM	CDS	1405762	1405903	.	-	.	transcript "131"
Adh	GeneMarkHMM	CDS	1406801	1406882	.	-	.	transcript "131"
Adh	GeneMarkHMM	CDS	1407035	1407146	.	-	.	transcript "131"
Adh	GeneMarkHMM	CDS	1408830	1408924	.	-	.	transcript "131"
Adh	GeneMarkHMM	stop_codon	1408922	1408924	.	-	.	transcript "131"
Adh	GeneMarkHMM	stop_codon	1410778	1410780	.	-	.	transcript "132"
Adh	GeneMarkHMM	CDS	1410778	1410893	.	-	.	transcript "132"
Adh	GeneMarkHMM	CDS	1411600	1411759	.	-	.	transcript "132"
Adh	GeneMarkHMM	CDS	1412512	1412741	.	-	.	transcript "132"
Adh	GeneMarkHMM	CDS	1413335	1413415	.	-	.	transcript "132"
Adh	GeneMarkHMM	CDS	1413651	1413732	.	-	.	transcript "132"
Adh	GeneMarkHMM	CDS	1413798	1413866	.	-	.	transcript "132"
Adh	GeneMarkHMM	stop_codon	1413864	1413866	.	-	.	transcript "132"
Adh	GeneMarkHMM	start_codon	1414397	1414399	.	+	.	transcript "133"
Adh	GeneMarkHMM	CDS	1414397	1414719	.	+	.	transcript "133"
Adh	GeneMarkHMM	CDS	1415068	1418081	.	+	.	transcript "133"
Adh	GeneMarkHMM	CDS	1418142	1419321	.	+	.	transcript "133"
Adh	GeneMarkHMM	CDS	1419378	1419918	.	+	.	transcript "133"
Adh	GeneMarkHMM	stop_codon	1419916	1419918	.	+	.	transcript "133"
Adh	GeneMarkHMM	stop_codon	1421921	1421923	.	-	.	transcript "134"
Adh	GeneMarkHMM	CDS	1421921	1422143	.	-	.	transcript "134"
Adh	GeneMarkHMM	CDS	1422196	1422320	.	-	.	transcript "134"
Adh	GeneMarkHMM	CDS	1424531	1424676	.	-	.	transcript "134"
Adh	GeneMarkHMM	CDS	1424907	1425041	.	-	.	transcript "134"
Adh	GeneMarkHMM	CDS	1425549	1425752	.	-	.	transcript "134"
Adh	GeneMarkHMM	CDS	1426168	1426281	.	-	.	transcript "134"
Adh	GeneMarkHMM	CDS	1426393	1426486	.	-	.	transcript "134"
Adh	GeneMarkHMM	CDS	1428573	1428690	.	-	.	transcript "134"
Adh	GeneMarkHMM	CDS	1431180	1431306	.	-	.	transcript "134"
Adh	GeneMarkHMM	CDS	1431588	1431639	.	-	.	transcript "134"
Adh	GeneMarkHMM	stop_codon	1431637	1431639	.	-	.	transcript "134"
Adh	GeneMarkHMM	stop_codon	1452198	1452200	.	-	.	transcript "135"
Adh	GeneMarkHMM	CDS	1452198	1452238	.	-	.	transcript "135"
Adh	GeneMarkHMM	CDS	1452554	1452758	.	-	.	transcript "135"
Adh	GeneMarkHMM	stop_codon	1452756	1452758	.	-	.	transcript "135"
Adh	GeneMarkHMM	stop_codon	1465977	1465979	.	-	.	transcript "136"
Adh	GeneMarkHMM	CDS	1465977	1466019	.	-	.	transcript "136"
Adh	GeneMarkHMM	CDS	1466153	1466744	.	-	.	transcript "136"
Adh	GeneMarkHMM	CDS	1466876	1467307	.	-	.	transcript "136"
Adh	GeneMarkHMM	CDS	1473611	1473791	.	-	.	transcript "136"
Adh	GeneMarkHMM	stop_codon	1473789	1473791	.	-	.	transcript "136"
Adh	GeneMarkHMM	start_codon	1475691	1475693	.	+	.	transcript "137"
Adh	GeneMarkHMM	CDS	1475691	1476341	.	+	.	transcript "137"
Adh	GeneMarkHMM	CDS	1476426	1476471	.	+	.	transcript "137"
Adh	GeneMarkHMM	CDS	1476547	1476936	.	+	.	transcript "137"
Adh	GeneMarkHMM	CDS	1477482	1477532	.	+	.	transcript "137"
Adh	GeneMarkHMM	CDS	1477581	1477984	.	+	.	transcript "137"
Adh	GeneMarkHMM	CDS	1478054	1478243	.	+	.	transcript "137"
Adh	GeneMarkHMM	CDS	1478631	1478916	.	+	.	transcript "137"
Adh	GeneMarkHMM	CDS	1480627	1480916	.	+	.	transcript "137"
Adh	GeneMarkHMM	CDS	1480974	1481086	.	+	.	transcript "137"
Adh	GeneMarkHMM	stop_codon	1481084	1481086	.	+	.	transcript "137"
Adh	GeneMarkHMM	start_codon	1495484	1495486	.	+	.	transcript "138"
Adh	GeneMarkHMM	CDS	1495484	1495522	.	+	.	transcript "138"
Adh	GeneMarkHMM	CDS	1495620	1495919	.	+	.	transcript "138"
Adh	GeneMarkHMM	CDS	1495977	1496198	.	+	.	transcript "138"
Adh	GeneMarkHMM	stop_codon	1496196	1496198	.	+	.	transcript "138"
Adh	GeneMarkHMM	stop_codon	1496304	1496306	.	-	.	transcript "139"
Adh	GeneMarkHMM	CDS	1496304	1496815	.	-	.	transcript "139"
Adh	GeneMarkHMM	CDS	1496865	1497000	.	-	.	transcript "139"
Adh	GeneMarkHMM	stop_codon	1496998	1497000	.	-	.	transcript "139"
Adh	GeneMarkHMM	start_codon	1497576	1497578	.	+	.	transcript "140"
Adh	GeneMarkHMM	CDS	1497576	1498121	.	+	.	transcript "140"
Adh	GeneMarkHMM	stop_codon	1498119	1498121	.	+	.	transcript "140"
Adh	GeneMarkHMM	stop_codon	1498334	1498336	.	-	.	transcript "141"
Adh	GeneMarkHMM	CDS	1498334	1499046	.	-	.	transcript "141"
Adh	GeneMarkHMM	CDS	1499102	1499249	.	-	.	transcript "141"
Adh	GeneMarkHMM	stop_codon	1499247	1499249	.	-	.	transcript "141"
Adh	GeneMarkHMM	start_codon	1499670	1499672	.	+	.	transcript "142"
Adh	GeneMarkHMM	CDS	1499670	1500797	.	+	.	transcript "142"
Adh	GeneMarkHMM	CDS	1502039	1502044	.	+	.	transcript "142"
Adh	GeneMarkHMM	stop_codon	1502042	1502044	.	+	.	transcript "142"
Adh	GeneMarkHMM	start_codon	1510747	1510749	.	+	.	transcript "143"
Adh	GeneMarkHMM	CDS	1510747	1510998	.	+	.	transcript "143"
Adh	GeneMarkHMM	CDS	1515041	1515175	.	+	.	transcript "143"
Adh	GeneMarkHMM	CDS	1515266	1515436	.	+	.	transcript "143"
Adh	GeneMarkHMM	CDS	1515498	1515714	.	+	.	transcript "143"
Adh	GeneMarkHMM	CDS	1515807	1515972	.	+	.	transcript "143"
Adh	GeneMarkHMM	CDS	1516036	1516279	.	+	.	transcript "143"
Adh	GeneMarkHMM	CDS	1516339	1516488	.	+	.	transcript "143"
Adh	GeneMarkHMM	CDS	1517178	1518249	.	+	.	transcript "143"
Adh	GeneMarkHMM	CDS	1518424	1518804	.	+	.	transcript "143"
Adh	GeneMarkHMM	CDS	1518877	1518968	.	+	.	transcript "143"
Adh	GeneMarkHMM	CDS	1519240	1519382	.	+	.	transcript "143"
Adh	GeneMarkHMM	CDS	1519441	1519564	.	+	.	transcript "143"
Adh	GeneMarkHMM	CDS	1519897	1520023	.	+	.	transcript "143"
Adh	GeneMarkHMM	CDS	1520081	1520337	.	+	.	transcript "143"
Adh	GeneMarkHMM	CDS	1520398	1520535	.	+	.	transcript "143"
Adh	GeneMarkHMM	CDS	1521654	1521842	.	+	.	transcript "143"
Adh	GeneMarkHMM	stop_codon	1521840	1521842	.	+	.	transcript "143"
Adh	GeneMarkHMM	start_codon	1525215	1525217	.	+	.	transcript "144"
Adh	GeneMarkHMM	CDS	1525215	1525447	.	+	.	transcript "144"
Adh	GeneMarkHMM	CDS	1526237	1526642	.	+	.	transcript "144"
Adh	GeneMarkHMM	CDS	1526702	1527379	.	+	.	transcript "144"
Adh	GeneMarkHMM	stop_codon	1527377	1527379	.	+	.	transcript "144"
Adh	GeneMarkHMM	stop_codon	1527523	1527525	.	-	.	transcript "145"
Adh	GeneMarkHMM	CDS	1527523	1527636	.	-	.	transcript "145"
Adh	GeneMarkHMM	CDS	1527705	1528201	.	-	.	transcript "145"
Adh	GeneMarkHMM	CDS	1528291	1528426	.	-	.	transcript "145"
Adh	GeneMarkHMM	stop_codon	1528424	1528426	.	-	.	transcript "145"
Adh	GeneMarkHMM	start_codon	1529588	1529590	.	+	.	transcript "146"
Adh	GeneMarkHMM	CDS	1529588	1529971	.	+	.	transcript "146"
Adh	GeneMarkHMM	CDS	1530746	1531626	.	+	.	transcript "146"
Adh	GeneMarkHMM	CDS	1531685	1531892	.	+	.	transcript "146"
Adh	GeneMarkHMM	CDS	1531958	1532269	.	+	.	transcript "146"
Adh	GeneMarkHMM	stop_codon	1532267	1532269	.	+	.	transcript "146"
Adh	GeneMarkHMM	stop_codon	1533935	1533937	.	-	.	transcript "147"
Adh	GeneMarkHMM	CDS	1533935	1534013	.	-	.	transcript "147"
Adh	GeneMarkHMM	CDS	1535066	1535271	.	-	.	transcript "147"
Adh	GeneMarkHMM	CDS	1535341	1535461	.	-	.	transcript "147"
Adh	GeneMarkHMM	CDS	1535530	1535676	.	-	.	transcript "147"
Adh	GeneMarkHMM	CDS	1535739	1536304	.	-	.	transcript "147"
Adh	GeneMarkHMM	CDS	1536364	1537150	.	-	.	transcript "147"
Adh	GeneMarkHMM	CDS	1537212	1538662	.	-	.	transcript "147"
Adh	GeneMarkHMM	CDS	1538719	1541113	.	-	.	transcript "147"
Adh	GeneMarkHMM	CDS	1541178	1541378	.	-	.	transcript "147"
Adh	GeneMarkHMM	CDS	1541445	1541794	.	-	.	transcript "147"
Adh	GeneMarkHMM	CDS	1542125	1542385	.	-	.	transcript "147"
Adh	GeneMarkHMM	CDS	1542861	1542932	.	-	.	transcript "147"
Adh	GeneMarkHMM	stop_codon	1542930	1542932	.	-	.	transcript "147"
Adh	GeneMarkHMM	start_codon	1547954	1547956	.	+	.	transcript "148"
Adh	GeneMarkHMM	CDS	1547954	1548151	.	+	.	transcript "148"
Adh	GeneMarkHMM	CDS	1548215	1548319	.	+	.	transcript "148"
Adh	GeneMarkHMM	CDS	1548383	1548538	.	+	.	transcript "148"
Adh	GeneMarkHMM	stop_codon	1548536	1548538	.	+	.	transcript "148"
Adh	GeneMarkHMM	stop_codon	1549142	1549144	.	-	.	transcript "149"
Adh	GeneMarkHMM	CDS	1549142	1550017	.	-	.	transcript "149"
Adh	GeneMarkHMM	CDS	1550084	1550149	.	-	.	transcript "149"
Adh	GeneMarkHMM	stop_codon	1550147	1550149	.	-	.	transcript "149"
Adh	GeneMarkHMM	stop_codon	1554085	1554087	.	-	.	transcript "150"
Adh	GeneMarkHMM	CDS	1554085	1554599	.	-	.	transcript "150"
Adh	GeneMarkHMM	CDS	1554841	1555107	.	-	.	transcript "150"
Adh	GeneMarkHMM	CDS	1556588	1557278	.	-	.	transcript "150"
Adh	GeneMarkHMM	stop_codon	1557276	1557278	.	-	.	transcript "150"
Adh	GeneMarkHMM	start_codon	1558057	1558059	.	+	.	transcript "151"
Adh	GeneMarkHMM	CDS	1558057	1558080	.	+	.	transcript "151"
Adh	GeneMarkHMM	CDS	1558134	1558521	.	+	.	transcript "151"
Adh	GeneMarkHMM	CDS	1558685	1559747	.	+	.	transcript "151"
Adh	GeneMarkHMM	CDS	1560329	1560435	.	+	.	transcript "151"
Adh	GeneMarkHMM	CDS	1560565	1561671	.	+	.	transcript "151"
Adh	GeneMarkHMM	CDS	1561989	1562278	.	+	.	transcript "151"
Adh	GeneMarkHMM	CDS	1562338	1563081	.	+	.	transcript "151"
Adh	GeneMarkHMM	CDS	1563140	1563353	.	+	.	transcript "151"
Adh	GeneMarkHMM	CDS	1563418	1563689	.	+	.	transcript "151"
Adh	GeneMarkHMM	CDS	1563761	1563814	.	+	.	transcript "151"
Adh	GeneMarkHMM	stop_codon	1563812	1563814	.	+	.	transcript "151"
Adh	GeneMarkHMM	start_codon	1565296	1565298	.	+	.	transcript "152"
Adh	GeneMarkHMM	CDS	1565296	1565530	.	+	.	transcript "152"
Adh	GeneMarkHMM	CDS	1576691	1576943	.	+	.	transcript "152"
Adh	GeneMarkHMM	CDS	1577036	1577406	.	+	.	transcript "152"
Adh	GeneMarkHMM	CDS	1577568	1577860	.	+	.	transcript "152"
Adh	GeneMarkHMM	CDS	1577926	1578009	.	+	.	transcript "152"
Adh	GeneMarkHMM	CDS	1580550	1580685	.	+	.	transcript "152"
Adh	GeneMarkHMM	CDS	1580750	1580810	.	+	.	transcript "152"
Adh	GeneMarkHMM	CDS	1580859	1580880	.	+	.	transcript "152"
Adh	GeneMarkHMM	CDS	1580946	1581227	.	+	.	transcript "152"
Adh	GeneMarkHMM	CDS	1581294	1581623	.	+	.	transcript "152"
Adh	GeneMarkHMM	CDS	1581774	1582136	.	+	.	transcript "152"
Adh	GeneMarkHMM	CDS	1582201	1582292	.	+	.	transcript "152"
Adh	GeneMarkHMM	CDS	1582550	1582687	.	+	.	transcript "152"
Adh	GeneMarkHMM	CDS	1583070	1583334	.	+	.	transcript "152"
Adh	GeneMarkHMM	CDS	1584330	1584828	.	+	.	transcript "152"
Adh	GeneMarkHMM	CDS	1584949	1585094	.	+	.	transcript "152"
Adh	GeneMarkHMM	CDS	1585153	1585380	.	+	.	transcript "152"
Adh	GeneMarkHMM	stop_codon	1585378	1585380	.	+	.	transcript "152"
Adh	GeneMarkHMM	stop_codon	1591829	1591831	.	-	.	transcript "153"
Adh	GeneMarkHMM	CDS	1591829	1592257	.	-	.	transcript "153"
Adh	GeneMarkHMM	CDS	1597193	1597255	.	-	.	transcript "153"
Adh	GeneMarkHMM	stop_codon	1597253	1597255	.	-	.	transcript "153"
Adh	GeneMarkHMM	start_codon	1599218	1599220	.	+	.	transcript "154"
Adh	GeneMarkHMM	CDS	1599218	1600177	.	+	.	transcript "154"
Adh	GeneMarkHMM	CDS	1601744	1602527	.	+	.	transcript "154"
Adh	GeneMarkHMM	CDS	1603293	1603885	.	+	.	transcript "154"
Adh	GeneMarkHMM	CDS	1603963	1605404	.	+	.	transcript "154"
Adh	GeneMarkHMM	CDS	1605651	1606718	.	+	.	transcript "154"
Adh	GeneMarkHMM	CDS	1606791	1607142	.	+	.	transcript "154"
Adh	GeneMarkHMM	CDS	1607205	1607306	.	+	.	transcript "154"
Adh	GeneMarkHMM	stop_codon	1607304	1607306	.	+	.	transcript "154"
Adh	GeneMarkHMM	start_codon	1624429	1624431	.	+	.	transcript "155"
Adh	GeneMarkHMM	CDS	1624429	1624528	.	+	.	transcript "155"
Adh	GeneMarkHMM	CDS	1624600	1624721	.	+	.	transcript "155"
Adh	GeneMarkHMM	stop_codon	1624719	1624721	.	+	.	transcript "155"
Adh	GeneMarkHMM	stop_codon	1634224	1634226	.	-	.	transcript "156"
Adh	GeneMarkHMM	CDS	1634224	1634574	.	-	.	transcript "156"
Adh	GeneMarkHMM	stop_codon	1634572	1634574	.	-	.	transcript "156"
Adh	GeneMarkHMM	stop_codon	1653232	1653234	.	-	.	transcript "157"
Adh	GeneMarkHMM	CDS	1653232	1653414	.	-	.	transcript "157"
Adh	GeneMarkHMM	CDS	1653857	1657133	.	-	.	transcript "157"
Adh	GeneMarkHMM	CDS	1657232	1657342	.	-	.	transcript "157"
Adh	GeneMarkHMM	CDS	1661045	1661189	.	-	.	transcript "157"
Adh	GeneMarkHMM	CDS	1661787	1661932	.	-	.	transcript "157"
Adh	GeneMarkHMM	CDS	1666903	1666996	.	-	.	transcript "157"
Adh	GeneMarkHMM	CDS	1667694	1667970	.	-	.	transcript "157"
Adh	GeneMarkHMM	stop_codon	1667968	1667970	.	-	.	transcript "157"
Adh	GeneMarkHMM	stop_codon	1690411	1690413	.	-	.	transcript "158"
Adh	GeneMarkHMM	CDS	1690411	1690566	.	-	.	transcript "158"
Adh	GeneMarkHMM	CDS	1692482	1692547	.	-	.	transcript "158"
Adh	GeneMarkHMM	stop_codon	1692545	1692547	.	-	.	transcript "158"
Adh	GeneMarkHMM	stop_codon	1696675	1696677	.	-	.	transcript "159"
Adh	GeneMarkHMM	CDS	1696675	1696843	.	-	.	transcript "159"
Adh	GeneMarkHMM	CDS	1696898	1696944	.	-	.	transcript "159"
Adh	GeneMarkHMM	stop_codon	1696942	1696944	.	-	.	transcript "159"
Adh	GeneMarkHMM	start_codon	1715814	1715816	.	+	.	transcript "160"
Adh	GeneMarkHMM	CDS	1715814	1715828	.	+	.	transcript "160"
Adh	GeneMarkHMM	CDS	1717259	1717294	.	+	.	transcript "160"
Adh	GeneMarkHMM	CDS	1717396	1717497	.	+	.	transcript "160"
Adh	GeneMarkHMM	stop_codon	1717495	1717497	.	+	.	transcript "160"
Adh	GeneMarkHMM	stop_codon	1718580	1718582	.	-	.	transcript "161"
Adh	GeneMarkHMM	CDS	1718580	1718725	.	-	.	transcript "161"
Adh	GeneMarkHMM	CDS	1719195	1719342	.	-	.	transcript "161"
Adh	GeneMarkHMM	CDS	1719504	1720004	.	-	.	transcript "161"
Adh	GeneMarkHMM	stop_codon	1720002	1720004	.	-	.	transcript "161"
Adh	GeneMarkHMM	stop_codon	1726091	1726093	.	-	.	transcript "162"
Adh	GeneMarkHMM	CDS	1726091	1726220	.	-	.	transcript "162"
Adh	GeneMarkHMM	CDS	1726256	1726435	.	-	.	transcript "162"
Adh	GeneMarkHMM	CDS	1730116	1730236	.	-	.	transcript "162"
Adh	GeneMarkHMM	CDS	1731062	1731172	.	-	.	transcript "162"
Adh	GeneMarkHMM	CDS	1732202	1732302	.	-	.	transcript "162"
Adh	GeneMarkHMM	CDS	1732714	1732838	.	-	.	transcript "162"
Adh	GeneMarkHMM	stop_codon	1732836	1732838	.	-	.	transcript "162"
Adh	GeneMarkHMM	stop_codon	1735037	1735039	.	-	.	transcript "163"
Adh	GeneMarkHMM	CDS	1735037	1735179	.	-	.	transcript "163"
Adh	GeneMarkHMM	CDS	1735826	1736004	.	-	.	transcript "163"
Adh	GeneMarkHMM	CDS	1737215	1737246	.	-	.	transcript "163"
Adh	GeneMarkHMM	stop_codon	1737244	1737246	.	-	.	transcript "163"
Adh	GeneMarkHMM	start_codon	1738791	1738793	.	+	.	transcript "164"
Adh	GeneMarkHMM	CDS	1738791	1739218	.	+	.	transcript "164"
Adh	GeneMarkHMM	CDS	1740300	1740540	.	+	.	transcript "164"
Adh	GeneMarkHMM	CDS	1740659	1740939	.	+	.	transcript "164"
Adh	GeneMarkHMM	CDS	1740995	1742042	.	+	.	transcript "164"
Adh	GeneMarkHMM	CDS	1742104	1742446	.	+	.	transcript "164"
Adh	GeneMarkHMM	CDS	1742886	1743193	.	+	.	transcript "164"
Adh	GeneMarkHMM	stop_codon	1743191	1743193	.	+	.	transcript "164"
Adh	GeneMarkHMM	stop_codon	1744620	1744622	.	-	.	transcript "165"
Adh	GeneMarkHMM	CDS	1744620	1745915	.	-	.	transcript "165"
Adh	GeneMarkHMM	stop_codon	1745913	1745915	.	-	.	transcript "165"
Adh	GeneMarkHMM	start_codon	1746303	1746305	.	+	.	transcript "166"
Adh	GeneMarkHMM	CDS	1746303	1746349	.	+	.	transcript "166"
Adh	GeneMarkHMM	CDS	1746401	1746842	.	+	.	transcript "166"
Adh	GeneMarkHMM	stop_codon	1746840	1746842	.	+	.	transcript "166"
Adh	GeneMarkHMM	stop_codon	1746966	1746968	.	-	.	transcript "167"
Adh	GeneMarkHMM	CDS	1746966	1747064	.	-	.	transcript "167"
Adh	GeneMarkHMM	CDS	1747116	1747238	.	-	.	transcript "167"
Adh	GeneMarkHMM	CDS	1747451	1747757	.	-	.	transcript "167"
Adh	GeneMarkHMM	CDS	1747825	1748093	.	-	.	transcript "167"
Adh	GeneMarkHMM	CDS	1748156	1748361	.	-	.	transcript "167"
Adh	GeneMarkHMM	CDS	1748434	1748590	.	-	.	transcript "167"
Adh	GeneMarkHMM	CDS	1748671	1748943	.	-	.	transcript "167"
Adh	GeneMarkHMM	CDS	1749003	1749033	.	-	.	transcript "167"
Adh	GeneMarkHMM	CDS	1751117	1751289	.	-	.	transcript "167"
Adh	GeneMarkHMM	CDS	1751370	1751492	.	-	.	transcript "167"
Adh	GeneMarkHMM	CDS	1751564	1751664	.	-	.	transcript "167"
Adh	GeneMarkHMM	CDS	1751722	1751956	.	-	.	transcript "167"
Adh	GeneMarkHMM	CDS	1752027	1752278	.	-	.	transcript "167"
Adh	GeneMarkHMM	CDS	1752622	1752780	.	-	.	transcript "167"
Adh	GeneMarkHMM	CDS	1752984	1753316	.	-	.	transcript "167"
Adh	GeneMarkHMM	CDS	1753422	1753778	.	-	.	transcript "167"
Adh	GeneMarkHMM	stop_codon	1753776	1753778	.	-	.	transcript "167"
Adh	GeneMarkHMM	stop_codon	1756026	1756028	.	-	.	transcript "168"
Adh	GeneMarkHMM	CDS	1756026	1756178	.	-	.	transcript "168"
Adh	GeneMarkHMM	CDS	1756248	1756386	.	-	.	transcript "168"
Adh	GeneMarkHMM	CDS	1756448	1756671	.	-	.	transcript "168"
Adh	GeneMarkHMM	CDS	1756797	1756939	.	-	.	transcript "168"
Adh	GeneMarkHMM	CDS	1757005	1757119	.	-	.	transcript "168"
Adh	GeneMarkHMM	CDS	1757182	1757352	.	-	.	transcript "168"
Adh	GeneMarkHMM	CDS	1757415	1757585	.	-	.	transcript "168"
Adh	GeneMarkHMM	CDS	1757648	1758409	.	-	.	transcript "168"
Adh	GeneMarkHMM	CDS	1758473	1758856	.	-	.	transcript "168"
Adh	GeneMarkHMM	CDS	1759026	1759682	.	-	.	transcript "168"
Adh	GeneMarkHMM	CDS	1760557	1760678	.	-	.	transcript "168"
Adh	GeneMarkHMM	CDS	1763528	1763582	.	-	.	transcript "168"
Adh	GeneMarkHMM	CDS	1763930	1764042	.	-	.	transcript "168"
Adh	GeneMarkHMM	CDS	1764272	1764501	.	-	.	transcript "168"
Adh	GeneMarkHMM	CDS	1764574	1764638	.	-	.	transcript "168"
Adh	GeneMarkHMM	stop_codon	1764636	1764638	.	-	.	transcript "168"
Adh	GeneMarkHMM	start_codon	1766105	1766107	.	+	.	transcript "169"
Adh	GeneMarkHMM	CDS	1766105	1766345	.	+	.	transcript "169"
Adh	GeneMarkHMM	CDS	1766667	1766778	.	+	.	transcript "169"
Adh	GeneMarkHMM	CDS	1766912	1767026	.	+	.	transcript "169"
Adh	GeneMarkHMM	CDS	1768563	1768793	.	+	.	transcript "169"
Adh	GeneMarkHMM	CDS	1768949	1768993	.	+	.	transcript "169"
Adh	GeneMarkHMM	stop_codon	1768991	1768993	.	+	.	transcript "169"
Adh	GeneMarkHMM	start_codon	1774781	1774783	.	+	.	transcript "170"
Adh	GeneMarkHMM	CDS	1774781	1775557	.	+	.	transcript "170"
Adh	GeneMarkHMM	stop_codon	1775555	1775557	.	+	.	transcript "170"
Adh	GeneMarkHMM	stop_codon	1780341	1780343	.	-	.	transcript "171"
Adh	GeneMarkHMM	CDS	1780341	1780496	.	-	.	transcript "171"
Adh	GeneMarkHMM	CDS	1781148	1781825	.	-	.	transcript "171"
Adh	GeneMarkHMM	stop_codon	1781823	1781825	.	-	.	transcript "171"
Adh	GeneMarkHMM	start_codon	1785433	1785435	.	+	.	transcript "172"
Adh	GeneMarkHMM	CDS	1785433	1785489	.	+	.	transcript "172"
Adh	GeneMarkHMM	CDS	1787638	1788915	.	+	.	transcript "172"
Adh	GeneMarkHMM	stop_codon	1788913	1788915	.	+	.	transcript "172"
Adh	GeneMarkHMM	stop_codon	1807761	1807763	.	-	.	transcript "173"
Adh	GeneMarkHMM	CDS	1807761	1808498	.	-	.	transcript "173"
Adh	GeneMarkHMM	stop_codon	1808496	1808498	.	-	.	transcript "173"
Adh	GeneMarkHMM	start_codon	1811839	1811841	.	+	.	transcript "174"
Adh	GeneMarkHMM	CDS	1811839	1811953	.	+	.	transcript "174"
Adh	GeneMarkHMM	CDS	1812956	1813017	.	+	.	transcript "174"
Adh	GeneMarkHMM	stop_codon	1813015	1813017	.	+	.	transcript "174"
Adh	GeneMarkHMM	start_codon	1817956	1817958	.	+	.	transcript "175"
Adh	GeneMarkHMM	CDS	1817956	1818034	.	+	.	transcript "175"
Adh	GeneMarkHMM	CDS	1818085	1818200	.	+	.	transcript "175"
Adh	GeneMarkHMM	CDS	1819380	1819519	.	+	.	transcript "175"
Adh	GeneMarkHMM	CDS	1819571	1819593	.	+	.	transcript "175"
Adh	GeneMarkHMM	CDS	1820550	1820647	.	+	.	transcript "175"
Adh	GeneMarkHMM	stop_codon	1820645	1820647	.	+	.	transcript "175"
Adh	GeneMarkHMM	start_codon	1823764	1823766	.	+	.	transcript "176"
Adh	GeneMarkHMM	CDS	1823764	1825158	.	+	.	transcript "176"
Adh	GeneMarkHMM	stop_codon	1825156	1825158	.	+	.	transcript "176"
Adh	GeneMarkHMM	stop_codon	1850650	1850652	.	-	.	transcript "177"
Adh	GeneMarkHMM	CDS	1850650	1851240	.	-	.	transcript "177"
Adh	GeneMarkHMM	stop_codon	1851238	1851240	.	-	.	transcript "177"
Adh	GeneMarkHMM	stop_codon	1879961	1879963	.	-	.	transcript "178"
Adh	GeneMarkHMM	CDS	1879961	1879999	.	-	.	transcript "178"
Adh	GeneMarkHMM	CDS	1884195	1884437	.	-	.	transcript "178"
Adh	GeneMarkHMM	stop_codon	1884435	1884437	.	-	.	transcript "178"
Adh	GeneMarkHMM	stop_codon	1913374	1913376	.	-	.	transcript "179"
Adh	GeneMarkHMM	CDS	1913374	1914932	.	-	.	transcript "179"
Adh	GeneMarkHMM	CDS	1914995	1915082	.	-	.	transcript "179"
Adh	GeneMarkHMM	stop_codon	1915080	1915082	.	-	.	transcript "179"
Adh	GeneMarkHMM	start_codon	1917420	1917422	.	+	.	transcript "180"
Adh	GeneMarkHMM	CDS	1917420	1917537	.	+	.	transcript "180"
Adh	GeneMarkHMM	CDS	1917607	1917914	.	+	.	transcript "180"
Adh	GeneMarkHMM	stop_codon	1917912	1917914	.	+	.	transcript "180"
Adh	GeneMarkHMM	start_codon	1923109	1923111	.	+	.	transcript "181"
Adh	GeneMarkHMM	CDS	1923109	1924563	.	+	.	transcript "181"
Adh	GeneMarkHMM	stop_codon	1924561	1924563	.	+	.	transcript "181"
Adh	GeneMarkHMM	stop_codon	1962833	1962835	.	-	.	transcript "182"
Adh	GeneMarkHMM	CDS	1962833	1962987	.	-	.	transcript "182"
Adh	GeneMarkHMM	CDS	1963924	1964018	.	-	.	transcript "182"
Adh	GeneMarkHMM	CDS	1964837	1964925	.	-	.	transcript "182"
Adh	GeneMarkHMM	stop_codon	1964923	1964925	.	-	.	transcript "182"
Adh	GeneMarkHMM	stop_codon	1966586	1966588	.	-	.	transcript "183"
Adh	GeneMarkHMM	CDS	1966586	1967758	.	-	.	transcript "183"
Adh	GeneMarkHMM	stop_codon	1967756	1967758	.	-	.	transcript "183"
Adh	GeneMarkHMM	start_codon	1974488	1974490	.	+	.	transcript "184"
Adh	GeneMarkHMM	CDS	1974488	1975018	.	+	.	transcript "184"
Adh	GeneMarkHMM	stop_codon	1975016	1975018	.	+	.	transcript "184"
Adh	GeneMarkHMM	start_codon	1988872	1988874	.	+	.	transcript "185"
Adh	GeneMarkHMM	CDS	1988872	1989075	.	+	.	transcript "185"
Adh	GeneMarkHMM	CDS	1991768	1992877	.	+	.	transcript "185"
Adh	GeneMarkHMM	CDS	1992942	1993204	.	+	.	transcript "185"
Adh	GeneMarkHMM	CDS	1993350	1993566	.	+	.	transcript "185"
Adh	GeneMarkHMM	stop_codon	1993564	1993566	.	+	.	transcript "185"
Adh	GeneMarkHMM	stop_codon	1999194	1999196	.	-	.	transcript "186"
Adh	GeneMarkHMM	CDS	1999194	1999256	.	-	.	transcript "186"
Adh	GeneMarkHMM	CDS	1999307	1999333	.	-	.	transcript "186"
Adh	GeneMarkHMM	CDS	1999393	1999539	.	-	.	transcript "186"
Adh	GeneMarkHMM	stop_codon	1999537	1999539	.	-	.	transcript "186"
Adh	GeneMarkHMM	start_codon	2035641	2035643	.	+	.	transcript "187"
Adh	GeneMarkHMM	CDS	2035641	2035774	.	+	.	transcript "187"
Adh	GeneMarkHMM	CDS	2037369	2037672	.	+	.	transcript "187"
Adh	GeneMarkHMM	stop_codon	2037670	2037672	.	+	.	transcript "187"
Adh	GeneMarkHMM	start_codon	2040123	2040125	.	+	.	transcript "188"
Adh	GeneMarkHMM	CDS	2040123	2040280	.	+	.	transcript "188"
Adh	GeneMarkHMM	CDS	2040432	2040693	.	+	.	transcript "188"
Adh	GeneMarkHMM	stop_codon	2040691	2040693	.	+	.	transcript "188"
Adh	GeneMarkHMM	start_codon	2068604	2068606	.	+	.	transcript "189"
Adh	GeneMarkHMM	CDS	2068604	2070501	.	+	.	transcript "189"
Adh	GeneMarkHMM	CDS	2071510	2072677	.	+	.	transcript "189"
Adh	GeneMarkHMM	stop_codon	2072675	2072677	.	+	.	transcript "189"
Adh	GeneMarkHMM	stop_codon	2100551	2100553	.	-	.	transcript "190"
Adh	GeneMarkHMM	CDS	2100551	2101352	.	-	.	transcript "190"
Adh	GeneMarkHMM	CDS	2102194	2102722	.	-	.	transcript "190"
Adh	GeneMarkHMM	CDS	2102776	2102911	.	-	.	transcript "190"
Adh	GeneMarkHMM	CDS	2103628	2104169	.	-	.	transcript "190"
Adh	GeneMarkHMM	CDS	2104226	2104442	.	-	.	transcript "190"
Adh	GeneMarkHMM	stop_codon	2104440	2104442	.	-	.	transcript "190"
Adh	GeneMarkHMM	stop_codon	2105170	2105172	.	-	.	transcript "191"
Adh	GeneMarkHMM	CDS	2105170	2105463	.	-	.	transcript "191"
Adh	GeneMarkHMM	CDS	2105530	2105720	.	-	.	transcript "191"
Adh	GeneMarkHMM	CDS	2105774	2105984	.	-	.	transcript "191"
Adh	GeneMarkHMM	stop_codon	2105982	2105984	.	-	.	transcript "191"
Adh	GeneMarkHMM	stop_codon	2111779	2111781	.	-	.	transcript "192"
Adh	GeneMarkHMM	CDS	2111779	2111847	.	-	.	transcript "192"
Adh	GeneMarkHMM	CDS	2111897	2112079	.	-	.	transcript "192"
Adh	GeneMarkHMM	CDS	2112328	2112336	.	-	.	transcript "192"
Adh	GeneMarkHMM	CDS	2112397	2112489	.	-	.	transcript "192"
Adh	GeneMarkHMM	stop_codon	2112487	2112489	.	-	.	transcript "192"
Adh	GeneMarkHMM	start_codon	2118335	2118337	.	+	.	transcript "193"
Adh	GeneMarkHMM	CDS	2118335	2118551	.	+	.	transcript "193"
Adh	GeneMarkHMM	CDS	2118614	2119144	.	+	.	transcript "193"
Adh	GeneMarkHMM	CDS	2119911	2120025	.	+	.	transcript "193"
Adh	GeneMarkHMM	CDS	2120092	2120194	.	+	.	transcript "193"
Adh	GeneMarkHMM	CDS	2120312	2121269	.	+	.	transcript "193"
Adh	GeneMarkHMM	CDS	2121336	2121745	.	+	.	transcript "193"
Adh	GeneMarkHMM	stop_codon	2121743	2121745	.	+	.	transcript "193"
Adh	GeneMarkHMM	stop_codon	2137486	2137488	.	-	.	transcript "194"
Adh	GeneMarkHMM	CDS	2137486	2137679	.	-	.	transcript "194"
Adh	GeneMarkHMM	CDS	2137746	2137902	.	-	.	transcript "194"
Adh	GeneMarkHMM	CDS	2137961	2138116	.	-	.	transcript "194"
Adh	GeneMarkHMM	CDS	2138186	2138671	.	-	.	transcript "194"
Adh	GeneMarkHMM	CDS	2138733	2138994	.	-	.	transcript "194"
Adh	GeneMarkHMM	CDS	2139065	2139169	.	-	.	transcript "194"
Adh	GeneMarkHMM	CDS	2139824	2140056	.	-	.	transcript "194"
Adh	GeneMarkHMM	CDS	2140148	2140353	.	-	.	transcript "194"
Adh	GeneMarkHMM	CDS	2140417	2140630	.	-	.	transcript "194"
Adh	GeneMarkHMM	CDS	2140705	2141412	.	-	.	transcript "194"
Adh	GeneMarkHMM	CDS	2141468	2141749	.	-	.	transcript "194"
Adh	GeneMarkHMM	CDS	2141998	2142471	.	-	.	transcript "194"
Adh	GeneMarkHMM	CDS	2146632	2146874	.	-	.	transcript "194"
Adh	GeneMarkHMM	stop_codon	2146872	2146874	.	-	.	transcript "194"
Adh	GeneMarkHMM	start_codon	2149292	2149294	.	+	.	transcript "195"
Adh	GeneMarkHMM	CDS	2149292	2149510	.	+	.	transcript "195"
Adh	GeneMarkHMM	CDS	2149741	2150589	.	+	.	transcript "195"
Adh	GeneMarkHMM	CDS	2150672	2150738	.	+	.	transcript "195"
Adh	GeneMarkHMM	CDS	2151060	2151169	.	+	.	transcript "195"
Adh	GeneMarkHMM	stop_codon	2151167	2151169	.	+	.	transcript "195"
Adh	GeneMarkHMM	stop_codon	2151764	2151766	.	-	.	transcript "196"
Adh	GeneMarkHMM	CDS	2151764	2151931	.	-	.	transcript "196"
Adh	GeneMarkHMM	CDS	2157849	2157893	.	-	.	transcript "196"
Adh	GeneMarkHMM	stop_codon	2157891	2157893	.	-	.	transcript "196"
Adh	GeneMarkHMM	stop_codon	2163892	2163894	.	-	.	transcript "197"
Adh	GeneMarkHMM	CDS	2163892	2164224	.	-	.	transcript "197"
Adh	GeneMarkHMM	stop_codon	2164222	2164224	.	-	.	transcript "197"
Adh	GeneMarkHMM	stop_codon	2165490	2165492	.	-	.	transcript "198"
Adh	GeneMarkHMM	CDS	2165490	2165568	.	-	.	transcript "198"
Adh	GeneMarkHMM	CDS	2167365	2167477	.	-	.	transcript "198"
Adh	GeneMarkHMM	stop_codon	2167475	2167477	.	-	.	transcript "198"
Adh	GeneMarkHMM	stop_codon	2180707	2180709	.	-	.	transcript "199"
Adh	GeneMarkHMM	CDS	2180707	2180982	.	-	.	transcript "199"
Adh	GeneMarkHMM	CDS	2181100	2181325	.	-	.	transcript "199"
Adh	GeneMarkHMM	CDS	2181392	2182662	.	-	.	transcript "199"
Adh	GeneMarkHMM	CDS	2187860	2187994	.	-	.	transcript "199"
Adh	GeneMarkHMM	CDS	2189454	2189772	.	-	.	transcript "199"
Adh	GeneMarkHMM	CDS	2192598	2192617	.	-	.	transcript "199"
Adh	GeneMarkHMM	stop_codon	2192615	2192617	.	-	.	transcript "199"
Adh	GeneMarkHMM	stop_codon	2201531	2201533	.	-	.	transcript "200"
Adh	GeneMarkHMM	CDS	2201531	2201677	.	-	.	transcript "200"
Adh	GeneMarkHMM	CDS	2202376	2202477	.	-	.	transcript "200"
Adh	GeneMarkHMM	CDS	2202548	2202802	.	-	.	transcript "200"
Adh	GeneMarkHMM	stop_codon	2202800	2202802	.	-	.	transcript "200"
Adh	GeneMarkHMM	start_codon	2204183	2204185	.	+	.	transcript "201"
Adh	GeneMarkHMM	CDS	2204183	2205278	.	+	.	transcript "201"
Adh	GeneMarkHMM	CDS	2205332	2207403	.	+	.	transcript "201"
Adh	GeneMarkHMM	stop_codon	2207401	2207403	.	+	.	transcript "201"
Adh	GeneMarkHMM	stop_codon	2208922	2208924	.	-	.	transcript "202"
Adh	GeneMarkHMM	CDS	2208922	2209531	.	-	.	transcript "202"
Adh	GeneMarkHMM	CDS	2209593	2209904	.	-	.	transcript "202"
Adh	GeneMarkHMM	CDS	2209967	2211186	.	-	.	transcript "202"
Adh	GeneMarkHMM	CDS	2211243	2211671	.	-	.	transcript "202"
Adh	GeneMarkHMM	CDS	2212036	2212168	.	-	.	transcript "202"
Adh	GeneMarkHMM	CDS	2212228	2212394	.	-	.	transcript "202"
Adh	GeneMarkHMM	stop_codon	2212392	2212394	.	-	.	transcript "202"
Adh	GeneMarkHMM	start_codon	2216202	2216204	.	+	.	transcript "203"
Adh	GeneMarkHMM	CDS	2216202	2216561	.	+	.	transcript "203"
Adh	GeneMarkHMM	CDS	2216630	2217034	.	+	.	transcript "203"
Adh	GeneMarkHMM	CDS	2217099	2217403	.	+	.	transcript "203"
Adh	GeneMarkHMM	CDS	2217501	2217537	.	+	.	transcript "203"
Adh	GeneMarkHMM	stop_codon	2217535	2217537	.	+	.	transcript "203"
Adh	GeneMarkHMM	stop_codon	2218461	2218463	.	-	.	transcript "204"
Adh	GeneMarkHMM	CDS	2218461	2218494	.	-	.	transcript "204"
Adh	GeneMarkHMM	CDS	2218559	2218905	.	-	.	transcript "204"
Adh	GeneMarkHMM	CDS	2218966	2219871	.	-	.	transcript "204"
Adh	GeneMarkHMM	CDS	2219932	2220065	.	-	.	transcript "204"
Adh	GeneMarkHMM	CDS	2220600	2222197	.	-	.	transcript "204"
Adh	GeneMarkHMM	CDS	2222257	2222379	.	-	.	transcript "204"
Adh	GeneMarkHMM	CDS	2222435	2222667	.	-	.	transcript "204"
Adh	GeneMarkHMM	CDS	2222723	2222818	.	-	.	transcript "204"
Adh	GeneMarkHMM	CDS	2222876	2222890	.	-	.	transcript "204"
Adh	GeneMarkHMM	stop_codon	2222888	2222890	.	-	.	transcript "204"
Adh	GeneMarkHMM	stop_codon	2223170	2223172	.	-	.	transcript "205"
Adh	GeneMarkHMM	CDS	2223170	2223346	.	-	.	transcript "205"
Adh	GeneMarkHMM	CDS	2223403	2223556	.	-	.	transcript "205"
Adh	GeneMarkHMM	CDS	2223854	2224229	.	-	.	transcript "205"
Adh	GeneMarkHMM	CDS	2224289	2224367	.	-	.	transcript "205"
Adh	GeneMarkHMM	stop_codon	2224365	2224367	.	-	.	transcript "205"
Adh	GeneMarkHMM	start_codon	2239954	2239956	.	+	.	transcript "206"
Adh	GeneMarkHMM	CDS	2239954	2240240	.	+	.	transcript "206"
Adh	GeneMarkHMM	CDS	2241396	2241563	.	+	.	transcript "206"
Adh	GeneMarkHMM	CDS	2241630	2241876	.	+	.	transcript "206"
Adh	GeneMarkHMM	stop_codon	2241874	2241876	.	+	.	transcript "206"
Adh	GeneMarkHMM	start_codon	2280718	2280720	.	+	.	transcript "207"
Adh	GeneMarkHMM	CDS	2280718	2280873	.	+	.	transcript "207"
Adh	GeneMarkHMM	CDS	2282154	2282159	.	+	.	transcript "207"
Adh	GeneMarkHMM	stop_codon	2282157	2282159	.	+	.	transcript "207"
Adh	GeneMarkHMM	start_codon	2283252	2283254	.	+	.	transcript "208"
Adh	GeneMarkHMM	CDS	2283252	2283263	.	+	.	transcript "208"
Adh	GeneMarkHMM	CDS	2283322	2283384	.	+	.	transcript "208"
Adh	GeneMarkHMM	stop_codon	2283382	2283384	.	+	.	transcript "208"
Adh	GeneMarkHMM	stop_codon	2288700	2288702	.	-	.	transcript "209"
Adh	GeneMarkHMM	CDS	2288700	2288778	.	-	.	transcript "209"
Adh	GeneMarkHMM	CDS	2288849	2289034	.	-	.	transcript "209"
Adh	GeneMarkHMM	CDS	2291657	2291847	.	-	.	transcript "209"
Adh	GeneMarkHMM	stop_codon	2291845	2291847	.	-	.	transcript "209"
Adh	GeneMarkHMM	start_codon	2303372	2303374	.	+	.	transcript "210"
Adh	GeneMarkHMM	CDS	2303372	2303375	.	+	.	transcript "210"
Adh	GeneMarkHMM	CDS	2303428	2304641	.	+	.	transcript "210"
Adh	GeneMarkHMM	stop_codon	2304639	2304641	.	+	.	transcript "210"
Adh	GeneMarkHMM	start_codon	2305038	2305040	.	+	.	transcript "211"
Adh	GeneMarkHMM	CDS	2305038	2305397	.	+	.	transcript "211"
Adh	GeneMarkHMM	CDS	2305489	2305763	.	+	.	transcript "211"
Adh	GeneMarkHMM	CDS	2305829	2306951	.	+	.	transcript "211"
Adh	GeneMarkHMM	stop_codon	2306949	2306951	.	+	.	transcript "211"
Adh	GeneMarkHMM	stop_codon	2327989	2327991	.	-	.	transcript "212"
Adh	GeneMarkHMM	CDS	2327989	2328098	.	-	.	transcript "212"
Adh	GeneMarkHMM	CDS	2328160	2328238	.	-	.	transcript "212"
Adh	GeneMarkHMM	stop_codon	2328236	2328238	.	-	.	transcript "212"
Adh	GeneMarkHMM	stop_codon	2328290	2328292	.	-	.	transcript "213"
Adh	GeneMarkHMM	CDS	2328290	2328403	.	-	.	transcript "213"
Adh	GeneMarkHMM	CDS	2328611	2329967	.	-	.	transcript "213"
Adh	GeneMarkHMM	CDS	2330026	2330135	.	-	.	transcript "213"
Adh	GeneMarkHMM	stop_codon	2330133	2330135	.	-	.	transcript "213"
Adh	GeneMarkHMM	stop_codon	2339377	2339379	.	-	.	transcript "214"
Adh	GeneMarkHMM	CDS	2339377	2340420	.	-	.	transcript "214"
Adh	GeneMarkHMM	CDS	2340535	2341630	.	-	.	transcript "214"
Adh	GeneMarkHMM	CDS	2341682	2341790	.	-	.	transcript "214"
Adh	GeneMarkHMM	CDS	2341855	2341911	.	-	.	transcript "214"
Adh	GeneMarkHMM	CDS	2341973	2341993	.	-	.	transcript "214"
Adh	GeneMarkHMM	CDS	2342049	2342274	.	-	.	transcript "214"
Adh	GeneMarkHMM	CDS	2342341	2342602	.	-	.	transcript "214"
Adh	GeneMarkHMM	CDS	2342664	2343851	.	-	.	transcript "214"
Adh	GeneMarkHMM	CDS	2349629	2349890	.	-	.	transcript "214"
Adh	GeneMarkHMM	CDS	2349968	2350879	.	-	.	transcript "214"
Adh	GeneMarkHMM	CDS	2351469	2351518	.	-	.	transcript "214"
Adh	GeneMarkHMM	CDS	2351765	2352026	.	-	.	transcript "214"
Adh	GeneMarkHMM	CDS	2352080	2352995	.	-	.	transcript "214"
Adh	GeneMarkHMM	CDS	2357224	2357480	.	-	.	transcript "214"
Adh	GeneMarkHMM	CDS	2357539	2357674	.	-	.	transcript "214"
Adh	GeneMarkHMM	CDS	2358742	2358953	.	-	.	transcript "214"
Adh	GeneMarkHMM	CDS	2362230	2362329	.	-	.	transcript "214"
Adh	GeneMarkHMM	stop_codon	2362327	2362329	.	-	.	transcript "214"
Adh	GeneMarkHMM	stop_codon	2365325	2365327	.	-	.	transcript "215"
Adh	GeneMarkHMM	CDS	2365325	2365399	.	-	.	transcript "215"
Adh	GeneMarkHMM	CDS	2365727	2365814	.	-	.	transcript "215"
Adh	GeneMarkHMM	CDS	2365912	2365956	.	-	.	transcript "215"
Adh	GeneMarkHMM	CDS	2366015	2366148	.	-	.	transcript "215"
Adh	GeneMarkHMM	stop_codon	2366146	2366148	.	-	.	transcript "215"
Adh	GeneMarkHMM	start_codon	2374482	2374484	.	+	.	transcript "216"
Adh	GeneMarkHMM	CDS	2374482	2375094	.	+	.	transcript "216"
Adh	GeneMarkHMM	CDS	2375482	2375580	.	+	.	transcript "216"
Adh	GeneMarkHMM	CDS	2375644	2375808	.	+	.	transcript "216"
Adh	GeneMarkHMM	CDS	2375872	2376036	.	+	.	transcript "216"
Adh	GeneMarkHMM	CDS	2376100	2376264	.	+	.	transcript "216"
Adh	GeneMarkHMM	CDS	2376328	2376492	.	+	.	transcript "216"
Adh	GeneMarkHMM	CDS	2376556	2376617	.	+	.	transcript "216"
Adh	GeneMarkHMM	CDS	2376903	2376908	.	+	.	transcript "216"
Adh	GeneMarkHMM	stop_codon	2376906	2376908	.	+	.	transcript "216"
Adh	GeneMarkHMM	start_codon	2392181	2392183	.	+	.	transcript "217"
Adh	GeneMarkHMM	CDS	2392181	2392737	.	+	.	transcript "217"
Adh	GeneMarkHMM	CDS	2392800	2393095	.	+	.	transcript "217"
Adh	GeneMarkHMM	CDS	2393155	2393360	.	+	.	transcript "217"
Adh	GeneMarkHMM	stop_codon	2393358	2393360	.	+	.	transcript "217"
Adh	GeneMarkHMM	start_codon	2406122	2406124	.	+	.	transcript "218"
Adh	GeneMarkHMM	CDS	2406122	2406329	.	+	.	transcript "218"
Adh	GeneMarkHMM	CDS	2407321	2407393	.	+	.	transcript "218"
Adh	GeneMarkHMM	CDS	2407447	2407845	.	+	.	transcript "218"
Adh	GeneMarkHMM	CDS	2407960	2408288	.	+	.	transcript "218"
Adh	GeneMarkHMM	CDS	2408358	2408554	.	+	.	transcript "218"
Adh	GeneMarkHMM	CDS	2410044	2410049	.	+	.	transcript "218"
Adh	GeneMarkHMM	stop_codon	2410047	2410049	.	+	.	transcript "218"
Adh	GeneMarkHMM	stop_codon	2421375	2421377	.	-	.	transcript "219"
Adh	GeneMarkHMM	CDS	2421375	2421443	.	-	.	transcript "219"
Adh	GeneMarkHMM	CDS	2421495	2421629	.	-	.	transcript "219"
Adh	GeneMarkHMM	stop_codon	2421627	2421629	.	-	.	transcript "219"
Adh	GeneMarkHMM	start_codon	2428833	2428835	.	+	.	transcript "220"
Adh	GeneMarkHMM	CDS	2428833	2429381	.	+	.	transcript "220"
Adh	GeneMarkHMM	stop_codon	2429379	2429381	.	+	.	transcript "220"
Adh	GeneMarkHMM	stop_codon	2440029	2440031	.	-	.	transcript "221"
Adh	GeneMarkHMM	CDS	2440029	2440096	.	-	.	transcript "221"
Adh	GeneMarkHMM	CDS	2440152	2440232	.	-	.	transcript "221"
Adh	GeneMarkHMM	CDS	2452399	2452589	.	-	.	transcript "221"
Adh	GeneMarkHMM	CDS	2452651	2452685	.	-	.	transcript "221"
Adh	GeneMarkHMM	stop_codon	2452683	2452685	.	-	.	transcript "221"
Adh	GeneMarkHMM	start_codon	2453955	2453957	.	+	.	transcript "222"
Adh	GeneMarkHMM	CDS	2453955	2454115	.	+	.	transcript "222"
Adh	GeneMarkHMM	CDS	2454183	2454275	.	+	.	transcript "222"
Adh	GeneMarkHMM	CDS	2454348	2454445	.	+	.	transcript "222"
Adh	GeneMarkHMM	CDS	2454499	2454611	.	+	.	transcript "222"
Adh	GeneMarkHMM	stop_codon	2454609	2454611	.	+	.	transcript "222"
Adh	GeneMarkHMM	start_codon	2480542	2480544	.	+	.	transcript "223"
Adh	GeneMarkHMM	CDS	2480542	2480707	.	+	.	transcript "223"
Adh	GeneMarkHMM	CDS	2481639	2481850	.	+	.	transcript "223"
Adh	GeneMarkHMM	CDS	2483447	2483582	.	+	.	transcript "223"
Adh	GeneMarkHMM	CDS	2483839	2483972	.	+	.	transcript "223"
Adh	GeneMarkHMM	CDS	2484693	2484860	.	+	.	transcript "223"
Adh	GeneMarkHMM	CDS	2485878	2485976	.	+	.	transcript "223"
Adh	GeneMarkHMM	CDS	2486400	2486522	.	+	.	transcript "223"
Adh	GeneMarkHMM	CDS	2486596	2486785	.	+	.	transcript "223"
Adh	GeneMarkHMM	CDS	2488187	2488227	.	+	.	transcript "223"
Adh	GeneMarkHMM	CDS	2488301	2488669	.	+	.	transcript "223"
Adh	GeneMarkHMM	CDS	2489186	2489191	.	+	.	transcript "223"
Adh	GeneMarkHMM	stop_codon	2489189	2489191	.	+	.	transcript "223"
Adh	GeneMarkHMM	start_codon	2493314	2493316	.	+	.	transcript "224"
Adh	GeneMarkHMM	CDS	2493314	2493620	.	+	.	transcript "224"
Adh	GeneMarkHMM	CDS	2493682	2493731	.	+	.	transcript "224"
Adh	GeneMarkHMM	CDS	2494047	2494116	.	+	.	transcript "224"
Adh	GeneMarkHMM	CDS	2494180	2494259	.	+	.	transcript "224"
Adh	GeneMarkHMM	CDS	2494325	2494651	.	+	.	transcript "224"
Adh	GeneMarkHMM	CDS	2495100	2495225	.	+	.	transcript "224"
Adh	GeneMarkHMM	CDS	2495286	2495667	.	+	.	transcript "224"
Adh	GeneMarkHMM	CDS	2495861	2496988	.	+	.	transcript "224"
Adh	GeneMarkHMM	CDS	2497217	2497460	.	+	.	transcript "224"
Adh	GeneMarkHMM	CDS	2497541	2497619	.	+	.	transcript "224"
Adh	GeneMarkHMM	stop_codon	2497617	2497619	.	+	.	transcript "224"
Adh	GeneMarkHMM	stop_codon	2520836	2520838	.	-	.	transcript "225"
Adh	GeneMarkHMM	CDS	2520836	2520978	.	-	.	transcript "225"
Adh	GeneMarkHMM	CDS	2522463	2522552	.	-	.	transcript "225"
Adh	GeneMarkHMM	CDS	2522638	2522802	.	-	.	transcript "225"
Adh	GeneMarkHMM	CDS	2522851	2522881	.	-	.	transcript "225"
Adh	GeneMarkHMM	stop_codon	2522879	2522881	.	-	.	transcript "225"
Adh	GeneMarkHMM	start_codon	2524359	2524361	.	+	.	transcript "226"
Adh	GeneMarkHMM	CDS	2524359	2524559	.	+	.	transcript "226"
Adh	GeneMarkHMM	CDS	2525929	2526064	.	+	.	transcript "226"
Adh	GeneMarkHMM	CDS	2527415	2527548	.	+	.	transcript "226"
Adh	GeneMarkHMM	CDS	2529073	2529195	.	+	.	transcript "226"
Adh	GeneMarkHMM	CDS	2529260	2529455	.	+	.	transcript "226"
Adh	GeneMarkHMM	CDS	2529735	2530066	.	+	.	transcript "226"
Adh	GeneMarkHMM	CDS	2530123	2530197	.	+	.	transcript "226"
Adh	GeneMarkHMM	stop_codon	2530195	2530197	.	+	.	transcript "226"
Adh	GeneMarkHMM	start_codon	2543568	2543570	.	+	.	transcript "227"
Adh	GeneMarkHMM	CDS	2543568	2543579	.	+	.	transcript "227"
Adh	GeneMarkHMM	CDS	2544334	2545099	.	+	.	transcript "227"
Adh	GeneMarkHMM	CDS	2548670	2548839	.	+	.	transcript "227"
Adh	GeneMarkHMM	stop_codon	2548837	2548839	.	+	.	transcript "227"
Adh	GeneMarkHMM	start_codon	2582975	2582977	.	+	.	transcript "228"
Adh	GeneMarkHMM	CDS	2582975	2583504	.	+	.	transcript "228"
Adh	GeneMarkHMM	CDS	2584127	2584238	.	+	.	transcript "228"
Adh	GeneMarkHMM	stop_codon	2584236	2584238	.	+	.	transcript "228"
Adh	GeneMarkHMM	start_codon	2590910	2590912	.	+	.	transcript "229"
Adh	GeneMarkHMM	CDS	2590910	2592084	.	+	.	transcript "229"
Adh	GeneMarkHMM	CDS	2592779	2593544	.	+	.	transcript "229"
Adh	GeneMarkHMM	CDS	2593610	2593615	.	+	.	transcript "229"
Adh	GeneMarkHMM	stop_codon	2593613	2593615	.	+	.	transcript "229"
Adh	GeneMarkHMM	stop_codon	2595904	2595906	.	-	.	transcript "230"
Adh	GeneMarkHMM	CDS	2595904	2596119	.	-	.	transcript "230"
Adh	GeneMarkHMM	CDS	2610337	2610462	.	-	.	transcript "230"
Adh	GeneMarkHMM	stop_codon	2610460	2610462	.	-	.	transcript "230"
Adh	GeneMarkHMM	start_codon	2619156	2619158	.	+	.	transcript "231"
Adh	GeneMarkHMM	CDS	2619156	2619165	.	+	.	transcript "231"
Adh	GeneMarkHMM	CDS	2619518	2620403	.	+	.	transcript "231"
Adh	GeneMarkHMM	CDS	2621231	2622507	.	+	.	transcript "231"
Adh	GeneMarkHMM	CDS	2622578	2622676	.	+	.	transcript "231"
Adh	GeneMarkHMM	CDS	2624114	2624266	.	+	.	transcript "231"
Adh	GeneMarkHMM	CDS	2624694	2624875	.	+	.	transcript "231"
Adh	GeneMarkHMM	CDS	2624976	2625495	.	+	.	transcript "231"
Adh	GeneMarkHMM	CDS	2625559	2625784	.	+	.	transcript "231"
Adh	GeneMarkHMM	CDS	2625851	2626052	.	+	.	transcript "231"
Adh	GeneMarkHMM	CDS	2626124	2626333	.	+	.	transcript "231"
Adh	GeneMarkHMM	CDS	2626392	2626547	.	+	.	transcript "231"
Adh	GeneMarkHMM	stop_codon	2626545	2626547	.	+	.	transcript "231"
Adh	GeneMarkHMM	start_codon	2632071	2632073	.	+	.	transcript "232"
Adh	GeneMarkHMM	CDS	2632071	2632090	.	+	.	transcript "232"
Adh	GeneMarkHMM	CDS	2632152	2632298	.	+	.	transcript "232"
Adh	GeneMarkHMM	CDS	2632363	2632834	.	+	.	transcript "232"
Adh	GeneMarkHMM	CDS	2632889	2632972	.	+	.	transcript "232"
Adh	GeneMarkHMM	CDS	2633028	2633093	.	+	.	transcript "232"
Adh	GeneMarkHMM	CDS	2633149	2633337	.	+	.	transcript "232"
Adh	GeneMarkHMM	CDS	2633397	2633645	.	+	.	transcript "232"
Adh	GeneMarkHMM	CDS	2633706	2634365	.	+	.	transcript "232"
Adh	GeneMarkHMM	CDS	2634452	2634889	.	+	.	transcript "232"
Adh	GeneMarkHMM	stop_codon	2634887	2634889	.	+	.	transcript "232"
Adh	GeneMarkHMM	start_codon	2638322	2638324	.	+	.	transcript "233"
Adh	GeneMarkHMM	CDS	2638322	2638414	.	+	.	transcript "233"
Adh	GeneMarkHMM	CDS	2638470	2639006	.	+	.	transcript "233"
Adh	GeneMarkHMM	stop_codon	2639004	2639006	.	+	.	transcript "233"
Adh	GeneMarkHMM	start_codon	2660848	2660850	.	+	.	transcript "234"
Adh	GeneMarkHMM	CDS	2660848	2661318	.	+	.	transcript "234"
Adh	GeneMarkHMM	CDS	2661378	2662292	.	+	.	transcript "234"
Adh	GeneMarkHMM	CDS	2662849	2663049	.	+	.	transcript "234"
Adh	GeneMarkHMM	stop_codon	2663047	2663049	.	+	.	transcript "234"
Adh	GeneMarkHMM	start_codon	2675920	2675922	.	+	.	transcript "235"
Adh	GeneMarkHMM	CDS	2675920	2675954	.	+	.	transcript "235"
Adh	GeneMarkHMM	CDS	2676013	2676043	.	+	.	transcript "235"
Adh	GeneMarkHMM	CDS	2681403	2681494	.	+	.	transcript "235"
Adh	GeneMarkHMM	CDS	2684880	2686209	.	+	.	transcript "235"
Adh	GeneMarkHMM	CDS	2686394	2686570	.	+	.	transcript "235"
Adh	GeneMarkHMM	CDS	2686628	2686705	.	+	.	transcript "235"
Adh	GeneMarkHMM	CDS	2686770	2687146	.	+	.	transcript "235"
Adh	GeneMarkHMM	CDS	2687211	2687359	.	+	.	transcript "235"
Adh	GeneMarkHMM	CDS	2687415	2687920	.	+	.	transcript "235"
Adh	GeneMarkHMM	CDS	2687988	2688230	.	+	.	transcript "235"
Adh	GeneMarkHMM	CDS	2688365	2688395	.	+	.	transcript "235"
Adh	GeneMarkHMM	CDS	2688462	2688883	.	+	.	transcript "235"
Adh	GeneMarkHMM	CDS	2689073	2689183	.	+	.	transcript "235"
Adh	GeneMarkHMM	stop_codon	2689181	2689183	.	+	.	transcript "235"
Adh	GeneMarkHMM	stop_codon	2697858	2697860	.	-	.	transcript "236"
Adh	GeneMarkHMM	CDS	2697858	2698028	.	-	.	transcript "236"
Adh	GeneMarkHMM	CDS	2698091	2698198	.	-	.	transcript "236"
Adh	GeneMarkHMM	stop_codon	2698196	2698198	.	-	.	transcript "236"
Adh	GeneMarkHMM	start_codon	2707374	2707376	.	+	.	transcript "237"
Adh	GeneMarkHMM	CDS	2707374	2707439	.	+	.	transcript "237"
Adh	GeneMarkHMM	CDS	2707509	2708522	.	+	.	transcript "237"
Adh	GeneMarkHMM	stop_codon	2708520	2708522	.	+	.	transcript "237"
Adh	GeneMarkHMM	stop_codon	2709485	2709487	.	-	.	transcript "238"
Adh	GeneMarkHMM	CDS	2709485	2710765	.	-	.	transcript "238"
Adh	GeneMarkHMM	stop_codon	2710763	2710765	.	-	.	transcript "238"
Adh	GeneMarkHMM	start_codon	2711460	2711462	.	+	.	transcript "239"
Adh	GeneMarkHMM	CDS	2711460	2711538	.	+	.	transcript "239"
Adh	GeneMarkHMM	CDS	2711599	2711717	.	+	.	transcript "239"
Adh	GeneMarkHMM	CDS	2711781	2711853	.	+	.	transcript "239"
Adh	GeneMarkHMM	CDS	2711910	2712440	.	+	.	transcript "239"
Adh	GeneMarkHMM	CDS	2712522	2712646	.	+	.	transcript "239"
Adh	GeneMarkHMM	stop_codon	2712644	2712646	.	+	.	transcript "239"
Adh	GeneMarkHMM	stop_codon	2714781	2714783	.	-	.	transcript "240"
Adh	GeneMarkHMM	CDS	2714781	2716277	.	-	.	transcript "240"
Adh	GeneMarkHMM	CDS	2728123	2728429	.	-	.	transcript "240"
Adh	GeneMarkHMM	CDS	2736358	2736449	.	-	.	transcript "240"
Adh	GeneMarkHMM	stop_codon	2736447	2736449	.	-	.	transcript "240"
Adh	GeneMarkHMM	start_codon	2737704	2737706	.	+	.	transcript "241"
Adh	GeneMarkHMM	CDS	2737704	2737731	.	+	.	transcript "241"
Adh	GeneMarkHMM	CDS	2737860	2738132	.	+	.	transcript "241"
Adh	GeneMarkHMM	CDS	2738403	2739461	.	+	.	transcript "241"
Adh	GeneMarkHMM	CDS	2739531	2740039	.	+	.	transcript "241"
Adh	GeneMarkHMM	stop_codon	2740037	2740039	.	+	.	transcript "241"
Adh	GeneMarkHMM	start_codon	2740542	2740544	.	+	.	transcript "242"
Adh	GeneMarkHMM	CDS	2740542	2741090	.	+	.	transcript "242"
Adh	GeneMarkHMM	stop_codon	2741088	2741090	.	+	.	transcript "242"
Adh	GeneMarkHMM	stop_codon	2741243	2741245	.	-	.	transcript "243"
Adh	GeneMarkHMM	CDS	2741243	2741254	.	-	.	transcript "243"
Adh	GeneMarkHMM	CDS	2741396	2741990	.	-	.	transcript "243"
Adh	GeneMarkHMM	CDS	2742666	2742709	.	-	.	transcript "243"
Adh	GeneMarkHMM	stop_codon	2742707	2742709	.	-	.	transcript "243"
Adh	GeneMarkHMM	start_codon	2743611	2743613	.	+	.	transcript "244"
Adh	GeneMarkHMM	CDS	2743611	2745122	.	+	.	transcript "244"
Adh	GeneMarkHMM	stop_codon	2745120	2745122	.	+	.	transcript "244"
Adh	GeneMarkHMM	stop_codon	2746815	2746817	.	-	.	transcript "245"
Adh	GeneMarkHMM	CDS	2746815	2747453	.	-	.	transcript "245"
Adh	GeneMarkHMM	CDS	2748132	2748572	.	-	.	transcript "245"
Adh	GeneMarkHMM	stop_codon	2748570	2748572	.	-	.	transcript "245"
Adh	GeneMarkHMM	start_codon	2749571	2749573	.	+	.	transcript "246"
Adh	GeneMarkHMM	CDS	2749571	2749696	.	+	.	transcript "246"
Adh	GeneMarkHMM	CDS	2749753	2750868	.	+	.	transcript "246"
Adh	GeneMarkHMM	stop_codon	2750866	2750868	.	+	.	transcript "246"
Adh	GeneMarkHMM	stop_codon	2751337	2751339	.	-	.	transcript "247"
Adh	GeneMarkHMM	CDS	2751337	2751465	.	-	.	transcript "247"
Adh	GeneMarkHMM	CDS	2751521	2751711	.	-	.	transcript "247"
Adh	GeneMarkHMM	CDS	2751778	2751871	.	-	.	transcript "247"
Adh	GeneMarkHMM	CDS	2751973	2751984	.	-	.	transcript "247"
Adh	GeneMarkHMM	stop_codon	2751982	2751984	.	-	.	transcript "247"
Adh	GeneMarkHMM	start_codon	2752612	2752614	.	+	.	transcript "248"
Adh	GeneMarkHMM	CDS	2752612	2752742	.	+	.	transcript "248"
Adh	GeneMarkHMM	CDS	2752822	2752985	.	+	.	transcript "248"
Adh	GeneMarkHMM	CDS	2753042	2753322	.	+	.	transcript "248"
Adh	GeneMarkHMM	CDS	2753412	2753565	.	+	.	transcript "248"
Adh	GeneMarkHMM	CDS	2753620	2753756	.	+	.	transcript "248"
Adh	GeneMarkHMM	CDS	2753812	2753817	.	+	.	transcript "248"
Adh	GeneMarkHMM	stop_codon	2753815	2753817	.	+	.	transcript "248"
Adh	GeneMarkHMM	stop_codon	2755219	2755221	.	-	.	transcript "249"
Adh	GeneMarkHMM	CDS	2755219	2755580	.	-	.	transcript "249"
Adh	GeneMarkHMM	CDS	2755775	2755883	.	-	.	transcript "249"
Adh	GeneMarkHMM	CDS	2755954	2756092	.	-	.	transcript "249"
Adh	GeneMarkHMM	CDS	2756201	2756274	.	-	.	transcript "249"
Adh	GeneMarkHMM	stop_codon	2756272	2756274	.	-	.	transcript "249"
Adh	GeneMarkHMM	start_codon	2756920	2756922	.	+	.	transcript "250"
Adh	GeneMarkHMM	CDS	2756920	2757589	.	+	.	transcript "250"
Adh	GeneMarkHMM	CDS	2757658	2758391	.	+	.	transcript "250"
Adh	GeneMarkHMM	stop_codon	2758389	2758391	.	+	.	transcript "250"
Adh	GeneMarkHMM	stop_codon	2759163	2759165	.	-	.	transcript "251"
Adh	GeneMarkHMM	CDS	2759163	2759190	.	-	.	transcript "251"
Adh	GeneMarkHMM	CDS	2759260	2759403	.	-	.	transcript "251"
Adh	GeneMarkHMM	CDS	2759527	2759639	.	-	.	transcript "251"
Adh	GeneMarkHMM	CDS	2759701	2759850	.	-	.	transcript "251"
Adh	GeneMarkHMM	stop_codon	2759848	2759850	.	-	.	transcript "251"
Adh	GeneMarkHMM	start_codon	2760361	2760363	.	+	.	transcript "252"
Adh	GeneMarkHMM	CDS	2760361	2760672	.	+	.	transcript "252"
Adh	GeneMarkHMM	CDS	2760766	2761087	.	+	.	transcript "252"
Adh	GeneMarkHMM	CDS	2761141	2762087	.	+	.	transcript "252"
Adh	GeneMarkHMM	stop_codon	2762085	2762087	.	+	.	transcript "252"
Adh	GeneMarkHMM	stop_codon	2762604	2762606	.	-	.	transcript "253"
Adh	GeneMarkHMM	CDS	2762604	2762608	.	-	.	transcript "253"
Adh	GeneMarkHMM	CDS	2762665	2762710	.	-	.	transcript "253"
Adh	GeneMarkHMM	CDS	2763711	2763968	.	-	.	transcript "253"
Adh	GeneMarkHMM	CDS	2764030	2764118	.	-	.	transcript "253"
Adh	GeneMarkHMM	CDS	2772220	2772430	.	-	.	transcript "253"
Adh	GeneMarkHMM	CDS	2772600	2772777	.	-	.	transcript "253"
Adh	GeneMarkHMM	CDS	2773593	2774287	.	-	.	transcript "253"
Adh	GeneMarkHMM	stop_codon	2774285	2774287	.	-	.	transcript "253"
Adh	GeneMarkHMM	start_codon	2776429	2776431	.	+	.	transcript "254"
Adh	GeneMarkHMM	CDS	2776429	2777295	.	+	.	transcript "254"
Adh	GeneMarkHMM	stop_codon	2777293	2777295	.	+	.	transcript "254"
Adh	GeneMarkHMM	stop_codon	2777390	2777392	.	-	.	transcript "255"
Adh	GeneMarkHMM	CDS	2777390	2777609	.	-	.	transcript "255"
Adh	GeneMarkHMM	CDS	2777672	2778342	.	-	.	transcript "255"
Adh	GeneMarkHMM	stop_codon	2778340	2778342	.	-	.	transcript "255"
Adh	GeneMarkHMM	start_codon	2779268	2779270	.	+	.	transcript "256"
Adh	GeneMarkHMM	CDS	2779268	2779279	.	+	.	transcript "256"
Adh	GeneMarkHMM	CDS	2779339	2779566	.	+	.	transcript "256"
Adh	GeneMarkHMM	stop_codon	2779564	2779566	.	+	.	transcript "256"
Adh	GeneMarkHMM	stop_codon	2785078	2785080	.	-	.	transcript "257"
Adh	GeneMarkHMM	CDS	2785078	2785356	.	-	.	transcript "257"
Adh	GeneMarkHMM	CDS	2786105	2786724	.	-	.	transcript "257"
Adh	GeneMarkHMM	CDS	2786839	2787069	.	-	.	transcript "257"
Adh	GeneMarkHMM	CDS	2787522	2787885	.	-	.	transcript "257"
Adh	GeneMarkHMM	CDS	2787948	2788135	.	-	.	transcript "257"
Adh	GeneMarkHMM	CDS	2788407	2788454	.	-	.	transcript "257"
Adh	GeneMarkHMM	CDS	2788523	2788540	.	-	.	transcript "257"
Adh	GeneMarkHMM	CDS	2788598	2788684	.	-	.	transcript "257"
Adh	GeneMarkHMM	CDS	2788808	2789082	.	-	.	transcript "257"
Adh	GeneMarkHMM	CDS	2789143	2789555	.	-	.	transcript "257"
Adh	GeneMarkHMM	CDS	2789836	2790921	.	-	.	transcript "257"
Adh	GeneMarkHMM	stop_codon	2790919	2790921	.	-	.	transcript "257"
Adh	GeneMarkHMM	stop_codon	2791866	2791868	.	-	.	transcript "258"
Adh	GeneMarkHMM	CDS	2791866	2792011	.	-	.	transcript "258"
Adh	GeneMarkHMM	CDS	2792082	2792564	.	-	.	transcript "258"
Adh	GeneMarkHMM	CDS	2793554	2793668	.	-	.	transcript "258"
Adh	GeneMarkHMM	CDS	2793686	2795139	.	-	.	transcript "258"
Adh	GeneMarkHMM	CDS	2795176	2798715	.	-	.	transcript "258"
Adh	GeneMarkHMM	CDS	2801187	2801286	.	-	.	transcript "258"
Adh	GeneMarkHMM	stop_codon	2801284	2801286	.	-	.	transcript "258"
Adh	GeneMarkHMM	start_codon	2802355	2802357	.	+	.	transcript "259"
Adh	GeneMarkHMM	CDS	2802355	2802394	.	+	.	transcript "259"
Adh	GeneMarkHMM	CDS	2802473	2802813	.	+	.	transcript "259"
Adh	GeneMarkHMM	stop_codon	2802811	2802813	.	+	.	transcript "259"
Adh	GeneMarkHMM	stop_codon	2804442	2804444	.	-	.	transcript "260"
Adh	GeneMarkHMM	CDS	2804442	2805730	.	-	.	transcript "260"
Adh	GeneMarkHMM	CDS	2805800	2805812	.	-	.	transcript "260"
Adh	GeneMarkHMM	stop_codon	2805810	2805812	.	-	.	transcript "260"
Adh	GeneMarkHMM	start_codon	2815178	2815180	.	+	.	transcript "261"
Adh	GeneMarkHMM	CDS	2815178	2815829	.	+	.	transcript "261"
Adh	GeneMarkHMM	CDS	2815894	2816135	.	+	.	transcript "261"
Adh	GeneMarkHMM	stop_codon	2816133	2816135	.	+	.	transcript "261"
Adh	GeneMarkHMM	stop_codon	2853316	2853318	.	-	.	transcript "262"
Adh	GeneMarkHMM	CDS	2853316	2853362	.	-	.	transcript "262"
Adh	GeneMarkHMM	CDS	2853744	2854099	.	-	.	transcript "262"
Adh	GeneMarkHMM	CDS	2854197	2855134	.	-	.	transcript "262"
Adh	GeneMarkHMM	CDS	2856104	2856265	.	-	.	transcript "262"
Adh	GeneMarkHMM	stop_codon	2856263	2856265	.	-	.	transcript "262"
Adh	GeneMarkHMM	start_codon	2894707	2894709	.	+	.	transcript "263"
Adh	GeneMarkHMM	CDS	2894707	2895247	.	+	.	transcript "263"
Adh	GeneMarkHMM	CDS	2895319	2895952	.	+	.	transcript "263"
Adh	GeneMarkHMM	CDS	2896639	2896763	.	+	.	transcript "263"
Adh	GeneMarkHMM	CDS	2898444	2899001	.	+	.	transcript "263"
Adh	GeneMarkHMM	CDS	2899061	2899716	.	+	.	transcript "263"
Adh	GeneMarkHMM	stop_codon	2899714	2899716	.	+	.	transcript "263"
Adh	GeneMarkHMM	start_codon	2900448	2900450	.	+	.	transcript "264"
Adh	GeneMarkHMM	CDS	2900448	2900565	.	+	.	transcript "264"
Adh	GeneMarkHMM	CDS	2900634	2901185	.	+	.	transcript "264"
Adh	GeneMarkHMM	CDS	2901452	2902107	.	+	.	transcript "264"
Adh	GeneMarkHMM	stop_codon	2902105	2902107	.	+	.	transcript "264"
Adh	GeneMarkHMM	stop_codon	2916879	2916881	.	-	.	transcript "265"
Adh	GeneMarkHMM	CDS	2916879	2917012	.	-	.	transcript "265"
Adh	GeneMarkHMM	CDS	2917311	2917504	.	-	.	transcript "265"
Adh	GeneMarkHMM	CDS	2917751	2917988	.	-	.	transcript "265"
Adh	GeneMarkHMM	CDS	2918253	2918513	.	-	.	transcript "265"
#
# compfly: 1. replaced "IMIM" with "GeneID" Oct 4 (MR)
#          2. Added new line at the end of the file. Oct 4 (MR)
#          3. tabs added Oct 4 (MR)
#
Adh	GeneID	CDS	90	441	.	-	.	transcript "0"
Adh	GeneID	CDS	2379	2862	.	-	.	transcript "0"
Adh	GeneID	CDS	3225	3550	.	-	.	transcript "0"
Adh	GeneID	CDS	6718	7018	.	-	.	transcript "0"
Adh	GeneID	start_codon	7016	7018	.	-	.	transcript "0"
Adh	GeneID	start_codon	12833	12835	.	+	.	transcript "1"
Adh	GeneID	CDS	12833	12879	.	+	.	transcript "1"
Adh	GeneID	CDS	16005	16158	.	+	.	transcript "1"
Adh	GeneID	CDS	17242	17286	.	+	.	transcript "1"
Adh	GeneID	stop_codon	17284	17286	.	+	.	transcript "1"
Adh	GeneID	start_codon	21920	21922	.	+	.	transcript "2"
Adh	GeneID	CDS	21920	21979	.	+	.	transcript "2"
Adh	GeneID	CDS	22140	22295	.	+	.	transcript "2"
Adh	GeneID	stop_codon	22293	22295	.	+	.	transcript "2"
Adh	GeneID	start_codon	22929	22931	.	+	.	transcript "3"
Adh	GeneID	CDS	22929	23189	.	+	.	transcript "3"
Adh	GeneID	CDS	23249	23404	.	+	.	transcript "3"
Adh	GeneID	stop_codon	23402	23404	.	+	.	transcript "3"
Adh	GeneID	start_codon	23970	23972	.	+	.	transcript "4"
Adh	GeneID	CDS	23970	24134	.	+	.	transcript "4"
Adh	GeneID	CDS	24195	24356	.	+	.	transcript "4"
Adh	GeneID	stop_codon	24354	24356	.	+	.	transcript "4"
Adh	GeneID	start_codon	25084	25086	.	+	.	transcript "5"
Adh	GeneID	CDS	25084	25209	.	+	.	transcript "5"
Adh	GeneID	CDS	25377	25436	.	+	.	transcript "5"
Adh	GeneID	stop_codon	25434	25436	.	+	.	transcript "5"
Adh	GeneID	stop_codon	26939	26941	.	-	.	transcript "6"
Adh	GeneID	CDS	26939	26982	.	-	.	transcript "6"
Adh	GeneID	CDS	28665	28784	.	-	.	transcript "6"
Adh	GeneID	CDS	31856	31925	.	-	.	transcript "6"
Adh	GeneID	CDS	33637	33735	.	-	.	transcript "6"
Adh	GeneID	start_codon	33733	33735	.	-	.	transcript "6"
Adh	GeneID	start_codon	34783	34785	.	+	.	transcript "7"
Adh	GeneID	CDS	34783	34822	.	+	.	transcript "7"
Adh	GeneID	CDS	34884	34957	.	+	.	transcript "7"
Adh	GeneID	CDS	35906	35995	.	+	.	transcript "7"
Adh	GeneID	stop_codon	35993	35995	.	+	.	transcript "7"
Adh	GeneID	start_codon	36731	36733	.	+	.	transcript "8"
Adh	GeneID	CDS	36731	37222	.	+	.	transcript "8"
Adh	GeneID	CDS	37795	37836	.	+	.	transcript "8"
Adh	GeneID	stop_codon	37834	37836	.	+	.	transcript "8"
Adh	GeneID	start_codon	45369	45371	.	+	.	transcript "9"
Adh	GeneID	CDS	45369	45421	.	+	.	transcript "9"
Adh	GeneID	CDS	46147	46201	.	+	.	transcript "9"
Adh	GeneID	CDS	52555	52587	.	+	.	transcript "9"
Adh	GeneID	CDS	53283	53330	.	+	.	transcript "9"
Adh	GeneID	stop_codon	53328	53330	.	+	.	transcript "9"
Adh	GeneID	stop_codon	63112	63114	.	-	.	transcript "10"
Adh	GeneID	CDS	63112	63146	.	-	.	transcript "10"
Adh	GeneID	CDS	65175	65209	.	-	.	transcript "10"
Adh	GeneID	CDS	65813	65904	.	-	.	transcript "10"
Adh	GeneID	CDS	66456	66512	.	-	.	transcript "10"
Adh	GeneID	start_codon	66510	66512	.	-	.	transcript "10"
Adh	GeneID	start_codon	69331	69333	.	+	.	transcript "11"
Adh	GeneID	CDS	69331	69426	.	+	.	transcript "11"
Adh	GeneID	CDS	71954	72014	.	+	.	transcript "11"
Adh	GeneID	CDS	78205	78266	.	+	.	transcript "11"
Adh	GeneID	CDS	80772	80831	.	+	.	transcript "11"
Adh	GeneID	stop_codon	80829	80831	.	+	.	transcript "11"
Adh	GeneID	stop_codon	84468	84470	.	-	.	transcript "12"
Adh	GeneID	CDS	84468	84563	.	-	.	transcript "12"
Adh	GeneID	CDS	86763	86927	.	-	.	transcript "12"
Adh	GeneID	start_codon	86925	86927	.	-	.	transcript "12"
Adh	GeneID	stop_codon	94344	94346	.	-	.	transcript "13"
Adh	GeneID	CDS	94344	94481	.	-	.	transcript "13"
Adh	GeneID	CDS	96195	96257	.	-	.	transcript "13"
Adh	GeneID	start_codon	96255	96257	.	-	.	transcript "13"
Adh	GeneID	start_codon	98960	98962	.	+	.	transcript "14"
Adh	GeneID	CDS	98960	99046	.	+	.	transcript "14"
Adh	GeneID	CDS	103543	103641	.	+	.	transcript "14"
Adh	GeneID	stop_codon	103639	103641	.	+	.	transcript "14"
Adh	GeneID	start_codon	104250	104252	.	+	.	transcript "15"
Adh	GeneID	CDS	104250	104330	.	+	.	transcript "15"
Adh	GeneID	CDS	110660	110741	.	+	.	transcript "15"
Adh	GeneID	CDS	124458	124936	.	+	.	transcript "15"
Adh	GeneID	CDS	127146	127292	.	+	.	transcript "15"
Adh	GeneID	CDS	127771	127931	.	+	.	transcript "15"
Adh	GeneID	CDS	127991	128225	.	+	.	transcript "15"
Adh	GeneID	CDS	128296	129342	.	+	.	transcript "15"
Adh	GeneID	CDS	129401	129965	.	+	.	transcript "15"
Adh	GeneID	CDS	131040	131248	.	+	.	transcript "15"
Adh	GeneID	stop_codon	131246	131248	.	+	.	transcript "15"
Adh	GeneID	stop_codon	132274	132276	.	-	.	transcript "16"
Adh	GeneID	CDS	132274	132348	.	-	.	transcript "16"
Adh	GeneID	CDS	132736	132799	.	-	.	transcript "16"
Adh	GeneID	CDS	133612	134233	.	-	.	transcript "16"
Adh	GeneID	CDS	134862	135000	.	-	.	transcript "16"
Adh	GeneID	start_codon	134998	135000	.	-	.	transcript "16"
Adh	GeneID	start_codon	159578	159580	.	+	.	transcript "17"
Adh	GeneID	CDS	159578	159874	.	+	.	transcript "17"
Adh	GeneID	CDS	161727	162105	.	+	.	transcript "17"
Adh	GeneID	CDS	162442	162557	.	+	.	transcript "17"
Adh	GeneID	CDS	162616	163137	.	+	.	transcript "17"
Adh	GeneID	CDS	163297	163527	.	+	.	transcript "17"
Adh	GeneID	stop_codon	163525	163527	.	+	.	transcript "17"
Adh	GeneID	start_codon	172541	172543	.	+	.	transcript "18"
Adh	GeneID	CDS	172541	172596	.	+	.	transcript "18"
Adh	GeneID	CDS	173740	173896	.	+	.	transcript "18"
Adh	GeneID	stop_codon	173894	173896	.	+	.	transcript "18"
Adh	GeneID	stop_codon	174958	174960	.	-	.	transcript "19"
Adh	GeneID	CDS	174958	175001	.	-	.	transcript "19"
Adh	GeneID	CDS	175152	175341	.	-	.	transcript "19"
Adh	GeneID	CDS	176875	176961	.	-	.	transcript "19"
Adh	GeneID	start_codon	176959	176961	.	-	.	transcript "19"
Adh	GeneID	stop_codon	177933	177935	.	-	.	transcript "20"
Adh	GeneID	CDS	177933	178015	.	-	.	transcript "20"
Adh	GeneID	CDS	178136	178300	.	-	.	transcript "20"
Adh	GeneID	CDS	181272	181409	.	-	.	transcript "20"
Adh	GeneID	CDS	183596	183635	.	-	.	transcript "20"
Adh	GeneID	CDS	183699	183764	.	-	.	transcript "20"
Adh	GeneID	CDS	183835	184040	.	-	.	transcript "20"
Adh	GeneID	CDS	184241	184282	.	-	.	transcript "20"
Adh	GeneID	CDS	196417	196460	.	-	.	transcript "20"
Adh	GeneID	CDS	197423	197466	.	-	.	transcript "20"
Adh	GeneID	CDS	198338	198400	.	-	.	transcript "20"
Adh	GeneID	start_codon	198398	198400	.	-	.	transcript "20"
Adh	GeneID	start_codon	202266	202268	.	+	.	transcript "21"
Adh	GeneID	CDS	202266	202646	.	+	.	transcript "21"
Adh	GeneID	CDS	202700	204199	.	+	.	transcript "21"
Adh	GeneID	stop_codon	204197	204199	.	+	.	transcript "21"
Adh	GeneID	stop_codon	213884	213886	.	-	.	transcript "22"
Adh	GeneID	CDS	213884	213925	.	-	.	transcript "22"
Adh	GeneID	CDS	216171	216746	.	-	.	transcript "22"
Adh	GeneID	start_codon	216744	216746	.	-	.	transcript "22"
Adh	GeneID	start_codon	220828	220830	.	+	.	transcript "23"
Adh	GeneID	CDS	220828	220908	.	+	.	transcript "23"
Adh	GeneID	CDS	224679	224738	.	+	.	transcript "23"
Adh	GeneID	CDS	225336	225380	.	+	.	transcript "23"
Adh	GeneID	CDS	233119	233181	.	+	.	transcript "23"
Adh	GeneID	stop_codon	233179	233181	.	+	.	transcript "23"
Adh	GeneID	start_codon	235935	235937	.	+	.	transcript "24"
Adh	GeneID	CDS	235935	235985	.	+	.	transcript "24"
Adh	GeneID	CDS	236048	236116	.	+	.	transcript "24"
Adh	GeneID	CDS	253725	253802	.	+	.	transcript "24"
Adh	GeneID	stop_codon	253800	253802	.	+	.	transcript "24"
Adh	GeneID	start_codon	260672	260674	.	+	.	transcript "25"
Adh	GeneID	CDS	260672	260736	.	+	.	transcript "25"
Adh	GeneID	CDS	262958	262991	.	+	.	transcript "25"
Adh	GeneID	CDS	264927	264997	.	+	.	transcript "25"
Adh	GeneID	CDS	265273	266322	.	+	.	transcript "25"
Adh	GeneID	CDS	266392	266619	.	+	.	transcript "25"
Adh	GeneID	CDS	266684	266867	.	+	.	transcript "25"
Adh	GeneID	CDS	266935	267073	.	+	.	transcript "25"
Adh	GeneID	CDS	267309	267367	.	+	.	transcript "25"
Adh	GeneID	stop_codon	267365	267367	.	+	.	transcript "25"
Adh	GeneID	stop_codon	268487	268489	.	-	.	transcript "26"
Adh	GeneID	CDS	268487	268518	.	-	.	transcript "26"
Adh	GeneID	CDS	269222	269559	.	-	.	transcript "26"
Adh	GeneID	CDS	269629	269907	.	-	.	transcript "26"
Adh	GeneID	CDS	271522	271573	.	-	.	transcript "26"
Adh	GeneID	CDS	273396	273483	.	-	.	transcript "26"
Adh	GeneID	start_codon	273481	273483	.	-	.	transcript "26"
Adh	GeneID	start_codon	274763	274765	.	+	.	transcript "27"
Adh	GeneID	CDS	274763	275383	.	+	.	transcript "27"
Adh	GeneID	CDS	277228	277299	.	+	.	transcript "27"
Adh	GeneID	stop_codon	277297	277299	.	+	.	transcript "27"
Adh	GeneID	start_codon	277921	277923	.	+	.	transcript "28"
Adh	GeneID	CDS	277921	278103	.	+	.	transcript "28"
Adh	GeneID	CDS	278222	278345	.	+	.	transcript "28"
Adh	GeneID	CDS	278537	278737	.	+	.	transcript "28"
Adh	GeneID	CDS	278802	279272	.	+	.	transcript "28"
Adh	GeneID	CDS	279548	279726	.	+	.	transcript "28"
Adh	GeneID	CDS	280031	280247	.	+	.	transcript "28"
Adh	GeneID	CDS	280310	280610	.	+	.	transcript "28"
Adh	GeneID	CDS	280674	280986	.	+	.	transcript "28"
Adh	GeneID	CDS	281051	281202	.	+	.	transcript "28"
Adh	GeneID	CDS	281264	281447	.	+	.	transcript "28"
Adh	GeneID	CDS	281550	281787	.	+	.	transcript "28"
Adh	GeneID	CDS	281848	282471	.	+	.	transcript "28"
Adh	GeneID	CDS	282539	283541	.	+	.	transcript "28"
Adh	GeneID	CDS	284969	285346	.	+	.	transcript "28"
Adh	GeneID	CDS	285416	286203	.	+	.	transcript "28"
Adh	GeneID	CDS	287010	287068	.	+	.	transcript "28"
Adh	GeneID	stop_codon	287066	287068	.	+	.	transcript "28"
Adh	GeneID	start_codon	287599	287601	.	+	.	transcript "29"
Adh	GeneID	CDS	287599	288379	.	+	.	transcript "29"
Adh	GeneID	CDS	288647	292689	.	+	.	transcript "29"
Adh	GeneID	CDS	296837	296911	.	+	.	transcript "29"
Adh	GeneID	stop_codon	296909	296911	.	+	.	transcript "29"
Adh	GeneID	start_codon	297680	297682	.	+	.	transcript "30"
Adh	GeneID	CDS	297680	297713	.	+	.	transcript "30"
Adh	GeneID	CDS	300675	300768	.	+	.	transcript "30"
Adh	GeneID	CDS	301078	301163	.	+	.	transcript "30"
Adh	GeneID	CDS	302560	302718	.	+	.	transcript "30"
Adh	GeneID	CDS	302786	303405	.	+	.	transcript "30"
Adh	GeneID	stop_codon	303403	303405	.	+	.	transcript "30"
Adh	GeneID	stop_codon	303960	303962	.	-	.	transcript "31"
Adh	GeneID	CDS	303960	304272	.	-	.	transcript "31"
Adh	GeneID	CDS	304330	304868	.	-	.	transcript "31"
Adh	GeneID	start_codon	304866	304868	.	-	.	transcript "31"
Adh	GeneID	start_codon	305396	305398	.	+	.	transcript "32"
Adh	GeneID	CDS	305396	305516	.	+	.	transcript "32"
Adh	GeneID	CDS	305577	305737	.	+	.	transcript "32"
Adh	GeneID	CDS	305803	306108	.	+	.	transcript "32"
Adh	GeneID	CDS	307656	309056	.	+	.	transcript "32"
Adh	GeneID	CDS	309110	309467	.	+	.	transcript "32"
Adh	GeneID	CDS	309530	310452	.	+	.	transcript "32"
Adh	GeneID	CDS	310517	311365	.	+	.	transcript "32"
Adh	GeneID	CDS	311428	312318	.	+	.	transcript "32"
Adh	GeneID	CDS	312387	313020	.	+	.	transcript "32"
Adh	GeneID	CDS	313086	313129	.	+	.	transcript "32"
Adh	GeneID	stop_codon	313127	313129	.	+	.	transcript "32"
Adh	GeneID	start_codon	315321	315323	.	+	.	transcript "33"
Adh	GeneID	CDS	315321	315899	.	+	.	transcript "33"
Adh	GeneID	CDS	316433	316800	.	+	.	transcript "33"
Adh	GeneID	CDS	316865	317462	.	+	.	transcript "33"
Adh	GeneID	stop_codon	317460	317462	.	+	.	transcript "33"
Adh	GeneID	stop_codon	318604	318606	.	-	.	transcript "34"
Adh	GeneID	CDS	318604	319430	.	-	.	transcript "34"
Adh	GeneID	CDS	319486	321442	.	-	.	transcript "34"
Adh	GeneID	start_codon	321440	321442	.	-	.	transcript "34"
Adh	GeneID	stop_codon	321967	321969	.	-	.	transcript "35"
Adh	GeneID	CDS	321967	323027	.	-	.	transcript "35"
Adh	GeneID	CDS	323097	323169	.	-	.	transcript "35"
Adh	GeneID	start_codon	323167	323169	.	-	.	transcript "35"
Adh	GeneID	start_codon	324088	324090	.	+	.	transcript "36"
Adh	GeneID	CDS	324088	324885	.	+	.	transcript "36"
Adh	GeneID	CDS	324939	325181	.	+	.	transcript "36"
Adh	GeneID	CDS	327205	328002	.	+	.	transcript "36"
Adh	GeneID	stop_codon	328000	328002	.	+	.	transcript "36"
Adh	GeneID	start_codon	329808	329810	.	+	.	transcript "37"
Adh	GeneID	CDS	329808	330183	.	+	.	transcript "37"
Adh	GeneID	CDS	331090	331184	.	+	.	transcript "37"
Adh	GeneID	stop_codon	331182	331184	.	+	.	transcript "37"
Adh	GeneID	stop_codon	336668	336670	.	-	.	transcript "38"
Adh	GeneID	CDS	336668	337323	.	-	.	transcript "38"
Adh	GeneID	CDS	338217	338879	.	-	.	transcript "38"
Adh	GeneID	CDS	338944	339013	.	-	.	transcript "38"
Adh	GeneID	start_codon	339011	339013	.	-	.	transcript "38"
Adh	GeneID	start_codon	340801	340803	.	+	.	transcript "39"
Adh	GeneID	CDS	340801	340870	.	+	.	transcript "39"
Adh	GeneID	CDS	341042	341517	.	+	.	transcript "39"
Adh	GeneID	stop_codon	341515	341517	.	+	.	transcript "39"
Adh	GeneID	start_codon	342065	342067	.	+	.	transcript "40"
Adh	GeneID	CDS	342065	342689	.	+	.	transcript "40"
Adh	GeneID	CDS	352465	352507	.	+	.	transcript "40"
Adh	GeneID	CDS	352710	352779	.	+	.	transcript "40"
Adh	GeneID	CDS	353896	353995	.	+	.	transcript "40"
Adh	GeneID	CDS	355461	355495	.	+	.	transcript "40"
Adh	GeneID	stop_codon	355493	355495	.	+	.	transcript "40"
Adh	GeneID	stop_codon	357545	357547	.	-	.	transcript "41"
Adh	GeneID	CDS	357545	357620	.	-	.	transcript "41"
Adh	GeneID	CDS	360158	360259	.	-	.	transcript "41"
Adh	GeneID	CDS	360758	360834	.	-	.	transcript "41"
Adh	GeneID	start_codon	360832	360834	.	-	.	transcript "41"
Adh	GeneID	start_codon	363679	363681	.	+	.	transcript "42"
Adh	GeneID	CDS	363679	363789	.	+	.	transcript "42"
Adh	GeneID	CDS	365825	365872	.	+	.	transcript "42"
Adh	GeneID	CDS	366881	366996	.	+	.	transcript "42"
Adh	GeneID	CDS	367823	367921	.	+	.	transcript "42"
Adh	GeneID	CDS	368199	368283	.	+	.	transcript "42"
Adh	GeneID	stop_codon	368281	368283	.	+	.	transcript "42"
Adh	GeneID	start_codon	373286	373288	.	+	.	transcript "43"
Adh	GeneID	CDS	373286	373457	.	+	.	transcript "43"
Adh	GeneID	CDS	380155	380203	.	+	.	transcript "43"
Adh	GeneID	CDS	381372	381403	.	+	.	transcript "43"
Adh	GeneID	CDS	385051	385283	.	+	.	transcript "43"
Adh	GeneID	CDS	388780	388921	.	+	.	transcript "43"
Adh	GeneID	CDS	389006	389140	.	+	.	transcript "43"
Adh	GeneID	CDS	389208	390491	.	+	.	transcript "43"
Adh	GeneID	CDS	390556	390673	.	+	.	transcript "43"
Adh	GeneID	CDS	390737	391112	.	+	.	transcript "43"
Adh	GeneID	CDS	391177	391489	.	+	.	transcript "43"
Adh	GeneID	CDS	391830	391921	.	+	.	transcript "43"
Adh	GeneID	stop_codon	391919	391921	.	+	.	transcript "43"
Adh	GeneID	stop_codon	393573	393575	.	-	.	transcript "44"
Adh	GeneID	CDS	393573	393814	.	-	.	transcript "44"
Adh	GeneID	CDS	393894	394052	.	-	.	transcript "44"
Adh	GeneID	CDS	394383	395732	.	-	.	transcript "44"
Adh	GeneID	CDS	395826	397468	.	-	.	transcript "44"
Adh	GeneID	CDS	397532	397671	.	-	.	transcript "44"
Adh	GeneID	start_codon	397669	397671	.	-	.	transcript "44"
Adh	GeneID	start_codon	400338	400340	.	+	.	transcript "45"
Adh	GeneID	CDS	400338	400923	.	+	.	transcript "45"
Adh	GeneID	CDS	401350	401713	.	+	.	transcript "45"
Adh	GeneID	CDS	401775	402341	.	+	.	transcript "45"
Adh	GeneID	CDS	402399	402539	.	+	.	transcript "45"
Adh	GeneID	CDS	403000	403033	.	+	.	transcript "45"
Adh	GeneID	stop_codon	403031	403033	.	+	.	transcript "45"
Adh	GeneID	start_codon	403813	403815	.	+	.	transcript "46"
Adh	GeneID	CDS	403813	404414	.	+	.	transcript "46"
Adh	GeneID	CDS	404467	405027	.	+	.	transcript "46"
Adh	GeneID	CDS	405085	405391	.	+	.	transcript "46"
Adh	GeneID	stop_codon	405389	405391	.	+	.	transcript "46"
Adh	GeneID	start_codon	408759	408761	.	+	.	transcript "47"
Adh	GeneID	CDS	408759	409001	.	+	.	transcript "47"
Adh	GeneID	CDS	409150	409656	.	+	.	transcript "47"
Adh	GeneID	CDS	410157	410315	.	+	.	transcript "47"
Adh	GeneID	CDS	410372	410612	.	+	.	transcript "47"
Adh	GeneID	CDS	410677	411401	.	+	.	transcript "47"
Adh	GeneID	CDS	411728	411835	.	+	.	transcript "47"
Adh	GeneID	stop_codon	411833	411835	.	+	.	transcript "47"
Adh	GeneID	stop_codon	415576	415578	.	-	.	transcript "48"
Adh	GeneID	CDS	415576	416211	.	-	.	transcript "48"
Adh	GeneID	CDS	416276	416749	.	-	.	transcript "48"
Adh	GeneID	CDS	424891	424974	.	-	.	transcript "48"
Adh	GeneID	start_codon	424972	424974	.	-	.	transcript "48"
Adh	GeneID	stop_codon	426746	426748	.	-	.	transcript "49"
Adh	GeneID	CDS	426746	427546	.	-	.	transcript "49"
Adh	GeneID	CDS	434505	434541	.	-	.	transcript "49"
Adh	GeneID	CDS	438983	439800	.	-	.	transcript "49"
Adh	GeneID	CDS	440839	440877	.	-	.	transcript "49"
Adh	GeneID	CDS	443615	443701	.	-	.	transcript "49"
Adh	GeneID	start_codon	443699	443701	.	-	.	transcript "49"
Adh	GeneID	start_codon	444366	444368	.	+	.	transcript "50"
Adh	GeneID	CDS	444366	444410	.	+	.	transcript "50"
Adh	GeneID	CDS	448492	448607	.	+	.	transcript "50"
Adh	GeneID	CDS	449015	449184	.	+	.	transcript "50"
Adh	GeneID	CDS	450558	450589	.	+	.	transcript "50"
Adh	GeneID	stop_codon	450587	450589	.	+	.	transcript "50"
Adh	GeneID	start_codon	451645	451647	.	+	.	transcript "51"
Adh	GeneID	CDS	451645	451902	.	+	.	transcript "51"
Adh	GeneID	CDS	454718	454755	.	+	.	transcript "51"
Adh	GeneID	CDS	454999	455702	.	+	.	transcript "51"
Adh	GeneID	CDS	455870	456267	.	+	.	transcript "51"
Adh	GeneID	stop_codon	456265	456267	.	+	.	transcript "51"
Adh	GeneID	start_codon	457298	457300	.	+	.	transcript "52"
Adh	GeneID	CDS	457298	457488	.	+	.	transcript "52"
Adh	GeneID	CDS	457649	458210	.	+	.	transcript "52"
Adh	GeneID	stop_codon	458208	458210	.	+	.	transcript "52"
Adh	GeneID	stop_codon	458837	458839	.	-	.	transcript "53"
Adh	GeneID	CDS	458837	459146	.	-	.	transcript "53"
Adh	GeneID	CDS	459225	459761	.	-	.	transcript "53"
Adh	GeneID	CDS	460256	460674	.	-	.	transcript "53"
Adh	GeneID	start_codon	460672	460674	.	-	.	transcript "53"
Adh	GeneID	stop_codon	462092	462094	.	-	.	transcript "54"
Adh	GeneID	CDS	462092	462584	.	-	.	transcript "54"
Adh	GeneID	CDS	462646	463209	.	-	.	transcript "54"
Adh	GeneID	CDS	463368	463657	.	-	.	transcript "54"
Adh	GeneID	start_codon	463655	463657	.	-	.	transcript "54"
Adh	GeneID	start_codon	464308	464310	.	+	.	transcript "55"
Adh	GeneID	CDS	464308	464615	.	+	.	transcript "55"
Adh	GeneID	CDS	464888	465434	.	+	.	transcript "55"
Adh	GeneID	stop_codon	465432	465434	.	+	.	transcript "55"
Adh	GeneID	stop_codon	466940	466942	.	-	.	transcript "56"
Adh	GeneID	CDS	466940	466984	.	-	.	transcript "56"
Adh	GeneID	CDS	468156	469610	.	-	.	transcript "56"
Adh	GeneID	start_codon	469608	469610	.	-	.	transcript "56"
Adh	GeneID	start_codon	471109	471111	.	+	.	transcript "57"
Adh	GeneID	CDS	471109	471296	.	+	.	transcript "57"
Adh	GeneID	CDS	471441	471687	.	+	.	transcript "57"
Adh	GeneID	CDS	471752	471856	.	+	.	transcript "57"
Adh	GeneID	CDS	471944	472490	.	+	.	transcript "57"
Adh	GeneID	CDS	472557	472823	.	+	.	transcript "57"
Adh	GeneID	CDS	472965	473128	.	+	.	transcript "57"
Adh	GeneID	stop_codon	473126	473128	.	+	.	transcript "57"
Adh	GeneID	start_codon	474097	474099	.	+	.	transcript "58"
Adh	GeneID	CDS	474097	474189	.	+	.	transcript "58"
Adh	GeneID	CDS	474251	474306	.	+	.	transcript "58"
Adh	GeneID	CDS	474365	475283	.	+	.	transcript "58"
Adh	GeneID	CDS	475427	476389	.	+	.	transcript "58"
Adh	GeneID	stop_codon	476387	476389	.	+	.	transcript "58"
Adh	GeneID	stop_codon	477171	477173	.	-	.	transcript "59"
Adh	GeneID	CDS	477171	477490	.	-	.	transcript "59"
Adh	GeneID	CDS	477548	479329	.	-	.	transcript "59"
Adh	GeneID	CDS	479386	479753	.	-	.	transcript "59"
Adh	GeneID	CDS	480016	480081	.	-	.	transcript "59"
Adh	GeneID	CDS	481570	481638	.	-	.	transcript "59"
Adh	GeneID	CDS	483386	483457	.	-	.	transcript "59"
Adh	GeneID	CDS	486686	487236	.	-	.	transcript "59"
Adh	GeneID	start_codon	487234	487236	.	-	.	transcript "59"
Adh	GeneID	start_codon	501938	501940	.	+	.	transcript "60"
Adh	GeneID	CDS	501938	502055	.	+	.	transcript "60"
Adh	GeneID	CDS	502113	502184	.	+	.	transcript "60"
Adh	GeneID	CDS	506504	506598	.	+	.	transcript "60"
Adh	GeneID	stop_codon	506596	506598	.	+	.	transcript "60"
Adh	GeneID	start_codon	509545	509547	.	+	.	transcript "61"
Adh	GeneID	CDS	509545	509783	.	+	.	transcript "61"
Adh	GeneID	CDS	509881	510226	.	+	.	transcript "61"
Adh	GeneID	CDS	510287	510786	.	+	.	transcript "61"
Adh	GeneID	CDS	511784	512375	.	+	.	transcript "61"
Adh	GeneID	CDS	512435	512758	.	+	.	transcript "61"
Adh	GeneID	stop_codon	512756	512758	.	+	.	transcript "61"
Adh	GeneID	start_codon	514500	514502	.	+	.	transcript "62"
Adh	GeneID	CDS	514500	514568	.	+	.	transcript "62"
Adh	GeneID	CDS	516142	516186	.	+	.	transcript "62"
Adh	GeneID	CDS	517385	517424	.	+	.	transcript "62"
Adh	GeneID	CDS	519063	519100	.	+	.	transcript "62"
Adh	GeneID	stop_codon	519098	519100	.	+	.	transcript "62"
Adh	GeneID	start_codon	520781	520783	.	+	.	transcript "63"
Adh	GeneID	CDS	520781	521850	.	+	.	transcript "63"
Adh	GeneID	CDS	522013	522988	.	+	.	transcript "63"
Adh	GeneID	stop_codon	522986	522988	.	+	.	transcript "63"
Adh	GeneID	start_codon	541380	541382	.	+	.	transcript "64"
Adh	GeneID	CDS	541380	541868	.	+	.	transcript "64"
Adh	GeneID	CDS	546070	546114	.	+	.	transcript "64"
Adh	GeneID	stop_codon	546112	546114	.	+	.	transcript "64"
Adh	GeneID	start_codon	552260	552262	.	+	.	transcript "65"
Adh	GeneID	CDS	552260	552388	.	+	.	transcript "65"
Adh	GeneID	CDS	554707	554823	.	+	.	transcript "65"
Adh	GeneID	stop_codon	554821	554823	.	+	.	transcript "65"
Adh	GeneID	start_codon	555669	555671	.	+	.	transcript "66"
Adh	GeneID	CDS	555669	555824	.	+	.	transcript "66"
Adh	GeneID	CDS	555920	556370	.	+	.	transcript "66"
Adh	GeneID	CDS	565238	565272	.	+	.	transcript "66"
Adh	GeneID	CDS	570329	570621	.	+	.	transcript "66"
Adh	GeneID	CDS	570790	570947	.	+	.	transcript "66"
Adh	GeneID	CDS	574289	574483	.	+	.	transcript "66"
Adh	GeneID	CDS	575409	575495	.	+	.	transcript "66"
Adh	GeneID	CDS	577240	577316	.	+	.	transcript "66"
Adh	GeneID	CDS	578136	578177	.	+	.	transcript "66"
Adh	GeneID	stop_codon	578175	578177	.	+	.	transcript "66"
Adh	GeneID	start_codon	582449	582451	.	+	.	transcript "67"
Adh	GeneID	CDS	582449	582610	.	+	.	transcript "67"
Adh	GeneID	CDS	588100	588144	.	+	.	transcript "67"
Adh	GeneID	CDS	590806	590840	.	+	.	transcript "67"
Adh	GeneID	CDS	597180	597264	.	+	.	transcript "67"
Adh	GeneID	stop_codon	597262	597264	.	+	.	transcript "67"
Adh	GeneID	start_codon	598403	598405	.	+	.	transcript "68"
Adh	GeneID	CDS	598403	598796	.	+	.	transcript "68"
Adh	GeneID	CDS	598857	599119	.	+	.	transcript "68"
Adh	GeneID	CDS	599219	600403	.	+	.	transcript "68"
Adh	GeneID	CDS	601852	601887	.	+	.	transcript "68"
Adh	GeneID	stop_codon	601885	601887	.	+	.	transcript "68"
Adh	GeneID	stop_codon	618525	618527	.	-	.	transcript "69"
Adh	GeneID	CDS	618525	618629	.	-	.	transcript "69"
Adh	GeneID	CDS	619451	619606	.	-	.	transcript "69"
Adh	GeneID	CDS	619825	619926	.	-	.	transcript "69"
Adh	GeneID	start_codon	619924	619926	.	-	.	transcript "69"
Adh	GeneID	start_codon	645844	645846	.	+	.	transcript "70"
Adh	GeneID	CDS	645844	645912	.	+	.	transcript "70"
Adh	GeneID	CDS	650611	651153	.	+	.	transcript "70"
Adh	GeneID	CDS	651278	651478	.	+	.	transcript "70"
Adh	GeneID	CDS	651583	652282	.	+	.	transcript "70"
Adh	GeneID	CDS	652397	652740	.	+	.	transcript "70"
Adh	GeneID	CDS	654404	654441	.	+	.	transcript "70"
Adh	GeneID	CDS	654829	654889	.	+	.	transcript "70"
Adh	GeneID	stop_codon	654887	654889	.	+	.	transcript "70"
Adh	GeneID	start_codon	655882	655884	.	+	.	transcript "71"
Adh	GeneID	CDS	655882	655918	.	+	.	transcript "71"
Adh	GeneID	CDS	656060	656143	.	+	.	transcript "71"
Adh	GeneID	CDS	656207	656368	.	+	.	transcript "71"
Adh	GeneID	CDS	656510	656593	.	+	.	transcript "71"
Adh	GeneID	CDS	656717	656922	.	+	.	transcript "71"
Adh	GeneID	stop_codon	656920	656922	.	+	.	transcript "71"
Adh	GeneID	stop_codon	657691	657693	.	-	.	transcript "72"
Adh	GeneID	CDS	657691	658001	.	-	.	transcript "72"
Adh	GeneID	CDS	658058	658265	.	-	.	transcript "72"
Adh	GeneID	CDS	658326	658463	.	-	.	transcript "72"
Adh	GeneID	CDS	658526	660838	.	-	.	transcript "72"
Adh	GeneID	CDS	660917	661225	.	-	.	transcript "72"
Adh	GeneID	start_codon	661223	661225	.	-	.	transcript "72"
Adh	GeneID	stop_codon	675845	675847	.	-	.	transcript "73"
Adh	GeneID	CDS	675845	675884	.	-	.	transcript "73"
Adh	GeneID	CDS	678040	678080	.	-	.	transcript "73"
Adh	GeneID	CDS	678702	678757	.	-	.	transcript "73"
Adh	GeneID	CDS	679981	680889	.	-	.	transcript "73"
Adh	GeneID	CDS	682192	682252	.	-	.	transcript "73"
Adh	GeneID	CDS	682831	682969	.	-	.	transcript "73"
Adh	GeneID	CDS	683154	683188	.	-	.	transcript "73"
Adh	GeneID	start_codon	683186	683188	.	-	.	transcript "73"
Adh	GeneID	stop_codon	686267	686269	.	-	.	transcript "74"
Adh	GeneID	CDS	686267	686318	.	-	.	transcript "74"
Adh	GeneID	CDS	689469	689746	.	-	.	transcript "74"
Adh	GeneID	CDS	689811	689983	.	-	.	transcript "74"
Adh	GeneID	CDS	691393	691603	.	-	.	transcript "74"
Adh	GeneID	CDS	692320	692362	.	-	.	transcript "74"
Adh	GeneID	CDS	692525	692589	.	-	.	transcript "74"
Adh	GeneID	start_codon	692587	692589	.	-	.	transcript "74"
Adh	GeneID	start_codon	694468	694470	.	+	.	transcript "75"
Adh	GeneID	CDS	694468	694500	.	+	.	transcript "75"
Adh	GeneID	CDS	694884	695008	.	+	.	transcript "75"
Adh	GeneID	CDS	695350	695392	.	+	.	transcript "75"
Adh	GeneID	stop_codon	695390	695392	.	+	.	transcript "75"
Adh	GeneID	stop_codon	702813	702815	.	-	.	transcript "76"
Adh	GeneID	CDS	702813	702853	.	-	.	transcript "76"
Adh	GeneID	CDS	708573	708672	.	-	.	transcript "76"
Adh	GeneID	CDS	710763	710805	.	-	.	transcript "76"
Adh	GeneID	CDS	716575	716639	.	-	.	transcript "76"
Adh	GeneID	start_codon	716637	716639	.	-	.	transcript "76"
Adh	GeneID	start_codon	717626	717628	.	+	.	transcript "77"
Adh	GeneID	CDS	717626	717770	.	+	.	transcript "77"
Adh	GeneID	CDS	717926	718029	.	+	.	transcript "77"
Adh	GeneID	stop_codon	718027	718029	.	+	.	transcript "77"
Adh	GeneID	start_codon	722080	722082	.	+	.	transcript "78"
Adh	GeneID	CDS	722080	722124	.	+	.	transcript "78"
Adh	GeneID	CDS	725159	725302	.	+	.	transcript "78"
Adh	GeneID	CDS	735103	735171	.	+	.	transcript "78"
Adh	GeneID	stop_codon	735169	735171	.	+	.	transcript "78"
Adh	GeneID	stop_codon	739646	739648	.	-	.	transcript "79"
Adh	GeneID	CDS	739646	739678	.	-	.	transcript "79"
Adh	GeneID	CDS	742986	743055	.	-	.	transcript "79"
Adh	GeneID	CDS	748186	748265	.	-	.	transcript "79"
Adh	GeneID	CDS	749991	750045	.	-	.	transcript "79"
Adh	GeneID	CDS	753536	753620	.	-	.	transcript "79"
Adh	GeneID	CDS	756108	756171	.	-	.	transcript "79"
Adh	GeneID	CDS	758657	758746	.	-	.	transcript "79"
Adh	GeneID	start_codon	758744	758746	.	-	.	transcript "79"
Adh	GeneID	start_codon	761011	761013	.	+	.	transcript "80"
Adh	GeneID	CDS	761011	761042	.	+	.	transcript "80"
Adh	GeneID	CDS	768619	768676	.	+	.	transcript "80"
Adh	GeneID	CDS	770770	770851	.	+	.	transcript "80"
Adh	GeneID	CDS	771955	772295	.	+	.	transcript "80"
Adh	GeneID	CDS	779692	781583	.	+	.	transcript "80"
Adh	GeneID	CDS	781886	782694	.	+	.	transcript "80"
Adh	GeneID	CDS	786542	786593	.	+	.	transcript "80"
Adh	GeneID	CDS	789714	789824	.	+	.	transcript "80"
Adh	GeneID	CDS	792099	792144	.	+	.	transcript "80"
Adh	GeneID	stop_codon	792142	792144	.	+	.	transcript "80"
Adh	GeneID	start_codon	801924	801926	.	+	.	transcript "81"
Adh	GeneID	CDS	801924	802914	.	+	.	transcript "81"
Adh	GeneID	CDS	809050	809081	.	+	.	transcript "81"
Adh	GeneID	stop_codon	809079	809081	.	+	.	transcript "81"
Adh	GeneID	start_codon	811439	811441	.	+	.	transcript "82"
Adh	GeneID	CDS	811439	811483	.	+	.	transcript "82"
Adh	GeneID	CDS	813257	814049	.	+	.	transcript "82"
Adh	GeneID	CDS	814383	814650	.	+	.	transcript "82"
Adh	GeneID	CDS	814726	814981	.	+	.	transcript "82"
Adh	GeneID	CDS	815046	815442	.	+	.	transcript "82"
Adh	GeneID	CDS	815528	817215	.	+	.	transcript "82"
Adh	GeneID	CDS	817273	818025	.	+	.	transcript "82"
Adh	GeneID	CDS	818086	818367	.	+	.	transcript "82"
Adh	GeneID	CDS	818447	818574	.	+	.	transcript "82"
Adh	GeneID	CDS	818633	819290	.	+	.	transcript "82"
Adh	GeneID	CDS	820171	820789	.	+	.	transcript "82"
Adh	GeneID	CDS	820846	820979	.	+	.	transcript "82"
Adh	GeneID	CDS	821037	821265	.	+	.	transcript "82"
Adh	GeneID	CDS	821333	821487	.	+	.	transcript "82"
Adh	GeneID	stop_codon	821485	821487	.	+	.	transcript "82"
Adh	GeneID	start_codon	822205	822207	.	+	.	transcript "83"
Adh	GeneID	CDS	822205	822454	.	+	.	transcript "83"
Adh	GeneID	CDS	822511	822815	.	+	.	transcript "83"
Adh	GeneID	CDS	822874	824011	.	+	.	transcript "83"
Adh	GeneID	CDS	824074	824822	.	+	.	transcript "83"
Adh	GeneID	CDS	824885	825688	.	+	.	transcript "83"
Adh	GeneID	CDS	825804	826423	.	+	.	transcript "83"
Adh	GeneID	CDS	827148	827511	.	+	.	transcript "83"
Adh	GeneID	stop_codon	827509	827511	.	+	.	transcript "83"
Adh	GeneID	start_codon	828047	828049	.	+	.	transcript "84"
Adh	GeneID	CDS	828047	828306	.	+	.	transcript "84"
Adh	GeneID	CDS	829802	829847	.	+	.	transcript "84"
Adh	GeneID	stop_codon	829845	829847	.	+	.	transcript "84"
Adh	GeneID	start_codon	832137	832139	.	+	.	transcript "85"
Adh	GeneID	CDS	832137	833531	.	+	.	transcript "85"
Adh	GeneID	CDS	834471	834502	.	+	.	transcript "85"
Adh	GeneID	CDS	835043	835312	.	+	.	transcript "85"
Adh	GeneID	CDS	836589	837106	.	+	.	transcript "85"
Adh	GeneID	CDS	837173	837428	.	+	.	transcript "85"
Adh	GeneID	CDS	837486	837859	.	+	.	transcript "85"
Adh	GeneID	CDS	837919	838152	.	+	.	transcript "85"
Adh	GeneID	CDS	838217	839076	.	+	.	transcript "85"
Adh	GeneID	stop_codon	839074	839076	.	+	.	transcript "85"
Adh	GeneID	stop_codon	841091	841093	.	-	.	transcript "86"
Adh	GeneID	CDS	841091	841333	.	-	.	transcript "86"
Adh	GeneID	CDS	841389	841969	.	-	.	transcript "86"
Adh	GeneID	CDS	842034	842362	.	-	.	transcript "86"
Adh	GeneID	CDS	843445	843518	.	-	.	transcript "86"
Adh	GeneID	CDS	846607	847372	.	-	.	transcript "86"
Adh	GeneID	CDS	847433	848154	.	-	.	transcript "86"
Adh	GeneID	CDS	848208	848609	.	-	.	transcript "86"
Adh	GeneID	CDS	848668	848733	.	-	.	transcript "86"
Adh	GeneID	start_codon	848731	848733	.	-	.	transcript "86"
Adh	GeneID	start_codon	851085	851087	.	+	.	transcript "87"
Adh	GeneID	CDS	851085	851190	.	+	.	transcript "87"
Adh	GeneID	CDS	851256	851436	.	+	.	transcript "87"
Adh	GeneID	CDS	851491	851673	.	+	.	transcript "87"
Adh	GeneID	CDS	853223	855014	.	+	.	transcript "87"
Adh	GeneID	stop_codon	855012	855014	.	+	.	transcript "87"
Adh	GeneID	start_codon	855874	855876	.	+	.	transcript "88"
Adh	GeneID	CDS	855874	855922	.	+	.	transcript "88"
Adh	GeneID	CDS	855982	856031	.	+	.	transcript "88"
Adh	GeneID	CDS	856092	856876	.	+	.	transcript "88"
Adh	GeneID	CDS	856942	858029	.	+	.	transcript "88"
Adh	GeneID	CDS	858109	858341	.	+	.	transcript "88"
Adh	GeneID	CDS	858418	858955	.	+	.	transcript "88"
Adh	GeneID	CDS	859860	859891	.	+	.	transcript "88"
Adh	GeneID	stop_codon	859889	859891	.	+	.	transcript "88"
Adh	GeneID	stop_codon	870700	870702	.	-	.	transcript "89"
Adh	GeneID	CDS	870700	870991	.	-	.	transcript "89"
Adh	GeneID	CDS	872891	873131	.	-	.	transcript "89"
Adh	GeneID	CDS	873191	873263	.	-	.	transcript "89"
Adh	GeneID	CDS	873583	874093	.	-	.	transcript "89"
Adh	GeneID	CDS	875573	875604	.	-	.	transcript "89"
Adh	GeneID	start_codon	875602	875604	.	-	.	transcript "89"
Adh	GeneID	stop_codon	876384	876386	.	-	.	transcript "90"
Adh	GeneID	CDS	876384	876445	.	-	.	transcript "90"
Adh	GeneID	CDS	878185	878253	.	-	.	transcript "90"
Adh	GeneID	CDS	885047	885676	.	-	.	transcript "90"
Adh	GeneID	CDS	885967	886798	.	-	.	transcript "90"
Adh	GeneID	CDS	892950	893033	.	-	.	transcript "90"
Adh	GeneID	start_codon	893031	893033	.	-	.	transcript "90"
Adh	GeneID	stop_codon	909468	909470	.	-	.	transcript "91"
Adh	GeneID	CDS	909468	909520	.	-	.	transcript "91"
Adh	GeneID	CDS	909634	909694	.	-	.	transcript "91"
Adh	GeneID	CDS	910801	911055	.	-	.	transcript "91"
Adh	GeneID	start_codon	911053	911055	.	-	.	transcript "91"
Adh	GeneID	stop_codon	918151	918153	.	-	.	transcript "92"
Adh	GeneID	CDS	918151	918795	.	-	.	transcript "92"
Adh	GeneID	CDS	923305	923338	.	-	.	transcript "92"
Adh	GeneID	CDS	927072	927193	.	-	.	transcript "92"
Adh	GeneID	start_codon	927191	927193	.	-	.	transcript "92"
Adh	GeneID	start_codon	936628	936630	.	+	.	transcript "93"
Adh	GeneID	CDS	936628	936689	.	+	.	transcript "93"
Adh	GeneID	CDS	937004	937060	.	+	.	transcript "93"
Adh	GeneID	CDS	940648	940729	.	+	.	transcript "93"
Adh	GeneID	CDS	952073	952111	.	+	.	transcript "93"
Adh	GeneID	CDS	954429	954461	.	+	.	transcript "93"
Adh	GeneID	stop_codon	954459	954461	.	+	.	transcript "93"
Adh	GeneID	start_codon	964272	964274	.	+	.	transcript "94"
Adh	GeneID	CDS	964272	964449	.	+	.	transcript "94"
Adh	GeneID	CDS	965831	965886	.	+	.	transcript "94"
Adh	GeneID	stop_codon	965884	965886	.	+	.	transcript "94"
Adh	GeneID	start_codon	984981	984983	.	+	.	transcript "95"
Adh	GeneID	CDS	984981	985070	.	+	.	transcript "95"
Adh	GeneID	CDS	985373	986896	.	+	.	transcript "95"
Adh	GeneID	stop_codon	986894	986896	.	+	.	transcript "95"
Adh	GeneID	stop_codon	988365	988367	.	-	.	transcript "96"
Adh	GeneID	CDS	988365	988405	.	-	.	transcript "96"
Adh	GeneID	CDS	997178	997221	.	-	.	transcript "96"
Adh	GeneID	CDS	997414	997461	.	-	.	transcript "96"
Adh	GeneID	CDS	1002231	1002292	.	-	.	transcript "96"
Adh	GeneID	start_codon	1002290	1002292	.	-	.	transcript "96"
Adh	GeneID	start_codon	1005238	1005240	.	+	.	transcript "97"
Adh	GeneID	CDS	1005238	1005277	.	+	.	transcript "97"
Adh	GeneID	CDS	1007522	1007590	.	+	.	transcript "97"
Adh	GeneID	CDS	1012157	1012246	.	+	.	transcript "97"
Adh	GeneID	CDS	1012639	1012679	.	+	.	transcript "97"
Adh	GeneID	stop_codon	1012677	1012679	.	+	.	transcript "97"
Adh	GeneID	start_codon	1014189	1014191	.	+	.	transcript "98"
Adh	GeneID	CDS	1014189	1014225	.	+	.	transcript "98"
Adh	GeneID	CDS	1015461	1015515	.	+	.	transcript "98"
Adh	GeneID	CDS	1016252	1016384	.	+	.	transcript "98"
Adh	GeneID	stop_codon	1016382	1016384	.	+	.	transcript "98"
Adh	GeneID	stop_codon	1028782	1028784	.	-	.	transcript "99"
Adh	GeneID	CDS	1028782	1028824	.	-	.	transcript "99"
Adh	GeneID	CDS	1031524	1031590	.	-	.	transcript "99"
Adh	GeneID	CDS	1041602	1041989	.	-	.	transcript "99"
Adh	GeneID	CDS	1042386	1042688	.	-	.	transcript "99"
Adh	GeneID	start_codon	1042686	1042688	.	-	.	transcript "99"
Adh	GeneID	stop_codon	1064499	1064501	.	-	.	transcript "100"
Adh	GeneID	CDS	1064499	1064541	.	-	.	transcript "100"
Adh	GeneID	CDS	1065198	1065299	.	-	.	transcript "100"
Adh	GeneID	CDS	1065545	1065723	.	-	.	transcript "100"
Adh	GeneID	start_codon	1065721	1065723	.	-	.	transcript "100"
Adh	GeneID	start_codon	1075625	1075627	.	+	.	transcript "101"
Adh	GeneID	CDS	1075625	1075695	.	+	.	transcript "101"
Adh	GeneID	CDS	1078475	1078592	.	+	.	transcript "101"
Adh	GeneID	CDS	1084256	1084368	.	+	.	transcript "101"
Adh	GeneID	CDS	1088043	1088085	.	+	.	transcript "101"
Adh	GeneID	stop_codon	1088083	1088085	.	+	.	transcript "101"
Adh	GeneID	stop_codon	1094605	1094607	.	-	.	transcript "102"
Adh	GeneID	CDS	1094605	1094643	.	-	.	transcript "102"
Adh	GeneID	CDS	1095422	1095533	.	-	.	transcript "102"
Adh	GeneID	CDS	1095586	1095735	.	-	.	transcript "102"
Adh	GeneID	CDS	1095848	1095987	.	-	.	transcript "102"
Adh	GeneID	CDS	1096326	1098979	.	-	.	transcript "102"
Adh	GeneID	CDS	1101509	1101797	.	-	.	transcript "102"
Adh	GeneID	start_codon	1101795	1101797	.	-	.	transcript "102"
Adh	GeneID	stop_codon	1103603	1103605	.	-	.	transcript "103"
Adh	GeneID	CDS	1103603	1103634	.	-	.	transcript "103"
Adh	GeneID	CDS	1104419	1104995	.	-	.	transcript "103"
Adh	GeneID	CDS	1105586	1105651	.	-	.	transcript "103"
Adh	GeneID	CDS	1109073	1109168	.	-	.	transcript "103"
Adh	GeneID	start_codon	1109166	1109168	.	-	.	transcript "103"
Adh	GeneID	start_codon	1110074	1110076	.	+	.	transcript "104"
Adh	GeneID	CDS	1110074	1110172	.	+	.	transcript "104"
Adh	GeneID	CDS	1110238	1110642	.	+	.	transcript "104"
Adh	GeneID	CDS	1110713	1110979	.	+	.	transcript "104"
Adh	GeneID	stop_codon	1110977	1110979	.	+	.	transcript "104"
Adh	GeneID	start_codon	1112087	1112089	.	+	.	transcript "105"
Adh	GeneID	CDS	1112087	1112209	.	+	.	transcript "105"
Adh	GeneID	CDS	1112261	1112578	.	+	.	transcript "105"
Adh	GeneID	stop_codon	1112576	1112578	.	+	.	transcript "105"
Adh	GeneID	stop_codon	1120749	1120751	.	-	.	transcript "106"
Adh	GeneID	CDS	1120749	1120789	.	-	.	transcript "106"
Adh	GeneID	CDS	1127373	1127404	.	-	.	transcript "106"
Adh	GeneID	CDS	1129815	1129895	.	-	.	transcript "106"
Adh	GeneID	CDS	1135298	1135448	.	-	.	transcript "106"
Adh	GeneID	CDS	1140650	1140710	.	-	.	transcript "106"
Adh	GeneID	start_codon	1140708	1140710	.	-	.	transcript "106"
Adh	GeneID	start_codon	1141729	1141731	.	+	.	transcript "107"
Adh	GeneID	CDS	1141729	1141828	.	+	.	transcript "107"
Adh	GeneID	CDS	1141947	1141989	.	+	.	transcript "107"
Adh	GeneID	CDS	1142192	1142261	.	+	.	transcript "107"
Adh	GeneID	CDS	1145597	1145713	.	+	.	transcript "107"
Adh	GeneID	stop_codon	1145711	1145713	.	+	.	transcript "107"
Adh	GeneID	stop_codon	1147763	1147765	.	-	.	transcript "108"
Adh	GeneID	CDS	1147763	1147806	.	-	.	transcript "108"
Adh	GeneID	CDS	1148478	1148530	.	-	.	transcript "108"
Adh	GeneID	CDS	1149750	1149784	.	-	.	transcript "108"
Adh	GeneID	CDS	1150024	1150103	.	-	.	transcript "108"
Adh	GeneID	CDS	1151840	1151874	.	-	.	transcript "108"
Adh	GeneID	CDS	1153200	1153246	.	-	.	transcript "108"
Adh	GeneID	start_codon	1153244	1153246	.	-	.	transcript "108"
Adh	GeneID	stop_codon	1157306	1157308	.	-	.	transcript "109"
Adh	GeneID	CDS	1157306	1157372	.	-	.	transcript "109"
Adh	GeneID	CDS	1159055	1159137	.	-	.	transcript "109"
Adh	GeneID	CDS	1159497	1159579	.	-	.	transcript "109"
Adh	GeneID	CDS	1169027	1169084	.	-	.	transcript "109"
Adh	GeneID	CDS	1179474	1179518	.	-	.	transcript "109"
Adh	GeneID	start_codon	1179516	1179518	.	-	.	transcript "109"
Adh	GeneID	stop_codon	1181634	1181636	.	-	.	transcript "110"
Adh	GeneID	CDS	1181634	1181705	.	-	.	transcript "110"
Adh	GeneID	CDS	1182203	1182415	.	-	.	transcript "110"
Adh	GeneID	start_codon	1182413	1182415	.	-	.	transcript "110"
Adh	GeneID	start_codon	1190280	1190282	.	+	.	transcript "111"
Adh	GeneID	CDS	1190280	1190389	.	+	.	transcript "111"
Adh	GeneID	CDS	1194789	1194854	.	+	.	transcript "111"
Adh	GeneID	CDS	1197300	1197354	.	+	.	transcript "111"
Adh	GeneID	stop_codon	1197352	1197354	.	+	.	transcript "111"
Adh	GeneID	stop_codon	1211853	1211855	.	-	.	transcript "112"
Adh	GeneID	CDS	1211853	1211963	.	-	.	transcript "112"
Adh	GeneID	CDS	1213712	1213750	.	-	.	transcript "112"
Adh	GeneID	CDS	1219570	1220115	.	-	.	transcript "112"
Adh	GeneID	CDS	1220453	1220706	.	-	.	transcript "112"
Adh	GeneID	CDS	1221529	1221762	.	-	.	transcript "112"
Adh	GeneID	CDS	1223350	1223572	.	-	.	transcript "112"
Adh	GeneID	start_codon	1223570	1223572	.	-	.	transcript "112"
Adh	GeneID	start_codon	1229684	1229686	.	+	.	transcript "113"
Adh	GeneID	CDS	1229684	1230238	.	+	.	transcript "113"
Adh	GeneID	CDS	1233044	1233280	.	+	.	transcript "113"
Adh	GeneID	stop_codon	1233278	1233280	.	+	.	transcript "113"
Adh	GeneID	start_codon	1252523	1252525	.	+	.	transcript "114"
Adh	GeneID	CDS	1252523	1253521	.	+	.	transcript "114"
Adh	GeneID	CDS	1253934	1254107	.	+	.	transcript "114"
Adh	GeneID	stop_codon	1254105	1254107	.	+	.	transcript "114"
Adh	GeneID	start_codon	1255669	1255671	.	+	.	transcript "115"
Adh	GeneID	CDS	1255669	1256020	.	+	.	transcript "115"
Adh	GeneID	CDS	1256255	1256823	.	+	.	transcript "115"
Adh	GeneID	stop_codon	1256821	1256823	.	+	.	transcript "115"
Adh	GeneID	stop_codon	1258365	1258367	.	-	.	transcript "116"
Adh	GeneID	CDS	1258365	1258396	.	-	.	transcript "116"
Adh	GeneID	CDS	1264126	1264286	.	-	.	transcript "116"
Adh	GeneID	CDS	1266094	1266134	.	-	.	transcript "116"
Adh	GeneID	start_codon	1266132	1266134	.	-	.	transcript "116"
Adh	GeneID	stop_codon	1267417	1267419	.	-	.	transcript "117"
Adh	GeneID	CDS	1267417	1267448	.	-	.	transcript "117"
Adh	GeneID	CDS	1269247	1269312	.	-	.	transcript "117"
Adh	GeneID	CDS	1272217	1272395	.	-	.	transcript "117"
Adh	GeneID	CDS	1273008	1273596	.	-	.	transcript "117"
Adh	GeneID	CDS	1274014	1274321	.	-	.	transcript "117"
Adh	GeneID	CDS	1279181	1279254	.	-	.	transcript "117"
Adh	GeneID	start_codon	1279252	1279254	.	-	.	transcript "117"
Adh	GeneID	stop_codon	1281793	1281795	.	-	.	transcript "118"
Adh	GeneID	CDS	1281793	1281831	.	-	.	transcript "118"
Adh	GeneID	CDS	1285216	1285502	.	-	.	transcript "118"
Adh	GeneID	CDS	1285595	1285746	.	-	.	transcript "118"
Adh	GeneID	CDS	1285814	1285859	.	-	.	transcript "118"
Adh	GeneID	CDS	1297137	1298310	.	-	.	transcript "118"
Adh	GeneID	start_codon	1298308	1298310	.	-	.	transcript "118"
Adh	GeneID	start_codon	1307887	1307889	.	+	.	transcript "119"
Adh	GeneID	CDS	1307887	1307937	.	+	.	transcript "119"
Adh	GeneID	CDS	1315241	1315331	.	+	.	transcript "119"
Adh	GeneID	CDS	1316134	1316186	.	+	.	transcript "119"
Adh	GeneID	stop_codon	1316184	1316186	.	+	.	transcript "119"
Adh	GeneID	stop_codon	1318581	1318583	.	-	.	transcript "120"
Adh	GeneID	CDS	1318581	1318735	.	-	.	transcript "120"
Adh	GeneID	CDS	1319386	1319494	.	-	.	transcript "120"
Adh	GeneID	start_codon	1319492	1319494	.	-	.	transcript "120"
Adh	GeneID	start_codon	1320688	1320690	.	+	.	transcript "121"
Adh	GeneID	CDS	1320688	1320757	.	+	.	transcript "121"
Adh	GeneID	CDS	1327079	1327129	.	+	.	transcript "121"
Adh	GeneID	CDS	1332021	1332113	.	+	.	transcript "121"
Adh	GeneID	CDS	1332968	1333107	.	+	.	transcript "121"
Adh	GeneID	stop_codon	1333105	1333107	.	+	.	transcript "121"
Adh	GeneID	stop_codon	1333719	1333721	.	-	.	transcript "122"
Adh	GeneID	CDS	1333719	1333789	.	-	.	transcript "122"
Adh	GeneID	CDS	1334947	1335024	.	-	.	transcript "122"
Adh	GeneID	CDS	1335080	1335356	.	-	.	transcript "122"
Adh	GeneID	CDS	1335416	1336157	.	-	.	transcript "122"
Adh	GeneID	CDS	1337668	1337917	.	-	.	transcript "122"
Adh	GeneID	CDS	1338337	1338640	.	-	.	transcript "122"
Adh	GeneID	CDS	1338702	1338785	.	-	.	transcript "122"
Adh	GeneID	start_codon	1338783	1338785	.	-	.	transcript "122"
Adh	GeneID	start_codon	1342117	1342119	.	+	.	transcript "123"
Adh	GeneID	CDS	1342117	1342152	.	+	.	transcript "123"
Adh	GeneID	CDS	1348357	1348416	.	+	.	transcript "123"
Adh	GeneID	CDS	1357856	1357920	.	+	.	transcript "123"
Adh	GeneID	CDS	1360498	1360540	.	+	.	transcript "123"
Adh	GeneID	stop_codon	1360538	1360540	.	+	.	transcript "123"
Adh	GeneID	stop_codon	1363672	1363674	.	-	.	transcript "124"
Adh	GeneID	CDS	1363672	1363731	.	-	.	transcript "124"
Adh	GeneID	CDS	1365170	1365361	.	-	.	transcript "124"
Adh	GeneID	CDS	1365421	1365611	.	-	.	transcript "124"
Adh	GeneID	CDS	1365666	1365762	.	-	.	transcript "124"
Adh	GeneID	CDS	1368902	1369189	.	-	.	transcript "124"
Adh	GeneID	start_codon	1369187	1369189	.	-	.	transcript "124"
Adh	GeneID	stop_codon	1371868	1371870	.	-	.	transcript "125"
Adh	GeneID	CDS	1371868	1371921	.	-	.	transcript "125"
Adh	GeneID	CDS	1371971	1372258	.	-	.	transcript "125"
Adh	GeneID	start_codon	1372256	1372258	.	-	.	transcript "125"
Adh	GeneID	start_codon	1376930	1376932	.	+	.	transcript "126"
Adh	GeneID	CDS	1376930	1377005	.	+	.	transcript "126"
Adh	GeneID	CDS	1377839	1377878	.	+	.	transcript "126"
Adh	GeneID	CDS	1392232	1392359	.	+	.	transcript "126"
Adh	GeneID	CDS	1397377	1397429	.	+	.	transcript "126"
Adh	GeneID	stop_codon	1397427	1397429	.	+	.	transcript "126"
Adh	GeneID	stop_codon	1398183	1398185	.	-	.	transcript "127"
Adh	GeneID	CDS	1398183	1398833	.	-	.	transcript "127"
Adh	GeneID	CDS	1399745	1399785	.	-	.	transcript "127"
Adh	GeneID	CDS	1400636	1400669	.	-	.	transcript "127"
Adh	GeneID	CDS	1401633	1401874	.	-	.	transcript "127"
Adh	GeneID	CDS	1402535	1402643	.	-	.	transcript "127"
Adh	GeneID	CDS	1402808	1402995	.	-	.	transcript "127"
Adh	GeneID	CDS	1403930	1404111	.	-	.	transcript "127"
Adh	GeneID	CDS	1405762	1405903	.	-	.	transcript "127"
Adh	GeneID	CDS	1406801	1406882	.	-	.	transcript "127"
Adh	GeneID	CDS	1407035	1407146	.	-	.	transcript "127"
Adh	GeneID	CDS	1408830	1408932	.	-	.	transcript "127"
Adh	GeneID	CDS	1411600	1411759	.	-	.	transcript "127"
Adh	GeneID	CDS	1412611	1412796	.	-	.	transcript "127"
Adh	GeneID	CDS	1412885	1412929	.	-	.	transcript "127"
Adh	GeneID	start_codon	1412927	1412929	.	-	.	transcript "127"
Adh	GeneID	start_codon	1416137	1416139	.	+	.	transcript "128"
Adh	GeneID	CDS	1416137	1418081	.	+	.	transcript "128"
Adh	GeneID	CDS	1418142	1419321	.	+	.	transcript "128"
Adh	GeneID	CDS	1419378	1419918	.	+	.	transcript "128"
Adh	GeneID	stop_codon	1419916	1419918	.	+	.	transcript "128"
Adh	GeneID	stop_codon	1420890	1420892	.	-	.	transcript "129"
Adh	GeneID	CDS	1420890	1420960	.	-	.	transcript "129"
Adh	GeneID	CDS	1422176	1422320	.	-	.	transcript "129"
Adh	GeneID	CDS	1424531	1424676	.	-	.	transcript "129"
Adh	GeneID	CDS	1425549	1425752	.	-	.	transcript "129"
Adh	GeneID	CDS	1426168	1426258	.	-	.	transcript "129"
Adh	GeneID	start_codon	1426256	1426258	.	-	.	transcript "129"
Adh	GeneID	stop_codon	1426880	1426882	.	-	.	transcript "130"
Adh	GeneID	CDS	1426880	1426919	.	-	.	transcript "130"
Adh	GeneID	CDS	1428573	1428690	.	-	.	transcript "130"
Adh	GeneID	CDS	1431180	1431231	.	-	.	transcript "130"
Adh	GeneID	start_codon	1431229	1431231	.	-	.	transcript "130"
Adh	GeneID	start_codon	1433593	1433595	.	+	.	transcript "131"
Adh	GeneID	CDS	1433593	1433625	.	+	.	transcript "131"
Adh	GeneID	CDS	1437091	1437123	.	+	.	transcript "131"
Adh	GeneID	CDS	1437932	1438005	.	+	.	transcript "131"
Adh	GeneID	CDS	1438274	1438368	.	+	.	transcript "131"
Adh	GeneID	CDS	1441776	1441821	.	+	.	transcript "131"
Adh	GeneID	CDS	1442523	1442576	.	+	.	transcript "131"
Adh	GeneID	CDS	1444445	1444487	.	+	.	transcript "131"
Adh	GeneID	CDS	1444717	1444764	.	+	.	transcript "131"
Adh	GeneID	CDS	1445532	1445710	.	+	.	transcript "131"
Adh	GeneID	CDS	1450916	1450963	.	+	.	transcript "131"
Adh	GeneID	CDS	1451479	1451512	.	+	.	transcript "131"
Adh	GeneID	stop_codon	1451510	1451512	.	+	.	transcript "131"
Adh	GeneID	stop_codon	1452945	1452947	.	-	.	transcript "132"
Adh	GeneID	CDS	1452945	1453020	.	-	.	transcript "132"
Adh	GeneID	CDS	1454848	1455010	.	-	.	transcript "132"
Adh	GeneID	CDS	1462140	1462195	.	-	.	transcript "132"
Adh	GeneID	CDS	1465981	1466019	.	-	.	transcript "132"
Adh	GeneID	CDS	1466153	1466744	.	-	.	transcript "132"
Adh	GeneID	CDS	1466876	1467307	.	-	.	transcript "132"
Adh	GeneID	CDS	1470304	1470339	.	-	.	transcript "132"
Adh	GeneID	CDS	1473611	1473791	.	-	.	transcript "132"
Adh	GeneID	start_codon	1473789	1473791	.	-	.	transcript "132"
Adh	GeneID	stop_codon	1475429	1475431	.	-	.	transcript "133"
Adh	GeneID	CDS	1475429	1475467	.	-	.	transcript "133"
Adh	GeneID	CDS	1477478	1477592	.	-	.	transcript "133"
Adh	GeneID	CDS	1480158	1480195	.	-	.	transcript "133"
Adh	GeneID	CDS	1481966	1482130	.	-	.	transcript "133"
Adh	GeneID	start_codon	1482128	1482130	.	-	.	transcript "133"
Adh	GeneID	stop_codon	1496304	1496306	.	-	.	transcript "134"
Adh	GeneID	CDS	1496304	1496815	.	-	.	transcript "134"
Adh	GeneID	CDS	1496865	1497000	.	-	.	transcript "134"
Adh	GeneID	start_codon	1496998	1497000	.	-	.	transcript "134"
Adh	GeneID	start_codon	1497576	1497578	.	+	.	transcript "135"
Adh	GeneID	CDS	1497576	1498089	.	+	.	transcript "135"
Adh	GeneID	CDS	1498983	1499050	.	+	.	transcript "135"
Adh	GeneID	stop_codon	1499048	1499050	.	+	.	transcript "135"
Adh	GeneID	start_codon	1499670	1499672	.	+	.	transcript "136"
Adh	GeneID	CDS	1499670	1500870	.	+	.	transcript "136"
Adh	GeneID	CDS	1500928	1501010	.	+	.	transcript "136"
Adh	GeneID	stop_codon	1501008	1501010	.	+	.	transcript "136"
Adh	GeneID	start_codon	1507074	1507076	.	+	.	transcript "137"
Adh	GeneID	CDS	1507074	1507134	.	+	.	transcript "137"
Adh	GeneID	CDS	1508779	1508852	.	+	.	transcript "137"
Adh	GeneID	CDS	1510744	1510998	.	+	.	transcript "137"
Adh	GeneID	CDS	1515041	1515175	.	+	.	transcript "137"
Adh	GeneID	CDS	1515266	1515440	.	+	.	transcript "137"
Adh	GeneID	CDS	1515807	1516279	.	+	.	transcript "137"
Adh	GeneID	CDS	1516339	1516488	.	+	.	transcript "137"
Adh	GeneID	CDS	1519636	1519752	.	+	.	transcript "137"
Adh	GeneID	CDS	1519897	1520023	.	+	.	transcript "137"
Adh	GeneID	CDS	1520081	1520232	.	+	.	transcript "137"
Adh	GeneID	CDS	1520398	1520535	.	+	.	transcript "137"
Adh	GeneID	CDS	1521654	1521834	.	+	.	transcript "137"
Adh	GeneID	CDS	1523263	1523303	.	+	.	transcript "137"
Adh	GeneID	stop_codon	1523301	1523303	.	+	.	transcript "137"
Adh	GeneID	start_codon	1525215	1525217	.	+	.	transcript "138"
Adh	GeneID	CDS	1525215	1525447	.	+	.	transcript "138"
Adh	GeneID	CDS	1526237	1526669	.	+	.	transcript "138"
Adh	GeneID	stop_codon	1526667	1526669	.	+	.	transcript "138"
Adh	GeneID	stop_codon	1527523	1527525	.	-	.	transcript "139"
Adh	GeneID	CDS	1527523	1527636	.	-	.	transcript "139"
Adh	GeneID	CDS	1527705	1528201	.	-	.	transcript "139"
Adh	GeneID	CDS	1528291	1528426	.	-	.	transcript "139"
Adh	GeneID	start_codon	1528424	1528426	.	-	.	transcript "139"
Adh	GeneID	start_codon	1529588	1529590	.	+	.	transcript "140"
Adh	GeneID	CDS	1529588	1529971	.	+	.	transcript "140"
Adh	GeneID	CDS	1530746	1531626	.	+	.	transcript "140"
Adh	GeneID	CDS	1531685	1531892	.	+	.	transcript "140"
Adh	GeneID	CDS	1531958	1532269	.	+	.	transcript "140"
Adh	GeneID	stop_codon	1532267	1532269	.	+	.	transcript "140"
Adh	GeneID	stop_codon	1533193	1533195	.	-	.	transcript "141"
Adh	GeneID	CDS	1533193	1533225	.	-	.	transcript "141"
Adh	GeneID	CDS	1535341	1535461	.	-	.	transcript "141"
Adh	GeneID	CDS	1535530	1535676	.	-	.	transcript "141"
Adh	GeneID	CDS	1535739	1536304	.	-	.	transcript "141"
Adh	GeneID	CDS	1536364	1537150	.	-	.	transcript "141"
Adh	GeneID	CDS	1537212	1538662	.	-	.	transcript "141"
Adh	GeneID	CDS	1538719	1541113	.	-	.	transcript "141"
Adh	GeneID	CDS	1541178	1541378	.	-	.	transcript "141"
Adh	GeneID	CDS	1541445	1541794	.	-	.	transcript "141"
Adh	GeneID	CDS	1542125	1542202	.	-	.	transcript "141"
Adh	GeneID	start_codon	1542200	1542202	.	-	.	transcript "141"
Adh	GeneID	start_codon	1542931	1542933	.	+	.	transcript "142"
Adh	GeneID	CDS	1542931	1542989	.	+	.	transcript "142"
Adh	GeneID	CDS	1546650	1546719	.	+	.	transcript "142"
Adh	GeneID	CDS	1548383	1548538	.	+	.	transcript "142"
Adh	GeneID	stop_codon	1548536	1548538	.	+	.	transcript "142"
Adh	GeneID	stop_codon	1549142	1549144	.	-	.	transcript "143"
Adh	GeneID	CDS	1549142	1550017	.	-	.	transcript "143"
Adh	GeneID	CDS	1550084	1550149	.	-	.	transcript "143"
Adh	GeneID	start_codon	1550147	1550149	.	-	.	transcript "143"
Adh	GeneID	stop_codon	1554085	1554087	.	-	.	transcript "144"
Adh	GeneID	CDS	1554085	1554599	.	-	.	transcript "144"
Adh	GeneID	CDS	1554841	1555107	.	-	.	transcript "144"
Adh	GeneID	CDS	1556588	1557278	.	-	.	transcript "144"
Adh	GeneID	start_codon	1557276	1557278	.	-	.	transcript "144"
Adh	GeneID	start_codon	1558057	1558059	.	+	.	transcript "145"
Adh	GeneID	CDS	1558057	1558521	.	+	.	transcript "145"
Adh	GeneID	CDS	1562338	1563081	.	+	.	transcript "145"
Adh	GeneID	CDS	1563140	1563353	.	+	.	transcript "145"
Adh	GeneID	CDS	1563418	1563689	.	+	.	transcript "145"
Adh	GeneID	CDS	1563761	1563814	.	+	.	transcript "145"
Adh	GeneID	stop_codon	1563812	1563814	.	+	.	transcript "145"
Adh	GeneID	start_codon	1565272	1565274	.	+	.	transcript "146"
Adh	GeneID	CDS	1565272	1565530	.	+	.	transcript "146"
Adh	GeneID	CDS	1565726	1565773	.	+	.	transcript "146"
Adh	GeneID	CDS	1576691	1576943	.	+	.	transcript "146"
Adh	GeneID	CDS	1577036	1577406	.	+	.	transcript "146"
Adh	GeneID	CDS	1577568	1577860	.	+	.	transcript "146"
Adh	GeneID	CDS	1579167	1579245	.	+	.	transcript "146"
Adh	GeneID	CDS	1580846	1580880	.	+	.	transcript "146"
Adh	GeneID	CDS	1581294	1581623	.	+	.	transcript "146"
Adh	GeneID	CDS	1581774	1582136	.	+	.	transcript "146"
Adh	GeneID	CDS	1582201	1582292	.	+	.	transcript "146"
Adh	GeneID	CDS	1582550	1582687	.	+	.	transcript "146"
Adh	GeneID	CDS	1583483	1583573	.	+	.	transcript "146"
Adh	GeneID	stop_codon	1583571	1583573	.	+	.	transcript "146"
Adh	GeneID	start_codon	1584396	1584398	.	+	.	transcript "147"
Adh	GeneID	CDS	1584396	1584828	.	+	.	transcript "147"
Adh	GeneID	CDS	1584949	1585094	.	+	.	transcript "147"
Adh	GeneID	CDS	1585153	1585380	.	+	.	transcript "147"
Adh	GeneID	stop_codon	1585378	1585380	.	+	.	transcript "147"
Adh	GeneID	start_codon	1593013	1593015	.	+	.	transcript "148"
Adh	GeneID	CDS	1593013	1593223	.	+	.	transcript "148"
Adh	GeneID	CDS	1596533	1596753	.	+	.	transcript "148"
Adh	GeneID	stop_codon	1596751	1596753	.	+	.	transcript "148"
Adh	GeneID	start_codon	1599218	1599220	.	+	.	transcript "149"
Adh	GeneID	CDS	1599218	1600177	.	+	.	transcript "149"
Adh	GeneID	CDS	1601744	1602565	.	+	.	transcript "149"
Adh	GeneID	stop_codon	1602563	1602565	.	+	.	transcript "149"
Adh	GeneID	start_codon	1603610	1603612	.	+	.	transcript "150"
Adh	GeneID	CDS	1603610	1603864	.	+	.	transcript "150"
Adh	GeneID	CDS	1603963	1605404	.	+	.	transcript "150"
Adh	GeneID	CDS	1605651	1606718	.	+	.	transcript "150"
Adh	GeneID	CDS	1606791	1607142	.	+	.	transcript "150"
Adh	GeneID	CDS	1610986	1611030	.	+	.	transcript "150"
Adh	GeneID	stop_codon	1611028	1611030	.	+	.	transcript "150"
Adh	GeneID	stop_codon	1613642	1613644	.	-	.	transcript "151"
Adh	GeneID	CDS	1613642	1613682	.	-	.	transcript "151"
Adh	GeneID	CDS	1615296	1615362	.	-	.	transcript "151"
Adh	GeneID	CDS	1615931	1615992	.	-	.	transcript "151"
Adh	GeneID	CDS	1623880	1623920	.	-	.	transcript "151"
Adh	GeneID	CDS	1630351	1630487	.	-	.	transcript "151"
Adh	GeneID	start_codon	1630485	1630487	.	-	.	transcript "151"
Adh	GeneID	stop_codon	1638007	1638009	.	-	.	transcript "152"
Adh	GeneID	CDS	1638007	1638042	.	-	.	transcript "152"
Adh	GeneID	CDS	1638160	1638209	.	-	.	transcript "152"
Adh	GeneID	CDS	1642165	1642329	.	-	.	transcript "152"
Adh	GeneID	CDS	1642667	1642853	.	-	.	transcript "152"
Adh	GeneID	CDS	1647638	1647703	.	-	.	transcript "152"
Adh	GeneID	start_codon	1647701	1647703	.	-	.	transcript "152"
Adh	GeneID	stop_codon	1650286	1650288	.	-	.	transcript "153"
Adh	GeneID	CDS	1650286	1650332	.	-	.	transcript "153"
Adh	GeneID	CDS	1651337	1651403	.	-	.	transcript "153"
Adh	GeneID	CDS	1653857	1657133	.	-	.	transcript "153"
Adh	GeneID	CDS	1657232	1657342	.	-	.	transcript "153"
Adh	GeneID	CDS	1661045	1661189	.	-	.	transcript "153"
Adh	GeneID	CDS	1667694	1667971	.	-	.	transcript "153"
Adh	GeneID	CDS	1678820	1678862	.	-	.	transcript "153"
Adh	GeneID	CDS	1681578	1681630	.	-	.	transcript "153"
Adh	GeneID	CDS	1682424	1682539	.	-	.	transcript "153"
Adh	GeneID	start_codon	1682537	1682539	.	-	.	transcript "153"
Adh	GeneID	start_codon	1690082	1690084	.	+	.	transcript "154"
Adh	GeneID	CDS	1690082	1690270	.	+	.	transcript "154"
Adh	GeneID	CDS	1692741	1692848	.	+	.	transcript "154"
Adh	GeneID	CDS	1694369	1694408	.	+	.	transcript "154"
Adh	GeneID	CDS	1703494	1703537	.	+	.	transcript "154"
Adh	GeneID	stop_codon	1703535	1703537	.	+	.	transcript "154"
Adh	GeneID	stop_codon	1711986	1711988	.	-	.	transcript "155"
Adh	GeneID	CDS	1711986	1712040	.	-	.	transcript "155"
Adh	GeneID	CDS	1716770	1716818	.	-	.	transcript "155"
Adh	GeneID	CDS	1719195	1719342	.	-	.	transcript "155"
Adh	GeneID	CDS	1719504	1720004	.	-	.	transcript "155"
Adh	GeneID	start_codon	1720002	1720004	.	-	.	transcript "155"
Adh	GeneID	stop_codon	1724655	1724657	.	-	.	transcript "156"
Adh	GeneID	CDS	1724655	1724709	.	-	.	transcript "156"
Adh	GeneID	CDS	1726256	1726435	.	-	.	transcript "156"
Adh	GeneID	CDS	1730116	1730236	.	-	.	transcript "156"
Adh	GeneID	CDS	1731062	1731172	.	-	.	transcript "156"
Adh	GeneID	CDS	1735826	1736004	.	-	.	transcript "156"
Adh	GeneID	CDS	1737215	1737246	.	-	.	transcript "156"
Adh	GeneID	start_codon	1737244	1737246	.	-	.	transcript "156"
Adh	GeneID	start_codon	1740274	1740276	.	+	.	transcript "157"
Adh	GeneID	CDS	1740274	1740540	.	+	.	transcript "157"
Adh	GeneID	CDS	1740659	1740939	.	+	.	transcript "157"
Adh	GeneID	CDS	1740995	1742042	.	+	.	transcript "157"
Adh	GeneID	CDS	1742104	1742446	.	+	.	transcript "157"
Adh	GeneID	CDS	1742505	1742590	.	+	.	transcript "157"
Adh	GeneID	stop_codon	1742588	1742590	.	+	.	transcript "157"
Adh	GeneID	stop_codon	1743988	1743990	.	-	.	transcript "158"
Adh	GeneID	CDS	1743988	1744025	.	-	.	transcript "158"
Adh	GeneID	CDS	1744330	1744361	.	-	.	transcript "158"
Adh	GeneID	CDS	1744624	1745915	.	-	.	transcript "158"
Adh	GeneID	start_codon	1745913	1745915	.	-	.	transcript "158"
Adh	GeneID	stop_codon	1748111	1748113	.	-	.	transcript "159"
Adh	GeneID	CDS	1748111	1748361	.	-	.	transcript "159"
Adh	GeneID	CDS	1751370	1751492	.	-	.	transcript "159"
Adh	GeneID	CDS	1751722	1751956	.	-	.	transcript "159"
Adh	GeneID	CDS	1752622	1752780	.	-	.	transcript "159"
Adh	GeneID	CDS	1752984	1753316	.	-	.	transcript "159"
Adh	GeneID	CDS	1753422	1753778	.	-	.	transcript "159"
Adh	GeneID	start_codon	1753776	1753778	.	-	.	transcript "159"
Adh	GeneID	stop_codon	1756026	1756028	.	-	.	transcript "160"
Adh	GeneID	CDS	1756026	1756178	.	-	.	transcript "160"
Adh	GeneID	CDS	1756797	1756973	.	-	.	transcript "160"
Adh	GeneID	CDS	1757182	1757352	.	-	.	transcript "160"
Adh	GeneID	CDS	1757415	1757585	.	-	.	transcript "160"
Adh	GeneID	CDS	1757648	1758409	.	-	.	transcript "160"
Adh	GeneID	CDS	1758473	1758856	.	-	.	transcript "160"
Adh	GeneID	CDS	1760557	1760616	.	-	.	transcript "160"
Adh	GeneID	start_codon	1760614	1760616	.	-	.	transcript "160"
Adh	GeneID	stop_codon	1763095	1763097	.	-	.	transcript "161"
Adh	GeneID	CDS	1763095	1763162	.	-	.	transcript "161"
Adh	GeneID	CDS	1764272	1764501	.	-	.	transcript "161"
Adh	GeneID	CDS	1764574	1764638	.	-	.	transcript "161"
Adh	GeneID	start_codon	1764636	1764638	.	-	.	transcript "161"
Adh	GeneID	start_codon	1766243	1766245	.	+	.	transcript "162"
Adh	GeneID	CDS	1766243	1766345	.	+	.	transcript "162"
Adh	GeneID	CDS	1769046	1769146	.	+	.	transcript "162"
Adh	GeneID	stop_codon	1769144	1769146	.	+	.	transcript "162"
Adh	GeneID	start_codon	1769829	1769831	.	+	.	transcript "163"
Adh	GeneID	CDS	1769829	1769976	.	+	.	transcript "163"
Adh	GeneID	CDS	1774716	1775557	.	+	.	transcript "163"
Adh	GeneID	stop_codon	1775555	1775557	.	+	.	transcript "163"
Adh	GeneID	start_codon	1776889	1776891	.	+	.	transcript "164"
Adh	GeneID	CDS	1776889	1777083	.	+	.	transcript "164"
Adh	GeneID	CDS	1786963	1786994	.	+	.	transcript "164"
Adh	GeneID	CDS	1787063	1787135	.	+	.	transcript "164"
Adh	GeneID	CDS	1787713	1788915	.	+	.	transcript "164"
Adh	GeneID	stop_codon	1788913	1788915	.	+	.	transcript "164"
Adh	GeneID	stop_codon	1790485	1790487	.	-	.	transcript "165"
Adh	GeneID	CDS	1790485	1790625	.	-	.	transcript "165"
Adh	GeneID	CDS	1792846	1792911	.	-	.	transcript "165"
Adh	GeneID	start_codon	1792909	1792911	.	-	.	transcript "165"
Adh	GeneID	stop_codon	1801494	1801496	.	-	.	transcript "166"
Adh	GeneID	CDS	1801494	1801614	.	-	.	transcript "166"
Adh	GeneID	CDS	1803081	1803155	.	-	.	transcript "166"
Adh	GeneID	CDS	1806093	1806145	.	-	.	transcript "166"
Adh	GeneID	CDS	1808001	1808476	.	-	.	transcript "166"
Adh	GeneID	CDS	1811030	1811121	.	-	.	transcript "166"
Adh	GeneID	CDS	1811467	1811600	.	-	.	transcript "166"
Adh	GeneID	start_codon	1811598	1811600	.	-	.	transcript "166"
Adh	GeneID	start_codon	1823887	1823889	.	+	.	transcript "167"
Adh	GeneID	CDS	1823887	1825154	.	+	.	transcript "167"
Adh	GeneID	CDS	1827797	1827872	.	+	.	transcript "167"
Adh	GeneID	stop_codon	1827870	1827872	.	+	.	transcript "167"
Adh	GeneID	start_codon	1850930	1850932	.	+	.	transcript "168"
Adh	GeneID	CDS	1850930	1850963	.	+	.	transcript "168"
Adh	GeneID	CDS	1862221	1862289	.	+	.	transcript "168"
Adh	GeneID	CDS	1871587	1871681	.	+	.	transcript "168"
Adh	GeneID	CDS	1874024	1874072	.	+	.	transcript "168"
Adh	GeneID	CDS	1875402	1875519	.	+	.	transcript "168"
Adh	GeneID	CDS	1878749	1878806	.	+	.	transcript "168"
Adh	GeneID	CDS	1880168	1880203	.	+	.	transcript "168"
Adh	GeneID	stop_codon	1880201	1880203	.	+	.	transcript "168"
Adh	GeneID	stop_codon	1884846	1884848	.	-	.	transcript "169"
Adh	GeneID	CDS	1884846	1884892	.	-	.	transcript "169"
Adh	GeneID	CDS	1885049	1885144	.	-	.	transcript "169"
Adh	GeneID	CDS	1886790	1886886	.	-	.	transcript "169"
Adh	GeneID	CDS	1891514	1891615	.	-	.	transcript "169"
Adh	GeneID	start_codon	1891613	1891615	.	-	.	transcript "169"
Adh	GeneID	start_codon	1894883	1894885	.	+	.	transcript "170"
Adh	GeneID	CDS	1894883	1894914	.	+	.	transcript "170"
Adh	GeneID	CDS	1895818	1895942	.	+	.	transcript "170"
Adh	GeneID	CDS	1898098	1898210	.	+	.	transcript "170"
Adh	GeneID	CDS	1901397	1901522	.	+	.	transcript "170"
Adh	GeneID	stop_codon	1901520	1901522	.	+	.	transcript "170"
Adh	GeneID	stop_codon	1904399	1904401	.	-	.	transcript "171"
Adh	GeneID	CDS	1904399	1904459	.	-	.	transcript "171"
Adh	GeneID	CDS	1905522	1905641	.	-	.	transcript "171"
Adh	GeneID	CDS	1912285	1912316	.	-	.	transcript "171"
Adh	GeneID	start_codon	1912314	1912316	.	-	.	transcript "171"
Adh	GeneID	stop_codon	1913374	1913376	.	-	.	transcript "172"
Adh	GeneID	CDS	1913374	1914932	.	-	.	transcript "172"
Adh	GeneID	CDS	1914995	1915082	.	-	.	transcript "172"
Adh	GeneID	start_codon	1915080	1915082	.	-	.	transcript "172"
Adh	GeneID	stop_codon	1920587	1920589	.	-	.	transcript "173"
Adh	GeneID	CDS	1920587	1920743	.	-	.	transcript "173"
Adh	GeneID	CDS	1922620	1922753	.	-	.	transcript "173"
Adh	GeneID	start_codon	1922751	1922753	.	-	.	transcript "173"
Adh	GeneID	start_codon	1923367	1923369	.	+	.	transcript "174"
Adh	GeneID	CDS	1923367	1924417	.	+	.	transcript "174"
Adh	GeneID	CDS	1935160	1935208	.	+	.	transcript "174"
Adh	GeneID	CDS	1935491	1935551	.	+	.	transcript "174"
Adh	GeneID	stop_codon	1935549	1935551	.	+	.	transcript "174"
Adh	GeneID	start_codon	1938049	1938051	.	+	.	transcript "175"
Adh	GeneID	CDS	1938049	1938118	.	+	.	transcript "175"
Adh	GeneID	CDS	1947070	1947197	.	+	.	transcript "175"
Adh	GeneID	CDS	1951837	1951895	.	+	.	transcript "175"
Adh	GeneID	CDS	1955064	1955133	.	+	.	transcript "175"
Adh	GeneID	CDS	1958152	1958236	.	+	.	transcript "175"
Adh	GeneID	CDS	1963680	1963768	.	+	.	transcript "175"
Adh	GeneID	stop_codon	1963766	1963768	.	+	.	transcript "175"
Adh	GeneID	stop_codon	1965627	1965629	.	-	.	transcript "176"
Adh	GeneID	CDS	1965627	1965662	.	-	.	transcript "176"
Adh	GeneID	CDS	1966664	1967758	.	-	.	transcript "176"
Adh	GeneID	start_codon	1967756	1967758	.	-	.	transcript "176"
Adh	GeneID	start_codon	1974488	1974490	.	+	.	transcript "177"
Adh	GeneID	CDS	1974488	1974956	.	+	.	transcript "177"
Adh	GeneID	CDS	1976787	1976905	.	+	.	transcript "177"
Adh	GeneID	stop_codon	1976903	1976905	.	+	.	transcript "177"
Adh	GeneID	start_codon	1981483	1981485	.	+	.	transcript "178"
Adh	GeneID	CDS	1981483	1981563	.	+	.	transcript "178"
Adh	GeneID	CDS	1983788	1983859	.	+	.	transcript "178"
Adh	GeneID	CDS	1986147	1986200	.	+	.	transcript "178"
Adh	GeneID	CDS	1987265	1987306	.	+	.	transcript "178"
Adh	GeneID	stop_codon	1987304	1987306	.	+	.	transcript "178"
Adh	GeneID	start_codon	1988872	1988874	.	+	.	transcript "179"
Adh	GeneID	CDS	1988872	1989075	.	+	.	transcript "179"
Adh	GeneID	CDS	1991768	1992877	.	+	.	transcript "179"
Adh	GeneID	CDS	1992942	1993204	.	+	.	transcript "179"
Adh	GeneID	CDS	1993350	1993566	.	+	.	transcript "179"
Adh	GeneID	stop_codon	1993564	1993566	.	+	.	transcript "179"
Adh	GeneID	stop_codon	1996049	1996051	.	-	.	transcript "180"
Adh	GeneID	CDS	1996049	1996120	.	-	.	transcript "180"
Adh	GeneID	CDS	2001465	2001677	.	-	.	transcript "180"
Adh	GeneID	start_codon	2001675	2001677	.	-	.	transcript "180"
Adh	GeneID	stop_codon	2007477	2007479	.	-	.	transcript "181"
Adh	GeneID	CDS	2007477	2007530	.	-	.	transcript "181"
Adh	GeneID	CDS	2007824	2007985	.	-	.	transcript "181"
Adh	GeneID	start_codon	2007983	2007985	.	-	.	transcript "181"
Adh	GeneID	start_codon	2008964	2008966	.	+	.	transcript "182"
Adh	GeneID	CDS	2008964	2009015	.	+	.	transcript "182"
Adh	GeneID	CDS	2011611	2011726	.	+	.	transcript "182"
Adh	GeneID	CDS	2013133	2013204	.	+	.	transcript "182"
Adh	GeneID	CDS	2014032	2014097	.	+	.	transcript "182"
Adh	GeneID	stop_codon	2014095	2014097	.	+	.	transcript "182"
Adh	GeneID	stop_codon	2015366	2015368	.	-	.	transcript "183"
Adh	GeneID	CDS	2015366	2015570	.	-	.	transcript "183"
Adh	GeneID	CDS	2029224	2029304	.	-	.	transcript "183"
Adh	GeneID	CDS	2029576	2029678	.	-	.	transcript "183"
Adh	GeneID	CDS	2034415	2034457	.	-	.	transcript "183"
Adh	GeneID	start_codon	2034455	2034457	.	-	.	transcript "183"
Adh	GeneID	start_codon	2040123	2040125	.	+	.	transcript "184"
Adh	GeneID	CDS	2040123	2040280	.	+	.	transcript "184"
Adh	GeneID	CDS	2040432	2040689	.	+	.	transcript "184"
Adh	GeneID	CDS	2046730	2046916	.	+	.	transcript "184"
Adh	GeneID	stop_codon	2046914	2046916	.	+	.	transcript "184"
Adh	GeneID	stop_codon	2047919	2047921	.	-	.	transcript "185"
Adh	GeneID	CDS	2047919	2048017	.	-	.	transcript "185"
Adh	GeneID	CDS	2053549	2053607	.	-	.	transcript "185"
Adh	GeneID	CDS	2054826	2054966	.	-	.	transcript "185"
Adh	GeneID	CDS	2063366	2063403	.	-	.	transcript "185"
Adh	GeneID	CDS	2067212	2067252	.	-	.	transcript "185"
Adh	GeneID	start_codon	2067250	2067252	.	-	.	transcript "185"
Adh	GeneID	start_codon	2068604	2068606	.	+	.	transcript "186"
Adh	GeneID	CDS	2068604	2070501	.	+	.	transcript "186"
Adh	GeneID	CDS	2071510	2072677	.	+	.	transcript "186"
Adh	GeneID	stop_codon	2072675	2072677	.	+	.	transcript "186"
Adh	GeneID	stop_codon	2087665	2087667	.	-	.	transcript "187"
Adh	GeneID	CDS	2087665	2087812	.	-	.	transcript "187"
Adh	GeneID	CDS	2092009	2092070	.	-	.	transcript "187"
Adh	GeneID	CDS	2097188	2097251	.	-	.	transcript "187"
Adh	GeneID	CDS	2099502	2099545	.	-	.	transcript "187"
Adh	GeneID	start_codon	2099543	2099545	.	-	.	transcript "187"
Adh	GeneID	stop_codon	2100422	2100424	.	-	.	transcript "188"
Adh	GeneID	CDS	2100422	2100484	.	-	.	transcript "188"
Adh	GeneID	CDS	2100632	2101336	.	-	.	transcript "188"
Adh	GeneID	start_codon	2101334	2101336	.	-	.	transcript "188"
Adh	GeneID	stop_codon	2103622	2103624	.	-	.	transcript "189"
Adh	GeneID	CDS	2103622	2104169	.	-	.	transcript "189"
Adh	GeneID	CDS	2104226	2104442	.	-	.	transcript "189"
Adh	GeneID	start_codon	2104440	2104442	.	-	.	transcript "189"
Adh	GeneID	stop_codon	2107451	2107453	.	-	.	transcript "190"
Adh	GeneID	CDS	2107451	2107499	.	-	.	transcript "190"
Adh	GeneID	CDS	2111222	2111292	.	-	.	transcript "190"
Adh	GeneID	CDS	2111897	2112079	.	-	.	transcript "190"
Adh	GeneID	CDS	2112328	2112381	.	-	.	transcript "190"
Adh	GeneID	start_codon	2112379	2112381	.	-	.	transcript "190"
Adh	GeneID	start_codon	2118335	2118337	.	+	.	transcript "191"
Adh	GeneID	CDS	2118335	2118551	.	+	.	transcript "191"
Adh	GeneID	CDS	2118614	2119161	.	+	.	transcript "191"
Adh	GeneID	stop_codon	2119159	2119161	.	+	.	transcript "191"
Adh	GeneID	start_codon	2119874	2119876	.	+	.	transcript "192"
Adh	GeneID	CDS	2119874	2120025	.	+	.	transcript "192"
Adh	GeneID	CDS	2120092	2120194	.	+	.	transcript "192"
Adh	GeneID	CDS	2120312	2121269	.	+	.	transcript "192"
Adh	GeneID	CDS	2121336	2121745	.	+	.	transcript "192"
Adh	GeneID	stop_codon	2121743	2121745	.	+	.	transcript "192"
Adh	GeneID	stop_codon	2128376	2128378	.	-	.	transcript "193"
Adh	GeneID	CDS	2128376	2128438	.	-	.	transcript "193"
Adh	GeneID	CDS	2131207	2131344	.	-	.	transcript "193"
Adh	GeneID	start_codon	2131342	2131344	.	-	.	transcript "193"
Adh	GeneID	stop_codon	2137486	2137488	.	-	.	transcript "194"
Adh	GeneID	CDS	2137486	2137679	.	-	.	transcript "194"
Adh	GeneID	CDS	2137746	2137902	.	-	.	transcript "194"
Adh	GeneID	CDS	2137961	2138116	.	-	.	transcript "194"
Adh	GeneID	CDS	2138186	2138671	.	-	.	transcript "194"
Adh	GeneID	CDS	2138733	2138985	.	-	.	transcript "194"
Adh	GeneID	CDS	2139065	2139169	.	-	.	transcript "194"
Adh	GeneID	CDS	2139350	2139382	.	-	.	transcript "194"
Adh	GeneID	CDS	2139824	2139903	.	-	.	transcript "194"
Adh	GeneID	CDS	2140148	2140353	.	-	.	transcript "194"
Adh	GeneID	CDS	2140417	2140630	.	-	.	transcript "194"
Adh	GeneID	CDS	2140705	2141412	.	-	.	transcript "194"
Adh	GeneID	CDS	2141998	2142471	.	-	.	transcript "194"
Adh	GeneID	CDS	2151821	2151931	.	-	.	transcript "194"
Adh	GeneID	CDS	2161195	2161276	.	-	.	transcript "194"
Adh	GeneID	CDS	2167365	2167477	.	-	.	transcript "194"
Adh	GeneID	start_codon	2167475	2167477	.	-	.	transcript "194"
Adh	GeneID	start_codon	2173083	2173085	.	+	.	transcript "195"
Adh	GeneID	CDS	2173083	2173437	.	+	.	transcript "195"
Adh	GeneID	CDS	2179601	2179638	.	+	.	transcript "195"
Adh	GeneID	stop_codon	2179636	2179638	.	+	.	transcript "195"
Adh	GeneID	stop_codon	2180707	2180709	.	-	.	transcript "196"
Adh	GeneID	CDS	2180707	2180982	.	-	.	transcript "196"
Adh	GeneID	CDS	2181100	2181325	.	-	.	transcript "196"
Adh	GeneID	CDS	2181392	2182662	.	-	.	transcript "196"
Adh	GeneID	CDS	2189454	2189790	.	-	.	transcript "196"
Adh	GeneID	CDS	2196827	2196891	.	-	.	transcript "196"
Adh	GeneID	CDS	2199659	2199721	.	-	.	transcript "196"
Adh	GeneID	CDS	2202548	2202802	.	-	.	transcript "196"
Adh	GeneID	start_codon	2202800	2202802	.	-	.	transcript "196"
Adh	GeneID	start_codon	2204183	2204185	.	+	.	transcript "197"
Adh	GeneID	CDS	2204183	2205278	.	+	.	transcript "197"
Adh	GeneID	CDS	2205332	2207403	.	+	.	transcript "197"
Adh	GeneID	stop_codon	2207401	2207403	.	+	.	transcript "197"
Adh	GeneID	stop_codon	2208922	2208924	.	-	.	transcript "198"
Adh	GeneID	CDS	2208922	2209531	.	-	.	transcript "198"
Adh	GeneID	CDS	2209593	2209904	.	-	.	transcript "198"
Adh	GeneID	CDS	2209967	2211186	.	-	.	transcript "198"
Adh	GeneID	CDS	2211243	2211671	.	-	.	transcript "198"
Adh	GeneID	CDS	2212036	2212168	.	-	.	transcript "198"
Adh	GeneID	CDS	2213422	2213491	.	-	.	transcript "198"
Adh	GeneID	CDS	2214022	2214088	.	-	.	transcript "198"
Adh	GeneID	start_codon	2214086	2214088	.	-	.	transcript "198"
Adh	GeneID	start_codon	2216202	2216204	.	+	.	transcript "199"
Adh	GeneID	CDS	2216202	2216447	.	+	.	transcript "199"
Adh	GeneID	CDS	2216609	2217034	.	+	.	transcript "199"
Adh	GeneID	CDS	2217501	2217533	.	+	.	transcript "199"
Adh	GeneID	stop_codon	2217531	2217533	.	+	.	transcript "199"
Adh	GeneID	stop_codon	2218461	2218463	.	-	.	transcript "200"
Adh	GeneID	CDS	2218461	2218494	.	-	.	transcript "200"
Adh	GeneID	CDS	2218559	2218905	.	-	.	transcript "200"
Adh	GeneID	CDS	2218966	2219871	.	-	.	transcript "200"
Adh	GeneID	CDS	2219932	2220057	.	-	.	transcript "200"
Adh	GeneID	start_codon	2220055	2220057	.	-	.	transcript "200"
Adh	GeneID	stop_codon	2220565	2220567	.	-	.	transcript "201"
Adh	GeneID	CDS	2220565	2222197	.	-	.	transcript "201"
Adh	GeneID	CDS	2222257	2222379	.	-	.	transcript "201"
Adh	GeneID	CDS	2223854	2223936	.	-	.	transcript "201"
Adh	GeneID	start_codon	2223934	2223936	.	-	.	transcript "201"
Adh	GeneID	start_codon	2237851	2237853	.	+	.	transcript "202"
Adh	GeneID	CDS	2237851	2237952	.	+	.	transcript "202"
Adh	GeneID	CDS	2244126	2244196	.	+	.	transcript "202"
Adh	GeneID	CDS	2250859	2250930	.	+	.	transcript "202"
Adh	GeneID	CDS	2251817	2251866	.	+	.	transcript "202"
Adh	GeneID	CDS	2262725	2262759	.	+	.	transcript "202"
Adh	GeneID	CDS	2262817	2262878	.	+	.	transcript "202"
Adh	GeneID	CDS	2267007	2267131	.	+	.	transcript "202"
Adh	GeneID	CDS	2272887	2272955	.	+	.	transcript "202"
Adh	GeneID	CDS	2274308	2274403	.	+	.	transcript "202"
Adh	GeneID	CDS	2283007	2283038	.	+	.	transcript "202"
Adh	GeneID	stop_codon	2283036	2283038	.	+	.	transcript "202"
Adh	GeneID	stop_codon	2284226	2284228	.	-	.	transcript "203"
Adh	GeneID	CDS	2284226	2284343	.	-	.	transcript "203"
Adh	GeneID	CDS	2284489	2284627	.	-	.	transcript "203"
Adh	GeneID	CDS	2286518	2286620	.	-	.	transcript "203"
Adh	GeneID	start_codon	2286618	2286620	.	-	.	transcript "203"
Adh	GeneID	stop_codon	2290884	2290886	.	-	.	transcript "204"
Adh	GeneID	CDS	2290884	2290927	.	-	.	transcript "204"
Adh	GeneID	CDS	2291643	2291847	.	-	.	transcript "204"
Adh	GeneID	start_codon	2291845	2291847	.	-	.	transcript "204"
Adh	GeneID	stop_codon	2292586	2292588	.	-	.	transcript "205"
Adh	GeneID	CDS	2292586	2292621	.	-	.	transcript "205"
Adh	GeneID	CDS	2298512	2298552	.	-	.	transcript "205"
Adh	GeneID	CDS	2300876	2300916	.	-	.	transcript "205"
Adh	GeneID	CDS	2302837	2302964	.	-	.	transcript "205"
Adh	GeneID	start_codon	2302962	2302964	.	-	.	transcript "205"
Adh	GeneID	start_codon	2303484	2303486	.	+	.	transcript "206"
Adh	GeneID	CDS	2303484	2304233	.	+	.	transcript "206"
Adh	GeneID	CDS	2305489	2305763	.	+	.	transcript "206"
Adh	GeneID	CDS	2305829	2306951	.	+	.	transcript "206"
Adh	GeneID	stop_codon	2306949	2306951	.	+	.	transcript "206"
Adh	GeneID	stop_codon	2308690	2308692	.	-	.	transcript "207"
Adh	GeneID	CDS	2308690	2308818	.	-	.	transcript "207"
Adh	GeneID	CDS	2310854	2310893	.	-	.	transcript "207"
Adh	GeneID	CDS	2311611	2311681	.	-	.	transcript "207"
Adh	GeneID	start_codon	2311679	2311681	.	-	.	transcript "207"
Adh	GeneID	stop_codon	2312684	2312686	.	-	.	transcript "208"
Adh	GeneID	CDS	2312684	2312753	.	-	.	transcript "208"
Adh	GeneID	CDS	2313467	2313611	.	-	.	transcript "208"
Adh	GeneID	CDS	2313807	2313838	.	-	.	transcript "208"
Adh	GeneID	CDS	2317213	2317246	.	-	.	transcript "208"
Adh	GeneID	CDS	2322940	2323009	.	-	.	transcript "208"
Adh	GeneID	CDS	2328611	2329967	.	-	.	transcript "208"
Adh	GeneID	CDS	2330026	2330087	.	-	.	transcript "208"
Adh	GeneID	start_codon	2330085	2330087	.	-	.	transcript "208"
Adh	GeneID	stop_codon	2338099	2338101	.	-	.	transcript "209"
Adh	GeneID	CDS	2338099	2338134	.	-	.	transcript "209"
Adh	GeneID	CDS	2339959	2340420	.	-	.	transcript "209"
Adh	GeneID	CDS	2340535	2341630	.	-	.	transcript "209"
Adh	GeneID	CDS	2341682	2341790	.	-	.	transcript "209"
Adh	GeneID	CDS	2342049	2342274	.	-	.	transcript "209"
Adh	GeneID	CDS	2342341	2342602	.	-	.	transcript "209"
Adh	GeneID	CDS	2342664	2343851	.	-	.	transcript "209"
Adh	GeneID	CDS	2343934	2343971	.	-	.	transcript "209"
Adh	GeneID	CDS	2344178	2344216	.	-	.	transcript "209"
Adh	GeneID	start_codon	2344214	2344216	.	-	.	transcript "209"
Adh	GeneID	start_codon	2346572	2346574	.	+	.	transcript "210"
Adh	GeneID	CDS	2346572	2346942	.	+	.	transcript "210"
Adh	GeneID	CDS	2347420	2347473	.	+	.	transcript "210"
Adh	GeneID	CDS	2347977	2348040	.	+	.	transcript "210"
Adh	GeneID	stop_codon	2348038	2348040	.	+	.	transcript "210"
Adh	GeneID	stop_codon	2349924	2349926	.	-	.	transcript "211"
Adh	GeneID	CDS	2349924	2350879	.	-	.	transcript "211"
Adh	GeneID	CDS	2352080	2353052	.	-	.	transcript "211"
Adh	GeneID	start_codon	2353050	2353052	.	-	.	transcript "211"
Adh	GeneID	stop_codon	2356352	2356354	.	-	.	transcript "212"
Adh	GeneID	CDS	2356352	2356488	.	-	.	transcript "212"
Adh	GeneID	CDS	2356993	2357164	.	-	.	transcript "212"
Adh	GeneID	CDS	2357224	2357437	.	-	.	transcript "212"
Adh	GeneID	CDS	2357539	2357674	.	-	.	transcript "212"
Adh	GeneID	CDS	2358742	2358835	.	-	.	transcript "212"
Adh	GeneID	start_codon	2358833	2358835	.	-	.	transcript "212"
Adh	GeneID	start_codon	2365166	2365168	.	+	.	transcript "213"
Adh	GeneID	CDS	2365166	2365310	.	+	.	transcript "213"
Adh	GeneID	CDS	2365994	2366070	.	+	.	transcript "213"
Adh	GeneID	stop_codon	2366068	2366070	.	+	.	transcript "213"
Adh	GeneID	stop_codon	2378084	2378086	.	-	.	transcript "214"
Adh	GeneID	CDS	2378084	2378124	.	-	.	transcript "214"
Adh	GeneID	CDS	2380142	2380199	.	-	.	transcript "214"
Adh	GeneID	CDS	2384370	2384440	.	-	.	transcript "214"
Adh	GeneID	CDS	2390039	2390108	.	-	.	transcript "214"
Adh	GeneID	start_codon	2390106	2390108	.	-	.	transcript "214"
Adh	GeneID	start_codon	2392553	2392555	.	+	.	transcript "215"
Adh	GeneID	CDS	2392553	2392737	.	+	.	transcript "215"
Adh	GeneID	CDS	2392800	2393095	.	+	.	transcript "215"
Adh	GeneID	CDS	2395174	2395226	.	+	.	transcript "215"
Adh	GeneID	stop_codon	2395224	2395226	.	+	.	transcript "215"
Adh	GeneID	start_codon	2400780	2400782	.	+	.	transcript "216"
Adh	GeneID	CDS	2400780	2400843	.	+	.	transcript "216"
Adh	GeneID	CDS	2402303	2402354	.	+	.	transcript "216"
Adh	GeneID	CDS	2407292	2407393	.	+	.	transcript "216"
Adh	GeneID	CDS	2407447	2407845	.	+	.	transcript "216"
Adh	GeneID	CDS	2407960	2408288	.	+	.	transcript "216"
Adh	GeneID	CDS	2408358	2408483	.	+	.	transcript "216"
Adh	GeneID	CDS	2415763	2415817	.	+	.	transcript "216"
Adh	GeneID	CDS	2416779	2416879	.	+	.	transcript "216"
Adh	GeneID	CDS	2417331	2417431	.	+	.	transcript "216"
Adh	GeneID	stop_codon	2417429	2417431	.	+	.	transcript "216"
Adh	GeneID	start_codon	2428833	2428835	.	+	.	transcript "217"
Adh	GeneID	CDS	2428833	2429184	.	+	.	transcript "217"
Adh	GeneID	CDS	2444164	2444213	.	+	.	transcript "217"
Adh	GeneID	CDS	2445792	2445848	.	+	.	transcript "217"
Adh	GeneID	CDS	2446577	2446664	.	+	.	transcript "217"
Adh	GeneID	CDS	2448038	2448087	.	+	.	transcript "217"
Adh	GeneID	CDS	2448799	2448851	.	+	.	transcript "217"
Adh	GeneID	CDS	2449238	2449271	.	+	.	transcript "217"
Adh	GeneID	stop_codon	2449269	2449271	.	+	.	transcript "217"
Adh	GeneID	start_codon	2465772	2465774	.	+	.	transcript "218"
Adh	GeneID	CDS	2465772	2465965	.	+	.	transcript "218"
Adh	GeneID	CDS	2466655	2466742	.	+	.	transcript "218"
Adh	GeneID	stop_codon	2466740	2466742	.	+	.	transcript "218"
Adh	GeneID	start_codon	2468501	2468503	.	+	.	transcript "219"
Adh	GeneID	CDS	2468501	2468536	.	+	.	transcript "219"
Adh	GeneID	CDS	2479652	2479721	.	+	.	transcript "219"
Adh	GeneID	CDS	2481639	2481850	.	+	.	transcript "219"
Adh	GeneID	CDS	2483447	2483582	.	+	.	transcript "219"
Adh	GeneID	CDS	2483839	2483972	.	+	.	transcript "219"
Adh	GeneID	CDS	2484693	2484860	.	+	.	transcript "219"
Adh	GeneID	CDS	2486400	2486522	.	+	.	transcript "219"
Adh	GeneID	CDS	2486596	2486785	.	+	.	transcript "219"
Adh	GeneID	CDS	2488301	2488344	.	+	.	transcript "219"
Adh	GeneID	stop_codon	2488342	2488344	.	+	.	transcript "219"
Adh	GeneID	start_codon	2493314	2493316	.	+	.	transcript "220"
Adh	GeneID	CDS	2493314	2493620	.	+	.	transcript "220"
Adh	GeneID	CDS	2493682	2493731	.	+	.	transcript "220"
Adh	GeneID	CDS	2494047	2494116	.	+	.	transcript "220"
Adh	GeneID	CDS	2494180	2494259	.	+	.	transcript "220"
Adh	GeneID	CDS	2494325	2494651	.	+	.	transcript "220"
Adh	GeneID	CDS	2495100	2495225	.	+	.	transcript "220"
Adh	GeneID	CDS	2495286	2495667	.	+	.	transcript "220"
Adh	GeneID	CDS	2495783	2496988	.	+	.	transcript "220"
Adh	GeneID	CDS	2497217	2497464	.	+	.	transcript "220"
Adh	GeneID	stop_codon	2497462	2497464	.	+	.	transcript "220"
Adh	GeneID	start_codon	2505534	2505536	.	+	.	transcript "221"
Adh	GeneID	CDS	2505534	2505597	.	+	.	transcript "221"
Adh	GeneID	CDS	2507301	2507374	.	+	.	transcript "221"
Adh	GeneID	CDS	2516024	2516126	.	+	.	transcript "221"
Adh	GeneID	CDS	2524318	2524565	.	+	.	transcript "221"
Adh	GeneID	CDS	2525929	2526064	.	+	.	transcript "221"
Adh	GeneID	CDS	2527415	2527548	.	+	.	transcript "221"
Adh	GeneID	CDS	2529073	2529195	.	+	.	transcript "221"
Adh	GeneID	CDS	2529260	2529455	.	+	.	transcript "221"
Adh	GeneID	CDS	2529735	2529997	.	+	.	transcript "221"
Adh	GeneID	CDS	2532892	2532954	.	+	.	transcript "221"
Adh	GeneID	stop_codon	2532952	2532954	.	+	.	transcript "221"
Adh	GeneID	start_codon	2537881	2537883	.	+	.	transcript "222"
Adh	GeneID	CDS	2537881	2537946	.	+	.	transcript "222"
Adh	GeneID	CDS	2542060	2542092	.	+	.	transcript "222"
Adh	GeneID	CDS	2544388	2545047	.	+	.	transcript "222"
Adh	GeneID	CDS	2549114	2549149	.	+	.	transcript "222"
Adh	GeneID	CDS	2551735	2551826	.	+	.	transcript "222"
Adh	GeneID	CDS	2552831	2552875	.	+	.	transcript "222"
Adh	GeneID	CDS	2562735	2562789	.	+	.	transcript "222"
Adh	GeneID	CDS	2570235	2570303	.	+	.	transcript "222"
Adh	GeneID	stop_codon	2570301	2570303	.	+	.	transcript "222"
Adh	GeneID	stop_codon	2572782	2572784	.	-	.	transcript "223"
Adh	GeneID	CDS	2572782	2572813	.	-	.	transcript "223"
Adh	GeneID	CDS	2576390	2576423	.	-	.	transcript "223"
Adh	GeneID	CDS	2579249	2579323	.	-	.	transcript "223"
Adh	GeneID	CDS	2580473	2580611	.	-	.	transcript "223"
Adh	GeneID	CDS	2581149	2581234	.	-	.	transcript "223"
Adh	GeneID	start_codon	2581232	2581234	.	-	.	transcript "223"
Adh	GeneID	start_codon	2590910	2590912	.	+	.	transcript "224"
Adh	GeneID	CDS	2590910	2591975	.	+	.	transcript "224"
Adh	GeneID	CDS	2595330	2595382	.	+	.	transcript "224"
Adh	GeneID	stop_codon	2595380	2595382	.	+	.	transcript "224"
Adh	GeneID	start_codon	2596549	2596551	.	+	.	transcript "225"
Adh	GeneID	CDS	2596549	2596639	.	+	.	transcript "225"
Adh	GeneID	CDS	2601031	2601171	.	+	.	transcript "225"
Adh	GeneID	CDS	2609590	2609636	.	+	.	transcript "225"
Adh	GeneID	stop_codon	2609634	2609636	.	+	.	transcript "225"
Adh	GeneID	stop_codon	2610624	2610626	.	-	.	transcript "226"
Adh	GeneID	CDS	2610624	2610673	.	-	.	transcript "226"
Adh	GeneID	CDS	2613845	2613908	.	-	.	transcript "226"
Adh	GeneID	CDS	2615080	2615192	.	-	.	transcript "226"
Adh	GeneID	CDS	2619035	2619107	.	-	.	transcript "226"
Adh	GeneID	start_codon	2619105	2619107	.	-	.	transcript "226"
Adh	GeneID	start_codon	2621205	2621207	.	+	.	transcript "227"
Adh	GeneID	CDS	2621205	2622507	.	+	.	transcript "227"
Adh	GeneID	CDS	2622578	2622779	.	+	.	transcript "227"
Adh	GeneID	CDS	2622977	2623082	.	+	.	transcript "227"
Adh	GeneID	CDS	2624976	2625495	.	+	.	transcript "227"
Adh	GeneID	CDS	2625559	2625784	.	+	.	transcript "227"
Adh	GeneID	CDS	2625851	2625978	.	+	.	transcript "227"
Adh	GeneID	CDS	2626595	2626653	.	+	.	transcript "227"
Adh	GeneID	CDS	2628411	2628470	.	+	.	transcript "227"
Adh	GeneID	stop_codon	2628468	2628470	.	+	.	transcript "227"
Adh	GeneID	start_codon	2632081	2632083	.	+	.	transcript "228"
Adh	GeneID	CDS	2632081	2632298	.	+	.	transcript "228"
Adh	GeneID	CDS	2632363	2632834	.	+	.	transcript "228"
Adh	GeneID	CDS	2633397	2633645	.	+	.	transcript "228"
Adh	GeneID	CDS	2633706	2634365	.	+	.	transcript "228"
Adh	GeneID	CDS	2634452	2634885	.	+	.	transcript "228"
Adh	GeneID	CDS	2641353	2641395	.	+	.	transcript "228"
Adh	GeneID	stop_codon	2641393	2641395	.	+	.	transcript "228"
Adh	GeneID	start_codon	2643798	2643800	.	+	.	transcript "229"
Adh	GeneID	CDS	2643798	2643862	.	+	.	transcript "229"
Adh	GeneID	CDS	2644474	2644588	.	+	.	transcript "229"
Adh	GeneID	CDS	2654047	2654208	.	+	.	transcript "229"
Adh	GeneID	CDS	2656498	2656563	.	+	.	transcript "229"
Adh	GeneID	stop_codon	2656561	2656563	.	+	.	transcript "229"
Adh	GeneID	start_codon	2660938	2660940	.	+	.	transcript "230"
Adh	GeneID	CDS	2660938	2661318	.	+	.	transcript "230"
Adh	GeneID	CDS	2661378	2662292	.	+	.	transcript "230"
Adh	GeneID	CDS	2662390	2662437	.	+	.	transcript "230"
Adh	GeneID	CDS	2664895	2664990	.	+	.	transcript "230"
Adh	GeneID	CDS	2681403	2681494	.	+	.	transcript "230"
Adh	GeneID	CDS	2684880	2686209	.	+	.	transcript "230"
Adh	GeneID	CDS	2686394	2686570	.	+	.	transcript "230"
Adh	GeneID	CDS	2686628	2686705	.	+	.	transcript "230"
Adh	GeneID	CDS	2686770	2687146	.	+	.	transcript "230"
Adh	GeneID	CDS	2687211	2687359	.	+	.	transcript "230"
Adh	GeneID	CDS	2687415	2687920	.	+	.	transcript "230"
Adh	GeneID	CDS	2687988	2688230	.	+	.	transcript "230"
Adh	GeneID	CDS	2688638	2688883	.	+	.	transcript "230"
Adh	GeneID	CDS	2689073	2689178	.	+	.	transcript "230"
Adh	GeneID	CDS	2689306	2689406	.	+	.	transcript "230"
Adh	GeneID	stop_codon	2689404	2689406	.	+	.	transcript "230"
Adh	GeneID	stop_codon	2696509	2696511	.	-	.	transcript "231"
Adh	GeneID	CDS	2696509	2696644	.	-	.	transcript "231"
Adh	GeneID	CDS	2697862	2698028	.	-	.	transcript "231"
Adh	GeneID	CDS	2698091	2698198	.	-	.	transcript "231"
Adh	GeneID	start_codon	2698196	2698198	.	-	.	transcript "231"
Adh	GeneID	stop_codon	2699344	2699346	.	-	.	transcript "232"
Adh	GeneID	CDS	2699344	2699418	.	-	.	transcript "232"
Adh	GeneID	CDS	2699909	2699957	.	-	.	transcript "232"
Adh	GeneID	CDS	2705551	2705590	.	-	.	transcript "232"
Adh	GeneID	CDS	2709814	2710672	.	-	.	transcript "232"
Adh	GeneID	start_codon	2710670	2710672	.	-	.	transcript "232"
Adh	GeneID	start_codon	2711460	2711462	.	+	.	transcript "233"
Adh	GeneID	CDS	2711460	2711538	.	+	.	transcript "233"
Adh	GeneID	CDS	2711758	2711853	.	+	.	transcript "233"
Adh	GeneID	CDS	2711910	2712440	.	+	.	transcript "233"
Adh	GeneID	CDS	2713038	2713174	.	+	.	transcript "233"
Adh	GeneID	stop_codon	2713172	2713174	.	+	.	transcript "233"
Adh	GeneID	stop_codon	2714781	2714783	.	-	.	transcript "234"
Adh	GeneID	CDS	2714781	2716277	.	-	.	transcript "234"
Adh	GeneID	CDS	2723356	2723388	.	-	.	transcript "234"
Adh	GeneID	start_codon	2723386	2723388	.	-	.	transcript "234"
Adh	GeneID	stop_codon	2724822	2724824	.	-	.	transcript "235"
Adh	GeneID	CDS	2724822	2724887	.	-	.	transcript "235"
Adh	GeneID	CDS	2728123	2728429	.	-	.	transcript "235"
Adh	GeneID	CDS	2729821	2729853	.	-	.	transcript "235"
Adh	GeneID	CDS	2734718	2734759	.	-	.	transcript "235"
Adh	GeneID	CDS	2736358	2736449	.	-	.	transcript "235"
Adh	GeneID	start_codon	2736447	2736449	.	-	.	transcript "235"
Adh	GeneID	start_codon	2737907	2737909	.	+	.	transcript "236"
Adh	GeneID	CDS	2737907	2738132	.	+	.	transcript "236"
Adh	GeneID	CDS	2738403	2739461	.	+	.	transcript "236"
Adh	GeneID	CDS	2739531	2740039	.	+	.	transcript "236"
Adh	GeneID	stop_codon	2740037	2740039	.	+	.	transcript "236"
Adh	GeneID	start_codon	2743611	2743613	.	+	.	transcript "237"
Adh	GeneID	CDS	2743611	2743977	.	+	.	transcript "237"
Adh	GeneID	CDS	2744320	2745122	.	+	.	transcript "237"
Adh	GeneID	stop_codon	2745120	2745122	.	+	.	transcript "237"
Adh	GeneID	stop_codon	2746815	2746817	.	-	.	transcript "238"
Adh	GeneID	CDS	2746815	2747453	.	-	.	transcript "238"
Adh	GeneID	CDS	2748132	2748572	.	-	.	transcript "238"
Adh	GeneID	start_codon	2748570	2748572	.	-	.	transcript "238"
Adh	GeneID	stop_codon	2751337	2751339	.	-	.	transcript "239"
Adh	GeneID	CDS	2751337	2751465	.	-	.	transcript "239"
Adh	GeneID	CDS	2751521	2751589	.	-	.	transcript "239"
Adh	GeneID	start_codon	2751587	2751589	.	-	.	transcript "239"
Adh	GeneID	start_codon	2752612	2752614	.	+	.	transcript "240"
Adh	GeneID	CDS	2752612	2752742	.	+	.	transcript "240"
Adh	GeneID	CDS	2752822	2752985	.	+	.	transcript "240"
Adh	GeneID	CDS	2753042	2753322	.	+	.	transcript "240"
Adh	GeneID	CDS	2754071	2754139	.	+	.	transcript "240"
Adh	GeneID	stop_codon	2754137	2754139	.	+	.	transcript "240"
Adh	GeneID	stop_codon	2755219	2755221	.	-	.	transcript "241"
Adh	GeneID	CDS	2755219	2755580	.	-	.	transcript "241"
Adh	GeneID	CDS	2755775	2755865	.	-	.	transcript "241"
Adh	GeneID	start_codon	2755863	2755865	.	-	.	transcript "241"
Adh	GeneID	start_codon	2756920	2756922	.	+	.	transcript "242"
Adh	GeneID	CDS	2756920	2757589	.	+	.	transcript "242"
Adh	GeneID	CDS	2757658	2758391	.	+	.	transcript "242"
Adh	GeneID	stop_codon	2758389	2758391	.	+	.	transcript "242"
Adh	GeneID	stop_codon	2759256	2759258	.	-	.	transcript "243"
Adh	GeneID	CDS	2759256	2759403	.	-	.	transcript "243"
Adh	GeneID	CDS	2759527	2759639	.	-	.	transcript "243"
Adh	GeneID	CDS	2759701	2759850	.	-	.	transcript "243"
Adh	GeneID	start_codon	2759848	2759850	.	-	.	transcript "243"
Adh	GeneID	start_codon	2760406	2760408	.	+	.	transcript "244"
Adh	GeneID	CDS	2760406	2760672	.	+	.	transcript "244"
Adh	GeneID	CDS	2760766	2761087	.	+	.	transcript "244"
Adh	GeneID	CDS	2761141	2762087	.	+	.	transcript "244"
Adh	GeneID	stop_codon	2762085	2762087	.	+	.	transcript "244"
Adh	GeneID	stop_codon	2762639	2762641	.	-	.	transcript "245"
Adh	GeneID	CDS	2762639	2762710	.	-	.	transcript "245"
Adh	GeneID	CDS	2763711	2763968	.	-	.	transcript "245"
Adh	GeneID	CDS	2764030	2764118	.	-	.	transcript "245"
Adh	GeneID	CDS	2765359	2765411	.	-	.	transcript "245"
Adh	GeneID	CDS	2766573	2766663	.	-	.	transcript "245"
Adh	GeneID	CDS	2772220	2772430	.	-	.	transcript "245"
Adh	GeneID	CDS	2772600	2772777	.	-	.	transcript "245"
Adh	GeneID	CDS	2773593	2774287	.	-	.	transcript "245"
Adh	GeneID	start_codon	2774285	2774287	.	-	.	transcript "245"
Adh	GeneID	stop_codon	2777390	2777392	.	-	.	transcript "246"
Adh	GeneID	CDS	2777390	2777609	.	-	.	transcript "246"
Adh	GeneID	CDS	2777672	2778342	.	-	.	transcript "246"
Adh	GeneID	start_codon	2778340	2778342	.	-	.	transcript "246"
Adh	GeneID	stop_codon	2785384	2785386	.	-	.	transcript "247"
Adh	GeneID	CDS	2785384	2785491	.	-	.	transcript "247"
Adh	GeneID	CDS	2787948	2788341	.	-	.	transcript "247"
Adh	GeneID	CDS	2788808	2789086	.	-	.	transcript "247"
Adh	GeneID	CDS	2789143	2789567	.	-	.	transcript "247"
Adh	GeneID	start_codon	2789565	2789567	.	-	.	transcript "247"
Adh	GeneID	stop_codon	2791866	2791868	.	-	.	transcript "248"
Adh	GeneID	CDS	2791866	2792011	.	-	.	transcript "248"
Adh	GeneID	CDS	2792082	2792601	.	-	.	transcript "248"
Adh	GeneID	start_codon	2792599	2792601	.	-	.	transcript "248"
Adh	GeneID	stop_codon	2793626	2793628	.	-	.	transcript "249"
Adh	GeneID	CDS	2793626	2797674	.	-	.	transcript "249"
Adh	GeneID	CDS	2801187	2801286	.	-	.	transcript "249"
Adh	GeneID	start_codon	2801284	2801286	.	-	.	transcript "249"
Adh	GeneID	stop_codon	2804442	2804444	.	-	.	transcript "250"
Adh	GeneID	CDS	2804442	2805730	.	-	.	transcript "250"
Adh	GeneID	CDS	2807942	2808020	.	-	.	transcript "250"
Adh	GeneID	start_codon	2808018	2808020	.	-	.	transcript "250"
Adh	GeneID	start_codon	2808552	2808554	.	+	.	transcript "251"
Adh	GeneID	CDS	2808552	2808602	.	+	.	transcript "251"
Adh	GeneID	CDS	2809680	2809823	.	+	.	transcript "251"
Adh	GeneID	CDS	2811810	2811890	.	+	.	transcript "251"
Adh	GeneID	stop_codon	2811888	2811890	.	+	.	transcript "251"
Adh	GeneID	start_codon	2815178	2815180	.	+	.	transcript "252"
Adh	GeneID	CDS	2815178	2815829	.	+	.	transcript "252"
Adh	GeneID	CDS	2815894	2816001	.	+	.	transcript "252"
Adh	GeneID	CDS	2817050	2817135	.	+	.	transcript "252"
Adh	GeneID	stop_codon	2817133	2817135	.	+	.	transcript "252"
Adh	GeneID	start_codon	2818476	2818478	.	+	.	transcript "253"
Adh	GeneID	CDS	2818476	2818511	.	+	.	transcript "253"
Adh	GeneID	CDS	2822268	2822465	.	+	.	transcript "253"
Adh	GeneID	stop_codon	2822463	2822465	.	+	.	transcript "253"
Adh	GeneID	stop_codon	2825764	2825766	.	-	.	transcript "254"
Adh	GeneID	CDS	2825764	2825833	.	-	.	transcript "254"
Adh	GeneID	CDS	2826113	2826233	.	-	.	transcript "254"
Adh	GeneID	CDS	2836812	2836843	.	-	.	transcript "254"
Adh	GeneID	CDS	2838610	2838665	.	-	.	transcript "254"
Adh	GeneID	CDS	2842689	2842759	.	-	.	transcript "254"
Adh	GeneID	CDS	2853744	2854099	.	-	.	transcript "254"
Adh	GeneID	CDS	2854197	2855182	.	-	.	transcript "254"
Adh	GeneID	start_codon	2855180	2855182	.	-	.	transcript "254"
Adh	GeneID	start_codon	2870618	2870620	.	+	.	transcript "255"
Adh	GeneID	CDS	2870618	2870720	.	+	.	transcript "255"
Adh	GeneID	CDS	2876212	2876251	.	+	.	transcript "255"
Adh	GeneID	CDS	2877802	2877835	.	+	.	transcript "255"
Adh	GeneID	CDS	2885189	2885284	.	+	.	transcript "255"
Adh	GeneID	stop_codon	2885282	2885284	.	+	.	transcript "255"
Adh	GeneID	start_codon	2894707	2894709	.	+	.	transcript "256"
Adh	GeneID	CDS	2894707	2895247	.	+	.	transcript "256"
Adh	GeneID	CDS	2895441	2895487	.	+	.	transcript "256"
Adh	GeneID	stop_codon	2895485	2895487	.	+	.	transcript "256"
Adh	GeneID	start_codon	2896655	2896657	.	+	.	transcript "257"
Adh	GeneID	CDS	2896655	2896763	.	+	.	transcript "257"
Adh	GeneID	CDS	2898444	2899001	.	+	.	transcript "257"
Adh	GeneID	CDS	2899061	2899716	.	+	.	transcript "257"
Adh	GeneID	stop_codon	2899714	2899716	.	+	.	transcript "257"
Adh	GeneID	start_codon	2900448	2900450	.	+	.	transcript "258"
Adh	GeneID	CDS	2900448	2900565	.	+	.	transcript "258"
Adh	GeneID	CDS	2900634	2901185	.	+	.	transcript "258"
Adh	GeneID	CDS	2901452	2902107	.	+	.	transcript "258"
Adh	GeneID	stop_codon	2902105	2902107	.	+	.	transcript "258"
Adh	GeneID	stop_codon	2910965	2910967	.	-	.	transcript "259"
Adh	GeneID	CDS	2910965	2911002	.	-	.	transcript "259"
Adh	GeneID	CDS	2911839	2911898	.	-	.	transcript "259"
Adh	GeneID	CDS	2917311	2917504	.	-	.	transcript "259"
Adh	GeneID	CDS	2917751	2917988	.	-	.	transcript "259"
Adh	GeneID	CDS	2918253	2918513	.	-	.	transcript "259"


# GENE ANNOTATION 1 for Adh region of Drosophila melanogaster (file: CGG1_Annotation_of_Adh.gff)
# Computational Genomic Group, The Sanger Centre, Hinxton, Cambridge CB10 1SA, UK
# Group Leader Victor Solovyev: Email: solovyev@sanger.ac.uk
#                                 WWW: http://genomic.sanger.ac.uk/
# ANNOTATION 1 (MAIN): CGG1 (use this file to compare with the other group annotations)
#   Presented most probable gene structures 1 variant for any sequence region
#   Total 288 genes; 1115 exons; Predictions based on Fgenes/Fgenesh programs;
#   58 genes have significant similarity with known proteins, transcript marked "homo"
#    2 other files (auxiliary annotations): 	
#    Annotation 2 (CGG2) (file: CGG2_Annotation_of_Adh.gff)
#      Presents most reliable list of Coding exons, that might be useful
#      to start experimental verification of genes using PCR primers; these exons
#      are the same in fgenes/fgenesh predictions: 
#      Total 598  exons.	
#    Annotation 3 (CGG3) (file: CGG3_Annotation_of_Adh.gff)
#      Presents possible gene variants predicted by 2 programs Fgenes/Fgenesh
#      it is very redundant, but should have the highest coverage of real genes: 
#      Total 875 genes; 2900 exons.
#
# compfly: 1. replaced sequence feature entry  Jul 5 (MR)
#
Adh	FGenesCGG1	CDS	1	441	.	-	.	transcript "1"	
Adh	FGenesCGG1	CDS	2379	2862	.	-	.	transcript "1"	
Adh	FGenesCGG1	CDS	3225	3550	.	-	.	transcript "1"	
Adh	FGenesCGG1	CDS	6718	7018	.	-	.	transcript "1"	
Adh	FGenesCGG1	start_codon	7016	7018	.	-	.	transcript "1"	
Adh	FGenesCGG1	CDS	12148	12250	.	-	.	transcript "2"	
Adh	FGenesCGG1	stop_codon	12148	12150	.	-	.	transcript "2"	
Adh	FGenesCGG1	CDS	14333	14407	.	-	.	transcript "2"	
Adh	FGenesCGG1	CDS	15268	15437	.	-	.	transcript "2"	
Adh	FGenesCGG1	start_codon	15435	15437	.	-	.	transcript "2"	
Adh	FGenesCGG1	CDS	16481	19594	.	-	.	transcript "3"	
Adh	FGenesCGG1	start_codon	19592	19594	.	-	.	transcript "3"	
Adh	FGenesCGG1	stop_codon	16481	16483	.	-	.	transcript "3"	
Adh	FGenesCGG1	CDS	21599	21979	.	+	.	transcript "4"	
Adh	FGenesCGG1	start_codon	21599	21601	.	+	.	transcript "4"	
Adh	FGenesCGG1	CDS	23871	24134	.	+	.	transcript "4"	
Adh	FGenesCGG1	CDS	24195	24356	.	+	.	transcript "4"	
Adh	FGenesCGG1	stop_codon	24354	24356	.	+	.	transcript "4"	
Adh	FGenesCGG1	CDS	26050	26166	.	+	.	transcript "5"	
Adh	FGenesCGG1	start_codon	26050	26052	.	+	.	transcript "5"	
Adh	FGenesCGG1	CDS	26209	26394	.	+	.	transcript "5"	
Adh	FGenesCGG1	stop_codon	26392	26394	.	+	.	transcript "5"	
Adh	FGenesCGG1	CDS	29156	29479	.	-	.	transcript "6"	
Adh	FGenesCGG1	start_codon	29477	29479	.	-	.	transcript "6"	
Adh	FGenesCGG1	stop_codon	29156	29158	.	-	.	transcript "6"	
Adh	FGenesCGG1	CDS	31722	31768	.	+	.	transcript "7"	
Adh	FGenesCGG1	start_codon	31722	31724	.	+	.	transcript "7"	
Adh	FGenesCGG1	CDS	32102	32319	.	+	.	transcript "7"	
Adh	FGenesCGG1	CDS	34532	34822	.	+	.	transcript "7"	
Adh	FGenesCGG1	CDS	34857	35332	.	+	.	transcript "7"	
Adh	FGenesCGG1	stop_codon	35330	35332	.	+	.	transcript "7"	
Adh	FGenesCGG1	CDS	35433	35749	.	-	.	transcript "8"	
Adh	FGenesCGG1	stop_codon	35433	35435	.	-	.	transcript "8"	
Adh	FGenesCGG1	CDS	35938	36226	.	-	.	transcript "8"	
Adh	FGenesCGG1	start_codon	36224	36226	.	-	.	transcript "8"	
Adh	FGenesCGG1	CDS	36410	37315	.	+	.	transcript "9"	
Adh	FGenesCGG1	start_codon	36410	36412	.	+	.	transcript "9"	
Adh	FGenesCGG1	stop_codon	37313	37315	.	+	.	transcript "9"	
Adh	FGenesCGG1	CDS	45358	45421	.	+	.	transcript "10"	
Adh	FGenesCGG1	start_codon	45358	45360	.	+	.	transcript "10"	
Adh	FGenesCGG1	CDS	52555	52587	.	+	.	transcript "10"	
Adh	FGenesCGG1	CDS	103543	103769	.	+	.	transcript "10"	
Adh	FGenesCGG1	CDS	103808	104330	.	+	.	transcript "10"	
Adh	FGenesCGG1	CDS	124458	124936	.	+	.	transcript "10"	
Adh	FGenesCGG1	CDS	127146	127292	.	+	.	transcript "10"	
Adh	FGenesCGG1	CDS	127771	127931	.	+	.	transcript "10"	
Adh	FGenesCGG1	CDS	127991	128225	.	+	.	transcript "10"	
Adh	FGenesCGG1	CDS	128296	129342	.	+	.	transcript "10"	
Adh	FGenesCGG1	CDS	129401	129965	.	+	.	transcript "10"	
Adh	FGenesCGG1	CDS	130136	130401	.	+	.	transcript "10"	
Adh	FGenesCGG1	stop_codon	130399	130401	.	+	.	transcript "10"	
Adh	FGenesCGG1	CDS	54448	55900	.	+	.	transcript "11"	
Adh	FGenesCGG1	stop_codon	55898	55900	.	+	.	transcript "11"	
Adh	FGenesCGG1	CDS	56155	58817	.	+	.	transcript "12"	
Adh	FGenesCGG1	start_codon	56155	56157	.	+	.	transcript "12"	
Adh	FGenesCGG1	CDS	89305	90666	.	-	.	transcript "13"	
Adh	FGenesCGG1	start_codon	90664	90666	.	-	.	transcript "13"	
Adh	FGenesCGG1	stop_codon	89305	89307	.	-	.	transcript "13"	
Adh	FGenesCGG1	CDS	93123	94100	.	-	.	transcript "14"	
Adh	FGenesCGG1	stop_codon	93123	93125	.	-	.	transcript "14"	
Adh	FGenesCGG1	CDS	95215	95259	.	-	.	transcript "14"	
Adh	FGenesCGG1	CDS	96195	96257	.	-	.	transcript "14"	
Adh	FGenesCGG1	start_codon	96255	96257	.	-	.	transcript "14"	
Adh	FGenesCGG1	CDS	133458	133548	.	-	.	transcript "15"	
Adh	FGenesCGG1	stop_codon	133458	133460	.	-	.	transcript "15"	
Adh	FGenesCGG1	CDS	133612	133750	.	-	.	transcript "15"	
Adh	FGenesCGG1	CDS	133961	134233	.	-	.	transcript "15"	
Adh	FGenesCGG1	CDS	134862	135000	.	-	.	transcript "15"	
Adh	FGenesCGG1	start_codon	134998	135000	.	-	.	transcript "15"	
Adh	FGenesCGG1	CDS	159578	159874	.	+	.	transcript "16"	
Adh	FGenesCGG1	start_codon	159578	159580	.	+	.	transcript "16"	
Adh	FGenesCGG1	CDS	160778	160792	.	+	.	transcript "16"	
Adh	FGenesCGG1	CDS	161727	162105	.	+	.	transcript "16"	
Adh	FGenesCGG1	CDS	162442	162557	.	+	.	transcript "16"	
Adh	FGenesCGG1	CDS	162616	163137	.	+	.	transcript "16"	
Adh	FGenesCGG1	CDS	163297	163527	.	+	.	transcript "16"	
Adh	FGenesCGG1	stop_codon	163525	163527	.	+	.	transcript "16"	
Adh	FGenesCGG1	CDS	167469	167524	.	-	.	transcript "17"	
Adh	FGenesCGG1	stop_codon	167469	167471	.	-	.	transcript "17"	
Adh	FGenesCGG1	CDS	172369	172869	.	-	.	transcript "17"	
Adh	FGenesCGG1	CDS	175152	175341	.	-	.	transcript "17"	
Adh	FGenesCGG1	CDS	176875	176942	.	-	.	transcript "17"	
Adh	FGenesCGG1	CDS	177956	178015	.	-	.	transcript "17"	
Adh	FGenesCGG1	CDS	178136	178300	.	-	.	transcript "17"	
Adh	FGenesCGG1	CDS	181272	181409	.	-	.	transcript "17"	
Adh	FGenesCGG1	CDS	183107	183235	.	-	.	transcript "17"	
Adh	FGenesCGG1	CDS	183341	183496	.	-	.	transcript "17"	
Adh	FGenesCGG1	CDS	183596	183635	.	-	.	transcript "17"	
Adh	FGenesCGG1	CDS	183699	183764	.	-	.	transcript "17"	
Adh	FGenesCGG1	CDS	183835	184040	.	-	.	transcript "17"	
Adh	FGenesCGG1	CDS	184241	184282	.	-	.	transcript "17"	
Adh	FGenesCGG1	CDS	185558	185615	.	-	.	transcript "17"	
Adh	FGenesCGG1	start_codon	185613	185615	.	-	.	transcript "17"	
Adh	FGenesCGG1	CDS	188492	188640	.	+	.	transcript "18"	
Adh	FGenesCGG1	start_codon	188492	188494	.	+	.	transcript "18"	
Adh	FGenesCGG1	CDS	189065	189192	.	+	.	transcript "18"	
Adh	FGenesCGG1	CDS	189224	189348	.	+	.	transcript "18"	
Adh	FGenesCGG1	CDS	189492	189584	.	+	.	transcript "18"	
Adh	FGenesCGG1	stop_codon	189582	189584	.	+	.	transcript "18"	
Adh	FGenesCGG1	CDS	202128	202646	.	+	.	transcript "19"	
Adh	FGenesCGG1	start_codon	202128	202130	.	+	.	transcript "19"	
Adh	FGenesCGG1	CDS	202700	204199	.	+	.	transcript "19"	
Adh	FGenesCGG1	stop_codon	204197	204199	.	+	.	transcript "19"	
Adh	FGenesCGG1	CDS	216144	216761	.	-	.	transcript "20"	
Adh	FGenesCGG1	stop_codon	216144	216146	.	-	.	transcript "20"	
Adh	FGenesCGG1	CDS	216820	217188	.	-	.	transcript "20"	
Adh	FGenesCGG1	start_codon	217186	217188	.	-	.	transcript "20"	
Adh	FGenesCGG1	CDS	229944	230462	.	+	.	transcript "21"	
Adh	FGenesCGG1	start_codon	229944	229946	.	+	.	transcript "21"	
Adh	FGenesCGG1	stop_codon	230460	230462	.	+	.	transcript "21"	
Adh	FGenesCGG1	CDS	230985	231322	.	-	.	transcript "22"	
Adh	FGenesCGG1	stop_codon	230985	230987	.	-	.	transcript "22"	
Adh	FGenesCGG1	CDS	231417	231615	.	-	.	transcript "22"	
Adh	FGenesCGG1	start_codon	231613	231615	.	-	.	transcript "22"	
Adh	FGenesCGG1	CDS	237474	237694	.	-	.	transcript "23"	
Adh	FGenesCGG1	stop_codon	237474	237476	.	-	.	transcript "23"	
Adh	FGenesCGG1	CDS	238361	238436	.	-	.	transcript "23"	
Adh	FGenesCGG1	CDS	238885	238894	.	-	.	transcript "23"	
Adh	FGenesCGG1	CDS	240094	240232	.	-	.	transcript "23"	
Adh	FGenesCGG1	CDS	240585	240630	.	-	.	transcript "23"	
Adh	FGenesCGG1	start_codon	240628	240630	.	-	.	transcript "23"	
Adh	FGenesCGG1	CDS	255763	256582	.	-	.	transcript "24"	
Adh	FGenesCGG1	stop_codon	255763	255765	.	-	.	transcript "24"	
Adh	FGenesCGG1	CDS	260965	261005	.	-	.	transcript "24"	
Adh	FGenesCGG1	start_codon	261003	261005	.	-	.	transcript "24"	
Adh	FGenesCGG1	CDS	263040	263066	.	+	.	transcript "25"	
Adh	FGenesCGG1	start_codon	263040	263042	.	+	.	transcript "25"	
Adh	FGenesCGG1	CDS	265187	266322	.	+	.	transcript "25"	
Adh	FGenesCGG1	CDS	266392	266611	.	+	.	transcript "25"	
Adh	FGenesCGG1	CDS	266760	266867	.	+	.	transcript "25"	
Adh	FGenesCGG1	CDS	266935	267073	.	+	.	transcript "25"	
Adh	FGenesCGG1	CDS	267134	267234	.	+	.	transcript "25"	
Adh	FGenesCGG1	stop_codon	267232	267234	.	+	.	transcript "25"	
Adh	FGenesCGG1	CDS	267759	268130	.	-	.	transcript "26"	
Adh	FGenesCGG1	stop_codon	267759	267761	.	-	.	transcript "26"	
Adh	FGenesCGG1	CDS	268725	268798	.	-	.	transcript "26"	
Adh	FGenesCGG1	CDS	269222	269541	.	-	.	transcript "26"	
Adh	FGenesCGG1	CDS	269629	269907	.	-	.	transcript "26"	
Adh	FGenesCGG1	CDS	271522	271573	.	-	.	transcript "26"	
Adh	FGenesCGG1	CDS	273396	273483	.	-	.	transcript "26"	
Adh	FGenesCGG1	start_codon	273481	273483	.	-	.	transcript "26"	
Adh	FGenesCGG1	CDS	274751	275848	.	+	.	transcript "27"	
Adh	FGenesCGG1	start_codon	274751	274753	.	+	.	transcript "27"	
Adh	FGenesCGG1	stop_codon	275846	275848	.	+	.	transcript "27"	
Adh	FGenesCGG1	CDS	276361	276696	.	-	.	transcript "28"	
Adh	FGenesCGG1	stop_codon	276361	276363	.	-	.	transcript "28"	
Adh	FGenesCGG1	CDS	276748	277188	.	-	.	transcript "28"	
Adh	FGenesCGG1	start_codon	277186	277188	.	-	.	transcript "28"	
Adh	FGenesCGG1	CDS	277921	278103	.	+	.	transcript "29"	
Adh	FGenesCGG1	start_codon	277921	277923	.	+	.	transcript "29"	
Adh	FGenesCGG1	CDS	278222	278345	.	+	.	transcript "29"	
Adh	FGenesCGG1	CDS	278537	278737	.	+	.	transcript "29"	
Adh	FGenesCGG1	CDS	278802	279272	.	+	.	transcript "29"	
Adh	FGenesCGG1	CDS	279331	279483	.	+	.	transcript "29"	
Adh	FGenesCGG1	CDS	279548	279726	.	+	.	transcript "29"	
Adh	FGenesCGG1	CDS	280031	280247	.	+	.	transcript "29"	
Adh	FGenesCGG1	CDS	280310	280610	.	+	.	transcript "29"	
Adh	FGenesCGG1	CDS	280674	280986	.	+	.	transcript "29"	
Adh	FGenesCGG1	CDS	281051	281202	.	+	.	transcript "29"	
Adh	FGenesCGG1	CDS	281264	281447	.	+	.	transcript "29"	
Adh	FGenesCGG1	CDS	281550	281787	.	+	.	transcript "29"	
Adh	FGenesCGG1	CDS	281848	282471	.	+	.	transcript "29"	
Adh	FGenesCGG1	CDS	282539	283541	.	+	.	transcript "29"	
Adh	FGenesCGG1	CDS	283608	284052	.	+	.	transcript "29"	
Adh	FGenesCGG1	stop_codon	284050	284052	.	+	.	transcript "29"	
Adh	FGenesCGG1	CDS	284779	284915	.	+	.	transcript "30"	
Adh	FGenesCGG1	start_codon	284779	284781	.	+	.	transcript "30"	
Adh	FGenesCGG1	CDS	284969	285346	.	+	.	transcript "30"	
Adh	FGenesCGG1	CDS	285416	286886	.	+	.	transcript "30"	
Adh	FGenesCGG1	stop_codon	286884	286886	.	+	.	transcript "30"	
Adh	FGenesCGG1	CDS	287599	288379	.	+	.	transcript "31"	
Adh	FGenesCGG1	start_codon	287599	287601	.	+	.	transcript "31"	
Adh	FGenesCGG1	CDS	288647	292689	.	+	.	transcript "31"	
Adh	FGenesCGG1	CDS	292759	292896	.	+	.	transcript "31"	
Adh	FGenesCGG1	stop_codon	292894	292896	.	+	.	transcript "31"	
Adh	FGenesCGG1	CDS	297680	297713	.	+	.	transcript "32"	
Adh	FGenesCGG1	start_codon	297680	297682	.	+	.	transcript "32"	
Adh	FGenesCGG1	CDS	302560	302718	.	+	.	transcript "32"	
Adh	FGenesCGG1	CDS	302786	303072	.	+	.	transcript "32"	
Adh	FGenesCGG1	CDS	303214	303405	.	+	.	transcript "32"	
Adh	FGenesCGG1	stop_codon	303403	303405	.	+	.	transcript "32"	
Adh	FGenesCGG1	CDS	303960	304272	.	-	.	transcript "33"	
Adh	FGenesCGG1	stop_codon	303960	303962	.	-	.	transcript "33"	
Adh	FGenesCGG1	CDS	304330	305000	.	-	.	transcript "33"	
Adh	FGenesCGG1	start_codon	304998	305000	.	-	.	transcript "33"	
Adh	FGenesCGG1	CDS	307965	309056	.	+	.	transcript "34"	
Adh	FGenesCGG1	start_codon	307965	307967	.	+	.	transcript "34"	
Adh	FGenesCGG1	CDS	309110	309467	.	+	.	transcript "34"	
Adh	FGenesCGG1	CDS	309530	310452	.	+	.	transcript "34"	
Adh	FGenesCGG1	CDS	310517	311365	.	+	.	transcript "34"	
Adh	FGenesCGG1	CDS	311428	312318	.	+	.	transcript "34"	
Adh	FGenesCGG1	CDS	312387	313020	.	+	.	transcript "34"	
Adh	FGenesCGG1	CDS	313086	313129	.	+	.	transcript "34"	
Adh	FGenesCGG1	stop_codon	313127	313129	.	+	.	transcript "34"	
Adh	FGenesCGG1	CDS	315138	315899	.	+	.	transcript "35"	
Adh	FGenesCGG1	start_codon	315138	315140	.	+	.	transcript "35"	
Adh	FGenesCGG1	CDS	316433	316800	.	+	.	transcript "35"	
Adh	FGenesCGG1	CDS	316865	317462	.	+	.	transcript "35"	
Adh	FGenesCGG1	stop_codon	317460	317462	.	+	.	transcript "35"	
Adh	FGenesCGG1	CDS	317891	318548	.	-	.	transcript "36"	
Adh	FGenesCGG1	stop_codon	317891	317893	.	-	.	transcript "36"	
Adh	FGenesCGG1	CDS	318608	319430	.	-	.	transcript "36"	
Adh	FGenesCGG1	CDS	319486	321442	.	-	.	transcript "36"	
Adh	FGenesCGG1	start_codon	321440	321442	.	-	.	transcript "36"	
Adh	FGenesCGG1	CDS	321967	323027	.	-	.	transcript "37"	
Adh	FGenesCGG1	stop_codon	321967	321969	.	-	.	transcript "37"	
Adh	FGenesCGG1	CDS	323097	323169	.	-	.	transcript "37"	
Adh	FGenesCGG1	start_codon	323167	323169	.	-	.	transcript "37"	
Adh	FGenesCGG1	CDS	323788	324885	.	+	.	transcript "38"	
Adh	FGenesCGG1	start_codon	323788	323790	.	+	.	transcript "38"	
Adh	FGenesCGG1	CDS	324939	325223	.	+	.	transcript "38"	
Adh	FGenesCGG1	stop_codon	325221	325223	.	+	.	transcript "38"	
Adh	FGenesCGG1	CDS	325240	325634	.	-	.	transcript "39"	
Adh	FGenesCGG1	stop_codon	325240	325242	.	-	.	transcript "39"	
Adh	FGenesCGG1	CDS	325689	326379	.	-	.	transcript "39"	
Adh	FGenesCGG1	start_codon	326377	326379	.	-	.	transcript "39"	
Adh	FGenesCGG1	CDS	326381	326822	.	-	.	transcript "40"	
Adh	FGenesCGG1	start_codon	326820	326822	.	-	.	transcript "40"	
Adh	FGenesCGG1	stop_codon	326381	326383	.	-	.	transcript "40"	
Adh	FGenesCGG1	CDS	327175	328002	.	+	.	transcript "41"	
Adh	FGenesCGG1	start_codon	327175	327177	.	+	.	transcript "41"	
Adh	FGenesCGG1	stop_codon	328000	328002	.	+	.	transcript "41"	
Adh	FGenesCGG1	CDS	328048	328383	.	-	.	transcript "42"	
Adh	FGenesCGG1	stop_codon	328048	328050	.	-	.	transcript "42"	
Adh	FGenesCGG1	CDS	328469	328634	.	-	.	transcript "42"	
Adh	FGenesCGG1	CDS	328690	328733	.	-	.	transcript "42"	
Adh	FGenesCGG1	start_codon	328731	328733	.	-	.	transcript "42"	
Adh	FGenesCGG1	CDS	329808	329867	.	+	.	transcript "43"	
Adh	FGenesCGG1	start_codon	329808	329810	.	+	.	transcript "43"	
Adh	FGenesCGG1	CDS	330027	330183	.	+	.	transcript "43"	
Adh	FGenesCGG1	CDS	333808	334040	.	+	.	transcript "43"	
Adh	FGenesCGG1	stop_codon	334038	334040	.	+	.	transcript "43"	
Adh	FGenesCGG1	CDS	334589	334786	.	-	.	transcript "44"	
Adh	FGenesCGG1	stop_codon	334589	334591	.	-	.	transcript "44"	
Adh	FGenesCGG1	CDS	334847	335125	.	-	.	transcript "44"	
Adh	FGenesCGG1	CDS	335195	335230	.	-	.	transcript "44"	
Adh	FGenesCGG1	start_codon	335228	335230	.	-	.	transcript "44"	
Adh	FGenesCGG1	CDS	336668	337323	.	-	.	transcript "45"	
Adh	FGenesCGG1	stop_codon	336668	336670	.	-	.	transcript "45"	
Adh	FGenesCGG1	CDS	337379	337457	.	-	.	transcript "45"	
Adh	FGenesCGG1	start_codon	337455	337457	.	-	.	transcript "45"	
Adh	FGenesCGG1	CDS	338167	338879	.	-	.	transcript "46"	
Adh	FGenesCGG1	stop_codon	338167	338169	.	-	.	transcript "46"	
Adh	FGenesCGG1	CDS	338944	339013	.	-	.	transcript "46"	
Adh	FGenesCGG1	start_codon	339011	339013	.	-	.	transcript "46"	
Adh	FGenesCGG1	CDS	340529	340634	.	+	.	transcript "47"	
Adh	FGenesCGG1	start_codon	340529	340531	.	+	.	transcript "47"	
Adh	FGenesCGG1	CDS	340705	340870	.	+	.	transcript "47"	
Adh	FGenesCGG1	CDS	340926	341517	.	+	.	transcript "47"	
Adh	FGenesCGG1	stop_codon	341515	341517	.	+	.	transcript "47"	
Adh	FGenesCGG1	CDS	341713	341857	.	+	.	transcript "48"	
Adh	FGenesCGG1	start_codon	341713	341715	.	+	.	transcript "48"	
Adh	FGenesCGG1	CDS	342003	342689	.	+	.	transcript "48"	
Adh	FGenesCGG1	CDS	343143	343368	.	+	.	transcript "48"	
Adh	FGenesCGG1	CDS	343432	343984	.	+	.	transcript "48"	
Adh	FGenesCGG1	stop_codon	343982	343984	.	+	.	transcript "48"	
Adh	FGenesCGG1	CDS	347626	349437	.	-	.	transcript "49"	
Adh	FGenesCGG1	stop_codon	347626	347628	.	-	.	transcript "49"	
Adh	FGenesCGG1	CDS	350212	351429	.	-	.	transcript "49"	
Adh	FGenesCGG1	CDS	352375	353478	.	-	.	transcript "49"	
Adh	FGenesCGG1	CDS	354175	354562	.	-	.	transcript "49"	
Adh	FGenesCGG1	CDS	360158	360259	.	-	.	transcript "49"	
Adh	FGenesCGG1	CDS	361766	361794	.	-	.	transcript "49"	
Adh	FGenesCGG1	start_codon	361792	361794	.	-	.	transcript "49"	
Adh	FGenesCGG1	CDS	385176	385283	.	+	.	transcript "50"	
Adh	FGenesCGG1	start_codon	385176	385178	.	+	.	transcript "50"	
Adh	FGenesCGG1	CDS	388780	388921	.	+	.	transcript "50"	
Adh	FGenesCGG1	CDS	389006	389140	.	+	.	transcript "50"	
Adh	FGenesCGG1	CDS	389208	390491	.	+	.	transcript "50"	
Adh	FGenesCGG1	CDS	390556	390673	.	+	.	transcript "50"	
Adh	FGenesCGG1	CDS	390737	391112	.	+	.	transcript "50"	
Adh	FGenesCGG1	CDS	391177	391500	.	+	.	transcript "50"	
Adh	FGenesCGG1	stop_codon	391498	391500	.	+	.	transcript "50"	
Adh	FGenesCGG1	CDS	393573	393814	.	-	.	transcript "51"	
Adh	FGenesCGG1	stop_codon	393573	393575	.	-	.	transcript "51"	
Adh	FGenesCGG1	CDS	393894	394052	.	-	.	transcript "51"	
Adh	FGenesCGG1	CDS	394383	395732	.	-	.	transcript "51"	
Adh	FGenesCGG1	CDS	395826	396192	.	-	.	transcript "51"	
Adh	FGenesCGG1	CDS	396385	397468	.	-	.	transcript "51"	
Adh	FGenesCGG1	CDS	397532	397671	.	-	.	transcript "51"	
Adh	FGenesCGG1	start_codon	397669	397671	.	-	.	transcript "51"	
Adh	FGenesCGG1	CDS	400338	400923	.	+	.	transcript "52"	
Adh	FGenesCGG1	start_codon	400338	400340	.	+	.	transcript "52"	
Adh	FGenesCGG1	CDS	401350	401713	.	+	.	transcript "52"	
Adh	FGenesCGG1	CDS	401775	402341	.	+	.	transcript "52"	
Adh	FGenesCGG1	CDS	402399	402539	.	+	.	transcript "52"	
Adh	FGenesCGG1	CDS	402607	402779	.	+	.	transcript "52"	
Adh	FGenesCGG1	CDS	402844	402860	.	+	.	transcript "52"	
Adh	FGenesCGG1	stop_codon	402858	402860	.	+	.	transcript "52"	
Adh	FGenesCGG1	CDS	403203	403277	.	+	.	transcript "53"	
Adh	FGenesCGG1	start_codon	403203	403205	.	+	.	transcript "53"	
Adh	FGenesCGG1	CDS	403468	404414	.	+	.	transcript "53"	
Adh	FGenesCGG1	CDS	404467	405027	.	+	.	transcript "53"	
Adh	FGenesCGG1	CDS	405085	405391	.	+	.	transcript "53"	
Adh	FGenesCGG1	stop_codon	405389	405391	.	+	.	transcript "53"	
Adh	FGenesCGG1	CDS	405952	406314	.	+	.	transcript "54"	
Adh	FGenesCGG1	start_codon	405952	405954	.	+	.	transcript "54"	
Adh	FGenesCGG1	stop_codon	406312	406314	.	+	.	transcript "54"	
Adh	FGenesCGG1	CDS	408759	409001	.	+	.	transcript "55"	
Adh	FGenesCGG1	start_codon	408759	408761	.	+	.	transcript "55"	
Adh	FGenesCGG1	CDS	409150	409656	.	+	.	transcript "55"	
Adh	FGenesCGG1	CDS	410157	410315	.	+	.	transcript "55"	
Adh	FGenesCGG1	CDS	410372	410612	.	+	.	transcript "55"	
Adh	FGenesCGG1	CDS	410677	411401	.	+	.	transcript "55"	
Adh	FGenesCGG1	CDS	411728	411831	.	+	.	transcript "55"	
Adh	FGenesCGG1	CDS	411898	411996	.	+	.	transcript "55"	
Adh	FGenesCGG1	CDS	412708	412711	.	+	.	transcript "55"	
Adh	FGenesCGG1	stop_codon	412709	412711	.	+	.	transcript "55"	
Adh	FGenesCGG1	CDS	414711	415055	.	-	.	transcript "56"	
Adh	FGenesCGG1	stop_codon	414711	414713	.	-	.	transcript "56"	
Adh	FGenesCGG1	CDS	415356	415519	.	-	.	transcript "56"	
Adh	FGenesCGG1	CDS	415584	416211	.	-	.	transcript "56"	
Adh	FGenesCGG1	CDS	416276	416749	.	-	.	transcript "56"	
Adh	FGenesCGG1	CDS	417100	417111	.	-	.	transcript "56"	
Adh	FGenesCGG1	start_codon	417109	417111	.	-	.	transcript "56"	
Adh	FGenesCGG1	CDS	417380	417492	.	+	.	transcript "57"	
Adh	FGenesCGG1	start_codon	417380	417382	.	+	.	transcript "57"	
Adh	FGenesCGG1	CDS	420781	420901	.	+	.	transcript "57"	
Adh	FGenesCGG1	CDS	423538	423693	.	+	.	transcript "57"	
Adh	FGenesCGG1	stop_codon	423691	423693	.	+	.	transcript "57"	
Adh	FGenesCGG1	CDS	426746	427546	.	-	.	transcript "58"	
Adh	FGenesCGG1	stop_codon	426746	426748	.	-	.	transcript "58"	
Adh	FGenesCGG1	CDS	432888	432947	.	-	.	transcript "58"	
Adh	FGenesCGG1	start_codon	432945	432947	.	-	.	transcript "58"	
Adh	FGenesCGG1	CDS	438994	439176	.	+	.	transcript "59"	
Adh	FGenesCGG1	start_codon	438994	438996	.	+	.	transcript "59"	
Adh	FGenesCGG1	CDS	439499	439600	.	+	.	transcript "59"	
Adh	FGenesCGG1	CDS	448492	448607	.	+	.	transcript "59"	
Adh	FGenesCGG1	CDS	449015	449225	.	+	.	transcript "59"	
Adh	FGenesCGG1	CDS	451744	451902	.	+	.	transcript "59"	
Adh	FGenesCGG1	CDS	453313	453459	.	+	.	transcript "59"	
Adh	FGenesCGG1	CDS	455021	455702	.	+	.	transcript "59"	
Adh	FGenesCGG1	CDS	455870	456267	.	+	.	transcript "59"	
Adh	FGenesCGG1	stop_codon	456265	456267	.	+	.	transcript "59"	
Adh	FGenesCGG1	CDS	457298	457488	.	+	.	transcript "60"	
Adh	FGenesCGG1	start_codon	457298	457300	.	+	.	transcript "60"	
Adh	FGenesCGG1	CDS	457649	458206	.	+	.	transcript "60"	
Adh	FGenesCGG1	CDS	458285	458481	.	+	.	transcript "60"	
Adh	FGenesCGG1	CDS	458547	458692	.	+	.	transcript "60"	
Adh	FGenesCGG1	stop_codon	458690	458692	.	+	.	transcript "60"	
Adh	FGenesCGG1	CDS	458837	459146	.	-	.	transcript "61"	
Adh	FGenesCGG1	stop_codon	458837	458839	.	-	.	transcript "61"	
Adh	FGenesCGG1	CDS	459225	459761	.	-	.	transcript "61"	
Adh	FGenesCGG1	CDS	460256	460674	.	-	.	transcript "61"	
Adh	FGenesCGG1	start_codon	460672	460674	.	-	.	transcript "61"	
Adh	FGenesCGG1	CDS	462092	462584	.	-	.	transcript "62"	
Adh	FGenesCGG1	stop_codon	462092	462094	.	-	.	transcript "62"	
Adh	FGenesCGG1	CDS	462646	463209	.	-	.	transcript "62"	
Adh	FGenesCGG1	CDS	463368	463657	.	-	.	transcript "62"	
Adh	FGenesCGG1	start_codon	463655	463657	.	-	.	transcript "62"	
Adh	FGenesCGG1	CDS	464308	464615	.	+	.	transcript "63"	
Adh	FGenesCGG1	start_codon	464308	464310	.	+	.	transcript "63"	
Adh	FGenesCGG1	CDS	464888	465434	.	+	.	transcript "63"	
Adh	FGenesCGG1	stop_codon	465432	465434	.	+	.	transcript "63"	
Adh	FGenesCGG1	CDS	467979	469628	.	-	.	transcript "64"	
Adh	FGenesCGG1	stop_codon	467979	467981	.	-	.	transcript "64"	
Adh	FGenesCGG1	CDS	469682	469686	.	-	.	transcript "64"	
Adh	FGenesCGG1	CDS	470967	471022	.	-	.	transcript "64"	
Adh	FGenesCGG1	start_codon	471020	471022	.	-	.	transcript "64"	
Adh	FGenesCGG1	CDS	471109	471296	.	+	.	transcript "65"	
Adh	FGenesCGG1	start_codon	471109	471111	.	+	.	transcript "65"	
Adh	FGenesCGG1	CDS	471441	471687	.	+	.	transcript "65"	
Adh	FGenesCGG1	CDS	471752	471856	.	+	.	transcript "65"	
Adh	FGenesCGG1	CDS	471944	472490	.	+	.	transcript "65"	
Adh	FGenesCGG1	CDS	472557	472823	.	+	.	transcript "65"	
Adh	FGenesCGG1	CDS	472965	473128	.	+	.	transcript "65"	
Adh	FGenesCGG1	stop_codon	473126	473128	.	+	.	transcript "65"	
Adh	FGenesCGG1	CDS	473959	474023	.	+	.	transcript "66"	
Adh	FGenesCGG1	start_codon	473959	473961	.	+	.	transcript "66"	
Adh	FGenesCGG1	CDS	474087	474189	.	+	.	transcript "66"	
Adh	FGenesCGG1	CDS	474251	474306	.	+	.	transcript "66"	
Adh	FGenesCGG1	CDS	474365	475283	.	+	.	transcript "66"	
Adh	FGenesCGG1	CDS	475427	476389	.	+	.	transcript "66"	
Adh	FGenesCGG1	stop_codon	476387	476389	.	+	.	transcript "66"	
Adh	FGenesCGG1	CDS	477171	477490	.	-	.	transcript "67"	
Adh	FGenesCGG1	stop_codon	477171	477173	.	-	.	transcript "67"	
Adh	FGenesCGG1	CDS	477548	479329	.	-	.	transcript "67"	
Adh	FGenesCGG1	CDS	479386	479753	.	-	.	transcript "67"	
Adh	FGenesCGG1	CDS	479815	479958	.	-	.	transcript "67"	
Adh	FGenesCGG1	CDS	480016	480081	.	-	.	transcript "67"	
Adh	FGenesCGG1	CDS	480147	480287	.	-	.	transcript "67"	
Adh	FGenesCGG1	CDS	480343	480480	.	-	.	transcript "67"	
Adh	FGenesCGG1	CDS	481570	481638	.	-	.	transcript "67"	
Adh	FGenesCGG1	CDS	483386	483457	.	-	.	transcript "67"	
Adh	FGenesCGG1	CDS	483532	483603	.	-	.	transcript "67"	
Adh	FGenesCGG1	CDS	484195	484338	.	-	.	transcript "67"	
Adh	FGenesCGG1	CDS	484664	484807	.	-	.	transcript "67"	
Adh	FGenesCGG1	CDS	485391	485462	.	-	.	transcript "67"	
Adh	FGenesCGG1	CDS	486686	487236	.	-	.	transcript "67"	
Adh	FGenesCGG1	start_codon	487234	487236	.	-	.	transcript "67"	
Adh	FGenesCGG1	CDS	498520	498979	.	+	.	transcript "68"	
Adh	FGenesCGG1	start_codon	498520	498522	.	+	.	transcript "68"	
Adh	FGenesCGG1	CDS	499082	499159	.	+	.	transcript "68"	
Adh	FGenesCGG1	CDS	499280	499593	.	+	.	transcript "68"	
Adh	FGenesCGG1	stop_codon	499591	499593	.	+	.	transcript "68"	
Adh	FGenesCGG1	CDS	505505	505549	.	+	.	transcript "69"	
Adh	FGenesCGG1	start_codon	505505	505507	.	+	.	transcript "69"	
Adh	FGenesCGG1	CDS	506822	506887	.	+	.	transcript "69"	
Adh	FGenesCGG1	CDS	509536	509783	.	+	.	transcript "69"	
Adh	FGenesCGG1	CDS	509881	510226	.	+	.	transcript "69"	
Adh	FGenesCGG1	CDS	510287	510786	.	+	.	transcript "69"	
Adh	FGenesCGG1	CDS	511784	512375	.	+	.	transcript "69"	
Adh	FGenesCGG1	CDS	512435	512758	.	+	.	transcript "69"	
Adh	FGenesCGG1	stop_codon	512756	512758	.	+	.	transcript "69"	
Adh	FGenesCGG1	CDS	520781	521850	.	+	.	transcript "70"	
Adh	FGenesCGG1	start_codon	520781	520783	.	+	.	transcript "70"	
Adh	FGenesCGG1	CDS	522013	522988	.	+	.	transcript "70"	
Adh	FGenesCGG1	stop_codon	522986	522988	.	+	.	transcript "70"	
Adh	FGenesCGG1	CDS	523395	523601	.	-	.	transcript "71"	
Adh	FGenesCGG1	stop_codon	523395	523397	.	-	.	transcript "71"	
Adh	FGenesCGG1	CDS	523705	524253	.	-	.	transcript "71"	
Adh	FGenesCGG1	CDS	524438	525283	.	-	.	transcript "71"	
Adh	FGenesCGG1	start_codon	525281	525283	.	-	.	transcript "71"	
Adh	FGenesCGG1	CDS	532399	532709	.	+	.	transcript "72"	
Adh	FGenesCGG1	start_codon	532399	532401	.	+	.	transcript "72"	
Adh	FGenesCGG1	CDS	533739	534006	.	+	.	transcript "72"	
Adh	FGenesCGG1	stop_codon	534004	534006	.	+	.	transcript "72"	
Adh	FGenesCGG1	CDS	541380	542513	.	+	.	transcript "73"	
Adh	FGenesCGG1	start_codon	541380	541382	.	+	.	transcript "73"	
Adh	FGenesCGG1	stop_codon	542511	542513	.	+	.	transcript "73"	
Adh	FGenesCGG1	CDS	555360	555824	.	+	.	transcript "74"	
Adh	FGenesCGG1	start_codon	555360	555362	.	+	.	transcript "74"	
Adh	FGenesCGG1	CDS	555920	556258	.	+	.	transcript "74"	
Adh	FGenesCGG1	stop_codon	556256	556258	.	+	.	transcript "74"	
Adh	FGenesCGG1	CDS	562642	562755	.	+	.	transcript "75"	
Adh	FGenesCGG1	CDS	570329	570664	.	+	.	transcript "75"	
Adh	FGenesCGG1	CDS	570872	570947	.	+	.	transcript "75"	
Adh	FGenesCGG1	CDS	574289	574483	.	+	.	transcript "75"	
Adh	FGenesCGG1	CDS	575409	575495	.	+	.	transcript "75"	
Adh	FGenesCGG1	CDS	577207	577316	.	+	.	transcript "75"	
Adh	FGenesCGG1	CDS	581726	581877	.	+	.	transcript "75"	
Adh	FGenesCGG1	CDS	598403	598796	.	+	.	transcript "76"	
Adh	FGenesCGG1	start_codon	598403	598405	.	+	.	transcript "76"	
Adh	FGenesCGG1	CDS	598857	599119	.	+	.	transcript "76"	
Adh	FGenesCGG1	CDS	599219	600403	.	+	.	transcript "76"	
Adh	FGenesCGG1	CDS	601476	601487	.	+	.	transcript "76"	
Adh	FGenesCGG1	stop_codon	601485	601487	.	+	.	transcript "76"	
Adh	FGenesCGG1	CDS	601945	602354	.	-	.	transcript "77"	
Adh	FGenesCGG1	stop_codon	601945	601947	.	-	.	transcript "77"	
Adh	FGenesCGG1	CDS	602559	602889	.	-	.	transcript "77"	
Adh	FGenesCGG1	CDS	603886	604323	.	-	.	transcript "77"	
Adh	FGenesCGG1	CDS	607752	607819	.	-	.	transcript "77"	
Adh	FGenesCGG1	CDS	615333	615618	.	-	.	transcript "77"	
Adh	FGenesCGG1	CDS	616137	616184	.	-	.	transcript "77"	
Adh	FGenesCGG1	CDS	619451	619606	.	-	.	transcript "77"	
Adh	FGenesCGG1	CDS	619825	619938	.	-	.	transcript "77"	
Adh	FGenesCGG1	CDS	627803	627966	.	-	.	transcript "77"	
Adh	FGenesCGG1	CDS	628785	628852	.	-	.	transcript "77"	
Adh	FGenesCGG1	CDS	629799	629926	.	-	.	transcript "77"	
Adh	FGenesCGG1	start_codon	629924	629926	.	-	.	transcript "77"	
Adh	FGenesCGG1	CDS	639175	639609	.	+	.	transcript "78"	
Adh	FGenesCGG1	start_codon	639175	639177	.	+	.	transcript "78"	
Adh	FGenesCGG1	stop_codon	639607	639609	.	+	.	transcript "78"	
Adh	FGenesCGG1	CDS	649359	649372	.	+	.	transcript "79"	
Adh	FGenesCGG1	start_codon	649359	649361	.	+	.	transcript "79"	
Adh	FGenesCGG1	CDS	650568	651153	.	+	.	transcript "79"	
Adh	FGenesCGG1	CDS	651278	651478	.	+	.	transcript "79"	
Adh	FGenesCGG1	CDS	651583	652282	.	+	.	transcript "79"	
Adh	FGenesCGG1	CDS	652397	652824	.	+	.	transcript "79"	
Adh	FGenesCGG1	stop_codon	652822	652824	.	+	.	transcript "79"	
Adh	FGenesCGG1	CDS	654984	656897	.	-	.	transcript "80"	
Adh	FGenesCGG1	stop_codon	654984	654986	.	-	.	transcript "80"	
Adh	FGenesCGG1	CDS	656952	656954	.	-	.	transcript "80"	
Adh	FGenesCGG1	start_codon	656952	656954	.	-	.	transcript "80"	
Adh	FGenesCGG1	CDS	657691	658001	.	-	.	transcript "81"	
Adh	FGenesCGG1	stop_codon	657691	657693	.	-	.	transcript "81"	
Adh	FGenesCGG1	CDS	658058	658265	.	-	.	transcript "81"	
Adh	FGenesCGG1	CDS	658326	658463	.	-	.	transcript "81"	
Adh	FGenesCGG1	CDS	658526	659000	.	-	.	transcript "81"	
Adh	FGenesCGG1	CDS	659094	660852	.	-	.	transcript "81"	
Adh	FGenesCGG1	CDS	660917	661061	.	-	.	transcript "81"	
Adh	FGenesCGG1	CDS	661834	661866	.	-	.	transcript "81"	
Adh	FGenesCGG1	start_codon	661864	661866	.	-	.	transcript "81"	
Adh	FGenesCGG1	CDS	679874	680889	.	-	.	transcript "82"	
Adh	FGenesCGG1	stop_codon	679874	679876	.	-	.	transcript "82"	
Adh	FGenesCGG1	CDS	682600	682771	.	-	.	transcript "82"	
Adh	FGenesCGG1	CDS	682831	682969	.	-	.	transcript "82"	
Adh	FGenesCGG1	CDS	689469	689596	.	-	.	transcript "82"	
Adh	FGenesCGG1	CDS	689705	689746	.	-	.	transcript "82"	
Adh	FGenesCGG1	CDS	689811	689983	.	-	.	transcript "82"	
Adh	FGenesCGG1	CDS	690663	691029	.	-	.	transcript "82"	
Adh	FGenesCGG1	CDS	691393	691416	.	-	.	transcript "82"	
Adh	FGenesCGG1	start_codon	691414	691416	.	-	.	transcript "82"	
Adh	FGenesCGG1	CDS	687440	687521	.	-	.	transcript "83"	
Adh	FGenesCGG1	stop_codon	687440	687442	.	-	.	transcript "83"	
Adh	FGenesCGG1	CDS	689469	689746	.	-	.	transcript "83"	
Adh	FGenesCGG1	CDS	689811	689983	.	-	.	transcript "83"	
Adh	FGenesCGG1	CDS	690663	691029	.	-	.	transcript "83"	
Adh	FGenesCGG1	CDS	691393	691416	.	-	.	transcript "83"	
Adh	FGenesCGG1	start_codon	691414	691416	.	-	.	transcript "83"	
Adh	FGenesCGG1	CDS	749101	749175	.	+	.	transcript "84"	
Adh	FGenesCGG1	start_codon	749101	749103	.	+	.	transcript "84"	
Adh	FGenesCGG1	CDS	753465	753640	.	+	.	transcript "84"	
Adh	FGenesCGG1	CDS	755993	756089	.	+	.	transcript "84"	
Adh	FGenesCGG1	CDS	756663	756872	.	+	.	transcript "84"	
Adh	FGenesCGG1	stop_codon	756870	756872	.	+	.	transcript "84"	
Adh	FGenesCGG1	CDS	771285	771386	.	+	.	transcript "85"	
Adh	FGenesCGG1	CDS	772047	772295	.	+	.	transcript "85"	
Adh	FGenesCGG1	CDS	779692	781583	.	+	.	transcript "85"	
Adh	FGenesCGG1	CDS	781886	781966	.	+	.	transcript "85"	
Adh	FGenesCGG1	CDS	781997	782694	.	+	.	transcript "85"	
Adh	FGenesCGG1	CDS	801976	802914	.	+	.	transcript "85"	
Adh	FGenesCGG1	CDS	813291	814049	.	+	.	transcript "85"	
Adh	FGenesCGG1	CDS	814794	814981	.	+	.	transcript "85"	
Adh	FGenesCGG1	CDS	815046	815442	.	+	.	transcript "85"	
Adh	FGenesCGG1	CDS	815528	815648	.	+	.	transcript "85"	
Adh	FGenesCGG1	CDS	815697	817215	.	+	.	transcript "85"	
Adh	FGenesCGG1	CDS	817273	818025	.	+	.	transcript "85"	
Adh	FGenesCGG1	CDS	818664	819290	.	+	.	transcript "85"	
Adh	FGenesCGG1	CDS	820171	820789	.	+	.	transcript "85"	
Adh	FGenesCGG1	CDS	820846	820979	.	+	.	transcript "85"	
Adh	FGenesCGG1	CDS	821037	821265	.	+	.	transcript "85"	
Adh	FGenesCGG1	CDS	822205	822454	.	+	.	transcript "86"	
Adh	FGenesCGG1	start_codon	822205	822207	.	+	.	transcript "86"	
Adh	FGenesCGG1	CDS	822511	822848	.	+	.	transcript "86"	
Adh	FGenesCGG1	CDS	822907	824011	.	+	.	transcript "86"	
Adh	FGenesCGG1	CDS	824074	824822	.	+	.	transcript "86"	
Adh	FGenesCGG1	CDS	824885	825688	.	+	.	transcript "86"	
Adh	FGenesCGG1	CDS	825804	826423	.	+	.	transcript "86"	
Adh	FGenesCGG1	CDS	826499	826653	.	+	.	transcript "86"	
Adh	FGenesCGG1	CDS	826714	826921	.	+	.	transcript "86"	
Adh	FGenesCGG1	CDS	826980	827087	.	+	.	transcript "86"	
Adh	FGenesCGG1	CDS	827148	827511	.	+	.	transcript "86"	
Adh	FGenesCGG1	stop_codon	827509	827511	.	+	.	transcript "86"	
Adh	FGenesCGG1	CDS	832137	833672	.	+	.	transcript "87"	
Adh	FGenesCGG1	start_codon	832137	832139	.	+	.	transcript "87"	
Adh	FGenesCGG1	stop_codon	833670	833672	.	+	.	transcript "87"	
Adh	FGenesCGG1	CDS	834884	834897	.	+	.	transcript "88"	
Adh	FGenesCGG1	start_codon	834884	834886	.	+	.	transcript "88"	
Adh	FGenesCGG1	CDS	835043	835312	.	+	.	transcript "88"	
Adh	FGenesCGG1	CDS	836514	837106	.	+	.	transcript "88"	
Adh	FGenesCGG1	CDS	837173	837428	.	+	.	transcript "88"	
Adh	FGenesCGG1	CDS	837486	837859	.	+	.	transcript "88"	
Adh	FGenesCGG1	CDS	837919	838152	.	+	.	transcript "88"	
Adh	FGenesCGG1	CDS	838217	839076	.	+	.	transcript "88"	
Adh	FGenesCGG1	stop_codon	839074	839076	.	+	.	transcript "88"	
Adh	FGenesCGG1	CDS	839671	840390	.	-	.	transcript "89"	
Adh	FGenesCGG1	start_codon	840388	840390	.	-	.	transcript "89"	
Adh	FGenesCGG1	stop_codon	839671	839673	.	-	.	transcript "89"	
Adh	FGenesCGG1	CDS	841091	841333	.	-	.	transcript "90"	
Adh	FGenesCGG1	stop_codon	841091	841093	.	-	.	transcript "90"	
Adh	FGenesCGG1	CDS	841389	841969	.	-	.	transcript "90"	
Adh	FGenesCGG1	CDS	842034	842442	.	-	.	transcript "90"	
Adh	FGenesCGG1	start_codon	842440	842442	.	-	.	transcript "90"	
Adh	FGenesCGG1	CDS	842968	843375	.	-	.	transcript "91"	
Adh	FGenesCGG1	stop_codon	842968	842970	.	-	.	transcript "91"	
Adh	FGenesCGG1	CDS	843445	843518	.	-	.	transcript "91"	
Adh	FGenesCGG1	CDS	847272	847372	.	-	.	transcript "91"	
Adh	FGenesCGG1	CDS	847433	848154	.	-	.	transcript "91"	
Adh	FGenesCGG1	CDS	848208	848348	.	-	.	transcript "91"	
Adh	FGenesCGG1	start_codon	848346	848348	.	-	.	transcript "91"	
Adh	FGenesCGG1	CDS	845892	846081	.	+	.	transcript "92"	
Adh	FGenesCGG1	start_codon	845892	845894	.	+	.	transcript "92"	
Adh	FGenesCGG1	CDS	846134	846339	.	+	.	transcript "92"	
Adh	FGenesCGG1	stop_codon	846337	846339	.	+	.	transcript "92"	
Adh	FGenesCGG1	CDS	846397	847372	.	-	.	transcript "93"	
Adh	FGenesCGG1	stop_codon	846397	846399	.	-	.	transcript "93"	
Adh	FGenesCGG1	CDS	847433	848154	.	-	.	transcript "93"	
Adh	FGenesCGG1	CDS	848208	848498	.	-	.	transcript "93"	
Adh	FGenesCGG1	start_codon	848496	848498	.	-	.	transcript "93"	
Adh	FGenesCGG1	CDS	851077	851190	.	+	.	transcript "94"	
Adh	FGenesCGG1	start_codon	851077	851079	.	+	.	transcript "94"	
Adh	FGenesCGG1	CDS	851256	851436	.	+	.	transcript "94"	
Adh	FGenesCGG1	CDS	851491	851673	.	+	.	transcript "94"	
Adh	FGenesCGG1	CDS	851742	851919	.	+	.	transcript "94"	
Adh	FGenesCGG1	stop_codon	851917	851919	.	+	.	transcript "94"	
Adh	FGenesCGG1	CDS	853116	855014	.	+	.	transcript "95"	
Adh	FGenesCGG1	start_codon	853116	853118	.	+	.	transcript "95"	
Adh	FGenesCGG1	stop_codon	855012	855014	.	+	.	transcript "95"	
Adh	FGenesCGG1	CDS	856092	856876	.	+	.	transcript "96"	
Adh	FGenesCGG1	start_codon	856092	856094	.	+	.	transcript "96"	
Adh	FGenesCGG1	CDS	856942	858029	.	+	.	transcript "96"	
Adh	FGenesCGG1	CDS	858109	858341	.	+	.	transcript "96"	
Adh	FGenesCGG1	CDS	858418	858966	.	+	.	transcript "96"	
Adh	FGenesCGG1	stop_codon	858964	858966	.	+	.	transcript "96"	
Adh	FGenesCGG1	CDS	872557	872818	.	-	.	transcript "97"	
Adh	FGenesCGG1	stop_codon	872557	872559	.	-	.	transcript "97"	
Adh	FGenesCGG1	CDS	872891	873131	.	-	.	transcript "97"	
Adh	FGenesCGG1	CDS	873191	873321	.	-	.	transcript "97"	
Adh	FGenesCGG1	CDS	873388	873527	.	-	.	transcript "97"	
Adh	FGenesCGG1	CDS	873583	874093	.	-	.	transcript "97"	
Adh	FGenesCGG1	CDS	874278	874541	.	-	.	transcript "97"	
Adh	FGenesCGG1	CDS	874599	874870	.	-	.	transcript "97"	
Adh	FGenesCGG1	start_codon	874868	874870	.	-	.	transcript "97"	
Adh	FGenesCGG1	CDS	884916	885676	.	-	.	transcript "98"	
Adh	FGenesCGG1	stop_codon	884916	884918	.	-	.	transcript "98"	
Adh	FGenesCGG1	CDS	885967	886798	.	-	.	transcript "98"	
Adh	FGenesCGG1	CDS	902105	902141	.	-	.	transcript "98"	
Adh	FGenesCGG1	CDS	904085	904200	.	-	.	transcript "98"	
Adh	FGenesCGG1	start_codon	904198	904200	.	-	.	transcript "98"	
Adh	FGenesCGG1	CDS	910572	910742	.	-	.	transcript "99"	
Adh	FGenesCGG1	stop_codon	910572	910574	.	-	.	transcript "99"	
Adh	FGenesCGG1	CDS	910801	911055	.	-	.	transcript "99"	
Adh	FGenesCGG1	start_codon	911053	911055	.	-	.	transcript "99"	
Adh	FGenesCGG1	CDS	918151	918795	.	-	.	transcript "100"	
Adh	FGenesCGG1	stop_codon	918151	918153	.	-	.	transcript "100"	
Adh	FGenesCGG1	CDS	918858	918869	.	-	.	transcript "100"	
Adh	FGenesCGG1	start_codon	918867	918869	.	-	.	transcript "100"	
Adh	FGenesCGG1	CDS	944218	944529	.	-	.	transcript "101"	
Adh	FGenesCGG1	stop_codon	944218	944220	.	-	.	transcript "101"	
Adh	FGenesCGG1	CDS	944917	945163	.	-	.	transcript "101"	
Adh	FGenesCGG1	CDS	947200	947366	.	-	.	transcript "101"	
Adh	FGenesCGG1	start_codon	947364	947366	.	-	.	transcript "101"	
Adh	FGenesCGG1	CDS	961162	962655	.	-	.	transcript "102"	
Adh	FGenesCGG1	start_codon	962653	962655	.	-	.	transcript "102"	
Adh	FGenesCGG1	stop_codon	961162	961164	.	-	.	transcript "102"	
Adh	FGenesCGG1	CDS	984981	985070	.	+	.	transcript "103"	
Adh	FGenesCGG1	start_codon	984981	984983	.	+	.	transcript "103"	
Adh	FGenesCGG1	CDS	985373	986896	.	+	.	transcript "103"	
Adh	FGenesCGG1	stop_codon	986894	986896	.	+	.	transcript "103"	
Adh	FGenesCGG1	CDS	1041376	1041530	.	-	.	transcript "104"	
Adh	FGenesCGG1	stop_codon	1041376	1041378	.	-	.	transcript "104"	
Adh	FGenesCGG1	CDS	1041602	1041989	.	-	.	transcript "104"	
Adh	FGenesCGG1	CDS	1042386	1042688	.	-	.	transcript "104"	
Adh	FGenesCGG1	start_codon	1042686	1042688	.	-	.	transcript "104"	
Adh	FGenesCGG1	CDS	1056859	1057314	.	-	.	transcript "105"	
Adh	FGenesCGG1	start_codon	1057312	1057314	.	-	.	transcript "105"	
Adh	FGenesCGG1	stop_codon	1056859	1056861	.	-	.	transcript "105"	
Adh	FGenesCGG1	CDS	1063870	1064189	.	-	.	transcript "106"	
Adh	FGenesCGG1	stop_codon	1063870	1063872	.	-	.	transcript "106"	
Adh	FGenesCGG1	CDS	1064248	1064380	.	-	.	transcript "106"	
Adh	FGenesCGG1	CDS	1066071	1066136	.	-	.	transcript "106"	
Adh	FGenesCGG1	start_codon	1066134	1066136	.	-	.	transcript "106"	
Adh	FGenesCGG1	CDS	1075461	1075695	.	+	.	transcript "107"	
Adh	FGenesCGG1	start_codon	1075461	1075463	.	+	.	transcript "107"	
Adh	FGenesCGG1	CDS	1078475	1078592	.	+	.	transcript "107"	
Adh	FGenesCGG1	CDS	1079921	1080080	.	+	.	transcript "107"	
Adh	FGenesCGG1	stop_codon	1080078	1080080	.	+	.	transcript "107"	
Adh	FGenesCGG1	CDS	1083400	1083793	.	-	.	transcript "108"	
Adh	FGenesCGG1	stop_codon	1083400	1083402	.	-	.	transcript "108"	
Adh	FGenesCGG1	CDS	1084155	1084220	.	-	.	transcript "108"	
Adh	FGenesCGG1	CDS	1084268	1084890	.	-	.	transcript "108"	
Adh	FGenesCGG1	start_codon	1084888	1084890	.	-	.	transcript "108"	
Adh	FGenesCGG1	CDS	1094528	1094610	.	-	.	transcript "109"	
Adh	FGenesCGG1	stop_codon	1094528	1094530	.	-	.	transcript "109"	
Adh	FGenesCGG1	CDS	1094867	1095215	.	-	.	transcript "109"	
Adh	FGenesCGG1	CDS	1095422	1095533	.	-	.	transcript "109"	
Adh	FGenesCGG1	CDS	1095586	1095735	.	-	.	transcript "109"	
Adh	FGenesCGG1	CDS	1095848	1095987	.	-	.	transcript "109"	
Adh	FGenesCGG1	CDS	1096062	1096196	.	-	.	transcript "109"	
Adh	FGenesCGG1	CDS	1096326	1098979	.	-	.	transcript "109"	
Adh	FGenesCGG1	CDS	1100157	1100179	.	-	.	transcript "109"	
Adh	FGenesCGG1	CDS	1101376	1101526	.	-	.	transcript "109"	
Adh	FGenesCGG1	CDS	1101569	1102085	.	-	.	transcript "109"	
Adh	FGenesCGG1	CDS	1102589	1102710	.	-	.	transcript "109"	
Adh	FGenesCGG1	CDS	1102937	1103103	.	-	.	transcript "109"	
Adh	FGenesCGG1	CDS	1103581	1103641	.	-	.	transcript "109"	
Adh	FGenesCGG1	CDS	1104419	1104995	.	-	.	transcript "109"	
Adh	FGenesCGG1	CDS	1105586	1105651	.	-	.	transcript "109"	
Adh	FGenesCGG1	CDS	1106188	1106223	.	-	.	transcript "109"	
Adh	FGenesCGG1	start_codon	1106221	1106223	.	-	.	transcript "109"	
Adh	FGenesCGG1	CDS	1110074	1110172	.	+	.	transcript "110"	
Adh	FGenesCGG1	start_codon	1110074	1110076	.	+	.	transcript "110"	
Adh	FGenesCGG1	CDS	1110238	1110642	.	+	.	transcript "110"	
Adh	FGenesCGG1	CDS	1110713	1110979	.	+	.	transcript "110"	
Adh	FGenesCGG1	stop_codon	1110977	1110979	.	+	.	transcript "110"	
Adh	FGenesCGG1	CDS	1111283	1111378	.	+	.	transcript "111"	
Adh	FGenesCGG1	start_codon	1111283	1111285	.	+	.	transcript "111"	
Adh	FGenesCGG1	CDS	1111805	1112209	.	+	.	transcript "111"	
Adh	FGenesCGG1	CDS	1112261	1112578	.	+	.	transcript "111"	
Adh	FGenesCGG1	stop_codon	1112576	1112578	.	+	.	transcript "111"	
Adh	FGenesCGG1	CDS	1115807	1115987	.	+	.	transcript "112"	
Adh	FGenesCGG1	start_codon	1115807	1115809	.	+	.	transcript "112"	
Adh	FGenesCGG1	CDS	1116315	1116493	.	+	.	transcript "112"	
Adh	FGenesCGG1	stop_codon	1116491	1116493	.	+	.	transcript "112"	
Adh	FGenesCGG1	CDS	1135267	1135448	.	-	.	transcript "113"	
Adh	FGenesCGG1	stop_codon	1135267	1135269	.	-	.	transcript "113"	
Adh	FGenesCGG1	CDS	1137998	1138304	.	-	.	transcript "113"	
Adh	FGenesCGG1	CDS	1139694	1140911	.	-	.	transcript "113"	
Adh	FGenesCGG1	CDS	1141857	1142960	.	-	.	transcript "113"	
Adh	FGenesCGG1	CDS	1143657	1144044	.	-	.	transcript "113"	
Adh	FGenesCGG1	CDS	1148443	1148528	.	-	.	transcript "113"	
Adh	FGenesCGG1	CDS	1150024	1150103	.	-	.	transcript "113"	
Adh	FGenesCGG1	CDS	1153160	1153412	.	-	.	transcript "113"	
Adh	FGenesCGG1	CDS	1163535	1163787	.	-	.	transcript "113"	
Adh	FGenesCGG1	CDS	1167182	1167214	.	-	.	transcript "113"	
Adh	FGenesCGG1	CDS	1171159	1171226	.	-	.	transcript "113"	
Adh	FGenesCGG1	CDS	1173555	1173713	.	-	.	transcript "113"	
Adh	FGenesCGG1	start_codon	1173711	1173713	.	-	.	transcript "113"	
Adh	FGenesCGG1	CDS	1178228	1178412	.	-	.	transcript "114"	
Adh	FGenesCGG1	stop_codon	1178228	1178230	.	-	.	transcript "114"	
Adh	FGenesCGG1	CDS	1179474	1179556	.	-	.	transcript "114"	
Adh	FGenesCGG1	CDS	1179759	1179811	.	-	.	transcript "114"	
Adh	FGenesCGG1	start_codon	1179809	1179811	.	-	.	transcript "114"	
Adh	FGenesCGG1	CDS	1181634	1181705	.	-	.	transcript "115"	
Adh	FGenesCGG1	stop_codon	1181634	1181636	.	-	.	transcript "115"	
Adh	FGenesCGG1	CDS	1182203	1182415	.	-	.	transcript "115"	
Adh	FGenesCGG1	start_codon	1182413	1182415	.	-	.	transcript "115"	
Adh	FGenesCGG1	CDS	1206476	1206487	.	+	.	transcript "116"	
Adh	FGenesCGG1	start_codon	1206476	1206478	.	+	.	transcript "116"	
Adh	FGenesCGG1	CDS	1206559	1206786	.	+	.	transcript "116"	
Adh	FGenesCGG1	stop_codon	1206784	1206786	.	+	.	transcript "116"	
Adh	FGenesCGG1	CDS	1207563	1207574	.	+	.	transcript "117"	
Adh	FGenesCGG1	start_codon	1207563	1207565	.	+	.	transcript "117"	
Adh	FGenesCGG1	CDS	1207666	1207953	.	+	.	transcript "117"	
Adh	FGenesCGG1	stop_codon	1207951	1207953	.	+	.	transcript "117"	
Adh	FGenesCGG1	CDS	1218040	1218115	.	-	.	transcript "118"	
Adh	FGenesCGG1	stop_codon	1218040	1218042	.	-	.	transcript "118"	
Adh	FGenesCGG1	CDS	1218392	1220253	.	-	.	transcript "118"	
Adh	FGenesCGG1	CDS	1220453	1221762	.	-	.	transcript "118"	
Adh	FGenesCGG1	CDS	1221977	1222190	.	-	.	transcript "118"	
Adh	FGenesCGG1	CDS	1222250	1222395	.	-	.	transcript "118"	
Adh	FGenesCGG1	CDS	1222483	1222632	.	-	.	transcript "118"	
Adh	FGenesCGG1	CDS	1222813	1223091	.	-	.	transcript "118"	
Adh	FGenesCGG1	CDS	1223350	1223779	.	-	.	transcript "118"	
Adh	FGenesCGG1	start_codon	1223777	1223779	.	-	.	transcript "118"	
Adh	FGenesCGG1	CDS	1229684	1230733	.	+	.	transcript "119"	
Adh	FGenesCGG1	start_codon	1229684	1229686	.	+	.	transcript "119"	
Adh	FGenesCGG1	stop_codon	1230731	1230733	.	+	.	transcript "119"	
Adh	FGenesCGG1	CDS	1231127	1231384	.	-	.	transcript "120"	
Adh	FGenesCGG1	stop_codon	1231127	1231129	.	-	.	transcript "120"	
Adh	FGenesCGG1	CDS	1231452	1231463	.	-	.	transcript "120"	
Adh	FGenesCGG1	start_codon	1231461	1231463	.	-	.	transcript "120"	
Adh	FGenesCGG1	CDS	1232958	1232969	.	+	.	transcript "121"	
Adh	FGenesCGG1	start_codon	1232958	1232960	.	+	.	transcript "121"	
Adh	FGenesCGG1	CDS	1233044	1233280	.	+	.	transcript "121"	
Adh	FGenesCGG1	stop_codon	1233278	1233280	.	+	.	transcript "121"	
Adh	FGenesCGG1	CDS	1250633	1251421	.	+	.	transcript "122"	
Adh	FGenesCGG1	start_codon	1250633	1250635	.	+	.	transcript "122"	
Adh	FGenesCGG1	stop_codon	1251419	1251421	.	+	.	transcript "122"	
Adh	FGenesCGG1	CDS	1252334	1252343	.	+	.	transcript "123"	
Adh	FGenesCGG1	start_codon	1252334	1252336	.	+	.	transcript "123"	
Adh	FGenesCGG1	CDS	1252515	1253617	.	+	.	transcript "123"	
Adh	FGenesCGG1	stop_codon	1253615	1253617	.	+	.	transcript "123"	
Adh	FGenesCGG1	CDS	1255669	1256823	.	+	.	transcript "124"	
Adh	FGenesCGG1	start_codon	1255669	1255671	.	+	.	transcript "124"	
Adh	FGenesCGG1	stop_codon	1256821	1256823	.	+	.	transcript "124"	
Adh	FGenesCGG1	CDS	1263535	1264034	.	-	.	transcript "125"	
Adh	FGenesCGG1	stop_codon	1263535	1263537	.	-	.	transcript "125"	
Adh	FGenesCGG1	CDS	1264126	1264286	.	-	.	transcript "125"	
Adh	FGenesCGG1	CDS	1264559	1264638	.	-	.	transcript "125"	
Adh	FGenesCGG1	start_codon	1264636	1264638	.	-	.	transcript "125"	
Adh	FGenesCGG1	CDS	1271377	1272140	.	-	.	transcript "126"	
Adh	FGenesCGG1	stop_codon	1271377	1271379	.	-	.	transcript "126"	
Adh	FGenesCGG1	CDS	1272217	1272395	.	-	.	transcript "126"	
Adh	FGenesCGG1	CDS	1273044	1273596	.	-	.	transcript "126"	
Adh	FGenesCGG1	CDS	1273652	1273827	.	-	.	transcript "126"	
Adh	FGenesCGG1	CDS	1273891	1273936	.	-	.	transcript "126"	
Adh	FGenesCGG1	CDS	1274014	1274248	.	-	.	transcript "126"	
Adh	FGenesCGG1	start_codon	1274246	1274248	.	-	.	transcript "126"	
Adh	FGenesCGG1	CDS	1282475	1282538	.	-	.	transcript "127"	
Adh	FGenesCGG1	stop_codon	1282475	1282477	.	-	.	transcript "127"	
Adh	FGenesCGG1	CDS	1285034	1285502	.	-	.	transcript "127"	
Adh	FGenesCGG1	CDS	1285595	1285746	.	-	.	transcript "127"	
Adh	FGenesCGG1	CDS	1289477	1289536	.	-	.	transcript "127"	
Adh	FGenesCGG1	CDS	1292542	1292594	.	-	.	transcript "127"	
Adh	FGenesCGG1	start_codon	1292592	1292594	.	-	.	transcript "127"	
Adh	FGenesCGG1	CDS	1294081	1298310	.	-	.	transcript "128"	
Adh	FGenesCGG1	start_codon	1298308	1298310	.	-	.	transcript "128"	
Adh	FGenesCGG1	stop_codon	1294081	1294083	.	-	.	transcript "128"	
Adh	FGenesCGG1	CDS	1300469	1300474	.	+	.	transcript "129"	
Adh	FGenesCGG1	start_codon	1300469	1300471	.	+	.	transcript "129"	
Adh	FGenesCGG1	CDS	1300535	1302247	.	+	.	transcript "129"	
Adh	FGenesCGG1	stop_codon	1302245	1302247	.	+	.	transcript "129"	
Adh	FGenesCGG1	CDS	1319530	1319593	.	+	.	transcript "130"	
Adh	FGenesCGG1	start_codon	1319530	1319532	.	+	.	transcript "130"	
Adh	FGenesCGG1	CDS	1323042	1323154	.	+	.	transcript "130"	
Adh	FGenesCGG1	CDS	1323725	1323898	.	+	.	transcript "130"	
Adh	FGenesCGG1	stop_codon	1323896	1323898	.	+	.	transcript "130"	
Adh	FGenesCGG1	CDS	1335075	1335356	.	-	.	transcript "131"	
Adh	FGenesCGG1	stop_codon	1335075	1335077	.	-	.	transcript "131"	
Adh	FGenesCGG1	CDS	1335416	1336157	.	-	.	transcript "131"	
Adh	FGenesCGG1	CDS	1336453	1336564	.	-	.	transcript "131"	
Adh	FGenesCGG1	CDS	1337714	1337917	.	-	.	transcript "131"	
Adh	FGenesCGG1	CDS	1338337	1338640	.	-	.	transcript "131"	
Adh	FGenesCGG1	CDS	1343580	1343725	.	-	.	transcript "132"	
Adh	FGenesCGG1	stop_codon	1343580	1343582	.	-	.	transcript "132"	
Adh	FGenesCGG1	CDS	1344195	1344342	.	-	.	transcript "132"	
Adh	FGenesCGG1	CDS	1344504	1344695	.	-	.	transcript "132"	
Adh	FGenesCGG1	CDS	1344753	1344992	.	-	.	transcript "132"	
Adh	FGenesCGG1	CDS	1347642	1347653	.	-	.	transcript "132"	
Adh	FGenesCGG1	CDS	1351261	1351435	.	-	.	transcript "132"	
Adh	FGenesCGG1	CDS	1355116	1355236	.	-	.	transcript "132"	
Adh	FGenesCGG1	CDS	1356062	1356172	.	-	.	transcript "132"	
Adh	FGenesCGG1	CDS	1364345	1364530	.	-	.	transcript "133"	
Adh	FGenesCGG1	stop_codon	1364345	1364347	.	-	.	transcript "133"	
Adh	FGenesCGG1	CDS	1365170	1365361	.	-	.	transcript "133"	
Adh	FGenesCGG1	CDS	1365421	1365611	.	-	.	transcript "133"	
Adh	FGenesCGG1	CDS	1365666	1365762	.	-	.	transcript "133"	
Adh	FGenesCGG1	CDS	1367386	1367388	.	-	.	transcript "133"	
Adh	FGenesCGG1	start_codon	1367386	1367388	.	-	.	transcript "133"	
Adh	FGenesCGG1	CDS	1368948	1369282	.	-	.	transcript "134"	
Adh	FGenesCGG1	start_codon	1369280	1369282	.	-	.	transcript "134"	
Adh	FGenesCGG1	stop_codon	1368948	1368950	.	-	.	transcript "134"	
Adh	FGenesCGG1	CDS	1372017	1372351	.	-	.	transcript "135"	
Adh	FGenesCGG1	start_codon	1372349	1372351	.	-	.	transcript "135"	
Adh	FGenesCGG1	stop_codon	1372017	1372019	.	-	.	transcript "135"	
Adh	FGenesCGG1	CDS	1398183	1398833	.	-	.	transcript "136"	
Adh	FGenesCGG1	stop_codon	1398183	1398185	.	-	.	transcript "136"	
Adh	FGenesCGG1	CDS	1401633	1401874	.	-	.	transcript "136"	
Adh	FGenesCGG1	CDS	1402535	1402643	.	-	.	transcript "136"	
Adh	FGenesCGG1	CDS	1402808	1402995	.	-	.	transcript "136"	
Adh	FGenesCGG1	CDS	1403930	1404111	.	-	.	transcript "136"	
Adh	FGenesCGG1	CDS	1405762	1405903	.	-	.	transcript "136"	
Adh	FGenesCGG1	CDS	1406801	1406882	.	-	.	transcript "136"	
Adh	FGenesCGG1	CDS	1407035	1407310	.	-	.	transcript "136"	
Adh	FGenesCGG1	start_codon	1407308	1407310	.	-	.	transcript "136"	
Adh	FGenesCGG1	CDS	1410778	1410897	.	-	.	transcript "137"	
Adh	FGenesCGG1	stop_codon	1410778	1410780	.	-	.	transcript "137"	
Adh	FGenesCGG1	CDS	1411607	1411759	.	-	.	transcript "137"	
Adh	FGenesCGG1	CDS	1412611	1412741	.	-	.	transcript "137"	
Adh	FGenesCGG1	CDS	1413301	1413415	.	-	.	transcript "137"	
Adh	FGenesCGG1	CDS	1413798	1413866	.	-	.	transcript "137"	
Adh	FGenesCGG1	start_codon	1413864	1413866	.	-	.	transcript "137"	
Adh	FGenesCGG1	CDS	1414397	1415978	.	+	.	transcript "138"	
Adh	FGenesCGG1	start_codon	1414397	1414399	.	+	.	transcript "138"	
Adh	FGenesCGG1	CDS	1416078	1418081	.	+	.	transcript "138"	
Adh	FGenesCGG1	CDS	1418142	1419321	.	+	.	transcript "138"	
Adh	FGenesCGG1	CDS	1419378	1419918	.	+	.	transcript "138"	
Adh	FGenesCGG1	stop_codon	1419916	1419918	.	+	.	transcript "138"	
Adh	FGenesCGG1	CDS	1421063	1421145	.	-	.	transcript "139"	
Adh	FGenesCGG1	stop_codon	1421063	1421065	.	-	.	transcript "139"	
Adh	FGenesCGG1	CDS	1422176	1422320	.	-	.	transcript "139"	
Adh	FGenesCGG1	CDS	1424531	1424676	.	-	.	transcript "139"	
Adh	FGenesCGG1	CDS	1425549	1425752	.	-	.	transcript "139"	
Adh	FGenesCGG1	CDS	1426168	1426281	.	-	.	transcript "139"	
Adh	FGenesCGG1	CDS	1426393	1426486	.	-	.	transcript "139"	
Adh	FGenesCGG1	CDS	1428573	1428690	.	-	.	transcript "139"	
Adh	FGenesCGG1	CDS	1431180	1431306	.	-	.	transcript "139"	
Adh	FGenesCGG1	CDS	1431588	1431639	.	-	.	transcript "139"	
Adh	FGenesCGG1	start_codon	1431637	1431639	.	-	.	transcript "139"	
Adh	FGenesCGG1	CDS	1465977	1466019	.	-	.	transcript "140"	
Adh	FGenesCGG1	stop_codon	1465977	1465979	.	-	.	transcript "140"	
Adh	FGenesCGG1	CDS	1466153	1466744	.	-	.	transcript "140"	
Adh	FGenesCGG1	CDS	1466876	1467307	.	-	.	transcript "140"	
Adh	FGenesCGG1	CDS	1469796	1469805	.	-	.	transcript "140"	
Adh	FGenesCGG1	start_codon	1469803	1469805	.	-	.	transcript "140"	
Adh	FGenesCGG1	CDS	1475691	1476936	.	+	.	transcript "141"	
Adh	FGenesCGG1	start_codon	1475691	1475693	.	+	.	transcript "141"	
Adh	FGenesCGG1	CDS	1477128	1480096	.	+	.	transcript "141"	
Adh	FGenesCGG1	stop_codon	1480094	1480096	.	+	.	transcript "141"	
Adh	FGenesCGG1	CDS	1481699	1481786	.	+	.	transcript "142"	
Adh	FGenesCGG1	start_codon	1481699	1481701	.	+	.	transcript "142"	
Adh	FGenesCGG1	CDS	1487199	1487229	.	+	.	transcript "142"	
Adh	FGenesCGG1	CDS	1491484	1491589	.	+	.	transcript "142"	
Adh	FGenesCGG1	CDS	1495620	1495919	.	+	.	transcript "142"	
Adh	FGenesCGG1	CDS	1495977	1496198	.	+	.	transcript "142"	
Adh	FGenesCGG1	stop_codon	1496196	1496198	.	+	.	transcript "142"	
Adh	FGenesCGG1	CDS	1496304	1496815	.	-	.	transcript "143"	
Adh	FGenesCGG1	stop_codon	1496304	1496306	.	-	.	transcript "143"	
Adh	FGenesCGG1	CDS	1496865	1497000	.	-	.	transcript "143"	
Adh	FGenesCGG1	start_codon	1496998	1497000	.	-	.	transcript "143"	
Adh	FGenesCGG1	CDS	1497576	1498121	.	+	.	transcript "144"	
Adh	FGenesCGG1	start_codon	1497576	1497578	.	+	.	transcript "144"	
Adh	FGenesCGG1	stop_codon	1498119	1498121	.	+	.	transcript "144"	
Adh	FGenesCGG1	CDS	1498334	1499046	.	-	.	transcript "145"	
Adh	FGenesCGG1	stop_codon	1498334	1498336	.	-	.	transcript "145"	
Adh	FGenesCGG1	CDS	1499102	1499249	.	-	.	transcript "145"	
Adh	FGenesCGG1	start_codon	1499247	1499249	.	-	.	transcript "145"	
Adh	FGenesCGG1	CDS	1499670	1500797	.	+	.	transcript "146"	
Adh	FGenesCGG1	start_codon	1499670	1499672	.	+	.	transcript "146"	
Adh	FGenesCGG1	CDS	1500954	1501010	.	+	.	transcript "146"	
Adh	FGenesCGG1	stop_codon	1501008	1501010	.	+	.	transcript "146"	
Adh	FGenesCGG1	CDS	1508672	1508695	.	+	.	transcript "147"	
Adh	FGenesCGG1	start_codon	1508672	1508674	.	+	.	transcript "147"	
Adh	FGenesCGG1	CDS	1510744	1510998	.	+	.	transcript "147"	
Adh	FGenesCGG1	CDS	1511927	1511935	.	+	.	transcript "147"	
Adh	FGenesCGG1	CDS	1515041	1515175	.	+	.	transcript "147"	
Adh	FGenesCGG1	CDS	1515266	1515436	.	+	.	transcript "147"	
Adh	FGenesCGG1	CDS	1515498	1515714	.	+	.	transcript "147"	
Adh	FGenesCGG1	CDS	1515807	1515972	.	+	.	transcript "147"	
Adh	FGenesCGG1	CDS	1516036	1516279	.	+	.	transcript "147"	
Adh	FGenesCGG1	CDS	1516339	1516488	.	+	.	transcript "147"	
Adh	FGenesCGG1	CDS	1516560	1519082	.	+	.	transcript "147"	
Adh	FGenesCGG1	CDS	1519240	1519382	.	+	.	transcript "147"	
Adh	FGenesCGG1	CDS	1519441	1519564	.	+	.	transcript "147"	
Adh	FGenesCGG1	CDS	1519636	1519752	.	+	.	transcript "147"	
Adh	FGenesCGG1	CDS	1519816	1520023	.	+	.	transcript "147"	
Adh	FGenesCGG1	CDS	1520081	1520337	.	+	.	transcript "147"	
Adh	FGenesCGG1	CDS	1520398	1520535	.	+	.	transcript "147"	
Adh	FGenesCGG1	CDS	1521654	1521834	.	+	.	transcript "147"	
Adh	FGenesCGG1	CDS	1522286	1522308	.	+	.	transcript "147"	
Adh	FGenesCGG1	stop_codon	1522306	1522308	.	+	.	transcript "147"	
Adh	FGenesCGG1	CDS	1525215	1525447	.	+	.	transcript "148"	
Adh	FGenesCGG1	start_codon	1525215	1525217	.	+	.	transcript "148"	
Adh	FGenesCGG1	CDS	1526237	1526642	.	+	.	transcript "148"	
Adh	FGenesCGG1	CDS	1526702	1527379	.	+	.	transcript "148"	
Adh	FGenesCGG1	stop_codon	1527377	1527379	.	+	.	transcript "148"	
Adh	FGenesCGG1	CDS	1529588	1529971	.	+	.	transcript "149"	
Adh	FGenesCGG1	start_codon	1529588	1529590	.	+	.	transcript "149"	
Adh	FGenesCGG1	CDS	1530746	1531626	.	+	.	transcript "149"	
Adh	FGenesCGG1	CDS	1531685	1531892	.	+	.	transcript "149"	
Adh	FGenesCGG1	CDS	1531958	1532269	.	+	.	transcript "149"	
Adh	FGenesCGG1	stop_codon	1532267	1532269	.	+	.	transcript "149"	
Adh	FGenesCGG1	CDS	1535065	1535271	.	-	.	transcript "150"	
Adh	FGenesCGG1	stop_codon	1535065	1535067	.	-	.	transcript "150"	
Adh	FGenesCGG1	CDS	1535341	1535461	.	-	.	transcript "150"	
Adh	FGenesCGG1	CDS	1535530	1535628	.	-	.	transcript "150"	
Adh	FGenesCGG1	CDS	1535739	1536304	.	-	.	transcript "150"	
Adh	FGenesCGG1	CDS	1536364	1536841	.	-	.	transcript "150"	
Adh	FGenesCGG1	CDS	1536914	1537150	.	-	.	transcript "150"	
Adh	FGenesCGG1	CDS	1537212	1538662	.	-	.	transcript "150"	
Adh	FGenesCGG1	CDS	1538758	1541113	.	-	.	transcript "150"	
Adh	FGenesCGG1	CDS	1541178	1541378	.	-	.	transcript "150"	
Adh	FGenesCGG1	CDS	1541445	1541794	.	-	.	transcript "150"	
Adh	FGenesCGG1	CDS	1542125	1542385	.	-	.	transcript "150"	
Adh	FGenesCGG1	CDS	1543065	1543082	.	-	.	transcript "150"	
Adh	FGenesCGG1	start_codon	1543080	1543082	.	-	.	transcript "150"	
Adh	FGenesCGG1	CDS	1546679	1546719	.	+	.	transcript "151"	
Adh	FGenesCGG1	start_codon	1546679	1546681	.	+	.	transcript "151"	
Adh	FGenesCGG1	CDS	1547905	1548319	.	+	.	transcript "151"	
Adh	FGenesCGG1	CDS	1548383	1548538	.	+	.	transcript "151"	
Adh	FGenesCGG1	stop_codon	1548536	1548538	.	+	.	transcript "151"	
Adh	FGenesCGG1	CDS	1549142	1550017	.	-	.	transcript "152"	
Adh	FGenesCGG1	stop_codon	1549142	1549144	.	-	.	transcript "152"	
Adh	FGenesCGG1	CDS	1550084	1550149	.	-	.	transcript "152"	
Adh	FGenesCGG1	start_codon	1550147	1550149	.	-	.	transcript "152"	
Adh	FGenesCGG1	CDS	1554085	1554599	.	-	.	transcript "153"	
Adh	FGenesCGG1	stop_codon	1554085	1554087	.	-	.	transcript "153"	
Adh	FGenesCGG1	CDS	1554841	1555107	.	-	.	transcript "153"	
Adh	FGenesCGG1	CDS	1556588	1557000	.	-	.	transcript "153"	
Adh	FGenesCGG1	start_codon	1556998	1557000	.	-	.	transcript "153"	
Adh	FGenesCGG1	CDS	1558057	1558080	.	+	.	transcript "154"	
Adh	FGenesCGG1	start_codon	1558057	1558059	.	+	.	transcript "154"	
Adh	FGenesCGG1	CDS	1558134	1558521	.	+	.	transcript "154"	
Adh	FGenesCGG1	CDS	1561989	1562278	.	+	.	transcript "154"	
Adh	FGenesCGG1	CDS	1562338	1563081	.	+	.	transcript "154"	
Adh	FGenesCGG1	CDS	1563140	1563353	.	+	.	transcript "154"	
Adh	FGenesCGG1	CDS	1563418	1563689	.	+	.	transcript "154"	
Adh	FGenesCGG1	CDS	1563761	1563814	.	+	.	transcript "154"	
Adh	FGenesCGG1	stop_codon	1563812	1563814	.	+	.	transcript "154"	
Adh	FGenesCGG1	CDS	1573842	1573911	.	+	.	transcript "155"	
Adh	FGenesCGG1	start_codon	1573842	1573844	.	+	.	transcript "155"	
Adh	FGenesCGG1	CDS	1576691	1576943	.	+	.	transcript "155"	
Adh	FGenesCGG1	CDS	1577036	1577406	.	+	.	transcript "155"	
Adh	FGenesCGG1	CDS	1577568	1577860	.	+	.	transcript "155"	
Adh	FGenesCGG1	CDS	1577926	1578081	.	+	.	transcript "155"	
Adh	FGenesCGG1	CDS	1580550	1580685	.	+	.	transcript "155"	
Adh	FGenesCGG1	CDS	1580750	1580880	.	+	.	transcript "155"	
Adh	FGenesCGG1	CDS	1580928	1581227	.	+	.	transcript "155"	
Adh	FGenesCGG1	CDS	1581294	1581623	.	+	.	transcript "155"	
Adh	FGenesCGG1	CDS	1581774	1582136	.	+	.	transcript "155"	
Adh	FGenesCGG1	CDS	1582201	1582292	.	+	.	transcript "155"	
Adh	FGenesCGG1	CDS	1582550	1582687	.	+	.	transcript "155"	
Adh	FGenesCGG1	CDS	1583070	1583334	.	+	.	transcript "155"	
Adh	FGenesCGG1	CDS	1584330	1584828	.	+	.	transcript "155"	
Adh	FGenesCGG1	CDS	1584949	1585094	.	+	.	transcript "155"	
Adh	FGenesCGG1	CDS	1585153	1585380	.	+	.	transcript "155"	
Adh	FGenesCGG1	stop_codon	1585378	1585380	.	+	.	transcript "155"	
Adh	FGenesCGG1	CDS	1599218	1600177	.	+	.	transcript "156"	
Adh	FGenesCGG1	start_codon	1599218	1599220	.	+	.	transcript "156"	
Adh	FGenesCGG1	CDS	1601744	1602565	.	+	.	transcript "156"	
Adh	FGenesCGG1	stop_codon	1602563	1602565	.	+	.	transcript "156"	
Adh	FGenesCGG1	CDS	1603541	1603885	.	+	.	transcript "157"	
Adh	FGenesCGG1	start_codon	1603541	1603543	.	+	.	transcript "157"	
Adh	FGenesCGG1	CDS	1603951	1605404	.	+	.	transcript "157"	
Adh	FGenesCGG1	CDS	1605651	1606718	.	+	.	transcript "157"	
Adh	FGenesCGG1	CDS	1606791	1607142	.	+	.	transcript "157"	
Adh	FGenesCGG1	CDS	1607205	1607306	.	+	.	transcript "157"	
Adh	FGenesCGG1	stop_codon	1607304	1607306	.	+	.	transcript "157"	
Adh	FGenesCGG1	CDS	1611614	1611677	.	+	.	transcript "158"	
Adh	FGenesCGG1	start_codon	1611614	1611616	.	+	.	transcript "158"	
Adh	FGenesCGG1	CDS	1611815	1612014	.	+	.	transcript "158"	
Adh	FGenesCGG1	CDS	1613840	1613968	.	+	.	transcript "158"	
Adh	FGenesCGG1	CDS	1617734	1617814	.	+	.	transcript "158"	
Adh	FGenesCGG1	CDS	1618309	1618392	.	+	.	transcript "158"	
Adh	FGenesCGG1	stop_codon	1618390	1618392	.	+	.	transcript "158"	
Adh	FGenesCGG1	CDS	1628213	1628396	.	-	.	transcript "159"	
Adh	FGenesCGG1	stop_codon	1628213	1628215	.	-	.	transcript "159"	
Adh	FGenesCGG1	CDS	1630152	1630237	.	-	.	transcript "159"	
Adh	FGenesCGG1	CDS	1638281	1638355	.	-	.	transcript "159"	
Adh	FGenesCGG1	start_codon	1638353	1638355	.	-	.	transcript "159"	
Adh	FGenesCGG1	CDS	1653232	1653414	.	-	.	transcript "160"	
Adh	FGenesCGG1	stop_codon	1653232	1653234	.	-	.	transcript "160"	
Adh	FGenesCGG1	CDS	1653857	1657133	.	-	.	transcript "160"	
Adh	FGenesCGG1	CDS	1657232	1657342	.	-	.	transcript "160"	
Adh	FGenesCGG1	CDS	1661045	1661189	.	-	.	transcript "160"	
Adh	FGenesCGG1	CDS	1661787	1662009	.	-	.	transcript "160"	
Adh	FGenesCGG1	start_codon	1662007	1662009	.	-	.	transcript "160"	
Adh	FGenesCGG1	CDS	1718580	1718725	.	-	.	transcript "161"	
Adh	FGenesCGG1	stop_codon	1718580	1718582	.	-	.	transcript "161"	
Adh	FGenesCGG1	CDS	1719195	1719342	.	-	.	transcript "161"	
Adh	FGenesCGG1	CDS	1719504	1719695	.	-	.	transcript "161"	
Adh	FGenesCGG1	CDS	1719753	1719992	.	-	.	transcript "161"	
Adh	FGenesCGG1	CDS	1722642	1722653	.	-	.	transcript "161"	
Adh	FGenesCGG1	CDS	1726261	1726435	.	-	.	transcript "161"	
Adh	FGenesCGG1	CDS	1730116	1730236	.	-	.	transcript "161"	
Adh	FGenesCGG1	CDS	1731062	1731125	.	-	.	transcript "161"	
Adh	FGenesCGG1	CDS	1739099	1739187	.	-	.	transcript "161"	
Adh	FGenesCGG1	CDS	1738791	1739218	.	+	.	transcript "162"	
Adh	FGenesCGG1	start_codon	1738791	1738793	.	+	.	transcript "162"	
Adh	FGenesCGG1	CDS	1740300	1740540	.	+	.	transcript "162"	
Adh	FGenesCGG1	CDS	1740659	1740939	.	+	.	transcript "162"	
Adh	FGenesCGG1	CDS	1740995	1742042	.	+	.	transcript "162"	
Adh	FGenesCGG1	CDS	1742104	1742446	.	+	.	transcript "162"	
Adh	FGenesCGG1	CDS	1742886	1743193	.	+	.	transcript "162"	
Adh	FGenesCGG1	stop_codon	1743191	1743193	.	+	.	transcript "162"	
Adh	FGenesCGG1	CDS	1744620	1745915	.	-	.	transcript "163"	
Adh	FGenesCGG1	start_codon	1745913	1745915	.	-	.	transcript "163"	
Adh	FGenesCGG1	stop_codon	1744620	1744622	.	-	.	transcript "163"	
Adh	FGenesCGG1	CDS	1746303	1746349	.	+	.	transcript "164"	
Adh	FGenesCGG1	start_codon	1746303	1746305	.	+	.	transcript "164"	
Adh	FGenesCGG1	CDS	1746401	1746842	.	+	.	transcript "164"	
Adh	FGenesCGG1	stop_codon	1746840	1746842	.	+	.	transcript "164"	
Adh	FGenesCGG1	CDS	1747065	1747238	.	-	.	transcript "165"	
Adh	FGenesCGG1	stop_codon	1747065	1747067	.	-	.	transcript "165"	
Adh	FGenesCGG1	CDS	1747451	1747682	.	-	.	transcript "165"	
Adh	FGenesCGG1	CDS	1747825	1748093	.	-	.	transcript "165"	
Adh	FGenesCGG1	CDS	1748156	1748337	.	-	.	transcript "165"	
Adh	FGenesCGG1	CDS	1748434	1748590	.	-	.	transcript "165"	
Adh	FGenesCGG1	CDS	1748785	1748943	.	-	.	transcript "165"	
Adh	FGenesCGG1	CDS	1751370	1751492	.	-	.	transcript "165"	
Adh	FGenesCGG1	CDS	1751564	1751652	.	-	.	transcript "165"	
Adh	FGenesCGG1	CDS	1751722	1751956	.	-	.	transcript "165"	
Adh	FGenesCGG1	CDS	1752027	1752278	.	-	.	transcript "165"	
Adh	FGenesCGG1	CDS	1752622	1752780	.	-	.	transcript "165"	
Adh	FGenesCGG1	CDS	1752984	1753316	.	-	.	transcript "165"	
Adh	FGenesCGG1	CDS	1753422	1753778	.	-	.	transcript "165"	
Adh	FGenesCGG1	start_codon	1753776	1753778	.	-	.	transcript "165"	
Adh	FGenesCGG1	CDS	1756026	1756178	.	-	.	transcript "166"	
Adh	FGenesCGG1	stop_codon	1756026	1756028	.	-	.	transcript "166"	
Adh	FGenesCGG1	CDS	1756248	1756386	.	-	.	transcript "166"	
Adh	FGenesCGG1	CDS	1756448	1756671	.	-	.	transcript "166"	
Adh	FGenesCGG1	CDS	1756797	1756876	.	-	.	transcript "166"	
Adh	FGenesCGG1	CDS	1757005	1757119	.	-	.	transcript "166"	
Adh	FGenesCGG1	CDS	1757182	1757352	.	-	.	transcript "166"	
Adh	FGenesCGG1	CDS	1757415	1757585	.	-	.	transcript "166"	
Adh	FGenesCGG1	CDS	1757648	1758409	.	-	.	transcript "166"	
Adh	FGenesCGG1	CDS	1758473	1758856	.	-	.	transcript "166"	
Adh	FGenesCGG1	CDS	1760557	1760616	.	-	.	transcript "166"	
Adh	FGenesCGG1	start_codon	1760614	1760616	.	-	.	transcript "166"	
Adh	FGenesCGG1	CDS	1763921	1764042	.	-	.	transcript "167"	
Adh	FGenesCGG1	stop_codon	1763921	1763923	.	-	.	transcript "167"	
Adh	FGenesCGG1	CDS	1764272	1764501	.	-	.	transcript "167"	
Adh	FGenesCGG1	CDS	1764574	1764638	.	-	.	transcript "167"	
Adh	FGenesCGG1	start_codon	1764636	1764638	.	-	.	transcript "167"	
Adh	FGenesCGG1	CDS	1772171	1772258	.	+	.	transcript "168"	
Adh	FGenesCGG1	start_codon	1772171	1772173	.	+	.	transcript "168"	
Adh	FGenesCGG1	CDS	1772478	1772741	.	+	.	transcript "168"	
Adh	FGenesCGG1	CDS	1774740	1775557	.	+	.	transcript "168"	
Adh	FGenesCGG1	stop_codon	1775555	1775557	.	+	.	transcript "168"	
Adh	FGenesCGG1	CDS	1780341	1780496	.	-	.	transcript "169"	
Adh	FGenesCGG1	stop_codon	1780341	1780343	.	-	.	transcript "169"	
Adh	FGenesCGG1	CDS	1781148	1781825	.	-	.	transcript "169"	
Adh	FGenesCGG1	start_codon	1781823	1781825	.	-	.	transcript "169"	
Adh	FGenesCGG1	CDS	1780341	1780519	.	-	.	transcript "170"	
Adh	FGenesCGG1	stop_codon	1780341	1780343	.	-	.	transcript "170"	
Adh	FGenesCGG1	CDS	1783610	1783696	.	-	.	transcript "170"	
Adh	FGenesCGG1	CDS	1784926	1785019	.	-	.	transcript "170"	
Adh	FGenesCGG1	start_codon	1785017	1785019	.	-	.	transcript "170"	
Adh	FGenesCGG1	CDS	1782285	1782330	.	+	.	transcript "171"	
Adh	FGenesCGG1	start_codon	1782285	1782287	.	+	.	transcript "171"	
Adh	FGenesCGG1	CDS	1782459	1782598	.	+	.	transcript "171"	
Adh	FGenesCGG1	CDS	1782661	1782799	.	+	.	transcript "171"	
Adh	FGenesCGG1	CDS	1782943	1783262	.	+	.	transcript "171"	
Adh	FGenesCGG1	stop_codon	1783260	1783262	.	+	.	transcript "171"	
Adh	FGenesCGG1	CDS	1785624	1785811	.	-	.	transcript "172"	
Adh	FGenesCGG1	stop_codon	1785624	1785626	.	-	.	transcript "172"	
Adh	FGenesCGG1	CDS	1786132	1786291	.	-	.	transcript "172"	
Adh	FGenesCGG1	CDS	1786326	1786409	.	-	.	transcript "172"	
Adh	FGenesCGG1	start_codon	1786407	1786409	.	-	.	transcript "172"	
Adh	FGenesCGG1	CDS	1787599	1788915	.	+	.	transcript "173"	
Adh	FGenesCGG1	start_codon	1787599	1787601	.	+	.	transcript "173"	
Adh	FGenesCGG1	stop_codon	1788913	1788915	.	+	.	transcript "173"	
Adh	FGenesCGG1	CDS	1807761	1808476	.	-	.	transcript "174"	
Adh	FGenesCGG1	stop_codon	1807761	1807763	.	-	.	transcript "174"	
Adh	FGenesCGG1	CDS	1808796	1808930	.	-	.	transcript "174"	
Adh	FGenesCGG1	CDS	1809495	1809558	.	-	.	transcript "174"	
Adh	FGenesCGG1	start_codon	1809556	1809558	.	-	.	transcript "174"	
Adh	FGenesCGG1	CDS	1810719	1811121	.	-	.	transcript "175"	
Adh	FGenesCGG1	stop_codon	1810719	1810721	.	-	.	transcript "175"	
Adh	FGenesCGG1	CDS	1811467	1811600	.	-	.	transcript "175"	
Adh	FGenesCGG1	start_codon	1811598	1811600	.	-	.	transcript "175"	
Adh	FGenesCGG1	CDS	1814984	1815052	.	+	.	transcript "176"	
Adh	FGenesCGG1	start_codon	1814984	1814986	.	+	.	transcript "176"	
Adh	FGenesCGG1	CDS	1815620	1815746	.	+	.	transcript "176"	
Adh	FGenesCGG1	CDS	1816239	1816307	.	+	.	transcript "176"	
Adh	FGenesCGG1	CDS	1818085	1818200	.	+	.	transcript "176"	
Adh	FGenesCGG1	CDS	1819380	1819522	.	+	.	transcript "176"	
Adh	FGenesCGG1	CDS	1820451	1820571	.	+	.	transcript "176"	
Adh	FGenesCGG1	stop_codon	1820569	1820571	.	+	.	transcript "176"	
Adh	FGenesCGG1	CDS	1823746	1825158	.	+	.	transcript "177"	
Adh	FGenesCGG1	start_codon	1823746	1823748	.	+	.	transcript "177"	
Adh	FGenesCGG1	stop_codon	1825156	1825158	.	+	.	transcript "177"	
Adh	FGenesCGG1	CDS	1833450	1833866	.	-	.	transcript "178"	
Adh	FGenesCGG1	stop_codon	1833450	1833452	.	-	.	transcript "178"	
Adh	FGenesCGG1	CDS	1833976	1834113	.	-	.	transcript "178"	
Adh	FGenesCGG1	start_codon	1834111	1834113	.	-	.	transcript "178"	
Adh	FGenesCGG1	CDS	1836751	1837287	.	-	.	transcript "179"	
Adh	FGenesCGG1	start_codon	1837285	1837287	.	-	.	transcript "179"	
Adh	FGenesCGG1	stop_codon	1836751	1836753	.	-	.	transcript "179"	
Adh	FGenesCGG1	CDS	1850650	1851240	.	-	.	transcript "180"	
Adh	FGenesCGG1	start_codon	1851238	1851240	.	-	.	transcript "180"	
Adh	FGenesCGG1	stop_codon	1850650	1850652	.	-	.	transcript "180"	
Adh	FGenesCGG1	CDS	1866720	1867213	.	+	.	transcript "181"	
Adh	FGenesCGG1	start_codon	1866720	1866722	.	+	.	transcript "181"	
Adh	FGenesCGG1	CDS	1869230	1869458	.	+	.	transcript "181"	
Adh	FGenesCGG1	CDS	1869590	1869714	.	+	.	transcript "181"	
Adh	FGenesCGG1	CDS	1871587	1871681	.	+	.	transcript "181"	
Adh	FGenesCGG1	CDS	1872202	1872347	.	+	.	transcript "181"	
Adh	FGenesCGG1	stop_codon	1872345	1872347	.	+	.	transcript "181"	
Adh	FGenesCGG1	CDS	1873004	1873304	.	-	.	transcript "182"	
Adh	FGenesCGG1	stop_codon	1873004	1873006	.	-	.	transcript "182"	
Adh	FGenesCGG1	CDS	1876024	1876403	.	-	.	transcript "182"	
Adh	FGenesCGG1	start_codon	1876401	1876403	.	-	.	transcript "182"	
Adh	FGenesCGG1	CDS	1879375	1879449	.	-	.	transcript "183"	
Adh	FGenesCGG1	stop_codon	1879375	1879377	.	-	.	transcript "183"	
Adh	FGenesCGG1	CDS	1879965	1880082	.	-	.	transcript "183"	
Adh	FGenesCGG1	CDS	1881544	1881812	.	-	.	transcript "183"	
Adh	FGenesCGG1	start_codon	1881810	1881812	.	-	.	transcript "183"	
Adh	FGenesCGG1	CDS	1884141	1884464	.	-	.	transcript "184"	
Adh	FGenesCGG1	stop_codon	1884141	1884143	.	-	.	transcript "184"	
Adh	FGenesCGG1	CDS	1885049	1885144	.	-	.	transcript "184"	
Adh	FGenesCGG1	CDS	1885417	1885599	.	-	.	transcript "184"	
Adh	FGenesCGG1	CDS	1886301	1886582	.	-	.	transcript "184"	
Adh	FGenesCGG1	CDS	1886761	1886886	.	-	.	transcript "184"	
Adh	FGenesCGG1	CDS	1887889	1887960	.	-	.	transcript "184"	
Adh	FGenesCGG1	start_codon	1887958	1887960	.	-	.	transcript "184"	
Adh	FGenesCGG1	CDS	1913374	1914932	.	-	.	transcript "185"	
Adh	FGenesCGG1	stop_codon	1913374	1913376	.	-	.	transcript "185"	
Adh	FGenesCGG1	CDS	1914995	1915082	.	-	.	transcript "185"	
Adh	FGenesCGG1	start_codon	1915080	1915082	.	-	.	transcript "185"	
Adh	FGenesCGG1	CDS	1923241	1924563	.	+	.	transcript "186"	
Adh	FGenesCGG1	start_codon	1923241	1923243	.	+	.	transcript "186"	
Adh	FGenesCGG1	stop_codon	1924561	1924563	.	+	.	transcript "186"	
Adh	FGenesCGG1	CDS	1936713	1936794	.	+	.	transcript "187"	
Adh	FGenesCGG1	start_codon	1936713	1936715	.	+	.	transcript "187"	
Adh	FGenesCGG1	CDS	1937906	1938118	.	+	.	transcript "187"	
Adh	FGenesCGG1	CDS	1938530	1938757	.	+	.	transcript "187"	
Adh	FGenesCGG1	CDS	1939045	1939772	.	+	.	transcript "187"	
Adh	FGenesCGG1	CDS	1939851	1942443	.	+	.	transcript "187"	
Adh	FGenesCGG1	CDS	1947070	1947197	.	+	.	transcript "187"	
Adh	FGenesCGG1	CDS	1951467	1951544	.	+	.	transcript "187"	
Adh	FGenesCGG1	stop_codon	1951542	1951544	.	+	.	transcript "187"	
Adh	FGenesCGG1	CDS	1960747	1960855	.	+	.	transcript "188"	
Adh	FGenesCGG1	start_codon	1960747	1960749	.	+	.	transcript "188"	
Adh	FGenesCGG1	CDS	1962476	1962516	.	+	.	transcript "188"	
Adh	FGenesCGG1	CDS	1962612	1962978	.	+	.	transcript "188"	
Adh	FGenesCGG1	CDS	1963353	1963651	.	+	.	transcript "188"	
Adh	FGenesCGG1	stop_codon	1963649	1963651	.	+	.	transcript "188"	
Adh	FGenesCGG1	CDS	1966586	1967758	.	-	.	transcript "189"	
Adh	FGenesCGG1	start_codon	1967756	1967758	.	-	.	transcript "189"	
Adh	FGenesCGG1	stop_codon	1966586	1966588	.	-	.	transcript "189"	
Adh	FGenesCGG1	CDS	1974488	1975018	.	+	.	transcript "190"	
Adh	FGenesCGG1	start_codon	1974488	1974490	.	+	.	transcript "190"	
Adh	FGenesCGG1	stop_codon	1975016	1975018	.	+	.	transcript "190"	
Adh	FGenesCGG1	CDS	1975782	1976154	.	+	.	transcript "191"	
Adh	FGenesCGG1	start_codon	1975782	1975784	.	+	.	transcript "191"	
Adh	FGenesCGG1	CDS	1976787	1976905	.	+	.	transcript "191"	
Adh	FGenesCGG1	stop_codon	1976903	1976905	.	+	.	transcript "191"	
Adh	FGenesCGG1	CDS	1988872	1989075	.	+	.	transcript "192"	
Adh	FGenesCGG1	start_codon	1988872	1988874	.	+	.	transcript "192"	
Adh	FGenesCGG1	CDS	1991768	1992877	.	+	.	transcript "192"	
Adh	FGenesCGG1	CDS	1992942	1993204	.	+	.	transcript "192"	
Adh	FGenesCGG1	CDS	1993350	1993566	.	+	.	transcript "192"	
Adh	FGenesCGG1	stop_codon	1993564	1993566	.	+	.	transcript "192"	
Adh	FGenesCGG1	CDS	2040123	2040280	.	+	.	transcript "193"	
Adh	FGenesCGG1	start_codon	2040123	2040125	.	+	.	transcript "193"	
Adh	FGenesCGG1	CDS	2040432	2040689	.	+	.	transcript "193"	
Adh	FGenesCGG1	CDS	2046730	2046916	.	+	.	transcript "193"	
Adh	FGenesCGG1	stop_codon	2046914	2046916	.	+	.	transcript "193"	
Adh	FGenesCGG1	CDS	2059194	2059847	.	-	.	transcript "194"	
Adh	FGenesCGG1	start_codon	2059845	2059847	.	-	.	transcript "194"	
Adh	FGenesCGG1	stop_codon	2059194	2059196	.	-	.	transcript "194"	
Adh	FGenesCGG1	CDS	2060482	2060539	.	-	.	transcript "195"	
Adh	FGenesCGG1	stop_codon	2060482	2060484	.	-	.	transcript "195"	
Adh	FGenesCGG1	CDS	2067212	2067288	.	-	.	transcript "195"	
Adh	FGenesCGG1	start_codon	2067286	2067288	.	-	.	transcript "195"	
Adh	FGenesCGG1	CDS	2068604	2070501	.	+	.	transcript "196"	
Adh	FGenesCGG1	start_codon	2068604	2068606	.	+	.	transcript "196"	
Adh	FGenesCGG1	CDS	2071510	2072677	.	+	.	transcript "196"	
Adh	FGenesCGG1	stop_codon	2072675	2072677	.	+	.	transcript "196"	
Adh	FGenesCGG1	CDS	2076918	2078162	.	+	.	transcript "197"	
Adh	FGenesCGG1	start_codon	2076918	2076920	.	+	.	transcript "197"	
Adh	FGenesCGG1	stop_codon	2078160	2078162	.	+	.	transcript "197"	
Adh	FGenesCGG1	CDS	2078140	2081293	.	+	.	transcript "198"	
Adh	FGenesCGG1	start_codon	2078140	2078142	.	+	.	transcript "198"	
Adh	FGenesCGG1	stop_codon	2081291	2081293	.	+	.	transcript "198"	
Adh	FGenesCGG1	CDS	2100551	2101358	.	-	.	transcript "199"	
Adh	FGenesCGG1	stop_codon	2100551	2100553	.	-	.	transcript "199"	
Adh	FGenesCGG1	CDS	2102194	2102639	.	-	.	transcript "199"	
Adh	FGenesCGG1	start_codon	2102637	2102639	.	-	.	transcript "199"	
Adh	FGenesCGG1	CDS	2103622	2104169	.	-	.	transcript "200"	
Adh	FGenesCGG1	stop_codon	2103622	2103624	.	-	.	transcript "200"	
Adh	FGenesCGG1	CDS	2104226	2104442	.	-	.	transcript "200"	
Adh	FGenesCGG1	start_codon	2104440	2104442	.	-	.	transcript "200"	
Adh	FGenesCGG1	CDS	2105170	2105720	.	-	.	transcript "201"	
Adh	FGenesCGG1	stop_codon	2105170	2105172	.	-	.	transcript "201"	
Adh	FGenesCGG1	CDS	2105774	2105984	.	-	.	transcript "201"	
Adh	FGenesCGG1	start_codon	2105982	2105984	.	-	.	transcript "201"	
Adh	FGenesCGG1	CDS	2105170	2105720	.	-	.	transcript "202"	
Adh	FGenesCGG1	stop_codon	2105170	2105172	.	-	.	transcript "202"	
Adh	FGenesCGG1	CDS	2105774	2105867	.	-	.	transcript "202"	
Adh	FGenesCGG1	start_codon	2105865	2105867	.	-	.	transcript "202"	
Adh	FGenesCGG1	CDS	2106653	2106860	.	+	.	transcript "203"	
Adh	FGenesCGG1	start_codon	2106653	2106655	.	+	.	transcript "203"	
Adh	FGenesCGG1	CDS	2106931	2107445	.	+	.	transcript "203"	
Adh	FGenesCGG1	stop_codon	2107443	2107445	.	+	.	transcript "203"	
Adh	FGenesCGG1	CDS	2108831	2108938	.	-	.	transcript "204"	
Adh	FGenesCGG1	stop_codon	2108831	2108833	.	-	.	transcript "204"	
Adh	FGenesCGG1	CDS	2111897	2112079	.	-	.	transcript "204"	
Adh	FGenesCGG1	CDS	2112133	2112228	.	-	.	transcript "204"	
Adh	FGenesCGG1	CDS	2112328	2112843	.	-	.	transcript "204"	
Adh	FGenesCGG1	CDS	2117185	2117211	.	-	.	transcript "204"	
Adh	FGenesCGG1	start_codon	2117209	2117211	.	-	.	transcript "204"	
Adh	FGenesCGG1	CDS	2118335	2118551	.	+	.	transcript "205"	
Adh	FGenesCGG1	start_codon	2118335	2118337	.	+	.	transcript "205"	
Adh	FGenesCGG1	CDS	2118614	2119161	.	+	.	transcript "205"	
Adh	FGenesCGG1	stop_codon	2119159	2119161	.	+	.	transcript "205"	
Adh	FGenesCGG1	CDS	2119874	2120025	.	+	.	transcript "206"	
Adh	FGenesCGG1	start_codon	2119874	2119876	.	+	.	transcript "206"	
Adh	FGenesCGG1	CDS	2120092	2120194	.	+	.	transcript "206"	
Adh	FGenesCGG1	CDS	2120312	2121269	.	+	.	transcript "206"	
Adh	FGenesCGG1	CDS	2121336	2121745	.	+	.	transcript "206"	
Adh	FGenesCGG1	stop_codon	2121743	2121745	.	+	.	transcript "206"	
Adh	FGenesCGG1	CDS	2137486	2137679	.	-	.	transcript "207"	
Adh	FGenesCGG1	stop_codon	2137486	2137488	.	-	.	transcript "207"	
Adh	FGenesCGG1	CDS	2137746	2137902	.	-	.	transcript "207"	
Adh	FGenesCGG1	CDS	2137961	2138116	.	-	.	transcript "207"	
Adh	FGenesCGG1	CDS	2138186	2138671	.	-	.	transcript "207"	
Adh	FGenesCGG1	CDS	2138733	2138994	.	-	.	transcript "207"	
Adh	FGenesCGG1	CDS	2139065	2139169	.	-	.	transcript "207"	
Adh	FGenesCGG1	CDS	2139824	2140056	.	-	.	transcript "207"	
Adh	FGenesCGG1	CDS	2140148	2140353	.	-	.	transcript "207"	
Adh	FGenesCGG1	CDS	2140417	2140630	.	-	.	transcript "207"	
Adh	FGenesCGG1	CDS	2140705	2141412	.	-	.	transcript "207"	
Adh	FGenesCGG1	CDS	2141468	2141749	.	-	.	transcript "207"	
Adh	FGenesCGG1	CDS	2141998	2142471	.	-	.	transcript "207"	
Adh	FGenesCGG1	CDS	2142732	2142776	.	-	.	transcript "207"	
Adh	FGenesCGG1	start_codon	2142774	2142776	.	-	.	transcript "207"	
Adh	FGenesCGG1	CDS	2148959	2148986	.	+	.	transcript "208"	
Adh	FGenesCGG1	start_codon	2148959	2148961	.	+	.	transcript "208"	
Adh	FGenesCGG1	CDS	2149314	2149510	.	+	.	transcript "208"	
Adh	FGenesCGG1	CDS	2149741	2150907	.	+	.	transcript "208"	
Adh	FGenesCGG1	stop_codon	2150905	2150907	.	+	.	transcript "208"	
Adh	FGenesCGG1	CDS	2151008	2151505	.	-	.	transcript "209"	
Adh	FGenesCGG1	stop_codon	2151008	2151010	.	-	.	transcript "209"	
Adh	FGenesCGG1	CDS	2151821	2151931	.	-	.	transcript "209"	
Adh	FGenesCGG1	CDS	2152628	2152651	.	-	.	transcript "209"	
Adh	FGenesCGG1	start_codon	2152649	2152651	.	-	.	transcript "209"	
Adh	FGenesCGG1	CDS	2154299	2154363	.	+	.	transcript "210"	
Adh	FGenesCGG1	start_codon	2154299	2154301	.	+	.	transcript "210"	
Adh	FGenesCGG1	CDS	2158289	2158329	.	+	.	transcript "210"	
Adh	FGenesCGG1	CDS	2158655	2159356	.	+	.	transcript "210"	
Adh	FGenesCGG1	CDS	2159581	2159642	.	+	.	transcript "210"	
Adh	FGenesCGG1	stop_codon	2159640	2159642	.	+	.	transcript "210"	
Adh	FGenesCGG1	CDS	2163892	2164261	.	-	.	transcript "211"	
Adh	FGenesCGG1	stop_codon	2163892	2163894	.	-	.	transcript "211"	
Adh	FGenesCGG1	CDS	2167365	2167477	.	-	.	transcript "211"	
Adh	FGenesCGG1	start_codon	2167475	2167477	.	-	.	transcript "211"	
Adh	FGenesCGG1	CDS	2174093	2177290	.	+	.	transcript "212"	
Adh	FGenesCGG1	start_codon	2174093	2174095	.	+	.	transcript "212"	
Adh	FGenesCGG1	stop_codon	2177288	2177290	.	+	.	transcript "212"	
Adh	FGenesCGG1	CDS	2180707	2180982	.	-	.	transcript "213"	
Adh	FGenesCGG1	stop_codon	2180707	2180709	.	-	.	transcript "213"	
Adh	FGenesCGG1	CDS	2181100	2181325	.	-	.	transcript "213"	
Adh	FGenesCGG1	CDS	2181392	2182662	.	-	.	transcript "213"	
Adh	FGenesCGG1	CDS	2182828	2182863	.	-	.	transcript "213"	
Adh	FGenesCGG1	start_codon	2182861	2182863	.	-	.	transcript "213"	
Adh	FGenesCGG1	CDS	2182500	2182662	.	-	.	transcript "214"	
Adh	FGenesCGG1	stop_codon	2182500	2182502	.	-	.	transcript "214"	
Adh	FGenesCGG1	CDS	2189454	2189790	.	-	.	transcript "214"	
Adh	FGenesCGG1	CDS	2192598	2192617	.	-	.	transcript "214"	
Adh	FGenesCGG1	start_codon	2192615	2192617	.	-	.	transcript "214"	
Adh	FGenesCGG1	CDS	2201531	2201677	.	-	.	transcript "215"	
Adh	FGenesCGG1	stop_codon	2201531	2201533	.	-	.	transcript "215"	
Adh	FGenesCGG1	CDS	2202376	2202477	.	-	.	transcript "215"	
Adh	FGenesCGG1	CDS	2202548	2202802	.	-	.	transcript "215"	
Adh	FGenesCGG1	start_codon	2202800	2202802	.	-	.	transcript "215"	
Adh	FGenesCGG1	CDS	2204183	2205278	.	+	.	transcript "216"	
Adh	FGenesCGG1	start_codon	2204183	2204185	.	+	.	transcript "216"	
Adh	FGenesCGG1	CDS	2205332	2207403	.	+	.	transcript "216"	
Adh	FGenesCGG1	stop_codon	2207401	2207403	.	+	.	transcript "216"	
Adh	FGenesCGG1	CDS	2208922	2209531	.	-	.	transcript "217"	
Adh	FGenesCGG1	stop_codon	2208922	2208924	.	-	.	transcript "217"	
Adh	FGenesCGG1	CDS	2209593	2209904	.	-	.	transcript "217"	
Adh	FGenesCGG1	CDS	2209967	2211186	.	-	.	transcript "217"	
Adh	FGenesCGG1	CDS	2211243	2211671	.	-	.	transcript "217"	
Adh	FGenesCGG1	CDS	2212036	2212168	.	-	.	transcript "217"	
Adh	FGenesCGG1	CDS	2212228	2212400	.	-	.	transcript "217"	
Adh	FGenesCGG1	start_codon	2212398	2212400	.	-	.	transcript "217"	
Adh	FGenesCGG1	CDS	2216202	2216561	.	+	.	transcript "218"	
Adh	FGenesCGG1	start_codon	2216202	2216204	.	+	.	transcript "218"	
Adh	FGenesCGG1	CDS	2216609	2217034	.	+	.	transcript "218"	
Adh	FGenesCGG1	CDS	2217099	2217403	.	+	.	transcript "218"	
Adh	FGenesCGG1	CDS	2217501	2217537	.	+	.	transcript "218"	
Adh	FGenesCGG1	stop_codon	2217535	2217537	.	+	.	transcript "218"	
Adh	FGenesCGG1	CDS	2218461	2218494	.	-	.	transcript "219"	
Adh	FGenesCGG1	stop_codon	2218461	2218463	.	-	.	transcript "219"	
Adh	FGenesCGG1	CDS	2218559	2218905	.	-	.	transcript "219"	
Adh	FGenesCGG1	CDS	2218966	2219871	.	-	.	transcript "219"	
Adh	FGenesCGG1	CDS	2219932	2220057	.	-	.	transcript "219"	
Adh	FGenesCGG1	start_codon	2220055	2220057	.	-	.	transcript "219"	
Adh	FGenesCGG1	CDS	2220565	2222197	.	-	.	transcript "220"	
Adh	FGenesCGG1	stop_codon	2220565	2220567	.	-	.	transcript "220"	
Adh	FGenesCGG1	CDS	2222257	2222379	.	-	.	transcript "220"	
Adh	FGenesCGG1	CDS	2222435	2222667	.	-	.	transcript "220"	
Adh	FGenesCGG1	CDS	2222723	2222818	.	-	.	transcript "220"	
Adh	FGenesCGG1	CDS	2223403	2223531	.	-	.	transcript "220"	
Adh	FGenesCGG1	CDS	2223874	2223936	.	-	.	transcript "220"	
Adh	FGenesCGG1	start_codon	2223934	2223936	.	-	.	transcript "220"	
Adh	FGenesCGG1	CDS	2236081	2241876	.	+	.	transcript "221"	
Adh	FGenesCGG1	start_codon	2236081	2236083	.	+	.	transcript "221"	
Adh	FGenesCGG1	stop_codon	2241874	2241876	.	+	.	transcript "221"	
Adh	FGenesCGG1	CDS	2263166	2263696	.	-	.	transcript "222"	
Adh	FGenesCGG1	stop_codon	2263166	2263168	.	-	.	transcript "222"	
Adh	FGenesCGG1	CDS	2263755	2263955	.	-	.	transcript "222"	
Adh	FGenesCGG1	start_codon	2263953	2263955	.	-	.	transcript "222"	
Adh	FGenesCGG1	CDS	2264594	2264686	.	+	.	transcript "223"	
Adh	FGenesCGG1	start_codon	2264594	2264596	.	+	.	transcript "223"	
Adh	FGenesCGG1	CDS	2270793	2270949	.	+	.	transcript "223"	
Adh	FGenesCGG1	CDS	2280575	2281032	.	+	.	transcript "223"	
Adh	FGenesCGG1	stop_codon	2281030	2281032	.	+	.	transcript "223"	
Adh	FGenesCGG1	CDS	2284485	2284627	.	-	.	transcript "224"	
Adh	FGenesCGG1	stop_codon	2284485	2284487	.	-	.	transcript "224"	
Adh	FGenesCGG1	CDS	2286518	2287433	.	-	.	transcript "224"	
Adh	FGenesCGG1	start_codon	2287431	2287433	.	-	.	transcript "224"	
Adh	FGenesCGG1	CDS	2303372	2303375	.	+	.	transcript "225"	
Adh	FGenesCGG1	start_codon	2303372	2303374	.	+	.	transcript "225"	
Adh	FGenesCGG1	CDS	2303428	2304641	.	+	.	transcript "225"	
Adh	FGenesCGG1	stop_codon	2304639	2304641	.	+	.	transcript "225"	
Adh	FGenesCGG1	CDS	2305038	2305397	.	+	.	transcript "226"	
Adh	FGenesCGG1	start_codon	2305038	2305040	.	+	.	transcript "226"	
Adh	FGenesCGG1	CDS	2305489	2305763	.	+	.	transcript "226"	
Adh	FGenesCGG1	CDS	2305829	2306951	.	+	.	transcript "226"	
Adh	FGenesCGG1	stop_codon	2306949	2306951	.	+	.	transcript "226"	
Adh	FGenesCGG1	CDS	2315767	2315925	.	-	.	transcript "227"	
Adh	FGenesCGG1	stop_codon	2315767	2315769	.	-	.	transcript "227"	
Adh	FGenesCGG1	CDS	2315991	2316098	.	-	.	transcript "227"	
Adh	FGenesCGG1	start_codon	2316096	2316098	.	-	.	transcript "227"	
Adh	FGenesCGG1	CDS	2328290	2328403	.	-	.	transcript "228"	
Adh	FGenesCGG1	stop_codon	2328290	2328292	.	-	.	transcript "228"	
Adh	FGenesCGG1	CDS	2328611	2329967	.	-	.	transcript "228"	
Adh	FGenesCGG1	CDS	2330026	2330181	.	-	.	transcript "228"	
Adh	FGenesCGG1	CDS	2330235	2330353	.	-	.	transcript "228"	
Adh	FGenesCGG1	CDS	2331101	2331310	.	-	.	transcript "228"	
Adh	FGenesCGG1	start_codon	2331308	2331310	.	-	.	transcript "228"	
Adh	FGenesCGG1	CDS	2333538	2333675	.	-	.	transcript "229"	
Adh	FGenesCGG1	stop_codon	2333538	2333540	.	-	.	transcript "229"	
Adh	FGenesCGG1	CDS	2333741	2333848	.	-	.	transcript "229"	
Adh	FGenesCGG1	start_codon	2333846	2333848	.	-	.	transcript "229"	
Adh	FGenesCGG1	CDS	2339377	2340420	.	-	.	transcript "230"	
Adh	FGenesCGG1	stop_codon	2339377	2339379	.	-	.	transcript "230"	
Adh	FGenesCGG1	CDS	2340535	2341630	.	-	.	transcript "230"	
Adh	FGenesCGG1	CDS	2341682	2341790	.	-	.	transcript "230"	
Adh	FGenesCGG1	CDS	2341855	2341911	.	-	.	transcript "230"	
Adh	FGenesCGG1	CDS	2341973	2341993	.	-	.	transcript "230"	
Adh	FGenesCGG1	CDS	2342049	2342274	.	-	.	transcript "230"	
Adh	FGenesCGG1	CDS	2342341	2342602	.	-	.	transcript "230"	
Adh	FGenesCGG1	CDS	2342664	2343851	.	-	.	transcript "230"	
Adh	FGenesCGG1	CDS	2344801	2344922	.	-	.	transcript "230"	
Adh	FGenesCGG1	CDS	2345026	2345085	.	-	.	transcript "230"	
Adh	FGenesCGG1	start_codon	2345083	2345085	.	-	.	transcript "230"	
Adh	FGenesCGG1	CDS	2347047	2347323	.	+	.	transcript "231"	
Adh	FGenesCGG1	start_codon	2347047	2347049	.	+	.	transcript "231"	
Adh	FGenesCGG1	CDS	2347420	2347676	.	+	.	transcript "231"	
Adh	FGenesCGG1	stop_codon	2347674	2347676	.	+	.	transcript "231"	
Adh	FGenesCGG1	CDS	2349595	2349890	.	-	.	transcript "232"	
Adh	FGenesCGG1	stop_codon	2349595	2349597	.	-	.	transcript "232"	
Adh	FGenesCGG1	CDS	2349968	2350879	.	-	.	transcript "232"	
Adh	FGenesCGG1	CDS	2351363	2351376	.	-	.	transcript "232"	
Adh	FGenesCGG1	CDS	2351765	2352026	.	-	.	transcript "232"	
Adh	FGenesCGG1	CDS	2352080	2353053	.	-	.	transcript "232"	
Adh	FGenesCGG1	CDS	2353442	2353506	.	-	.	transcript "232"	
Adh	FGenesCGG1	start_codon	2353504	2353506	.	-	.	transcript "232"	
Adh	FGenesCGG1	CDS	2356352	2356488	.	-	.	transcript "233"	
Adh	FGenesCGG1	stop_codon	2356352	2356354	.	-	.	transcript "233"	
Adh	FGenesCGG1	CDS	2356993	2357164	.	-	.	transcript "233"	
Adh	FGenesCGG1	CDS	2357224	2357495	.	-	.	transcript "233"	
Adh	FGenesCGG1	CDS	2357539	2357674	.	-	.	transcript "233"	
Adh	FGenesCGG1	CDS	2358742	2358953	.	-	.	transcript "233"	
Adh	FGenesCGG1	CDS	2359791	2359824	.	-	.	transcript "233"	
Adh	FGenesCGG1	start_codon	2359822	2359824	.	-	.	transcript "233"	
Adh	FGenesCGG1	CDS	2366992	2366996	.	+	.	transcript "234"	
Adh	FGenesCGG1	start_codon	2366992	2366994	.	+	.	transcript "234"	
Adh	FGenesCGG1	CDS	2367795	2368068	.	+	.	transcript "234"	
Adh	FGenesCGG1	stop_codon	2368066	2368068	.	+	.	transcript "234"	
Adh	FGenesCGG1	CDS	2374085	2374324	.	+	.	transcript "235"	
Adh	FGenesCGG1	start_codon	2374085	2374087	.	+	.	transcript "235"	
Adh	FGenesCGG1	CDS	2374356	2376636	.	+	.	transcript "235"	
Adh	FGenesCGG1	CDS	2376903	2376916	.	+	.	transcript "235"	
Adh	FGenesCGG1	stop_codon	2376914	2376916	.	+	.	transcript "235"	
Adh	FGenesCGG1	CDS	2391676	2391819	.	+	.	transcript "236"	
Adh	FGenesCGG1	start_codon	2391676	2391678	.	+	.	transcript "236"	
Adh	FGenesCGG1	CDS	2392136	2392737	.	+	.	transcript "236"	
Adh	FGenesCGG1	CDS	2392800	2393095	.	+	.	transcript "236"	
Adh	FGenesCGG1	CDS	2393155	2393360	.	+	.	transcript "236"	
Adh	FGenesCGG1	stop_codon	2393358	2393360	.	+	.	transcript "236"	
Adh	FGenesCGG1	CDS	2400780	2400843	.	+	.	transcript "237"	
Adh	FGenesCGG1	start_codon	2400780	2400782	.	+	.	transcript "237"	
Adh	FGenesCGG1	CDS	2402303	2402354	.	+	.	transcript "237"	
Adh	FGenesCGG1	CDS	2407292	2407393	.	+	.	transcript "237"	
Adh	FGenesCGG1	CDS	2407456	2407845	.	+	.	transcript "237"	
Adh	FGenesCGG1	CDS	2407960	2408288	.	+	.	transcript "237"	
Adh	FGenesCGG1	CDS	2408358	2408611	.	+	.	transcript "237"	
Adh	FGenesCGG1	stop_codon	2408609	2408611	.	+	.	transcript "237"	
Adh	FGenesCGG1	CDS	2428833	2429381	.	+	.	transcript "238"	
Adh	FGenesCGG1	start_codon	2428833	2428835	.	+	.	transcript "238"	
Adh	FGenesCGG1	stop_codon	2429379	2429381	.	+	.	transcript "238"	
Adh	FGenesCGG1	CDS	2449548	2449879	.	-	.	transcript "239"	
Adh	FGenesCGG1	stop_codon	2449548	2449550	.	-	.	transcript "239"	
Adh	FGenesCGG1	CDS	2452399	2452705	.	-	.	transcript "239"	
Adh	FGenesCGG1	start_codon	2452703	2452705	.	-	.	transcript "239"	
Adh	FGenesCGG1	CDS	2453955	2454115	.	+	.	transcript "240"	
Adh	FGenesCGG1	start_codon	2453955	2453957	.	+	.	transcript "240"	
Adh	FGenesCGG1	CDS	2454348	2454498	.	+	.	transcript "240"	
Adh	FGenesCGG1	stop_codon	2454496	2454498	.	+	.	transcript "240"	
Adh	FGenesCGG1	CDS	2480542	2480707	.	+	.	transcript "241"	
Adh	FGenesCGG1	start_codon	2480542	2480544	.	+	.	transcript "241"	
Adh	FGenesCGG1	CDS	2481639	2481850	.	+	.	transcript "241"	
Adh	FGenesCGG1	CDS	2483447	2483582	.	+	.	transcript "241"	
Adh	FGenesCGG1	CDS	2483839	2483972	.	+	.	transcript "241"	
Adh	FGenesCGG1	CDS	2484693	2484860	.	+	.	transcript "241"	
Adh	FGenesCGG1	CDS	2486400	2486522	.	+	.	transcript "241"	
Adh	FGenesCGG1	CDS	2486596	2486785	.	+	.	transcript "241"	
Adh	FGenesCGG1	CDS	2488134	2488789	.	+	.	transcript "241"	
Adh	FGenesCGG1	stop_codon	2488787	2488789	.	+	.	transcript "241"	
Adh	FGenesCGG1	CDS	2493314	2493620	.	+	.	transcript "242"	
Adh	FGenesCGG1	start_codon	2493314	2493316	.	+	.	transcript "242"	
Adh	FGenesCGG1	CDS	2493682	2493731	.	+	.	transcript "242"	
Adh	FGenesCGG1	CDS	2494047	2494116	.	+	.	transcript "242"	
Adh	FGenesCGG1	CDS	2494180	2494259	.	+	.	transcript "242"	
Adh	FGenesCGG1	CDS	2494325	2494651	.	+	.	transcript "242"	
Adh	FGenesCGG1	CDS	2495100	2495225	.	+	.	transcript "242"	
Adh	FGenesCGG1	CDS	2495286	2495667	.	+	.	transcript "242"	
Adh	FGenesCGG1	CDS	2495861	2496988	.	+	.	transcript "242"	
Adh	FGenesCGG1	CDS	2497217	2497464	.	+	.	transcript "242"	
Adh	FGenesCGG1	stop_codon	2497462	2497464	.	+	.	transcript "242"	
Adh	FGenesCGG1	CDS	2505534	2505597	.	+	.	transcript "243"	
Adh	FGenesCGG1	start_codon	2505534	2505536	.	+	.	transcript "243"	
Adh	FGenesCGG1	CDS	2524357	2524565	.	+	.	transcript "243"	
Adh	FGenesCGG1	CDS	2525929	2526064	.	+	.	transcript "243"	
Adh	FGenesCGG1	CDS	2527415	2527548	.	+	.	transcript "243"	
Adh	FGenesCGG1	CDS	2529073	2529195	.	+	.	transcript "243"	
Adh	FGenesCGG1	CDS	2529260	2529455	.	+	.	transcript "243"	
Adh	FGenesCGG1	CDS	2529735	2530156	.	+	.	transcript "243"	
Adh	FGenesCGG1	stop_codon	2530154	2530156	.	+	.	transcript "243"	
Adh	FGenesCGG1	CDS	2544295	2545124	.	+	.	transcript "244"	
Adh	FGenesCGG1	start_codon	2544295	2544297	.	+	.	transcript "244"	
Adh	FGenesCGG1	CDS	2545309	2545387	.	+	.	transcript "244"	
Adh	FGenesCGG1	stop_codon	2545385	2545387	.	+	.	transcript "244"	
Adh	FGenesCGG1	CDS	2582975	2583547	.	+	.	transcript "245"	
Adh	FGenesCGG1	start_codon	2582975	2582977	.	+	.	transcript "245"	
Adh	FGenesCGG1	stop_codon	2583545	2583547	.	+	.	transcript "245"	
Adh	FGenesCGG1	CDS	2584077	2584353	.	-	.	transcript "246"	
Adh	FGenesCGG1	stop_codon	2584077	2584079	.	-	.	transcript "246"	
Adh	FGenesCGG1	CDS	2584421	2584453	.	-	.	transcript "246"	
Adh	FGenesCGG1	CDS	2585086	2585177	.	-	.	transcript "246"	
Adh	FGenesCGG1	start_codon	2585175	2585177	.	-	.	transcript "246"	
Adh	FGenesCGG1	CDS	2590910	2591237	.	+	.	transcript "247"	
Adh	FGenesCGG1	start_codon	2590910	2590912	.	+	.	transcript "247"	
Adh	FGenesCGG1	CDS	2591682	2592084	.	+	.	transcript "247"	
Adh	FGenesCGG1	CDS	2594131	2594140	.	+	.	transcript "247"	
Adh	FGenesCGG1	stop_codon	2594138	2594140	.	+	.	transcript "247"	
Adh	FGenesCGG1	CDS	2595467	2595538	.	-	.	transcript "248"	
Adh	FGenesCGG1	stop_codon	2595467	2595469	.	-	.	transcript "248"	
Adh	FGenesCGG1	CDS	2597248	2597299	.	-	.	transcript "248"	
Adh	FGenesCGG1	CDS	2597822	2598057	.	-	.	transcript "248"	
Adh	FGenesCGG1	start_codon	2598055	2598057	.	-	.	transcript "248"	
Adh	FGenesCGG1	CDS	2604868	2607939	.	-	.	transcript "249"	
Adh	FGenesCGG1	start_codon	2607937	2607939	.	-	.	transcript "249"	
Adh	FGenesCGG1	stop_codon	2604868	2604870	.	-	.	transcript "249"	
Adh	FGenesCGG1	CDS	2607999	2609243	.	-	.	transcript "250"	
Adh	FGenesCGG1	start_codon	2609241	2609243	.	-	.	transcript "250"	
Adh	FGenesCGG1	stop_codon	2607999	2608001	.	-	.	transcript "250"	
Adh	FGenesCGG1	CDS	2609738	2609955	.	-	.	transcript "251"	
Adh	FGenesCGG1	stop_codon	2609738	2609740	.	-	.	transcript "251"	
Adh	FGenesCGG1	CDS	2610787	2610919	.	-	.	transcript "251"	
Adh	FGenesCGG1	start_codon	2610917	2610919	.	-	.	transcript "251"	
Adh	FGenesCGG1	CDS	2619967	2620307	.	+	.	transcript "252"	
Adh	FGenesCGG1	start_codon	2619967	2619969	.	+	.	transcript "252"	
Adh	FGenesCGG1	CDS	2621231	2622507	.	+	.	transcript "252"	
Adh	FGenesCGG1	CDS	2622578	2622803	.	+	.	transcript "252"	
Adh	FGenesCGG1	CDS	2622977	2623082	.	+	.	transcript "252"	
Adh	FGenesCGG1	CDS	2623709	2623781	.	+	.	transcript "252"	
Adh	FGenesCGG1	CDS	2624114	2624266	.	+	.	transcript "252"	
Adh	FGenesCGG1	CDS	2624694	2624875	.	+	.	transcript "252"	
Adh	FGenesCGG1	CDS	2624976	2625495	.	+	.	transcript "252"	
Adh	FGenesCGG1	CDS	2625559	2625784	.	+	.	transcript "252"	
Adh	FGenesCGG1	CDS	2625851	2626052	.	+	.	transcript "252"	
Adh	FGenesCGG1	CDS	2626124	2626333	.	+	.	transcript "252"	
Adh	FGenesCGG1	CDS	2626392	2626510	.	+	.	transcript "252"	
Adh	FGenesCGG1	CDS	2626595	2626653	.	+	.	transcript "252"	
Adh	FGenesCGG1	CDS	2627634	2627751	.	+	.	transcript "252"	
Adh	FGenesCGG1	CDS	2628166	2628295	.	+	.	transcript "252"	
Adh	FGenesCGG1	CDS	2628460	2628626	.	+	.	transcript "252"	
Adh	FGenesCGG1	CDS	2628718	2628805	.	+	.	transcript "252"	
Adh	FGenesCGG1	CDS	2629398	2629505	.	+	.	transcript "252"	
Adh	FGenesCGG1	CDS	2632038	2632090	.	+	.	transcript "252"	
Adh	FGenesCGG1	CDS	2632152	2632298	.	+	.	transcript "252"	
Adh	FGenesCGG1	CDS	2632363	2632834	.	+	.	transcript "252"	
Adh	FGenesCGG1	CDS	2632889	2632972	.	+	.	transcript "252"	
Adh	FGenesCGG1	CDS	2633028	2633093	.	+	.	transcript "252"	
Adh	FGenesCGG1	CDS	2633149	2633337	.	+	.	transcript "252"	
Adh	FGenesCGG1	CDS	2633397	2633645	.	+	.	transcript "252"	
Adh	FGenesCGG1	CDS	2633706	2634365	.	+	.	transcript "252"	
Adh	FGenesCGG1	CDS	2634452	2634885	.	+	.	transcript "252"	
Adh	FGenesCGG1	CDS	2635370	2635410	.	+	.	transcript "252"	
Adh	FGenesCGG1	CDS	2638284	2638414	.	+	.	transcript "252"	
Adh	FGenesCGG1	CDS	2638470	2639006	.	+	.	transcript "252"	
Adh	FGenesCGG1	stop_codon	2639004	2639006	.	+	.	transcript "252"	
Adh	FGenesCGG1	CDS	2654023	2654334	.	-	.	transcript "253"	
Adh	FGenesCGG1	stop_codon	2654023	2654025	.	-	.	transcript "253"	
Adh	FGenesCGG1	CDS	2654553	2654831	.	-	.	transcript "253"	
Adh	FGenesCGG1	CDS	2655328	2655375	.	-	.	transcript "253"	
Adh	FGenesCGG1	CDS	2657978	2658090	.	-	.	transcript "253"	
Adh	FGenesCGG1	CDS	2658302	2658374	.	-	.	transcript "253"	
Adh	FGenesCGG1	start_codon	2658372	2658374	.	-	.	transcript "253"	
Adh	FGenesCGG1	CDS	2681334	2681494	.	+	.	transcript "254"	
Adh	FGenesCGG1	start_codon	2681334	2681336	.	+	.	transcript "254"	
Adh	FGenesCGG1	CDS	2684880	2686209	.	+	.	transcript "254"	
Adh	FGenesCGG1	CDS	2686394	2686570	.	+	.	transcript "254"	
Adh	FGenesCGG1	CDS	2686628	2686705	.	+	.	transcript "254"	
Adh	FGenesCGG1	CDS	2686770	2687146	.	+	.	transcript "254"	
Adh	FGenesCGG1	CDS	2687211	2687359	.	+	.	transcript "254"	
Adh	FGenesCGG1	CDS	2687415	2687920	.	+	.	transcript "254"	
Adh	FGenesCGG1	CDS	2687988	2688230	.	+	.	transcript "254"	
Adh	FGenesCGG1	CDS	2688302	2688395	.	+	.	transcript "254"	
Adh	FGenesCGG1	CDS	2688462	2688883	.	+	.	transcript "254"	
Adh	FGenesCGG1	CDS	2689073	2689183	.	+	.	transcript "254"	
Adh	FGenesCGG1	stop_codon	2689181	2689183	.	+	.	transcript "254"	
Adh	FGenesCGG1	CDS	2691341	2694259	.	+	.	transcript "255"	
Adh	FGenesCGG1	start_codon	2691341	2691343	.	+	.	transcript "255"	
Adh	FGenesCGG1	stop_codon	2694257	2694259	.	+	.	transcript "255"	
Adh	FGenesCGG1	CDS	2696335	2696446	.	-	.	transcript "256"	
Adh	FGenesCGG1	stop_codon	2696335	2696337	.	-	.	transcript "256"	
Adh	FGenesCGG1	CDS	2696513	2696701	.	-	.	transcript "256"	
Adh	FGenesCGG1	CDS	2697862	2698028	.	-	.	transcript "256"	
Adh	FGenesCGG1	CDS	2698091	2698210	.	-	.	transcript "256"	
Adh	FGenesCGG1	start_codon	2698208	2698210	.	-	.	transcript "256"	
Adh	FGenesCGG1	CDS	2707374	2707439	.	+	.	transcript "257"	
Adh	FGenesCGG1	start_codon	2707374	2707376	.	+	.	transcript "257"	
Adh	FGenesCGG1	CDS	2707509	2708522	.	+	.	transcript "257"	
Adh	FGenesCGG1	stop_codon	2708520	2708522	.	+	.	transcript "257"	
Adh	FGenesCGG1	CDS	2709485	2710765	.	-	.	transcript "258"	
Adh	FGenesCGG1	start_codon	2710763	2710765	.	-	.	transcript "258"	
Adh	FGenesCGG1	stop_codon	2709485	2709487	.	-	.	transcript "258"	
Adh	FGenesCGG1	CDS	2711460	2711538	.	+	.	transcript "259"	
Adh	FGenesCGG1	start_codon	2711460	2711462	.	+	.	transcript "259"	
Adh	FGenesCGG1	CDS	2711599	2711717	.	+	.	transcript "259"	
Adh	FGenesCGG1	CDS	2711781	2711853	.	+	.	transcript "259"	
Adh	FGenesCGG1	CDS	2711910	2712440	.	+	.	transcript "259"	
Adh	FGenesCGG1	CDS	2712522	2712646	.	+	.	transcript "259"	
Adh	FGenesCGG1	stop_codon	2712644	2712646	.	+	.	transcript "259"	
Adh	FGenesCGG1	CDS	2714781	2716277	.	-	.	transcript "260"	
Adh	FGenesCGG1	stop_codon	2714781	2714783	.	-	.	transcript "260"	
Adh	FGenesCGG1	CDS	2716683	2716697	.	-	.	transcript "260"	
Adh	FGenesCGG1	start_codon	2716695	2716697	.	-	.	transcript "260"	
Adh	FGenesCGG1	CDS	2725026	2725040	.	-	.	transcript "261"	
Adh	FGenesCGG1	stop_codon	2725026	2725028	.	-	.	transcript "261"	
Adh	FGenesCGG1	CDS	2728123	2728429	.	-	.	transcript "261"	
Adh	FGenesCGG1	CDS	2736358	2736449	.	-	.	transcript "261"	
Adh	FGenesCGG1	start_codon	2736447	2736449	.	-	.	transcript "261"	
Adh	FGenesCGG1	CDS	2737704	2737731	.	+	.	transcript "262"	
Adh	FGenesCGG1	start_codon	2737704	2737706	.	+	.	transcript "262"	
Adh	FGenesCGG1	CDS	2737860	2738132	.	+	.	transcript "262"	
Adh	FGenesCGG1	CDS	2738403	2739461	.	+	.	transcript "262"	
Adh	FGenesCGG1	CDS	2739531	2740039	.	+	.	transcript "262"	
Adh	FGenesCGG1	stop_codon	2740037	2740039	.	+	.	transcript "262"	
Adh	FGenesCGG1	CDS	2741387	2741990	.	-	.	transcript "263"	
Adh	FGenesCGG1	stop_codon	2741387	2741389	.	-	.	transcript "263"	
Adh	FGenesCGG1	CDS	2742220	2742230	.	-	.	transcript "263"	
Adh	FGenesCGG1	start_codon	2742228	2742230	.	-	.	transcript "263"	
Adh	FGenesCGG1	CDS	2743611	2745122	.	+	.	transcript "264"	
Adh	FGenesCGG1	start_codon	2743611	2743613	.	+	.	transcript "264"	
Adh	FGenesCGG1	stop_codon	2745120	2745122	.	+	.	transcript "264"	
Adh	FGenesCGG1	CDS	2746815	2747453	.	-	.	transcript "265"	
Adh	FGenesCGG1	stop_codon	2746815	2746817	.	-	.	transcript "265"	
Adh	FGenesCGG1	CDS	2748132	2748572	.	-	.	transcript "265"	
Adh	FGenesCGG1	start_codon	2748570	2748572	.	-	.	transcript "265"	
Adh	FGenesCGG1	CDS	2750059	2750868	.	+	.	transcript "266"	
Adh	FGenesCGG1	start_codon	2750059	2750061	.	+	.	transcript "266"	
Adh	FGenesCGG1	stop_codon	2750866	2750868	.	+	.	transcript "266"	
Adh	FGenesCGG1	CDS	2751337	2751465	.	-	.	transcript "267"	
Adh	FGenesCGG1	stop_codon	2751337	2751339	.	-	.	transcript "267"	
Adh	FGenesCGG1	CDS	2751521	2751711	.	-	.	transcript "267"	
Adh	FGenesCGG1	CDS	2751778	2751871	.	-	.	transcript "267"	
Adh	FGenesCGG1	CDS	2752031	2752033	.	-	.	transcript "267"	
Adh	FGenesCGG1	start_codon	2752031	2752033	.	-	.	transcript "267"	
Adh	FGenesCGG1	CDS	2752612	2752742	.	+	.	transcript "268"	
Adh	FGenesCGG1	start_codon	2752612	2752614	.	+	.	transcript "268"	
Adh	FGenesCGG1	CDS	2752822	2752985	.	+	.	transcript "268"	
Adh	FGenesCGG1	CDS	2753042	2753322	.	+	.	transcript "268"	
Adh	FGenesCGG1	CDS	2753382	2753565	.	+	.	transcript "268"	
Adh	FGenesCGG1	CDS	2753620	2754004	.	+	.	transcript "268"	
Adh	FGenesCGG1	CDS	2754057	2754364	.	+	.	transcript "268"	
Adh	FGenesCGG1	CDS	2754423	2754557	.	+	.	transcript "268"	
Adh	FGenesCGG1	CDS	2754615	2754739	.	+	.	transcript "268"	
Adh	FGenesCGG1	stop_codon	2754737	2754739	.	+	.	transcript "268"	
Adh	FGenesCGG1	CDS	2755219	2755580	.	-	.	transcript "269"	
Adh	FGenesCGG1	stop_codon	2755219	2755221	.	-	.	transcript "269"	
Adh	FGenesCGG1	CDS	2755775	2755883	.	-	.	transcript "269"	
Adh	FGenesCGG1	CDS	2755954	2756092	.	-	.	transcript "269"	
Adh	FGenesCGG1	CDS	2756201	2756274	.	-	.	transcript "269"	
Adh	FGenesCGG1	start_codon	2756272	2756274	.	-	.	transcript "269"	
Adh	FGenesCGG1	CDS	2757391	2757589	.	+	.	transcript "270"	
Adh	FGenesCGG1	start_codon	2757391	2757393	.	+	.	transcript "270"	
Adh	FGenesCGG1	CDS	2757658	2758391	.	+	.	transcript "270"	
Adh	FGenesCGG1	stop_codon	2758389	2758391	.	+	.	transcript "270"	
Adh	FGenesCGG1	CDS	2759163	2759190	.	-	.	transcript "271"	
Adh	FGenesCGG1	stop_codon	2759163	2759165	.	-	.	transcript "271"	
Adh	FGenesCGG1	CDS	2759260	2759403	.	-	.	transcript "271"	
Adh	FGenesCGG1	CDS	2759527	2759639	.	-	.	transcript "271"	
Adh	FGenesCGG1	CDS	2759701	2759850	.	-	.	transcript "271"	
Adh	FGenesCGG1	start_codon	2759848	2759850	.	-	.	transcript "271"	
Adh	FGenesCGG1	CDS	2760361	2760672	.	+	.	transcript "272"	
Adh	FGenesCGG1	start_codon	2760361	2760363	.	+	.	transcript "272"	
Adh	FGenesCGG1	CDS	2760766	2761087	.	+	.	transcript "272"	
Adh	FGenesCGG1	CDS	2761141	2762087	.	+	.	transcript "272"	
Adh	FGenesCGG1	stop_codon	2762085	2762087	.	+	.	transcript "272"	
Adh	FGenesCGG1	CDS	2762639	2762710	.	-	.	transcript "273"	
Adh	FGenesCGG1	stop_codon	2762639	2762641	.	-	.	transcript "273"	
Adh	FGenesCGG1	CDS	2763711	2763968	.	-	.	transcript "273"	
Adh	FGenesCGG1	CDS	2764030	2764118	.	-	.	transcript "273"	
Adh	FGenesCGG1	CDS	2772220	2772430	.	-	.	transcript "273"	
Adh	FGenesCGG1	CDS	2772600	2772777	.	-	.	transcript "273"	
Adh	FGenesCGG1	CDS	2773593	2774287	.	-	.	transcript "273"	
Adh	FGenesCGG1	start_codon	2774285	2774287	.	-	.	transcript "273"	
Adh	FGenesCGG1	CDS	2790007	2791503	.	-	.	transcript "274"	
Adh	FGenesCGG1	start_codon	2791501	2791503	.	-	.	transcript "274"	
Adh	FGenesCGG1	stop_codon	2790007	2790009	.	-	.	transcript "274"	
Adh	FGenesCGG1	CDS	2791866	2792011	.	-	.	transcript "275"	
Adh	FGenesCGG1	stop_codon	2791866	2791868	.	-	.	transcript "275"	
Adh	FGenesCGG1	CDS	2792082	2792601	.	-	.	transcript "275"	
Adh	FGenesCGG1	start_codon	2792599	2792601	.	-	.	transcript "275"	
Adh	FGenesCGG1	CDS	2793626	2798713	.	-	.	transcript "276"	
Adh	FGenesCGG1	start_codon	2798711	2798713	.	-	.	transcript "276"	
Adh	FGenesCGG1	stop_codon	2793626	2793628	.	-	.	transcript "276"	
Adh	FGenesCGG1	CDS	2802355	2802394	.	+	.	transcript "277"	
Adh	FGenesCGG1	start_codon	2802355	2802357	.	+	.	transcript "277"	
Adh	FGenesCGG1	CDS	2802443	2802813	.	+	.	transcript "277"	
Adh	FGenesCGG1	stop_codon	2802811	2802813	.	+	.	transcript "277"	
Adh	FGenesCGG1	CDS	2804442	2805730	.	-	.	transcript "278"	
Adh	FGenesCGG1	stop_codon	2804442	2804444	.	-	.	transcript "278"	
Adh	FGenesCGG1	CDS	2805800	2805812	.	-	.	transcript "278"	
Adh	FGenesCGG1	start_codon	2805810	2805812	.	-	.	transcript "278"	
Adh	FGenesCGG1	CDS	2815178	2815829	.	+	.	transcript "279"	
Adh	FGenesCGG1	start_codon	2815178	2815180	.	+	.	transcript "279"	
Adh	FGenesCGG1	CDS	2815894	2816135	.	+	.	transcript "279"	
Adh	FGenesCGG1	stop_codon	2816133	2816135	.	+	.	transcript "279"	
Adh	FGenesCGG1	CDS	2825682	2825833	.	-	.	transcript "280"	
Adh	FGenesCGG1	stop_codon	2825682	2825684	.	-	.	transcript "280"	
Adh	FGenesCGG1	CDS	2829004	2829191	.	-	.	transcript "280"	
Adh	FGenesCGG1	CDS	2829637	2829727	.	-	.	transcript "280"	
Adh	FGenesCGG1	CDS	2831482	2831626	.	-	.	transcript "280"	
Adh	FGenesCGG1	start_codon	2831624	2831626	.	-	.	transcript "280"	
Adh	FGenesCGG1	CDS	2835018	2835056	.	+	.	transcript "281"	
Adh	FGenesCGG1	start_codon	2835018	2835020	.	+	.	transcript "281"	
Adh	FGenesCGG1	CDS	2840422	2840772	.	+	.	transcript "281"	
Adh	FGenesCGG1	CDS	2841783	2841806	.	+	.	transcript "281"	
Adh	FGenesCGG1	stop_codon	2841804	2841806	.	+	.	transcript "281"	
Adh	FGenesCGG1	CDS	2845972	2846128	.	-	.	transcript "282"	
Adh	FGenesCGG1	stop_codon	2845972	2845974	.	-	.	transcript "282"	
Adh	FGenesCGG1	CDS	2848102	2848427	.	-	.	transcript "282"	
Adh	FGenesCGG1	CDS	2849124	2849126	.	-	.	transcript "282"	
Adh	FGenesCGG1	start_codon	2849124	2849126	.	-	.	transcript "282"	
Adh	FGenesCGG1	CDS	2853052	2853132	.	-	.	transcript "283"	
Adh	FGenesCGG1	stop_codon	2853052	2853054	.	-	.	transcript "283"	
Adh	FGenesCGG1	CDS	2853349	2853362	.	-	.	transcript "283"	
Adh	FGenesCGG1	CDS	2853744	2854099	.	-	.	transcript "283"	
Adh	FGenesCGG1	CDS	2854197	2855206	.	-	.	transcript "283"	
Adh	FGenesCGG1	CDS	2856104	2856265	.	-	.	transcript "283"	
Adh	FGenesCGG1	start_codon	2856263	2856265	.	-	.	transcript "283"	
Adh	FGenesCGG1	CDS	2869663	2869682	.	+	.	transcript "284"	
Adh	FGenesCGG1	start_codon	2869663	2869665	.	+	.	transcript "284"	
Adh	FGenesCGG1	CDS	2872476	2872590	.	+	.	transcript "284"	
Adh	FGenesCGG1	CDS	2880718	2880820	.	+	.	transcript "284"	
Adh	FGenesCGG1	CDS	2882019	2882485	.	+	.	transcript "284"	
Adh	FGenesCGG1	stop_codon	2882483	2882485	.	+	.	transcript "284"	
Adh	FGenesCGG1	CDS	2894587	2895247	.	+	.	transcript "285"	
Adh	FGenesCGG1	start_codon	2894587	2894589	.	+	.	transcript "285"	
Adh	FGenesCGG1	CDS	2895319	2895977	.	+	.	transcript "285"	
Adh	FGenesCGG1	stop_codon	2895975	2895977	.	+	.	transcript "285"	
Adh	FGenesCGG1	CDS	2896655	2896763	.	+	.	transcript "286"	
Adh	FGenesCGG1	start_codon	2896655	2896657	.	+	.	transcript "286"	
Adh	FGenesCGG1	CDS	2898444	2899001	.	+	.	transcript "286"	
Adh	FGenesCGG1	CDS	2899061	2899716	.	+	.	transcript "286"	
Adh	FGenesCGG1	stop_codon	2899714	2899716	.	+	.	transcript "286"	
Adh	FGenesCGG1	CDS	2900448	2900565	.	+	.	transcript "287"	
Adh	FGenesCGG1	start_codon	2900448	2900450	.	+	.	transcript "287"	
Adh	FGenesCGG1	CDS	2900634	2901185	.	+	.	transcript "287"	
Adh	FGenesCGG1	CDS	2901452	2902048	.	+	.	transcript "287"	
Adh	FGenesCGG1	CDS	2902973	2903168	.	+	.	transcript "287"	
Adh	FGenesCGG1	CDS	2904175	2904292	.	+	.	transcript "287"	
Adh	FGenesCGG1	stop_codon	2904290	2904292	.	+	.	transcript "287"	
Adh	FGenesCGG1	CDS	2916879	2917012	.	-	.	transcript "288"	
Adh	FGenesCGG1	stop_codon	2916879	2916881	.	-	.	transcript "288"	
Adh	FGenesCGG1	CDS	2917311	2917504	.	-	.	transcript "288"	
Adh	FGenesCGG1	CDS	2917751	2917988	.	-	.	transcript "288"	
Adh	FGenesCGG1	CDS	2918253	2918513	.	-	.	transcript "288"	
# GENE ANNOTATION 2 for Adh region of Drosophila melanogaster (file: CGG2_Annotation_of_Adh.gff)
# Computational Genomic Group, The Sanger Centre, Hinxton, Cambridge CB10 1SA, UK
# Group Leader Victor Solovyev: Email: solovyev@sanger.ac.uk
#                                 WWW: http://genomic.sanger.ac.uk/
# ANNOTATION 2 (AUXILIARY): CGG2 
#      Presents most reliable list of Coding exons, that might be useful
#      to start experimental verification of genes using PCR primers; these exons
#      are the same in fgenes/fgenesh predictions: 
#      Total 598  exons.	
#    2 other files (MAIN and AUXILIARY annotations):	
#    Annotation 1 (CGG1 - MAIN) (file: CGG1_Annotation_of_Adh.gff)
#        Presented most probable gene structures 1 variant for any sequence region
#        Total 288 genes; 1115 exons; Predictions based on Fgenes/Fgenesh programs;
#        58 genes have significant similarity with known proteins, transcript marked "homo"
#    Annotation 3 (CGG3) (file: CGG3_Annotation_of_Adh.gff)
#        Presents possible gene variants predicted by 2 programs Fgenes/Fgenesh
#        it is very redundant, but should have the highest the highest coverage of real genes: 
#      Total 875 genes; 2900 exons.
#
# compfly: 1. replaced sequence feature entry  Jul 5 (MR)
#
Adh	FGenesCGG2	CDS	1	441	.	-	.	transcript "1"	
Adh	FGenesCGG2	CDS	2379	2862	.	-	.	transcript "1"	
Adh	FGenesCGG2	CDS	3225	3550	.	-	.	transcript "1"	
Adh	FGenesCGG2	CDS	6718	7018	.	-	.	transcript "1"	
Adh	FGenesCGG2	CDS	24195	24356	.	+	.	transcript "6"	
Adh	FGenesCGG2	CDS	45358	45421	.	+	.	transcript "19"	
Adh	FGenesCGG2	CDS	52555	52587	.	+	.	transcript "19"	
Adh	FGenesCGG2	CDS	103543	103769	.	+	.	transcript "19"	
Adh	FGenesCGG2	CDS	103808	104330	.	+	.	transcript "19"	
Adh	FGenesCGG2	CDS	124458	124936	.	+	.	transcript "19"	
Adh	FGenesCGG2	CDS	127146	127292	.	+	.	transcript "19"	
Adh	FGenesCGG2	CDS	127771	127931	.	+	.	transcript "19"	
Adh	FGenesCGG2	CDS	127991	128225	.	+	.	transcript "19"	
Adh	FGenesCGG2	CDS	128296	129342	.	+	.	transcript "19"	
Adh	FGenesCGG2	CDS	129401	129965	.	+	.	transcript "19"	
Adh	FGenesCGG2	CDS	130136	130401	.	+	.	transcript "19"	
Adh	FGenesCGG2	CDS	54448	55900	.	+	.	transcript "20"	
Adh	FGenesCGG2	CDS	56155	58817	.	+	.	transcript "21"	
Adh	FGenesCGG2	CDS	89305	90666	.	-	.	transcript "22"	
Adh	FGenesCGG2	CDS	93123	94100	.	-	.	transcript "23"	
Adh	FGenesCGG2	CDS	95215	95259	.	-	.	transcript "23"	
Adh	FGenesCGG2	CDS	96195	96257	.	-	.	transcript "23"	
Adh	FGenesCGG2	CDS	133458	133548	.	-	.	transcript "26"	
Adh	FGenesCGG2	CDS	159578	159874	.	+	.	transcript "34"	
Adh	FGenesCGG2	CDS	161727	162105	.	+	.	transcript "34"	
Adh	FGenesCGG2	CDS	162442	162557	.	+	.	transcript "34"	
Adh	FGenesCGG2	CDS	163297	163527	.	+	.	transcript "34"	
Adh	FGenesCGG2	CDS	177956	178015	.	-	.	transcript "38"	
Adh	FGenesCGG2	CDS	178136	178300	.	-	.	transcript "38"	
Adh	FGenesCGG2	CDS	181272	181409	.	-	.	transcript "38"	
Adh	FGenesCGG2	CDS	183107	183235	.	-	.	transcript "38"	
Adh	FGenesCGG2	CDS	183341	183496	.	-	.	transcript "38"	
Adh	FGenesCGG2	CDS	183596	183635	.	-	.	transcript "38"	
Adh	FGenesCGG2	CDS	183699	183764	.	-	.	transcript "38"	
Adh	FGenesCGG2	CDS	183835	184040	.	-	.	transcript "38"	
Adh	FGenesCGG2	CDS	184241	184282	.	-	.	transcript "38"	
Adh	FGenesCGG2	CDS	229944	230462	.	+	.	transcript "55"	
Adh	FGenesCGG2	CDS	263040	263066	.	+	.	transcript "68"	
Adh	FGenesCGG2	CDS	265187	266322	.	+	.	transcript "68"	
Adh	FGenesCGG2	CDS	266392	266611	.	+	.	transcript "68"	
Adh	FGenesCGG2	CDS	266760	266867	.	+	.	transcript "68"	
Adh	FGenesCGG2	CDS	266935	267073	.	+	.	transcript "68"	
Adh	FGenesCGG2	CDS	267134	267234	.	+	.	transcript "68"	
Adh	FGenesCGG2	CDS	269629	269907	.	-	.	transcript "70"	
Adh	FGenesCGG2	CDS	271522	271573	.	-	.	transcript "70"	
Adh	FGenesCGG2	CDS	273396	273483	.	-	.	transcript "70"	
Adh	FGenesCGG2	CDS	274751	275848	.	+	.	transcript "72"	
Adh	FGenesCGG2	CDS	276748	277188	.	-	.	transcript "73"	
Adh	FGenesCGG2	CDS	277921	278103	.	+	.	transcript "75"	
Adh	FGenesCGG2	CDS	278222	278345	.	+	.	transcript "75"	
Adh	FGenesCGG2	CDS	278537	278737	.	+	.	transcript "75"	
Adh	FGenesCGG2	CDS	280674	280986	.	+	.	transcript "75"	
Adh	FGenesCGG2	CDS	281051	281202	.	+	.	transcript "75"	
Adh	FGenesCGG2	CDS	281264	281447	.	+	.	transcript "75"	
Adh	FGenesCGG2	CDS	281550	281787	.	+	.	transcript "75"	
Adh	FGenesCGG2	CDS	281848	282471	.	+	.	transcript "75"	
Adh	FGenesCGG2	CDS	283608	284052	.	+	.	transcript "75"	
Adh	FGenesCGG2	CDS	284969	285346	.	+	.	transcript "77"	
Adh	FGenesCGG2	CDS	285416	286886	.	+	.	transcript "77"	
Adh	FGenesCGG2	CDS	292759	292896	.	+	.	transcript "79"	
Adh	FGenesCGG2	CDS	297680	297713	.	+	.	transcript "82"	
Adh	FGenesCGG2	CDS	302560	302718	.	+	.	transcript "82"	
Adh	FGenesCGG2	CDS	303960	304272	.	-	.	transcript "85"	
Adh	FGenesCGG2	CDS	307965	309056	.	+	.	transcript "87"	
Adh	FGenesCGG2	CDS	309110	309467	.	+	.	transcript "87"	
Adh	FGenesCGG2	CDS	309530	310452	.	+	.	transcript "87"	
Adh	FGenesCGG2	CDS	310517	311365	.	+	.	transcript "87"	
Adh	FGenesCGG2	CDS	311428	312318	.	+	.	transcript "87"	
Adh	FGenesCGG2	CDS	312387	313020	.	+	.	transcript "87"	
Adh	FGenesCGG2	CDS	313086	313129	.	+	.	transcript "87"	
Adh	FGenesCGG2	CDS	315138	315899	.	+	.	transcript "88"	
Adh	FGenesCGG2	CDS	316433	316800	.	+	.	transcript "88"	
Adh	FGenesCGG2	CDS	316865	317462	.	+	.	transcript "88"	
Adh	FGenesCGG2	CDS	317891	318548	.	-	.	transcript "89"	
Adh	FGenesCGG2	CDS	318608	319430	.	-	.	transcript "89"	
Adh	FGenesCGG2	CDS	319486	321442	.	-	.	transcript "89"	
Adh	FGenesCGG2	CDS	321967	323027	.	-	.	transcript "90"	
Adh	FGenesCGG2	CDS	323097	323169	.	-	.	transcript "90"	
Adh	FGenesCGG2	CDS	323788	324885	.	+	.	transcript "92"	
Adh	FGenesCGG2	CDS	324939	325223	.	+	.	transcript "92"	
Adh	FGenesCGG2	CDS	325240	325634	.	-	.	transcript "93"	
Adh	FGenesCGG2	CDS	325689	326379	.	-	.	transcript "93"	
Adh	FGenesCGG2	CDS	334589	334786	.	-	.	transcript "99"	
Adh	FGenesCGG2	CDS	334847	335125	.	-	.	transcript "99"	
Adh	FGenesCGG2	CDS	337379	337457	.	-	.	transcript "100"	
Adh	FGenesCGG2	CDS	338944	339013	.	-	.	transcript "102"	
Adh	FGenesCGG2	CDS	340529	340634	.	+	.	transcript "104"	
Adh	FGenesCGG2	CDS	340705	340870	.	+	.	transcript "104"	
Adh	FGenesCGG2	CDS	342003	342689	.	+	.	transcript "104"	
Adh	FGenesCGG2	CDS	373286	373457	.	+	.	transcript "114"	
Adh	FGenesCGG2	CDS	388780	388921	.	+	.	transcript "118"	
Adh	FGenesCGG2	CDS	389006	389140	.	+	.	transcript "118"	
Adh	FGenesCGG2	CDS	389208	390491	.	+	.	transcript "118"	
Adh	FGenesCGG2	CDS	390556	390673	.	+	.	transcript "118"	
Adh	FGenesCGG2	CDS	390737	391112	.	+	.	transcript "118"	
Adh	FGenesCGG2	CDS	391177	391500	.	+	.	transcript "118"	
Adh	FGenesCGG2	CDS	393573	393814	.	-	.	transcript "120"	
Adh	FGenesCGG2	CDS	393894	394052	.	-	.	transcript "120"	
Adh	FGenesCGG2	CDS	394383	395732	.	-	.	transcript "120"	
Adh	FGenesCGG2	CDS	400338	400923	.	+	.	transcript "122"	
Adh	FGenesCGG2	CDS	401350	401713	.	+	.	transcript "122"	
Adh	FGenesCGG2	CDS	401775	402341	.	+	.	transcript "122"	
Adh	FGenesCGG2	CDS	402399	402539	.	+	.	transcript "122"	
Adh	FGenesCGG2	CDS	402607	402779	.	+	.	transcript "122"	
Adh	FGenesCGG2	CDS	402844	402860	.	+	.	transcript "122"	
Adh	FGenesCGG2	CDS	404467	405027	.	+	.	transcript "123"	
Adh	FGenesCGG2	CDS	405952	406314	.	+	.	transcript "125"	
Adh	FGenesCGG2	CDS	409150	409656	.	+	.	transcript "126"	
Adh	FGenesCGG2	CDS	410157	410315	.	+	.	transcript "126"	
Adh	FGenesCGG2	CDS	410372	410612	.	+	.	transcript "126"	
Adh	FGenesCGG2	CDS	411728	411831	.	+	.	transcript "126"	
Adh	FGenesCGG2	CDS	411898	411996	.	+	.	transcript "126"	
Adh	FGenesCGG2	CDS	426746	427546	.	-	.	transcript "132"	
Adh	FGenesCGG2	CDS	455870	456267	.	+	.	transcript "136"	
Adh	FGenesCGG2	CDS	459225	459761	.	-	.	transcript "140"	
Adh	FGenesCGG2	CDS	462646	463209	.	-	.	transcript "140"	
Adh	FGenesCGG2	CDS	463368	463657	.	-	.	transcript "140"	
Adh	FGenesCGG2	CDS	471109	471296	.	+	.	transcript "149"	
Adh	FGenesCGG2	CDS	471441	471687	.	+	.	transcript "149"	
Adh	FGenesCGG2	CDS	471752	471856	.	+	.	transcript "149"	
Adh	FGenesCGG2	CDS	471944	472490	.	+	.	transcript "149"	
Adh	FGenesCGG2	CDS	472557	472823	.	+	.	transcript "149"	
Adh	FGenesCGG2	CDS	472965	473128	.	+	.	transcript "149"	
Adh	FGenesCGG2	CDS	474251	474306	.	+	.	transcript "150"	
Adh	FGenesCGG2	CDS	479386	479753	.	-	.	transcript "152"	
Adh	FGenesCGG2	CDS	481570	481638	.	-	.	transcript "152"	
Adh	FGenesCGG2	CDS	484664	484807	.	-	.	transcript "152"	
Adh	FGenesCGG2	CDS	485391	485462	.	-	.	transcript "152"	
Adh	FGenesCGG2	CDS	498520	498979	.	+	.	transcript "155"	
Adh	FGenesCGG2	CDS	499082	499159	.	+	.	transcript "155"	
Adh	FGenesCGG2	CDS	499280	499593	.	+	.	transcript "155"	
Adh	FGenesCGG2	CDS	509881	510226	.	+	.	transcript "159"	
Adh	FGenesCGG2	CDS	510287	510786	.	+	.	transcript "159"	
Adh	FGenesCGG2	CDS	511784	512375	.	+	.	transcript "159"	
Adh	FGenesCGG2	CDS	512435	512758	.	+	.	transcript "159"	
Adh	FGenesCGG2	CDS	520781	521850	.	+	.	transcript "164"	
Adh	FGenesCGG2	CDS	522013	522988	.	+	.	transcript "164"	
Adh	FGenesCGG2	CDS	541380	542513	.	+	.	transcript "172"	
Adh	FGenesCGG2	CDS	555360	555824	.	+	.	transcript "177"	
Adh	FGenesCGG2	CDS	555920	556258	.	+	.	transcript "177"	
Adh	FGenesCGG2	CDS	562642	562755	.	+	.	transcript "183"	
Adh	FGenesCGG2	CDS	570329	570664	.	+	.	transcript "183"	
Adh	FGenesCGG2	CDS	570872	570947	.	+	.	transcript "183"	
Adh	FGenesCGG2	CDS	574289	574483	.	+	.	transcript "183"	
Adh	FGenesCGG2	CDS	575409	575495	.	+	.	transcript "183"	
Adh	FGenesCGG2	CDS	577207	577316	.	+	.	transcript "183"	
Adh	FGenesCGG2	CDS	581726	581877	.	+	.	transcript "183"	
Adh	FGenesCGG2	CDS	598857	599119	.	+	.	transcript "191"	
Adh	FGenesCGG2	CDS	616137	616184	.	-	.	transcript "194"	
Adh	FGenesCGG2	CDS	636233	636494	.	-	.	transcript "202"	
Adh	FGenesCGG2	CDS	651278	651478	.	+	.	transcript "205"	
Adh	FGenesCGG2	CDS	651583	652282	.	+	.	transcript "205"	
Adh	FGenesCGG2	CDS	657691	658001	.	-	.	transcript "208"	
Adh	FGenesCGG2	CDS	658326	658463	.	-	.	transcript "208"	
Adh	FGenesCGG2	CDS	679874	680889	.	-	.	transcript "214"	
Adh	FGenesCGG2	CDS	682600	682771	.	-	.	transcript "214"	
Adh	FGenesCGG2	CDS	682831	682969	.	-	.	transcript "214"	
Adh	FGenesCGG2	CDS	689811	689983	.	-	.	transcript "214"	
Adh	FGenesCGG2	CDS	690663	691029	.	-	.	transcript "214"	
Adh	FGenesCGG2	CDS	691393	691416	.	-	.	transcript "214"	
Adh	FGenesCGG2	CDS	755993	756089	.	+	.	transcript "225"	
Adh	FGenesCGG2	CDS	756663	756872	.	+	.	transcript "225"	
Adh	FGenesCGG2	CDS	771955	772295	.	+	.	transcript "231"	
Adh	FGenesCGG2	CDS	779692	781583	.	+	.	transcript "231"	
Adh	FGenesCGG2	CDS	781886	782694	.	+	.	transcript "231"	
Adh	FGenesCGG2	CDS	771285	771386	.	+	.	transcript "233"	
Adh	FGenesCGG2	CDS	772047	772295	.	+	.	transcript "233"	
Adh	FGenesCGG2	CDS	781886	781966	.	+	.	transcript "233"	
Adh	FGenesCGG2	CDS	781997	782694	.	+	.	transcript "233"	
Adh	FGenesCGG2	CDS	801976	802914	.	+	.	transcript "233"	
Adh	FGenesCGG2	CDS	813291	814049	.	+	.	transcript "233"	
Adh	FGenesCGG2	CDS	814794	814981	.	+	.	transcript "233"	
Adh	FGenesCGG2	CDS	815046	815442	.	+	.	transcript "233"	
Adh	FGenesCGG2	CDS	815528	815648	.	+	.	transcript "233"	
Adh	FGenesCGG2	CDS	815697	817215	.	+	.	transcript "233"	
Adh	FGenesCGG2	CDS	817273	818025	.	+	.	transcript "233"	
Adh	FGenesCGG2	CDS	818664	819290	.	+	.	transcript "233"	
Adh	FGenesCGG2	CDS	820171	820789	.	+	.	transcript "233"	
Adh	FGenesCGG2	CDS	820846	820979	.	+	.	transcript "233"	
Adh	FGenesCGG2	CDS	821037	821265	.	+	.	transcript "233"	
Adh	FGenesCGG2	CDS	814726	814981	.	+	.	transcript "242"	
Adh	FGenesCGG2	CDS	818086	818367	.	+	.	transcript "242"	
Adh	FGenesCGG2	CDS	818447	818574	.	+	.	transcript "242"	
Adh	FGenesCGG2	CDS	818633	819290	.	+	.	transcript "242"	
Adh	FGenesCGG2	CDS	822511	822848	.	+	.	transcript "243"	
Adh	FGenesCGG2	CDS	822907	824011	.	+	.	transcript "243"	
Adh	FGenesCGG2	CDS	825804	826423	.	+	.	transcript "243"	
Adh	FGenesCGG2	CDS	826499	826653	.	+	.	transcript "243"	
Adh	FGenesCGG2	CDS	826714	826921	.	+	.	transcript "243"	
Adh	FGenesCGG2	CDS	826980	827087	.	+	.	transcript "243"	
Adh	FGenesCGG2	CDS	827148	827511	.	+	.	transcript "243"	
Adh	FGenesCGG2	CDS	837919	838152	.	+	.	transcript "247"	
Adh	FGenesCGG2	CDS	841091	841333	.	-	.	transcript "251"	
Adh	FGenesCGG2	CDS	841389	841969	.	-	.	transcript "251"	
Adh	FGenesCGG2	CDS	842968	843375	.	-	.	transcript "253"	
Adh	FGenesCGG2	CDS	843445	843518	.	-	.	transcript "253"	
Adh	FGenesCGG2	CDS	847433	848154	.	-	.	transcript "253"	
Adh	FGenesCGG2	CDS	851077	851190	.	+	.	transcript "257"	
Adh	FGenesCGG2	CDS	851256	851436	.	+	.	transcript "257"	
Adh	FGenesCGG2	CDS	851491	851673	.	+	.	transcript "257"	
Adh	FGenesCGG2	CDS	851742	851919	.	+	.	transcript "257"	
Adh	FGenesCGG2	CDS	856092	856876	.	+	.	transcript "261"	
Adh	FGenesCGG2	CDS	856942	858029	.	+	.	transcript "261"	
Adh	FGenesCGG2	CDS	858109	858341	.	+	.	transcript "261"	
Adh	FGenesCGG2	CDS	858418	858966	.	+	.	transcript "261"	
Adh	FGenesCGG2	CDS	872557	872818	.	-	.	transcript "265"	
Adh	FGenesCGG2	CDS	872891	873131	.	-	.	transcript "265"	
Adh	FGenesCGG2	CDS	873191	873321	.	-	.	transcript "265"	
Adh	FGenesCGG2	CDS	873388	873527	.	-	.	transcript "265"	
Adh	FGenesCGG2	CDS	873583	874093	.	-	.	transcript "265"	
Adh	FGenesCGG2	CDS	874278	874541	.	-	.	transcript "265"	
Adh	FGenesCGG2	CDS	874599	874870	.	-	.	transcript "265"	
Adh	FGenesCGG2	CDS	884916	885676	.	-	.	transcript "269"	
Adh	FGenesCGG2	CDS	885967	886798	.	-	.	transcript "269"	
Adh	FGenesCGG2	CDS	918151	918795	.	-	.	transcript "274"	
Adh	FGenesCGG2	CDS	984981	985070	.	+	.	transcript "293"	
Adh	FGenesCGG2	CDS	985373	986896	.	+	.	transcript "293"	
Adh	FGenesCGG2	CDS	1006438	1006597	.	-	.	transcript "297"	
Adh	FGenesCGG2	CDS	1007537	1007583	.	-	.	transcript "297"	
Adh	FGenesCGG2	CDS	1018766	1018852	.	+	.	transcript "301"	
Adh	FGenesCGG2	CDS	1018978	1019148	.	+	.	transcript "301"	
Adh	FGenesCGG2	CDS	1041376	1041530	.	-	.	transcript "306"	
Adh	FGenesCGG2	CDS	1041602	1041989	.	-	.	transcript "306"	
Adh	FGenesCGG2	CDS	1056859	1057314	.	-	.	transcript "313"	
Adh	FGenesCGG2	CDS	1064248	1064380	.	-	.	transcript "316"	
Adh	FGenesCGG2	CDS	1066071	1066136	.	-	.	transcript "316"	
Adh	FGenesCGG2	CDS	1084155	1084220	.	-	.	transcript "325"	
Adh	FGenesCGG2	CDS	1095422	1095533	.	-	.	transcript "330"	
Adh	FGenesCGG2	CDS	1095586	1095735	.	-	.	transcript "330"	
Adh	FGenesCGG2	CDS	1095848	1095987	.	-	.	transcript "330"	
Adh	FGenesCGG2	CDS	1096062	1096196	.	-	.	transcript "330"	
Adh	FGenesCGG2	CDS	1101376	1101526	.	-	.	transcript "330"	
Adh	FGenesCGG2	CDS	1105586	1105651	.	-	.	transcript "330"	
Adh	FGenesCGG2	CDS	1106188	1106223	.	-	.	transcript "330"	
Adh	FGenesCGG2	CDS	1110074	1110172	.	+	.	transcript "333"	
Adh	FGenesCGG2	CDS	1110238	1110642	.	+	.	transcript "333"	
Adh	FGenesCGG2	CDS	1110713	1110979	.	+	.	transcript "333"	
Adh	FGenesCGG2	CDS	1111283	1111378	.	+	.	transcript "334"	
Adh	FGenesCGG2	CDS	1111805	1112209	.	+	.	transcript "334"	
Adh	FGenesCGG2	CDS	1112261	1112578	.	+	.	transcript "334"	
Adh	FGenesCGG2	CDS	1179474	1179556	.	-	.	transcript "350"	
Adh	FGenesCGG2	CDS	1179759	1179811	.	-	.	transcript "350"	
Adh	FGenesCGG2	CDS	1181634	1181705	.	-	.	transcript "352"	
Adh	FGenesCGG2	CDS	1182203	1182415	.	-	.	transcript "352"	
Adh	FGenesCGG2	CDS	1232958	1232969	.	+	.	transcript "364"	
Adh	FGenesCGG2	CDS	1237619	1237735	.	-	.	transcript "367"	
Adh	FGenesCGG2	CDS	1285595	1285746	.	-	.	transcript "385"	
Adh	FGenesCGG2	CDS	1294081	1298310	.	-	.	transcript "389"	
Adh	FGenesCGG2	CDS	1300469	1300474	.	+	.	transcript "390"	
Adh	FGenesCGG2	CDS	1334780	1335024	.	-	.	transcript "402"	
Adh	FGenesCGG2	CDS	1335080	1335356	.	-	.	transcript "402"	
Adh	FGenesCGG2	CDS	1335075	1335356	.	-	.	transcript "404"	
Adh	FGenesCGG2	CDS	1335416	1336157	.	-	.	transcript "404"	
Adh	FGenesCGG2	CDS	1336453	1336564	.	-	.	transcript "404"	
Adh	FGenesCGG2	CDS	1337714	1337917	.	-	.	transcript "404"	
Adh	FGenesCGG2	CDS	1338337	1338640	.	-	.	transcript "404"	
Adh	FGenesCGG2	CDS	1343580	1343725	.	-	.	transcript "407"	
Adh	FGenesCGG2	CDS	1344195	1344342	.	-	.	transcript "407"	
Adh	FGenesCGG2	CDS	1344504	1344695	.	-	.	transcript "407"	
Adh	FGenesCGG2	CDS	1344753	1344992	.	-	.	transcript "407"	
Adh	FGenesCGG2	CDS	1347642	1347653	.	-	.	transcript "407"	
Adh	FGenesCGG2	CDS	1351261	1351435	.	-	.	transcript "407"	
Adh	FGenesCGG2	CDS	1355116	1355236	.	-	.	transcript "407"	
Adh	FGenesCGG2	CDS	1356062	1356172	.	-	.	transcript "407"	
Adh	FGenesCGG2	CDS	1365666	1365762	.	-	.	transcript "412"	
Adh	FGenesCGG2	CDS	1368948	1369282	.	-	.	transcript "414"	
Adh	FGenesCGG2	CDS	1372017	1372351	.	-	.	transcript "418"	
Adh	FGenesCGG2	CDS	1398183	1398833	.	-	.	transcript "423"	
Adh	FGenesCGG2	CDS	1401633	1401874	.	-	.	transcript "423"	
Adh	FGenesCGG2	CDS	1402535	1402643	.	-	.	transcript "423"	
Adh	FGenesCGG2	CDS	1402808	1402995	.	-	.	transcript "423"	
Adh	FGenesCGG2	CDS	1403930	1404111	.	-	.	transcript "423"	
Adh	FGenesCGG2	CDS	1405762	1405903	.	-	.	transcript "423"	
Adh	FGenesCGG2	CDS	1406801	1406882	.	-	.	transcript "423"	
Adh	FGenesCGG2	CDS	1408830	1408932	.	-	.	transcript "423"	
Adh	FGenesCGG2	CDS	1412611	1412741	.	-	.	transcript "425"	
Adh	FGenesCGG2	CDS	1419378	1419918	.	+	.	transcript "427"	
Adh	FGenesCGG2	CDS	1421063	1421145	.	-	.	transcript "429"	
Adh	FGenesCGG2	CDS	1422176	1422320	.	-	.	transcript "429"	
Adh	FGenesCGG2	CDS	1424531	1424676	.	-	.	transcript "429"	
Adh	FGenesCGG2	CDS	1425549	1425752	.	-	.	transcript "429"	
Adh	FGenesCGG2	CDS	1426168	1426281	.	-	.	transcript "429"	
Adh	FGenesCGG2	CDS	1426393	1426486	.	-	.	transcript "429"	
Adh	FGenesCGG2	CDS	1428573	1428690	.	-	.	transcript "429"	
Adh	FGenesCGG2	CDS	1445532	1445710	.	+	.	transcript "431"	
Adh	FGenesCGG2	CDS	1457726	1457826	.	+	.	transcript "435"	
Adh	FGenesCGG2	CDS	1465977	1466019	.	-	.	transcript "438"	
Adh	FGenesCGG2	CDS	1466153	1466744	.	-	.	transcript "438"	
Adh	FGenesCGG2	CDS	1466876	1467307	.	-	.	transcript "438"	
Adh	FGenesCGG2	CDS	1495620	1495919	.	+	.	transcript "442"	
Adh	FGenesCGG2	CDS	1495977	1496198	.	+	.	transcript "442"	
Adh	FGenesCGG2	CDS	1496865	1497000	.	-	.	transcript "445"	
Adh	FGenesCGG2	CDS	1499102	1499249	.	-	.	transcript "448"	
Adh	FGenesCGG2	CDS	1515498	1515714	.	+	.	transcript "454"	
Adh	FGenesCGG2	CDS	1515807	1515972	.	+	.	transcript "454"	
Adh	FGenesCGG2	CDS	1516036	1516279	.	+	.	transcript "454"	
Adh	FGenesCGG2	CDS	1516339	1516488	.	+	.	transcript "454"	
Adh	FGenesCGG2	CDS	1519240	1519382	.	+	.	transcript "454"	
Adh	FGenesCGG2	CDS	1519441	1519564	.	+	.	transcript "454"	
Adh	FGenesCGG2	CDS	1520081	1520337	.	+	.	transcript "454"	
Adh	FGenesCGG2	CDS	1520398	1520535	.	+	.	transcript "454"	
Adh	FGenesCGG2	CDS	1521654	1521834	.	+	.	transcript "454"	
Adh	FGenesCGG2	CDS	1527523	1527636	.	-	.	transcript "457"	
Adh	FGenesCGG2	CDS	1527705	1528201	.	-	.	transcript "457"	
Adh	FGenesCGG2	CDS	1528291	1528426	.	-	.	transcript "457"	
Adh	FGenesCGG2	CDS	1529588	1529971	.	+	.	transcript "459"	
Adh	FGenesCGG2	CDS	1530746	1531626	.	+	.	transcript "459"	
Adh	FGenesCGG2	CDS	1531685	1531892	.	+	.	transcript "459"	
Adh	FGenesCGG2	CDS	1531958	1532269	.	+	.	transcript "459"	
Adh	FGenesCGG2	CDS	1535065	1535271	.	-	.	transcript "460"	
Adh	FGenesCGG2	CDS	1535341	1535461	.	-	.	transcript "460"	
Adh	FGenesCGG2	CDS	1535530	1535628	.	-	.	transcript "460"	
Adh	FGenesCGG2	CDS	1535739	1536304	.	-	.	transcript "460"	
Adh	FGenesCGG2	CDS	1536364	1536841	.	-	.	transcript "460"	
Adh	FGenesCGG2	CDS	1536914	1537150	.	-	.	transcript "460"	
Adh	FGenesCGG2	CDS	1537212	1538662	.	-	.	transcript "460"	
Adh	FGenesCGG2	CDS	1538758	1541113	.	-	.	transcript "460"	
Adh	FGenesCGG2	CDS	1541178	1541378	.	-	.	transcript "460"	
Adh	FGenesCGG2	CDS	1541445	1541794	.	-	.	transcript "460"	
Adh	FGenesCGG2	CDS	1542125	1542385	.	-	.	transcript "460"	
Adh	FGenesCGG2	CDS	1543065	1543082	.	-	.	transcript "460"	
Adh	FGenesCGG2	CDS	1548383	1548538	.	+	.	transcript "461"	
Adh	FGenesCGG2	CDS	1549142	1550017	.	-	.	transcript "463"	
Adh	FGenesCGG2	CDS	1550084	1550149	.	-	.	transcript "463"	
Adh	FGenesCGG2	CDS	1554841	1555107	.	-	.	transcript "464"	
Adh	FGenesCGG2	CDS	1558057	1558080	.	+	.	transcript "466"	
Adh	FGenesCGG2	CDS	1558134	1558521	.	+	.	transcript "466"	
Adh	FGenesCGG2	CDS	1561989	1562278	.	+	.	transcript "466"	
Adh	FGenesCGG2	CDS	1562338	1563081	.	+	.	transcript "466"	
Adh	FGenesCGG2	CDS	1563140	1563353	.	+	.	transcript "466"	
Adh	FGenesCGG2	CDS	1563418	1563689	.	+	.	transcript "466"	
Adh	FGenesCGG2	CDS	1563761	1563814	.	+	.	transcript "466"	
Adh	FGenesCGG2	CDS	1576691	1576943	.	+	.	transcript "467"	
Adh	FGenesCGG2	CDS	1577036	1577406	.	+	.	transcript "467"	
Adh	FGenesCGG2	CDS	1577926	1578081	.	+	.	transcript "467"	
Adh	FGenesCGG2	CDS	1580750	1580880	.	+	.	transcript "467"	
Adh	FGenesCGG2	CDS	1581294	1581623	.	+	.	transcript "467"	
Adh	FGenesCGG2	CDS	1581774	1582136	.	+	.	transcript "467"	
Adh	FGenesCGG2	CDS	1582201	1582292	.	+	.	transcript "467"	
Adh	FGenesCGG2	CDS	1582550	1582687	.	+	.	transcript "467"	
Adh	FGenesCGG2	CDS	1584949	1585094	.	+	.	transcript "469"	
Adh	FGenesCGG2	CDS	1585153	1585380	.	+	.	transcript "469"	
Adh	FGenesCGG2	CDS	1601744	1602565	.	+	.	transcript "477"	
Adh	FGenesCGG2	CDS	1603541	1603885	.	+	.	transcript "479"	
Adh	FGenesCGG2	CDS	1603951	1605404	.	+	.	transcript "479"	
Adh	FGenesCGG2	CDS	1605651	1606718	.	+	.	transcript "479"	
Adh	FGenesCGG2	CDS	1606791	1607142	.	+	.	transcript "479"	
Adh	FGenesCGG2	CDS	1607205	1607306	.	+	.	transcript "479"	
Adh	FGenesCGG2	CDS	1611815	1612014	.	+	.	transcript "480"	
Adh	FGenesCGG2	CDS	1613840	1613968	.	+	.	transcript "480"	
Adh	FGenesCGG2	CDS	1653232	1653414	.	-	.	transcript "496"	
Adh	FGenesCGG2	CDS	1657232	1657342	.	-	.	transcript "496"	
Adh	FGenesCGG2	CDS	1661045	1661189	.	-	.	transcript "496"	
Adh	FGenesCGG2	CDS	1667694	1667971	.	-	.	transcript "496"	
Adh	FGenesCGG2	CDS	1692478	1692547	.	-	.	transcript "502"	
Adh	FGenesCGG2	CDS	1695150	1695306	.	-	.	transcript "504"	
Adh	FGenesCGG2	CDS	1718580	1718725	.	-	.	transcript "509"	
Adh	FGenesCGG2	CDS	1719195	1719342	.	-	.	transcript "509"	
Adh	FGenesCGG2	CDS	1719504	1720004	.	-	.	transcript "509"	
Adh	FGenesCGG2	CDS	1719504	1719695	.	-	.	transcript "511"	
Adh	FGenesCGG2	CDS	1719753	1719992	.	-	.	transcript "511"	
Adh	FGenesCGG2	CDS	1722642	1722653	.	-	.	transcript "511"	
Adh	FGenesCGG2	CDS	1726261	1726435	.	-	.	transcript "511"	
Adh	FGenesCGG2	CDS	1730116	1730236	.	-	.	transcript "511"	
Adh	FGenesCGG2	CDS	1731062	1731125	.	-	.	transcript "511"	
Adh	FGenesCGG2	CDS	1739099	1739187	.	-	.	transcript "511"	
Adh	FGenesCGG2	CDS	1726256	1726435	.	-	.	transcript "513"	
Adh	FGenesCGG2	CDS	1731062	1731172	.	-	.	transcript "513"	
Adh	FGenesCGG2	CDS	1735826	1736004	.	-	.	transcript "513"	
Adh	FGenesCGG2	CDS	1740659	1740939	.	+	.	transcript "515"	
Adh	FGenesCGG2	CDS	1740995	1742042	.	+	.	transcript "515"	
Adh	FGenesCGG2	CDS	1742104	1742446	.	+	.	transcript "515"	
Adh	FGenesCGG2	CDS	1744620	1745915	.	-	.	transcript "517"	
Adh	FGenesCGG2	CDS	1751370	1751492	.	-	.	transcript "520"	
Adh	FGenesCGG2	CDS	1751722	1751956	.	-	.	transcript "520"	
Adh	FGenesCGG2	CDS	1752622	1752780	.	-	.	transcript "520"	
Adh	FGenesCGG2	CDS	1752984	1753316	.	-	.	transcript "520"	
Adh	FGenesCGG2	CDS	1756026	1756178	.	-	.	transcript "522"	
Adh	FGenesCGG2	CDS	1756248	1756386	.	-	.	transcript "522"	
Adh	FGenesCGG2	CDS	1756448	1756671	.	-	.	transcript "522"	
Adh	FGenesCGG2	CDS	1756797	1756876	.	-	.	transcript "522"	
Adh	FGenesCGG2	CDS	1757005	1757119	.	-	.	transcript "522"	
Adh	FGenesCGG2	CDS	1757182	1757352	.	-	.	transcript "522"	
Adh	FGenesCGG2	CDS	1757415	1757585	.	-	.	transcript "522"	
Adh	FGenesCGG2	CDS	1757648	1758409	.	-	.	transcript "522"	
Adh	FGenesCGG2	CDS	1758473	1758856	.	-	.	transcript "522"	
Adh	FGenesCGG2	CDS	1760557	1760616	.	-	.	transcript "522"	
Adh	FGenesCGG2	CDS	1763921	1764042	.	-	.	transcript "523"	
Adh	FGenesCGG2	CDS	1764272	1764501	.	-	.	transcript "523"	
Adh	FGenesCGG2	CDS	1764574	1764638	.	-	.	transcript "523"	
Adh	FGenesCGG2	CDS	1772171	1772258	.	+	.	transcript "529"	
Adh	FGenesCGG2	CDS	1772478	1772741	.	+	.	transcript "529"	
Adh	FGenesCGG2	CDS	1787599	1788915	.	+	.	transcript "537"	
Adh	FGenesCGG2	CDS	1804220	1804279	.	-	.	transcript "544"	
Adh	FGenesCGG2	CDS	1809495	1809558	.	-	.	transcript "546"	
Adh	FGenesCGG2	CDS	1810719	1811121	.	-	.	transcript "548"	
Adh	FGenesCGG2	CDS	1811467	1811600	.	-	.	transcript "548"	
Adh	FGenesCGG2	CDS	1812952	1813153	.	-	.	transcript "550"	
Adh	FGenesCGG2	CDS	1819380	1819522	.	+	.	transcript "552"	
Adh	FGenesCGG2	CDS	1823746	1825158	.	+	.	transcript "554"	
Adh	FGenesCGG2	CDS	1833450	1833866	.	-	.	transcript "557"	
Adh	FGenesCGG2	CDS	1871587	1871681	.	+	.	transcript "570"	
Adh	FGenesCGG2	CDS	1879965	1880082	.	-	.	transcript "574"	
Adh	FGenesCGG2	CDS	1885049	1885144	.	-	.	transcript "574"	
Adh	FGenesCGG2	CDS	1886761	1886886	.	-	.	transcript "576"	
Adh	FGenesCGG2	CDS	1913374	1914932	.	-	.	transcript "584"	
Adh	FGenesCGG2	CDS	1914995	1915082	.	-	.	transcript "584"	
Adh	FGenesCGG2	CDS	1947070	1947197	.	+	.	transcript "596"	
Adh	FGenesCGG2	CDS	1960747	1960855	.	+	.	transcript "604"	
Adh	FGenesCGG2	CDS	1962476	1962516	.	+	.	transcript "604"	
Adh	FGenesCGG2	CDS	1966586	1967758	.	-	.	transcript "607"	
Adh	FGenesCGG2	CDS	1976787	1976905	.	+	.	transcript "612"	
Adh	FGenesCGG2	CDS	1988872	1989075	.	+	.	transcript "616"	
Adh	FGenesCGG2	CDS	1991768	1992877	.	+	.	transcript "616"	
Adh	FGenesCGG2	CDS	1992942	1993204	.	+	.	transcript "616"	
Adh	FGenesCGG2	CDS	1993350	1993566	.	+	.	transcript "616"	
Adh	FGenesCGG2	CDS	2033074	2033194	.	+	.	transcript "624"	
Adh	FGenesCGG2	CDS	2040123	2040280	.	+	.	transcript "628"	
Adh	FGenesCGG2	CDS	2040432	2040689	.	+	.	transcript "628"	
Adh	FGenesCGG2	CDS	2068604	2070501	.	+	.	transcript "637"	
Adh	FGenesCGG2	CDS	2071510	2072677	.	+	.	transcript "637"	
Adh	FGenesCGG2	CDS	2076918	2078162	.	+	.	transcript "640"	
Adh	FGenesCGG2	CDS	2078140	2081293	.	+	.	transcript "641"	
Adh	FGenesCGG2	CDS	2105170	2105720	.	-	.	transcript "648"	
Adh	FGenesCGG2	CDS	2106653	2106860	.	+	.	transcript "650"	
Adh	FGenesCGG2	CDS	2106931	2107445	.	+	.	transcript "650"	
Adh	FGenesCGG2	CDS	2111897	2112079	.	-	.	transcript "652"	
Adh	FGenesCGG2	CDS	2118335	2118551	.	+	.	transcript "656"	
Adh	FGenesCGG2	CDS	2120092	2120194	.	+	.	transcript "656"	
Adh	FGenesCGG2	CDS	2120312	2121269	.	+	.	transcript "656"	
Adh	FGenesCGG2	CDS	2121336	2121745	.	+	.	transcript "656"	
Adh	FGenesCGG2	CDS	2125843	2125928	.	+	.	transcript "659"	
Adh	FGenesCGG2	CDS	2137486	2137679	.	-	.	transcript "661"	
Adh	FGenesCGG2	CDS	2137746	2137902	.	-	.	transcript "661"	
Adh	FGenesCGG2	CDS	2137961	2138116	.	-	.	transcript "661"	
Adh	FGenesCGG2	CDS	2138186	2138671	.	-	.	transcript "661"	
Adh	FGenesCGG2	CDS	2138733	2138994	.	-	.	transcript "661"	
Adh	FGenesCGG2	CDS	2139065	2139169	.	-	.	transcript "661"	
Adh	FGenesCGG2	CDS	2139824	2140056	.	-	.	transcript "661"	
Adh	FGenesCGG2	CDS	2140148	2140353	.	-	.	transcript "661"	
Adh	FGenesCGG2	CDS	2140417	2140630	.	-	.	transcript "661"	
Adh	FGenesCGG2	CDS	2141468	2141749	.	-	.	transcript "661"	
Adh	FGenesCGG2	CDS	2151821	2151931	.	-	.	transcript "666"	
Adh	FGenesCGG2	CDS	2167365	2167477	.	-	.	transcript "670"	
Adh	FGenesCGG2	CDS	2180707	2180982	.	-	.	transcript "676"	
Adh	FGenesCGG2	CDS	2181100	2181325	.	-	.	transcript "676"	
Adh	FGenesCGG2	CDS	2181392	2182662	.	-	.	transcript "676"	
Adh	FGenesCGG2	CDS	2182828	2182863	.	-	.	transcript "676"	
Adh	FGenesCGG2	CDS	2182500	2182662	.	-	.	transcript "677"	
Adh	FGenesCGG2	CDS	2189454	2189790	.	-	.	transcript "677"	
Adh	FGenesCGG2	CDS	2192598	2192617	.	-	.	transcript "677"	
Adh	FGenesCGG2	CDS	2201531	2201677	.	-	.	transcript "680"	
Adh	FGenesCGG2	CDS	2202376	2202477	.	-	.	transcript "680"	
Adh	FGenesCGG2	CDS	2204183	2205278	.	+	.	transcript "682"	
Adh	FGenesCGG2	CDS	2205332	2207403	.	+	.	transcript "682"	
Adh	FGenesCGG2	CDS	2208922	2209531	.	-	.	transcript "684"	
Adh	FGenesCGG2	CDS	2209593	2209904	.	-	.	transcript "684"	
Adh	FGenesCGG2	CDS	2209967	2211186	.	-	.	transcript "684"	
Adh	FGenesCGG2	CDS	2211243	2211671	.	-	.	transcript "684"	
Adh	FGenesCGG2	CDS	2212036	2212168	.	-	.	transcript "684"	
Adh	FGenesCGG2	CDS	2212228	2212400	.	-	.	transcript "684"	
Adh	FGenesCGG2	CDS	2216609	2217034	.	+	.	transcript "687"	
Adh	FGenesCGG2	CDS	2218461	2218494	.	-	.	transcript "689"	
Adh	FGenesCGG2	CDS	2218559	2218905	.	-	.	transcript "689"	
Adh	FGenesCGG2	CDS	2220565	2222197	.	-	.	transcript "691"	
Adh	FGenesCGG2	CDS	2222257	2222379	.	-	.	transcript "691"	
Adh	FGenesCGG2	CDS	2222435	2222667	.	-	.	transcript "691"	
Adh	FGenesCGG2	CDS	2222723	2222818	.	-	.	transcript "691"	
Adh	FGenesCGG2	CDS	2263166	2263696	.	-	.	transcript "702"	
Adh	FGenesCGG2	CDS	2305489	2305763	.	+	.	transcript "712"	
Adh	FGenesCGG2	CDS	2305829	2306951	.	+	.	transcript "712"	
Adh	FGenesCGG2	CDS	2311611	2311711	.	-	.	transcript "716"	
Adh	FGenesCGG2	CDS	2315767	2315925	.	-	.	transcript "718"	
Adh	FGenesCGG2	CDS	2315991	2316098	.	-	.	transcript "718"	
Adh	FGenesCGG2	CDS	2328290	2328403	.	-	.	transcript "721"	
Adh	FGenesCGG2	CDS	2333538	2333675	.	-	.	transcript "723"	
Adh	FGenesCGG2	CDS	2333741	2333848	.	-	.	transcript "723"	
Adh	FGenesCGG2	CDS	2341682	2341790	.	-	.	transcript "727"	
Adh	FGenesCGG2	CDS	2341855	2341911	.	-	.	transcript "727"	
Adh	FGenesCGG2	CDS	2342049	2342274	.	-	.	transcript "727"	
Adh	FGenesCGG2	CDS	2342341	2342602	.	-	.	transcript "727"	
Adh	FGenesCGG2	CDS	2356993	2357164	.	-	.	transcript "731"	
Adh	FGenesCGG2	CDS	2358742	2358953	.	-	.	transcript "731"	
Adh	FGenesCGG2	CDS	2392800	2393095	.	+	.	transcript "747"	
Adh	FGenesCGG2	CDS	2400780	2400843	.	+	.	transcript "750"	
Adh	FGenesCGG2	CDS	2407292	2407393	.	+	.	transcript "750"	
Adh	FGenesCGG2	CDS	2407960	2408288	.	+	.	transcript "750"	
Adh	FGenesCGG2	CDS	2408358	2408611	.	+	.	transcript "750"	
Adh	FGenesCGG2	CDS	2445792	2445848	.	+	.	transcript "760"	
Adh	FGenesCGG2	CDS	2481639	2481850	.	+	.	transcript "769"	
Adh	FGenesCGG2	CDS	2483447	2483582	.	+	.	transcript "769"	
Adh	FGenesCGG2	CDS	2486400	2486522	.	+	.	transcript "770"	
Adh	FGenesCGG2	CDS	2486596	2486785	.	+	.	transcript "770"	
Adh	FGenesCGG2	CDS	2488134	2488789	.	+	.	transcript "770"	
Adh	FGenesCGG2	CDS	2493314	2493620	.	+	.	transcript "772"	
Adh	FGenesCGG2	CDS	2493682	2493731	.	+	.	transcript "772"	
Adh	FGenesCGG2	CDS	2494047	2494116	.	+	.	transcript "772"	
Adh	FGenesCGG2	CDS	2494180	2494259	.	+	.	transcript "772"	
Adh	FGenesCGG2	CDS	2494325	2494651	.	+	.	transcript "772"	
Adh	FGenesCGG2	CDS	2495100	2495225	.	+	.	transcript "772"	
Adh	FGenesCGG2	CDS	2495286	2495667	.	+	.	transcript "772"	
Adh	FGenesCGG2	CDS	2495861	2496988	.	+	.	transcript "772"	
Adh	FGenesCGG2	CDS	2497217	2497464	.	+	.	transcript "772"	
Adh	FGenesCGG2	CDS	2505534	2505597	.	+	.	transcript "774"	
Adh	FGenesCGG2	CDS	2524357	2524565	.	+	.	transcript "774"	
Adh	FGenesCGG2	CDS	2525929	2526064	.	+	.	transcript "774"	
Adh	FGenesCGG2	CDS	2527415	2527548	.	+	.	transcript "774"	
Adh	FGenesCGG2	CDS	2529073	2529195	.	+	.	transcript "774"	
Adh	FGenesCGG2	CDS	2529260	2529455	.	+	.	transcript "774"	
Adh	FGenesCGG2	CDS	2529735	2530156	.	+	.	transcript "774"	
Adh	FGenesCGG2	CDS	2607999	2609243	.	-	.	transcript "790"	
Adh	FGenesCGG2	CDS	2619967	2620307	.	+	.	transcript "795"	
Adh	FGenesCGG2	CDS	2621231	2622507	.	+	.	transcript "795"	
Adh	FGenesCGG2	CDS	2622578	2622803	.	+	.	transcript "795"	
Adh	FGenesCGG2	CDS	2622977	2623082	.	+	.	transcript "795"	
Adh	FGenesCGG2	CDS	2623709	2623781	.	+	.	transcript "795"	
Adh	FGenesCGG2	CDS	2624114	2624266	.	+	.	transcript "795"	
Adh	FGenesCGG2	CDS	2624694	2624875	.	+	.	transcript "795"	
Adh	FGenesCGG2	CDS	2624976	2625495	.	+	.	transcript "795"	
Adh	FGenesCGG2	CDS	2625559	2625784	.	+	.	transcript "795"	
Adh	FGenesCGG2	CDS	2625851	2626052	.	+	.	transcript "795"	
Adh	FGenesCGG2	CDS	2626124	2626333	.	+	.	transcript "795"	
Adh	FGenesCGG2	CDS	2626392	2626510	.	+	.	transcript "795"	
Adh	FGenesCGG2	CDS	2626595	2626653	.	+	.	transcript "795"	
Adh	FGenesCGG2	CDS	2627634	2627751	.	+	.	transcript "795"	
Adh	FGenesCGG2	CDS	2628166	2628295	.	+	.	transcript "795"	
Adh	FGenesCGG2	CDS	2628460	2628626	.	+	.	transcript "795"	
Adh	FGenesCGG2	CDS	2628718	2628805	.	+	.	transcript "795"	
Adh	FGenesCGG2	CDS	2629398	2629505	.	+	.	transcript "795"	
Adh	FGenesCGG2	CDS	2632038	2632090	.	+	.	transcript "795"	
Adh	FGenesCGG2	CDS	2632152	2632298	.	+	.	transcript "795"	
Adh	FGenesCGG2	CDS	2632363	2632834	.	+	.	transcript "795"	
Adh	FGenesCGG2	CDS	2632889	2632972	.	+	.	transcript "795"	
Adh	FGenesCGG2	CDS	2633028	2633093	.	+	.	transcript "795"	
Adh	FGenesCGG2	CDS	2633149	2633337	.	+	.	transcript "795"	
Adh	FGenesCGG2	CDS	2633397	2633645	.	+	.	transcript "795"	
Adh	FGenesCGG2	CDS	2633706	2634365	.	+	.	transcript "795"	
Adh	FGenesCGG2	CDS	2634452	2634885	.	+	.	transcript "795"	
Adh	FGenesCGG2	CDS	2635370	2635410	.	+	.	transcript "795"	
Adh	FGenesCGG2	CDS	2638284	2638414	.	+	.	transcript "795"	
Adh	FGenesCGG2	CDS	2638470	2639006	.	+	.	transcript "795"	
Adh	FGenesCGG2	CDS	2661378	2662292	.	+	.	transcript "799"	
Adh	FGenesCGG2	CDS	2686394	2686570	.	+	.	transcript "799"	
Adh	FGenesCGG2	CDS	2686628	2686705	.	+	.	transcript "799"	
Adh	FGenesCGG2	CDS	2686770	2687146	.	+	.	transcript "799"	
Adh	FGenesCGG2	CDS	2687211	2687359	.	+	.	transcript "799"	
Adh	FGenesCGG2	CDS	2687415	2687920	.	+	.	transcript "799"	
Adh	FGenesCGG2	CDS	2687988	2688230	.	+	.	transcript "799"	
Adh	FGenesCGG2	CDS	2688302	2688395	.	+	.	transcript "799"	
Adh	FGenesCGG2	CDS	2688462	2688883	.	+	.	transcript "799"	
Adh	FGenesCGG2	CDS	2696335	2696446	.	-	.	transcript "806"	
Adh	FGenesCGG2	CDS	2696513	2696701	.	-	.	transcript "806"	
Adh	FGenesCGG2	CDS	2697862	2698028	.	-	.	transcript "806"	
Adh	FGenesCGG2	CDS	2698091	2698210	.	-	.	transcript "806"	
Adh	FGenesCGG2	CDS	2707509	2708522	.	+	.	transcript "809"	
Adh	FGenesCGG2	CDS	2709485	2710765	.	-	.	transcript "811"	
Adh	FGenesCGG2	CDS	2712522	2712646	.	+	.	transcript "812"	
Adh	FGenesCGG2	CDS	2728123	2728429	.	-	.	transcript "818"	
Adh	FGenesCGG2	CDS	2736358	2736449	.	-	.	transcript "818"	
Adh	FGenesCGG2	CDS	2743611	2745122	.	+	.	transcript "827"	
Adh	FGenesCGG2	CDS	2746815	2747453	.	-	.	transcript "829"	
Adh	FGenesCGG2	CDS	2752612	2752742	.	+	.	transcript "834"	
Adh	FGenesCGG2	CDS	2752822	2752985	.	+	.	transcript "834"	
Adh	FGenesCGG2	CDS	2753042	2753322	.	+	.	transcript "834"	
Adh	FGenesCGG2	CDS	2755219	2755580	.	-	.	transcript "836"	
Adh	FGenesCGG2	CDS	2755775	2755883	.	-	.	transcript "836"	
Adh	FGenesCGG2	CDS	2757391	2757589	.	+	.	transcript "839"	
Adh	FGenesCGG2	CDS	2757658	2758391	.	+	.	transcript "839"	
Adh	FGenesCGG2	CDS	2759163	2759190	.	-	.	transcript "840"	
Adh	FGenesCGG2	CDS	2759260	2759403	.	-	.	transcript "840"	
Adh	FGenesCGG2	CDS	2759527	2759639	.	-	.	transcript "840"	
Adh	FGenesCGG2	CDS	2759701	2759850	.	-	.	transcript "840"	
Adh	FGenesCGG2	CDS	2760361	2760672	.	+	.	transcript "841"	
Adh	FGenesCGG2	CDS	2760766	2761087	.	+	.	transcript "841"	
Adh	FGenesCGG2	CDS	2761141	2762087	.	+	.	transcript "841"	
Adh	FGenesCGG2	CDS	2762639	2762710	.	-	.	transcript "842"	
Adh	FGenesCGG2	CDS	2763711	2763968	.	-	.	transcript "842"	
Adh	FGenesCGG2	CDS	2764030	2764118	.	-	.	transcript "842"	
Adh	FGenesCGG2	CDS	2772220	2772430	.	-	.	transcript "842"	
Adh	FGenesCGG2	CDS	2772600	2772777	.	-	.	transcript "842"	
Adh	FGenesCGG2	CDS	2773593	2774287	.	-	.	transcript "842"	
Adh	FGenesCGG2	CDS	2791866	2792011	.	-	.	transcript "844"	
Adh	FGenesCGG2	CDS	2792082	2792601	.	-	.	transcript "844"	
Adh	FGenesCGG2	CDS	2853744	2854099	.	-	.	transcript "861"	
Adh	FGenesCGG2	CDS	2894587	2895247	.	+	.	transcript "869"	
Adh	FGenesCGG2	CDS	2895319	2895977	.	+	.	transcript "869"	
Adh	FGenesCGG2	CDS	2896655	2896763	.	+	.	transcript "870"	
Adh	FGenesCGG2	CDS	2898444	2899001	.	+	.	transcript "870"	
Adh	FGenesCGG2	CDS	2899061	2899716	.	+	.	transcript "870"	
Adh	FGenesCGG2	CDS	2900448	2900565	.	+	.	transcript "871"	
Adh	FGenesCGG2	CDS	2900634	2901185	.	+	.	transcript "871"	
Adh	FGenesCGG2	CDS	2901452	2902048	.	+	.	transcript "871"	
Adh	FGenesCGG2	CDS	2902973	2903168	.	+	.	transcript "871"	
Adh	FGenesCGG2	CDS	2904175	2904292	.	+	.	transcript "871"	
Adh	FGenesCGG2	CDS	2916879	2917012	.	-	.	transcript "875"	
Adh	FGenesCGG2	CDS	2917311	2917504	.	-	.	transcript "875"	
Adh	FGenesCGG2	CDS	2917751	2917988	.	-	.	transcript "875"	
Adh	FGenesCGG2	CDS	2918253	2918513	.	-	.	transcript "875"	
# GENE ANNOTATION 3 for Adh region of Drosophila melanogaster (file: CGG3_Annotation_of_Adh.gff)
# Computational Genomic Group, The Sanger Centre, Hinxton, Cambridge CB10 1SA, UK
# Group Leader Victor Solovyev: Email: solovyev@sanger.ac.uk
#                                 WWW: http://genomic.sanger.ac.uk/
# ANNOTATION 3 (AUXILIARY): CGG3 
#   Presents possible gene variants predicted by 2 programs Fgenes/Fgenesh
#      it is very redundant, but should have the highest coverage of real genes: 
#      Total 875 genes; 2900 exons.
#    2 other files (MAIN and AUXILIARY annotations):	
#    Annotation 1 (CGG1 - MAIN) (file: CGG1_Annotation_of_Adh.gff)
#         Presented most probable gene structures 1 variant for any sequence region
#        Total 288 genes; 1115 exons; Predictions based on Fgenes/Fgenesh programs;
#        58 genes have significant similarity with known proteins, transcript marked "homo"
#    Annotation 2 (CGG2)        (file: CGG2_Annotation_of_Adh.gff)
#      Presents most reliable list of Coding exons, that might be useful
#      to start experimental verification of genes using PCR primers; these exons
#      are the same in fgenes/fgenesh predictions: 
#      Total 598  exons.	
#
# compfly: 1. replaced sequence feature entry  Jul 5 (MR)
#
Adh	FGenesCGG3	CDS	1	441	.	-	.	transcript "1"	
Adh	FGenesCGG3	CDS	2379	2862	.	-	.	transcript "1"	
Adh	FGenesCGG3	CDS	3225	3550	.	-	.	transcript "1"	
Adh	FGenesCGG3	CDS	6718	7018	.	-	.	transcript "1"	
Adh	FGenesCGG3	start_codon	7016	7018	.	-	.	transcript "1"	
Adh	FGenesCGG3	CDS	12148	12250	.	-	.	transcript "2"	
Adh	FGenesCGG3	stop_codon	12148	12150	.	-	.	transcript "2"	
Adh	FGenesCGG3	CDS	14333	14407	.	-	.	transcript "2"	
Adh	FGenesCGG3	CDS	15268	15437	.	-	.	transcript "2"	
Adh	FGenesCGG3	start_codon	15435	15437	.	-	.	transcript "2"	
Adh	FGenesCGG3	CDS	15264	15437	.	-	.	transcript "3"	
Adh	FGenesCGG3	start_codon	15435	15437	.	-	.	transcript "3"	
Adh	FGenesCGG3	stop_codon	15264	15266	.	-	.	transcript "3"	
Adh	FGenesCGG3	CDS	16481	19594	.	-	.	transcript "4"	
Adh	FGenesCGG3	start_codon	19592	19594	.	-	.	transcript "4"	
Adh	FGenesCGG3	stop_codon	16481	16483	.	-	.	transcript "4"	
Adh	FGenesCGG3	CDS	20994	21077	.	+	.	transcript "5"	
Adh	FGenesCGG3	start_codon	20994	20996	.	+	.	transcript "5"	
Adh	FGenesCGG3	CDS	21560	21979	.	+	.	transcript "5"	
Adh	FGenesCGG3	CDS	22140	22295	.	+	.	transcript "5"	
Adh	FGenesCGG3	stop_codon	22293	22295	.	+	.	transcript "5"	
Adh	FGenesCGG3	CDS	21599	21979	.	+	.	transcript "6"	
Adh	FGenesCGG3	start_codon	21599	21601	.	+	.	transcript "6"	
Adh	FGenesCGG3	CDS	23871	24134	.	+	.	transcript "6"	
Adh	FGenesCGG3	CDS	24195	24356	.	+	.	transcript "6"	
Adh	FGenesCGG3	stop_codon	24354	24356	.	+	.	transcript "6"	
Adh	FGenesCGG3	CDS	22980	23189	.	+	.	transcript "7"	
Adh	FGenesCGG3	start_codon	22980	22982	.	+	.	transcript "7"	
Adh	FGenesCGG3	CDS	23249	23404	.	+	.	transcript "7"	
Adh	FGenesCGG3	stop_codon	23402	23404	.	+	.	transcript "7"	
Adh	FGenesCGG3	CDS	24061	24063	.	+	.	transcript "8"	
Adh	FGenesCGG3	start_codon	24061	24063	.	+	.	transcript "8"	
Adh	FGenesCGG3	CDS	24195	24356	.	+	.	transcript "8"	
Adh	FGenesCGG3	stop_codon	24354	24356	.	+	.	transcript "8"	
Adh	FGenesCGG3	CDS	26050	26166	.	+	.	transcript "9"	
Adh	FGenesCGG3	start_codon	26050	26052	.	+	.	transcript "9"	
Adh	FGenesCGG3	CDS	26209	26394	.	+	.	transcript "9"	
Adh	FGenesCGG3	stop_codon	26392	26394	.	+	.	transcript "9"	
Adh	FGenesCGG3	CDS	28247	28271	.	-	.	transcript "10"	
Adh	FGenesCGG3	stop_codon	28247	28249	.	-	.	transcript "10"	
Adh	FGenesCGG3	CDS	28665	28744	.	-	.	transcript "10"	
Adh	FGenesCGG3	CDS	29183	29224	.	-	.	transcript "10"	
Adh	FGenesCGG3	start_codon	29222	29224	.	-	.	transcript "10"	
Adh	FGenesCGG3	CDS	29156	29479	.	-	.	transcript "11"	
Adh	FGenesCGG3	start_codon	29477	29479	.	-	.	transcript "11"	
Adh	FGenesCGG3	stop_codon	29156	29158	.	-	.	transcript "11"	
Adh	FGenesCGG3	CDS	30219	30295	.	+	.	transcript "12"	
Adh	FGenesCGG3	start_codon	30219	30221	.	+	.	transcript "12"	
Adh	FGenesCGG3	CDS	30590	30695	.	+	.	transcript "12"	
Adh	FGenesCGG3	stop_codon	30693	30695	.	+	.	transcript "12"	
Adh	FGenesCGG3	CDS	31722	31768	.	+	.	transcript "13"	
Adh	FGenesCGG3	start_codon	31722	31724	.	+	.	transcript "13"	
Adh	FGenesCGG3	CDS	32102	32319	.	+	.	transcript "13"	
Adh	FGenesCGG3	CDS	34532	34822	.	+	.	transcript "13"	
Adh	FGenesCGG3	CDS	34857	35332	.	+	.	transcript "13"	
Adh	FGenesCGG3	stop_codon	35330	35332	.	+	.	transcript "13"	
Adh	FGenesCGG3	CDS	32220	32309	.	-	.	transcript "14"	
Adh	FGenesCGG3	stop_codon	32220	32222	.	-	.	transcript "14"	
Adh	FGenesCGG3	CDS	32377	32454	.	-	.	transcript "14"	
Adh	FGenesCGG3	start_codon	32452	32454	.	-	.	transcript "14"	
Adh	FGenesCGG3	CDS	34783	34822	.	+	.	transcript "15"	
Adh	FGenesCGG3	start_codon	34783	34785	.	+	.	transcript "15"	
Adh	FGenesCGG3	CDS	34857	34957	.	+	.	transcript "15"	
Adh	FGenesCGG3	CDS	36794	37222	.	+	.	transcript "15"	
Adh	FGenesCGG3	CDS	37587	37727	.	+	.	transcript "15"	
Adh	FGenesCGG3	CDS	40785	40841	.	+	.	transcript "15"	
Adh	FGenesCGG3	stop_codon	40839	40841	.	+	.	transcript "15"	
Adh	FGenesCGG3	CDS	35433	35749	.	-	.	transcript "16"	
Adh	FGenesCGG3	stop_codon	35433	35435	.	-	.	transcript "16"	
Adh	FGenesCGG3	CDS	35938	36226	.	-	.	transcript "16"	
Adh	FGenesCGG3	start_codon	36224	36226	.	-	.	transcript "16"	
Adh	FGenesCGG3	CDS	36410	37315	.	+	.	transcript "17"	
Adh	FGenesCGG3	start_codon	36410	36412	.	+	.	transcript "17"	
Adh	FGenesCGG3	stop_codon	37313	37315	.	+	.	transcript "17"	
Adh	FGenesCGG3	CDS	41756	41946	.	-	.	transcript "18"	
Adh	FGenesCGG3	stop_codon	41756	41758	.	-	.	transcript "18"	
Adh	FGenesCGG3	CDS	42159	42447	.	-	.	transcript "18"	
Adh	FGenesCGG3	start_codon	42445	42447	.	-	.	transcript "18"	
Adh	FGenesCGG3	CDS	45358	45421	.	+	.	transcript "19"	
Adh	FGenesCGG3	start_codon	45358	45360	.	+	.	transcript "19"	
Adh	FGenesCGG3	CDS	52555	52587	.	+	.	transcript "19"	
Adh	FGenesCGG3	CDS	103543	103769	.	+	.	transcript "19"	
Adh	FGenesCGG3	CDS	103808	104330	.	+	.	transcript "19"	
Adh	FGenesCGG3	CDS	124458	124936	.	+	.	transcript "19"	
Adh	FGenesCGG3	CDS	127146	127292	.	+	.	transcript "19"	
Adh	FGenesCGG3	CDS	127771	127931	.	+	.	transcript "19"	
Adh	FGenesCGG3	CDS	127991	128225	.	+	.	transcript "19"	
Adh	FGenesCGG3	CDS	128296	129342	.	+	.	transcript "19"	
Adh	FGenesCGG3	CDS	129401	129965	.	+	.	transcript "19"	
Adh	FGenesCGG3	CDS	130136	130401	.	+	.	transcript "19"	
Adh	FGenesCGG3	stop_codon	130399	130401	.	+	.	transcript "19"	
Adh	FGenesCGG3	CDS	54448	55900	.	+	.	transcript "20"	
Adh	FGenesCGG3	stop_codon	55898	55900	.	+	.	transcript "20"	
Adh	FGenesCGG3	CDS	56155	58817	.	+	.	transcript "21"	
Adh	FGenesCGG3	start_codon	56155	56157	.	+	.	transcript "21"	
Adh	FGenesCGG3	CDS	89305	90666	.	-	.	transcript "22"	
Adh	FGenesCGG3	start_codon	90664	90666	.	-	.	transcript "22"	
Adh	FGenesCGG3	stop_codon	89305	89307	.	-	.	transcript "22"	
Adh	FGenesCGG3	CDS	93123	94100	.	-	.	transcript "23"	
Adh	FGenesCGG3	stop_codon	93123	93125	.	-	.	transcript "23"	
Adh	FGenesCGG3	CDS	95215	95259	.	-	.	transcript "23"	
Adh	FGenesCGG3	CDS	96195	96257	.	-	.	transcript "23"	
Adh	FGenesCGG3	start_codon	96255	96257	.	-	.	transcript "23"	
Adh	FGenesCGG3	CDS	131040	131248	.	+	.	transcript "24"	
Adh	FGenesCGG3	start_codon	131040	131042	.	+	.	transcript "24"	
Adh	FGenesCGG3	stop_codon	131246	131248	.	+	.	transcript "24"	
Adh	FGenesCGG3	CDS	131264	131386	.	+	.	transcript "25"	
Adh	FGenesCGG3	start_codon	131264	131266	.	+	.	transcript "25"	
Adh	FGenesCGG3	CDS	131427	131546	.	+	.	transcript "25"	
Adh	FGenesCGG3	stop_codon	131544	131546	.	+	.	transcript "25"	
Adh	FGenesCGG3	CDS	133458	133548	.	-	.	transcript "26"	
Adh	FGenesCGG3	stop_codon	133458	133460	.	-	.	transcript "26"	
Adh	FGenesCGG3	CDS	133612	133750	.	-	.	transcript "26"	
Adh	FGenesCGG3	CDS	133961	134233	.	-	.	transcript "26"	
Adh	FGenesCGG3	CDS	134862	135000	.	-	.	transcript "26"	
Adh	FGenesCGG3	start_codon	134998	135000	.	-	.	transcript "26"	
Adh	FGenesCGG3	CDS	133458	133548	.	-	.	transcript "27"	
Adh	FGenesCGG3	stop_codon	133458	133460	.	-	.	transcript "27"	
Adh	FGenesCGG3	CDS	133612	134233	.	-	.	transcript "27"	
Adh	FGenesCGG3	CDS	134862	134967	.	-	.	transcript "27"	
Adh	FGenesCGG3	start_codon	134965	134967	.	-	.	transcript "27"	
Adh	FGenesCGG3	CDS	137680	137762	.	+	.	transcript "28"	
Adh	FGenesCGG3	start_codon	137680	137682	.	+	.	transcript "28"	
Adh	FGenesCGG3	CDS	141117	141200	.	+	.	transcript "28"	
Adh	FGenesCGG3	CDS	147064	147190	.	+	.	transcript "28"	
Adh	FGenesCGG3	stop_codon	147188	147190	.	+	.	transcript "28"	
Adh	FGenesCGG3	CDS	141479	141637	.	+	.	transcript "29"	
Adh	FGenesCGG3	start_codon	141479	141481	.	+	.	transcript "29"	
Adh	FGenesCGG3	CDS	141746	141847	.	+	.	transcript "29"	
Adh	FGenesCGG3	stop_codon	141845	141847	.	+	.	transcript "29"	
Adh	FGenesCGG3	CDS	144056	144192	.	-	.	transcript "30"	
Adh	FGenesCGG3	stop_codon	144056	144058	.	-	.	transcript "30"	
Adh	FGenesCGG3	CDS	146134	146287	.	-	.	transcript "30"	
Adh	FGenesCGG3	CDS	146339	146407	.	-	.	transcript "30"	
Adh	FGenesCGG3	start_codon	146405	146407	.	-	.	transcript "30"	
Adh	FGenesCGG3	CDS	149551	149557	.	+	.	transcript "31"	
Adh	FGenesCGG3	start_codon	149551	149553	.	+	.	transcript "31"	
Adh	FGenesCGG3	CDS	156111	156277	.	+	.	transcript "31"	
Adh	FGenesCGG3	CDS	157986	158018	.	+	.	transcript "31"	
Adh	FGenesCGG3	stop_codon	158016	158018	.	+	.	transcript "31"	
Adh	FGenesCGG3	CDS	150529	150687	.	+	.	transcript "32"	
Adh	FGenesCGG3	start_codon	150529	150531	.	+	.	transcript "32"	
Adh	FGenesCGG3	CDS	150796	150897	.	+	.	transcript "32"	
Adh	FGenesCGG3	stop_codon	150895	150897	.	+	.	transcript "32"	
Adh	FGenesCGG3	CDS	153103	153239	.	-	.	transcript "33"	
Adh	FGenesCGG3	stop_codon	153103	153105	.	-	.	transcript "33"	
Adh	FGenesCGG3	CDS	155181	155334	.	-	.	transcript "33"	
Adh	FGenesCGG3	CDS	155386	155454	.	-	.	transcript "33"	
Adh	FGenesCGG3	start_codon	155452	155454	.	-	.	transcript "33"	
Adh	FGenesCGG3	CDS	159578	159874	.	+	.	transcript "34"	
Adh	FGenesCGG3	start_codon	159578	159580	.	+	.	transcript "34"	
Adh	FGenesCGG3	CDS	161727	162105	.	+	.	transcript "34"	
Adh	FGenesCGG3	CDS	162442	162557	.	+	.	transcript "34"	
Adh	FGenesCGG3	CDS	162616	162954	.	+	.	transcript "34"	
Adh	FGenesCGG3	CDS	162991	163137	.	+	.	transcript "34"	
Adh	FGenesCGG3	CDS	163297	163527	.	+	.	transcript "34"	
Adh	FGenesCGG3	stop_codon	163525	163527	.	+	.	transcript "34"	
Adh	FGenesCGG3	CDS	159578	159874	.	+	.	transcript "35"	
Adh	FGenesCGG3	start_codon	159578	159580	.	+	.	transcript "35"	
Adh	FGenesCGG3	CDS	160778	160792	.	+	.	transcript "35"	
Adh	FGenesCGG3	CDS	161727	162105	.	+	.	transcript "35"	
Adh	FGenesCGG3	CDS	162442	162557	.	+	.	transcript "35"	
Adh	FGenesCGG3	CDS	162616	163137	.	+	.	transcript "35"	
Adh	FGenesCGG3	CDS	163297	163527	.	+	.	transcript "35"	
Adh	FGenesCGG3	stop_codon	163525	163527	.	+	.	transcript "35"	
Adh	FGenesCGG3	CDS	164127	164417	.	+	.	transcript "36"	
Adh	FGenesCGG3	start_codon	164127	164129	.	+	.	transcript "36"	
Adh	FGenesCGG3	stop_codon	164415	164417	.	+	.	transcript "36"	
Adh	FGenesCGG3	CDS	167440	167541	.	-	.	transcript "37"	
Adh	FGenesCGG3	stop_codon	167440	167442	.	-	.	transcript "37"	
Adh	FGenesCGG3	CDS	167624	167631	.	-	.	transcript "37"	
Adh	FGenesCGG3	CDS	169154	169259	.	-	.	transcript "37"	
Adh	FGenesCGG3	start_codon	169257	169259	.	-	.	transcript "37"	
Adh	FGenesCGG3	CDS	167469	167524	.	-	.	transcript "38"	
Adh	FGenesCGG3	stop_codon	167469	167471	.	-	.	transcript "38"	
Adh	FGenesCGG3	CDS	172369	172869	.	-	.	transcript "38"	
Adh	FGenesCGG3	CDS	175152	175341	.	-	.	transcript "38"	
Adh	FGenesCGG3	CDS	176875	176942	.	-	.	transcript "38"	
Adh	FGenesCGG3	CDS	177956	178015	.	-	.	transcript "38"	
Adh	FGenesCGG3	CDS	178136	178300	.	-	.	transcript "38"	
Adh	FGenesCGG3	CDS	181272	181409	.	-	.	transcript "38"	
Adh	FGenesCGG3	CDS	183107	183235	.	-	.	transcript "38"	
Adh	FGenesCGG3	CDS	183341	183496	.	-	.	transcript "38"	
Adh	FGenesCGG3	CDS	183596	183635	.	-	.	transcript "38"	
Adh	FGenesCGG3	CDS	183699	183764	.	-	.	transcript "38"	
Adh	FGenesCGG3	CDS	183835	184040	.	-	.	transcript "38"	
Adh	FGenesCGG3	CDS	184241	184282	.	-	.	transcript "38"	
Adh	FGenesCGG3	CDS	185558	185615	.	-	.	transcript "38"	
Adh	FGenesCGG3	start_codon	185613	185615	.	-	.	transcript "38"	
Adh	FGenesCGG3	CDS	172106	172869	.	-	.	transcript "39"	
Adh	FGenesCGG3	stop_codon	172106	172108	.	-	.	transcript "39"	
Adh	FGenesCGG3	CDS	173381	173396	.	-	.	transcript "39"	
Adh	FGenesCGG3	start_codon	173394	173396	.	-	.	transcript "39"	
Adh	FGenesCGG3	CDS	176070	176077	.	-	.	transcript "40"	
Adh	FGenesCGG3	stop_codon	176070	176072	.	-	.	transcript "40"	
Adh	FGenesCGG3	CDS	176875	176961	.	-	.	transcript "40"	
Adh	FGenesCGG3	CDS	177956	178015	.	-	.	transcript "40"	
Adh	FGenesCGG3	CDS	178136	178300	.	-	.	transcript "40"	
Adh	FGenesCGG3	CDS	179847	179900	.	-	.	transcript "40"	
Adh	FGenesCGG3	CDS	181272	181409	.	-	.	transcript "40"	
Adh	FGenesCGG3	CDS	183107	183235	.	-	.	transcript "40"	
Adh	FGenesCGG3	CDS	183341	183496	.	-	.	transcript "40"	
Adh	FGenesCGG3	CDS	183596	183635	.	-	.	transcript "40"	
Adh	FGenesCGG3	CDS	183699	183764	.	-	.	transcript "40"	
Adh	FGenesCGG3	CDS	183835	184040	.	-	.	transcript "40"	
Adh	FGenesCGG3	CDS	184241	184282	.	-	.	transcript "40"	
Adh	FGenesCGG3	CDS	185488	185708	.	-	.	transcript "40"	
Adh	FGenesCGG3	CDS	186584	186657	.	-	.	transcript "40"	
Adh	FGenesCGG3	start_codon	186655	186657	.	-	.	transcript "40"	
Adh	FGenesCGG3	CDS	188492	188640	.	+	.	transcript "41"	
Adh	FGenesCGG3	start_codon	188492	188494	.	+	.	transcript "41"	
Adh	FGenesCGG3	CDS	189065	189192	.	+	.	transcript "41"	
Adh	FGenesCGG3	CDS	189224	189348	.	+	.	transcript "41"	
Adh	FGenesCGG3	CDS	189492	189584	.	+	.	transcript "41"	
Adh	FGenesCGG3	stop_codon	189582	189584	.	+	.	transcript "41"	
Adh	FGenesCGG3	CDS	189165	189192	.	+	.	transcript "42"	
Adh	FGenesCGG3	start_codon	189165	189167	.	+	.	transcript "42"	
Adh	FGenesCGG3	CDS	189492	189748	.	+	.	transcript "42"	
Adh	FGenesCGG3	stop_codon	189746	189748	.	+	.	transcript "42"	
Adh	FGenesCGG3	CDS	195247	195252	.	+	.	transcript "43"	
Adh	FGenesCGG3	start_codon	195247	195249	.	+	.	transcript "43"	
Adh	FGenesCGG3	CDS	202116	202646	.	+	.	transcript "43"	
Adh	FGenesCGG3	CDS	203000	204199	.	+	.	transcript "43"	
Adh	FGenesCGG3	stop_codon	204197	204199	.	+	.	transcript "43"	
Adh	FGenesCGG3	CDS	197110	197301	.	-	.	transcript "44"	
Adh	FGenesCGG3	stop_codon	197110	197112	.	-	.	transcript "44"	
Adh	FGenesCGG3	CDS	197423	197466	.	-	.	transcript "44"	
Adh	FGenesCGG3	CDS	198304	198453	.	-	.	transcript "44"	
Adh	FGenesCGG3	CDS	198837	198840	.	-	.	transcript "44"	
Adh	FGenesCGG3	start_codon	198838	198840	.	-	.	transcript "44"	
Adh	FGenesCGG3	CDS	202128	202646	.	+	.	transcript "45"	
Adh	FGenesCGG3	start_codon	202128	202130	.	+	.	transcript "45"	
Adh	FGenesCGG3	CDS	202700	204199	.	+	.	transcript "45"	
Adh	FGenesCGG3	stop_codon	204197	204199	.	+	.	transcript "45"	
Adh	FGenesCGG3	CDS	206143	206372	.	-	.	transcript "46"	
Adh	FGenesCGG3	stop_codon	206143	206145	.	-	.	transcript "46"	
Adh	FGenesCGG3	CDS	207724	207826	.	-	.	transcript "46"	
Adh	FGenesCGG3	CDS	209072	209177	.	-	.	transcript "46"	
Adh	FGenesCGG3	CDS	216310	216761	.	-	.	transcript "46"	
Adh	FGenesCGG3	CDS	216820	216966	.	-	.	transcript "46"	
Adh	FGenesCGG3	start_codon	216964	216966	.	-	.	transcript "46"	
Adh	FGenesCGG3	CDS	207399	207406	.	-	.	transcript "47"	
Adh	FGenesCGG3	stop_codon	207399	207401	.	-	.	transcript "47"	
Adh	FGenesCGG3	CDS	207724	207883	.	-	.	transcript "47"	
Adh	FGenesCGG3	start_codon	207881	207883	.	-	.	transcript "47"	
Adh	FGenesCGG3	CDS	216144	216761	.	-	.	transcript "48"	
Adh	FGenesCGG3	stop_codon	216144	216146	.	-	.	transcript "48"	
Adh	FGenesCGG3	CDS	216820	217188	.	-	.	transcript "48"	
Adh	FGenesCGG3	start_codon	217186	217188	.	-	.	transcript "48"	
Adh	FGenesCGG3	CDS	218629	218828	.	-	.	transcript "49"	
Adh	FGenesCGG3	stop_codon	218629	218631	.	-	.	transcript "49"	
Adh	FGenesCGG3	CDS	219603	219933	.	-	.	transcript "49"	
Adh	FGenesCGG3	start_codon	219931	219933	.	-	.	transcript "49"	
Adh	FGenesCGG3	CDS	219632	219823	.	+	.	transcript "50"	
Adh	FGenesCGG3	start_codon	219632	219634	.	+	.	transcript "50"	
Adh	FGenesCGG3	stop_codon	219821	219823	.	+	.	transcript "50"	
Adh	FGenesCGG3	CDS	220828	220908	.	+	.	transcript "51"	
Adh	FGenesCGG3	start_codon	220828	220830	.	+	.	transcript "51"	
Adh	FGenesCGG3	CDS	221194	221205	.	+	.	transcript "51"	
Adh	FGenesCGG3	stop_codon	221203	221205	.	+	.	transcript "51"	
Adh	FGenesCGG3	CDS	220838	220908	.	+	.	transcript "52"	
Adh	FGenesCGG3	start_codon	220838	220840	.	+	.	transcript "52"	
Adh	FGenesCGG3	CDS	222937	222985	.	+	.	transcript "52"	
Adh	FGenesCGG3	CDS	224508	224563	.	+	.	transcript "52"	
Adh	FGenesCGG3	CDS	226769	226994	.	+	.	transcript "52"	
Adh	FGenesCGG3	stop_codon	226992	226994	.	+	.	transcript "52"	
Adh	FGenesCGG3	CDS	222916	223002	.	-	.	transcript "53"	
Adh	FGenesCGG3	stop_codon	222916	222918	.	-	.	transcript "53"	
Adh	FGenesCGG3	CDS	223791	223823	.	-	.	transcript "53"	
Adh	FGenesCGG3	start_codon	223821	223823	.	-	.	transcript "53"	
Adh	FGenesCGG3	CDS	226411	226504	.	+	.	transcript "54"	
Adh	FGenesCGG3	start_codon	226411	226413	.	+	.	transcript "54"	
Adh	FGenesCGG3	CDS	227770	227992	.	+	.	transcript "54"	
Adh	FGenesCGG3	CDS	228521	228602	.	+	.	transcript "54"	
Adh	FGenesCGG3	stop_codon	228600	228602	.	+	.	transcript "54"	
Adh	FGenesCGG3	CDS	229944	230462	.	+	.	transcript "55"	
Adh	FGenesCGG3	start_codon	229944	229946	.	+	.	transcript "55"	
Adh	FGenesCGG3	stop_codon	230460	230462	.	+	.	transcript "55"	
Adh	FGenesCGG3	CDS	229944	230462	.	+	.	transcript "56"	
Adh	FGenesCGG3	start_codon	229944	229946	.	+	.	transcript "56"	
Adh	FGenesCGG3	stop_codon	230460	230462	.	+	.	transcript "56"	
Adh	FGenesCGG3	CDS	230985	231293	.	-	.	transcript "57"	
Adh	FGenesCGG3	start_codon	231291	231293	.	-	.	transcript "57"	
Adh	FGenesCGG3	stop_codon	230985	230987	.	-	.	transcript "57"	
Adh	FGenesCGG3	CDS	230985	231322	.	-	.	transcript "58"	
Adh	FGenesCGG3	stop_codon	230985	230987	.	-	.	transcript "58"	
Adh	FGenesCGG3	CDS	231417	231615	.	-	.	transcript "58"	
Adh	FGenesCGG3	start_codon	231613	231615	.	-	.	transcript "58"	
Adh	FGenesCGG3	CDS	233055	233064	.	+	.	transcript "59"	
Adh	FGenesCGG3	start_codon	233055	233057	.	+	.	transcript "59"	
Adh	FGenesCGG3	CDS	233890	233943	.	+	.	transcript "59"	
Adh	FGenesCGG3	CDS	235893	235948	.	+	.	transcript "59"	
Adh	FGenesCGG3	stop_codon	235946	235948	.	+	.	transcript "59"	
Adh	FGenesCGG3	CDS	236722	236991	.	+	.	transcript "60"	
Adh	FGenesCGG3	start_codon	236722	236724	.	+	.	transcript "60"	
Adh	FGenesCGG3	stop_codon	236989	236991	.	+	.	transcript "60"	
Adh	FGenesCGG3	CDS	237088	237123	.	-	.	transcript "61"	
Adh	FGenesCGG3	stop_codon	237088	237090	.	-	.	transcript "61"	
Adh	FGenesCGG3	CDS	240427	240680	.	-	.	transcript "61"	
Adh	FGenesCGG3	CDS	242533	242554	.	-	.	transcript "61"	
Adh	FGenesCGG3	start_codon	242552	242554	.	-	.	transcript "61"	
Adh	FGenesCGG3	CDS	237474	237694	.	-	.	transcript "62"	
Adh	FGenesCGG3	stop_codon	237474	237476	.	-	.	transcript "62"	
Adh	FGenesCGG3	CDS	238361	238436	.	-	.	transcript "62"	
Adh	FGenesCGG3	CDS	238885	238894	.	-	.	transcript "62"	
Adh	FGenesCGG3	CDS	240094	240232	.	-	.	transcript "62"	
Adh	FGenesCGG3	CDS	240585	240630	.	-	.	transcript "62"	
Adh	FGenesCGG3	start_codon	240628	240630	.	-	.	transcript "62"	
Adh	FGenesCGG3	CDS	244652	244709	.	+	.	transcript "63"	
Adh	FGenesCGG3	start_codon	244652	244654	.	+	.	transcript "63"	
Adh	FGenesCGG3	CDS	247147	247256	.	+	.	transcript "63"	
Adh	FGenesCGG3	stop_codon	247254	247256	.	+	.	transcript "63"	
Adh	FGenesCGG3	CDS	252219	252356	.	+	.	transcript "64"	
Adh	FGenesCGG3	start_codon	252219	252221	.	+	.	transcript "64"	
Adh	FGenesCGG3	stop_codon	252354	252356	.	+	.	transcript "64"	
Adh	FGenesCGG3	CDS	252819	253106	.	-	.	transcript "65"	
Adh	FGenesCGG3	stop_codon	252819	252821	.	-	.	transcript "65"	
Adh	FGenesCGG3	CDS	254629	254868	.	-	.	transcript "65"	
Adh	FGenesCGG3	start_codon	254866	254868	.	-	.	transcript "65"	
Adh	FGenesCGG3	CDS	255763	256582	.	-	.	transcript "66"	
Adh	FGenesCGG3	stop_codon	255763	255765	.	-	.	transcript "66"	
Adh	FGenesCGG3	CDS	260965	261005	.	-	.	transcript "66"	
Adh	FGenesCGG3	start_codon	261003	261005	.	-	.	transcript "66"	
Adh	FGenesCGG3	CDS	259611	259694	.	-	.	transcript "67"	
Adh	FGenesCGG3	stop_codon	259611	259613	.	-	.	transcript "67"	
Adh	FGenesCGG3	CDS	260798	260896	.	-	.	transcript "67"	
Adh	FGenesCGG3	CDS	261452	261466	.	-	.	transcript "67"	
Adh	FGenesCGG3	start_codon	261464	261466	.	-	.	transcript "67"	
Adh	FGenesCGG3	CDS	263040	263066	.	+	.	transcript "68"	
Adh	FGenesCGG3	start_codon	263040	263042	.	+	.	transcript "68"	
Adh	FGenesCGG3	CDS	265187	266322	.	+	.	transcript "68"	
Adh	FGenesCGG3	CDS	266392	266611	.	+	.	transcript "68"	
Adh	FGenesCGG3	CDS	266760	266867	.	+	.	transcript "68"	
Adh	FGenesCGG3	CDS	266935	267073	.	+	.	transcript "68"	
Adh	FGenesCGG3	CDS	267134	267234	.	+	.	transcript "68"	
Adh	FGenesCGG3	stop_codon	267232	267234	.	+	.	transcript "68"	
Adh	FGenesCGG3	CDS	267633	267656	.	+	.	transcript "69"	
Adh	FGenesCGG3	start_codon	267633	267635	.	+	.	transcript "69"	
Adh	FGenesCGG3	CDS	267912	268061	.	+	.	transcript "69"	
Adh	FGenesCGG3	stop_codon	268059	268061	.	+	.	transcript "69"	
Adh	FGenesCGG3	CDS	267759	268130	.	-	.	transcript "70"	
Adh	FGenesCGG3	stop_codon	267759	267761	.	-	.	transcript "70"	
Adh	FGenesCGG3	CDS	268725	268798	.	-	.	transcript "70"	
Adh	FGenesCGG3	CDS	269222	269541	.	-	.	transcript "70"	
Adh	FGenesCGG3	CDS	269629	269907	.	-	.	transcript "70"	
Adh	FGenesCGG3	CDS	271522	271573	.	-	.	transcript "70"	
Adh	FGenesCGG3	CDS	273396	273483	.	-	.	transcript "70"	
Adh	FGenesCGG3	start_codon	273481	273483	.	-	.	transcript "70"	
Adh	FGenesCGG3	CDS	268982	269157	.	-	.	transcript "71"	
Adh	FGenesCGG3	stop_codon	268982	268984	.	-	.	transcript "71"	
Adh	FGenesCGG3	CDS	269222	269559	.	-	.	transcript "71"	
Adh	FGenesCGG3	CDS	269629	269907	.	-	.	transcript "71"	
Adh	FGenesCGG3	CDS	271522	271573	.	-	.	transcript "71"	
Adh	FGenesCGG3	CDS	273396	273483	.	-	.	transcript "71"	
Adh	FGenesCGG3	start_codon	273481	273483	.	-	.	transcript "71"	
Adh	FGenesCGG3	CDS	274751	275848	.	+	.	transcript "72"	
Adh	FGenesCGG3	start_codon	274751	274753	.	+	.	transcript "72"	
Adh	FGenesCGG3	stop_codon	275846	275848	.	+	.	transcript "72"	
Adh	FGenesCGG3	CDS	276292	276305	.	-	.	transcript "73"	
Adh	FGenesCGG3	stop_codon	276292	276294	.	-	.	transcript "73"	
Adh	FGenesCGG3	CDS	276588	276696	.	-	.	transcript "73"	
Adh	FGenesCGG3	CDS	276748	277188	.	-	.	transcript "73"	
Adh	FGenesCGG3	start_codon	277186	277188	.	-	.	transcript "73"	
Adh	FGenesCGG3	CDS	276361	276696	.	-	.	transcript "74"	
Adh	FGenesCGG3	stop_codon	276361	276363	.	-	.	transcript "74"	
Adh	FGenesCGG3	CDS	276748	277188	.	-	.	transcript "74"	
Adh	FGenesCGG3	start_codon	277186	277188	.	-	.	transcript "74"	
Adh	FGenesCGG3	CDS	277921	278103	.	+	.	transcript "75"	
Adh	FGenesCGG3	start_codon	277921	277923	.	+	.	transcript "75"	
Adh	FGenesCGG3	CDS	278222	278345	.	+	.	transcript "75"	
Adh	FGenesCGG3	CDS	278537	278737	.	+	.	transcript "75"	
Adh	FGenesCGG3	CDS	278802	279272	.	+	.	transcript "75"	
Adh	FGenesCGG3	CDS	279331	279483	.	+	.	transcript "75"	
Adh	FGenesCGG3	CDS	279548	279726	.	+	.	transcript "75"	
Adh	FGenesCGG3	CDS	280031	280247	.	+	.	transcript "75"	
Adh	FGenesCGG3	CDS	280310	280610	.	+	.	transcript "75"	
Adh	FGenesCGG3	CDS	280674	280986	.	+	.	transcript "75"	
Adh	FGenesCGG3	CDS	281051	281202	.	+	.	transcript "75"	
Adh	FGenesCGG3	CDS	281264	281447	.	+	.	transcript "75"	
Adh	FGenesCGG3	CDS	281550	281787	.	+	.	transcript "75"	
Adh	FGenesCGG3	CDS	281848	282471	.	+	.	transcript "75"	
Adh	FGenesCGG3	CDS	282539	283541	.	+	.	transcript "75"	
Adh	FGenesCGG3	CDS	283608	284052	.	+	.	transcript "75"	
Adh	FGenesCGG3	stop_codon	284050	284052	.	+	.	transcript "75"	
Adh	FGenesCGG3	CDS	277921	278103	.	+	.	transcript "76"	
Adh	FGenesCGG3	start_codon	277921	277923	.	+	.	transcript "76"	
Adh	FGenesCGG3	CDS	278222	278345	.	+	.	transcript "76"	
Adh	FGenesCGG3	CDS	278537	278737	.	+	.	transcript "76"	
Adh	FGenesCGG3	CDS	279029	279272	.	+	.	transcript "76"	
Adh	FGenesCGG3	CDS	280674	280986	.	+	.	transcript "76"	
Adh	FGenesCGG3	CDS	281051	281202	.	+	.	transcript "76"	
Adh	FGenesCGG3	CDS	281264	281447	.	+	.	transcript "76"	
Adh	FGenesCGG3	CDS	281550	281787	.	+	.	transcript "76"	
Adh	FGenesCGG3	CDS	281848	282471	.	+	.	transcript "76"	
Adh	FGenesCGG3	CDS	282539	283066	.	+	.	transcript "76"	
Adh	FGenesCGG3	CDS	283112	283541	.	+	.	transcript "76"	
Adh	FGenesCGG3	CDS	283608	284052	.	+	.	transcript "76"	
Adh	FGenesCGG3	stop_codon	284050	284052	.	+	.	transcript "76"	
Adh	FGenesCGG3	CDS	284779	284915	.	+	.	transcript "77"	
Adh	FGenesCGG3	start_codon	284779	284781	.	+	.	transcript "77"	
Adh	FGenesCGG3	CDS	284969	285346	.	+	.	transcript "77"	
Adh	FGenesCGG3	CDS	285416	286886	.	+	.	transcript "77"	
Adh	FGenesCGG3	stop_codon	286884	286886	.	+	.	transcript "77"	
Adh	FGenesCGG3	CDS	284887	284915	.	+	.	transcript "78"	
Adh	FGenesCGG3	start_codon	284887	284889	.	+	.	transcript "78"	
Adh	FGenesCGG3	CDS	284969	285346	.	+	.	transcript "78"	
Adh	FGenesCGG3	CDS	285416	286886	.	+	.	transcript "78"	
Adh	FGenesCGG3	stop_codon	286884	286886	.	+	.	transcript "78"	
Adh	FGenesCGG3	CDS	287599	288379	.	+	.	transcript "79"	
Adh	FGenesCGG3	start_codon	287599	287601	.	+	.	transcript "79"	
Adh	FGenesCGG3	CDS	288647	292689	.	+	.	transcript "79"	
Adh	FGenesCGG3	CDS	292759	292896	.	+	.	transcript "79"	
Adh	FGenesCGG3	stop_codon	292894	292896	.	+	.	transcript "79"	
Adh	FGenesCGG3	CDS	287743	288105	.	-	.	transcript "80"	
Adh	FGenesCGG3	start_codon	288103	288105	.	-	.	transcript "80"	
Adh	FGenesCGG3	stop_codon	287743	287745	.	-	.	transcript "80"	
Adh	FGenesCGG3	CDS	288664	292689	.	+	.	transcript "81"	
Adh	FGenesCGG3	start_codon	288664	288666	.	+	.	transcript "81"	
Adh	FGenesCGG3	CDS	292759	292896	.	+	.	transcript "81"	
Adh	FGenesCGG3	stop_codon	292894	292896	.	+	.	transcript "81"	
Adh	FGenesCGG3	CDS	297680	297713	.	+	.	transcript "82"	
Adh	FGenesCGG3	start_codon	297680	297682	.	+	.	transcript "82"	
Adh	FGenesCGG3	CDS	302560	302718	.	+	.	transcript "82"	
Adh	FGenesCGG3	CDS	302786	303072	.	+	.	transcript "82"	
Adh	FGenesCGG3	CDS	303214	303405	.	+	.	transcript "82"	
Adh	FGenesCGG3	stop_codon	303403	303405	.	+	.	transcript "82"	
Adh	FGenesCGG3	CDS	297680	297713	.	+	.	transcript "83"	
Adh	FGenesCGG3	start_codon	297680	297682	.	+	.	transcript "83"	
Adh	FGenesCGG3	CDS	298058	298128	.	+	.	transcript "83"	
Adh	FGenesCGG3	stop_codon	298126	298128	.	+	.	transcript "83"	
Adh	FGenesCGG3	CDS	301913	301961	.	+	.	transcript "84"	
Adh	FGenesCGG3	start_codon	301913	301915	.	+	.	transcript "84"	
Adh	FGenesCGG3	CDS	302560	302718	.	+	.	transcript "84"	
Adh	FGenesCGG3	CDS	302786	303405	.	+	.	transcript "84"	
Adh	FGenesCGG3	stop_codon	303403	303405	.	+	.	transcript "84"	
Adh	FGenesCGG3	CDS	303960	304272	.	-	.	transcript "85"	
Adh	FGenesCGG3	stop_codon	303960	303962	.	-	.	transcript "85"	
Adh	FGenesCGG3	CDS	304330	304745	.	-	.	transcript "85"	
Adh	FGenesCGG3	start_codon	304743	304745	.	-	.	transcript "85"	
Adh	FGenesCGG3	CDS	303960	304272	.	-	.	transcript "86"	
Adh	FGenesCGG3	stop_codon	303960	303962	.	-	.	transcript "86"	
Adh	FGenesCGG3	CDS	304330	305000	.	-	.	transcript "86"	
Adh	FGenesCGG3	start_codon	304998	305000	.	-	.	transcript "86"	
Adh	FGenesCGG3	CDS	307965	309056	.	+	.	transcript "87"	
Adh	FGenesCGG3	start_codon	307965	307967	.	+	.	transcript "87"	
Adh	FGenesCGG3	CDS	309110	309467	.	+	.	transcript "87"	
Adh	FGenesCGG3	CDS	309530	310452	.	+	.	transcript "87"	
Adh	FGenesCGG3	CDS	310517	311365	.	+	.	transcript "87"	
Adh	FGenesCGG3	CDS	311428	312318	.	+	.	transcript "87"	
Adh	FGenesCGG3	CDS	312387	313020	.	+	.	transcript "87"	
Adh	FGenesCGG3	CDS	313086	313129	.	+	.	transcript "87"	
Adh	FGenesCGG3	stop_codon	313127	313129	.	+	.	transcript "87"	
Adh	FGenesCGG3	CDS	315138	315899	.	+	.	transcript "88"	
Adh	FGenesCGG3	start_codon	315138	315140	.	+	.	transcript "88"	
Adh	FGenesCGG3	CDS	316433	316800	.	+	.	transcript "88"	
Adh	FGenesCGG3	CDS	316865	317462	.	+	.	transcript "88"	
Adh	FGenesCGG3	stop_codon	317460	317462	.	+	.	transcript "88"	
Adh	FGenesCGG3	CDS	317891	318548	.	-	.	transcript "89"	
Adh	FGenesCGG3	stop_codon	317891	317893	.	-	.	transcript "89"	
Adh	FGenesCGG3	CDS	318608	319430	.	-	.	transcript "89"	
Adh	FGenesCGG3	CDS	319486	321442	.	-	.	transcript "89"	
Adh	FGenesCGG3	start_codon	321440	321442	.	-	.	transcript "89"	
Adh	FGenesCGG3	CDS	321967	323027	.	-	.	transcript "90"	
Adh	FGenesCGG3	stop_codon	321967	321969	.	-	.	transcript "90"	
Adh	FGenesCGG3	CDS	323097	323169	.	-	.	transcript "90"	
Adh	FGenesCGG3	start_codon	323167	323169	.	-	.	transcript "90"	
Adh	FGenesCGG3	CDS	321967	323027	.	-	.	transcript "91"	
Adh	FGenesCGG3	stop_codon	321967	321969	.	-	.	transcript "91"	
Adh	FGenesCGG3	CDS	323097	323169	.	-	.	transcript "91"	
Adh	FGenesCGG3	start_codon	323167	323169	.	-	.	transcript "91"	
Adh	FGenesCGG3	CDS	323788	324885	.	+	.	transcript "92"	
Adh	FGenesCGG3	start_codon	323788	323790	.	+	.	transcript "92"	
Adh	FGenesCGG3	CDS	324939	325223	.	+	.	transcript "92"	
Adh	FGenesCGG3	stop_codon	325221	325223	.	+	.	transcript "92"	
Adh	FGenesCGG3	CDS	325240	325634	.	-	.	transcript "93"	
Adh	FGenesCGG3	stop_codon	325240	325242	.	-	.	transcript "93"	
Adh	FGenesCGG3	CDS	325689	326379	.	-	.	transcript "93"	
Adh	FGenesCGG3	start_codon	326377	326379	.	-	.	transcript "93"	
Adh	FGenesCGG3	CDS	326381	326822	.	-	.	transcript "94"	
Adh	FGenesCGG3	start_codon	326820	326822	.	-	.	transcript "94"	
Adh	FGenesCGG3	stop_codon	326381	326383	.	-	.	transcript "94"	
Adh	FGenesCGG3	CDS	327175	328002	.	+	.	transcript "95"	
Adh	FGenesCGG3	start_codon	327175	327177	.	+	.	transcript "95"	
Adh	FGenesCGG3	stop_codon	328000	328002	.	+	.	transcript "95"	
Adh	FGenesCGG3	CDS	328048	328383	.	-	.	transcript "96"	
Adh	FGenesCGG3	stop_codon	328048	328050	.	-	.	transcript "96"	
Adh	FGenesCGG3	CDS	328469	328634	.	-	.	transcript "96"	
Adh	FGenesCGG3	CDS	328690	328733	.	-	.	transcript "96"	
Adh	FGenesCGG3	start_codon	328731	328733	.	-	.	transcript "96"	
Adh	FGenesCGG3	CDS	329808	330183	.	+	.	transcript "97"	
Adh	FGenesCGG3	start_codon	329808	329810	.	+	.	transcript "97"	
Adh	FGenesCGG3	CDS	330331	330347	.	+	.	transcript "97"	
Adh	FGenesCGG3	stop_codon	330345	330347	.	+	.	transcript "97"	
Adh	FGenesCGG3	CDS	329808	329867	.	+	.	transcript "98"	
Adh	FGenesCGG3	start_codon	329808	329810	.	+	.	transcript "98"	
Adh	FGenesCGG3	CDS	330027	330183	.	+	.	transcript "98"	
Adh	FGenesCGG3	CDS	333808	334040	.	+	.	transcript "98"	
Adh	FGenesCGG3	stop_codon	334038	334040	.	+	.	transcript "98"	
Adh	FGenesCGG3	CDS	334589	334786	.	-	.	transcript "99"	
Adh	FGenesCGG3	stop_codon	334589	334591	.	-	.	transcript "99"	
Adh	FGenesCGG3	CDS	334847	335125	.	-	.	transcript "99"	
Adh	FGenesCGG3	CDS	335195	335230	.	-	.	transcript "99"	
Adh	FGenesCGG3	start_codon	335228	335230	.	-	.	transcript "99"	
Adh	FGenesCGG3	CDS	334589	334786	.	-	.	transcript "100"	
Adh	FGenesCGG3	stop_codon	334589	334591	.	-	.	transcript "100"	
Adh	FGenesCGG3	CDS	334847	335125	.	-	.	transcript "100"	
Adh	FGenesCGG3	CDS	336807	336919	.	-	.	transcript "100"	
Adh	FGenesCGG3	CDS	337379	337457	.	-	.	transcript "100"	
Adh	FGenesCGG3	start_codon	337455	337457	.	-	.	transcript "100"	
Adh	FGenesCGG3	CDS	336668	337323	.	-	.	transcript "101"	
Adh	FGenesCGG3	stop_codon	336668	336670	.	-	.	transcript "101"	
Adh	FGenesCGG3	CDS	337379	337457	.	-	.	transcript "101"	
Adh	FGenesCGG3	start_codon	337455	337457	.	-	.	transcript "101"	
Adh	FGenesCGG3	CDS	338167	338879	.	-	.	transcript "102"	
Adh	FGenesCGG3	stop_codon	338167	338169	.	-	.	transcript "102"	
Adh	FGenesCGG3	CDS	338944	339013	.	-	.	transcript "102"	
Adh	FGenesCGG3	start_codon	339011	339013	.	-	.	transcript "102"	
Adh	FGenesCGG3	CDS	338167	338409	.	-	.	transcript "103"	
Adh	FGenesCGG3	stop_codon	338167	338169	.	-	.	transcript "103"	
Adh	FGenesCGG3	CDS	338644	338879	.	-	.	transcript "103"	
Adh	FGenesCGG3	CDS	338944	339013	.	-	.	transcript "103"	
Adh	FGenesCGG3	start_codon	339011	339013	.	-	.	transcript "103"	
Adh	FGenesCGG3	CDS	340529	340634	.	+	.	transcript "104"	
Adh	FGenesCGG3	start_codon	340529	340531	.	+	.	transcript "104"	
Adh	FGenesCGG3	CDS	340705	340870	.	+	.	transcript "104"	
Adh	FGenesCGG3	CDS	340926	340992	.	+	.	transcript "104"	
Adh	FGenesCGG3	CDS	341779	341857	.	+	.	transcript "104"	
Adh	FGenesCGG3	CDS	342003	342689	.	+	.	transcript "104"	
Adh	FGenesCGG3	CDS	344266	344279	.	+	.	transcript "104"	
Adh	FGenesCGG3	stop_codon	344277	344279	.	+	.	transcript "104"	
Adh	FGenesCGG3	CDS	340529	340634	.	+	.	transcript "105"	
Adh	FGenesCGG3	start_codon	340529	340531	.	+	.	transcript "105"	
Adh	FGenesCGG3	CDS	340705	340870	.	+	.	transcript "105"	
Adh	FGenesCGG3	CDS	340926	341517	.	+	.	transcript "105"	
Adh	FGenesCGG3	stop_codon	341515	341517	.	+	.	transcript "105"	
Adh	FGenesCGG3	CDS	341713	341857	.	+	.	transcript "106"	
Adh	FGenesCGG3	start_codon	341713	341715	.	+	.	transcript "106"	
Adh	FGenesCGG3	CDS	342003	342689	.	+	.	transcript "106"	
Adh	FGenesCGG3	CDS	343143	343368	.	+	.	transcript "106"	
Adh	FGenesCGG3	CDS	343432	343984	.	+	.	transcript "106"	
Adh	FGenesCGG3	stop_codon	343982	343984	.	+	.	transcript "106"	
Adh	FGenesCGG3	CDS	347626	349437	.	-	.	transcript "107"	
Adh	FGenesCGG3	stop_codon	347626	347628	.	-	.	transcript "107"	
Adh	FGenesCGG3	CDS	350212	351429	.	-	.	transcript "107"	
Adh	FGenesCGG3	CDS	352375	353478	.	-	.	transcript "107"	
Adh	FGenesCGG3	CDS	354175	354562	.	-	.	transcript "107"	
Adh	FGenesCGG3	CDS	360158	360259	.	-	.	transcript "107"	
Adh	FGenesCGG3	CDS	361766	361794	.	-	.	transcript "107"	
Adh	FGenesCGG3	start_codon	361792	361794	.	-	.	transcript "107"	
Adh	FGenesCGG3	CDS	352023	352041	.	+	.	transcript "108"	
Adh	FGenesCGG3	start_codon	352023	352025	.	+	.	transcript "108"	
Adh	FGenesCGG3	CDS	352453	352507	.	+	.	transcript "108"	
Adh	FGenesCGG3	CDS	352710	352779	.	+	.	transcript "108"	
Adh	FGenesCGG3	CDS	353469	353498	.	+	.	transcript "108"	
Adh	FGenesCGG3	stop_codon	353496	353498	.	+	.	transcript "108"	
Adh	FGenesCGG3	CDS	354824	354922	.	+	.	transcript "109"	
Adh	FGenesCGG3	start_codon	354824	354826	.	+	.	transcript "109"	
Adh	FGenesCGG3	CDS	357861	357978	.	+	.	transcript "109"	
Adh	FGenesCGG3	CDS	359317	359576	.	+	.	transcript "109"	
Adh	FGenesCGG3	stop_codon	359574	359576	.	+	.	transcript "109"	
Adh	FGenesCGG3	CDS	360105	360259	.	-	.	transcript "110"	
Adh	FGenesCGG3	stop_codon	360105	360107	.	-	.	transcript "110"	
Adh	FGenesCGG3	CDS	361766	361859	.	-	.	transcript "110"	
Adh	FGenesCGG3	CDS	363245	363328	.	-	.	transcript "110"	
Adh	FGenesCGG3	CDS	364258	364468	.	-	.	transcript "110"	
Adh	FGenesCGG3	CDS	364708	364802	.	-	.	transcript "110"	
Adh	FGenesCGG3	start_codon	364800	364802	.	-	.	transcript "110"	
Adh	FGenesCGG3	CDS	363679	363789	.	+	.	transcript "111"	
Adh	FGenesCGG3	start_codon	363679	363681	.	+	.	transcript "111"	
Adh	FGenesCGG3	CDS	365326	365397	.	+	.	transcript "111"	
Adh	FGenesCGG3	CDS	366881	366996	.	+	.	transcript "111"	
Adh	FGenesCGG3	CDS	367951	368080	.	+	.	transcript "111"	
Adh	FGenesCGG3	stop_codon	368078	368080	.	+	.	transcript "111"	
Adh	FGenesCGG3	CDS	368893	368995	.	-	.	transcript "112"	
Adh	FGenesCGG3	stop_codon	368893	368895	.	-	.	transcript "112"	
Adh	FGenesCGG3	CDS	371649	371827	.	-	.	transcript "112"	
Adh	FGenesCGG3	CDS	371895	371948	.	-	.	transcript "112"	
Adh	FGenesCGG3	start_codon	371946	371948	.	-	.	transcript "112"	
Adh	FGenesCGG3	CDS	371714	371827	.	+	.	transcript "113"	
Adh	FGenesCGG3	start_codon	371714	371716	.	+	.	transcript "113"	
Adh	FGenesCGG3	stop_codon	371825	371827	.	+	.	transcript "113"	
Adh	FGenesCGG3	CDS	373286	373457	.	+	.	transcript "114"	
Adh	FGenesCGG3	start_codon	373286	373288	.	+	.	transcript "114"	
Adh	FGenesCGG3	CDS	375816	375838	.	+	.	transcript "114"	
Adh	FGenesCGG3	stop_codon	375836	375838	.	+	.	transcript "114"	
Adh	FGenesCGG3	CDS	373286	373457	.	+	.	transcript "115"	
Adh	FGenesCGG3	start_codon	373286	373288	.	+	.	transcript "115"	
Adh	FGenesCGG3	CDS	373676	373686	.	+	.	transcript "115"	
Adh	FGenesCGG3	stop_codon	373684	373686	.	+	.	transcript "115"	
Adh	FGenesCGG3	CDS	378470	378560	.	-	.	transcript "116"	
Adh	FGenesCGG3	stop_codon	378470	378472	.	-	.	transcript "116"	
Adh	FGenesCGG3	CDS	381104	381165	.	-	.	transcript "116"	
Adh	FGenesCGG3	start_codon	381163	381165	.	-	.	transcript "116"	
Adh	FGenesCGG3	CDS	381304	381403	.	+	.	transcript "117"	
Adh	FGenesCGG3	start_codon	381304	381306	.	+	.	transcript "117"	
Adh	FGenesCGG3	CDS	385051	385283	.	+	.	transcript "117"	
Adh	FGenesCGG3	CDS	385672	385788	.	+	.	transcript "117"	
Adh	FGenesCGG3	stop_codon	385786	385788	.	+	.	transcript "117"	
Adh	FGenesCGG3	CDS	385176	385283	.	+	.	transcript "118"	
Adh	FGenesCGG3	start_codon	385176	385178	.	+	.	transcript "118"	
Adh	FGenesCGG3	CDS	388780	388921	.	+	.	transcript "118"	
Adh	FGenesCGG3	CDS	389006	389140	.	+	.	transcript "118"	
Adh	FGenesCGG3	CDS	389208	390491	.	+	.	transcript "118"	
Adh	FGenesCGG3	CDS	390556	390673	.	+	.	transcript "118"	
Adh	FGenesCGG3	CDS	390737	391112	.	+	.	transcript "118"	
Adh	FGenesCGG3	CDS	391177	391500	.	+	.	transcript "118"	
Adh	FGenesCGG3	stop_codon	391498	391500	.	+	.	transcript "118"	
Adh	FGenesCGG3	CDS	387837	387884	.	+	.	transcript "119"	
Adh	FGenesCGG3	start_codon	387837	387839	.	+	.	transcript "119"	
Adh	FGenesCGG3	CDS	388780	388921	.	+	.	transcript "119"	
Adh	FGenesCGG3	CDS	389006	389140	.	+	.	transcript "119"	
Adh	FGenesCGG3	CDS	389208	390491	.	+	.	transcript "119"	
Adh	FGenesCGG3	CDS	390556	390673	.	+	.	transcript "119"	
Adh	FGenesCGG3	CDS	390737	391112	.	+	.	transcript "119"	
Adh	FGenesCGG3	CDS	391177	391500	.	+	.	transcript "119"	
Adh	FGenesCGG3	stop_codon	391498	391500	.	+	.	transcript "119"	
Adh	FGenesCGG3	CDS	393573	393814	.	-	.	transcript "120"	
Adh	FGenesCGG3	stop_codon	393573	393575	.	-	.	transcript "120"	
Adh	FGenesCGG3	CDS	393894	394052	.	-	.	transcript "120"	
Adh	FGenesCGG3	CDS	394383	395732	.	-	.	transcript "120"	
Adh	FGenesCGG3	CDS	395826	395912	.	-	.	transcript "120"	
Adh	FGenesCGG3	CDS	396111	396192	.	-	.	transcript "120"	
Adh	FGenesCGG3	CDS	397532	397682	.	-	.	transcript "120"	
Adh	FGenesCGG3	CDS	399709	399749	.	-	.	transcript "120"	
Adh	FGenesCGG3	start_codon	399747	399749	.	-	.	transcript "120"	
Adh	FGenesCGG3	CDS	393573	393814	.	-	.	transcript "121"	
Adh	FGenesCGG3	stop_codon	393573	393575	.	-	.	transcript "121"	
Adh	FGenesCGG3	CDS	393894	394052	.	-	.	transcript "121"	
Adh	FGenesCGG3	CDS	394383	395732	.	-	.	transcript "121"	
Adh	FGenesCGG3	CDS	395826	396192	.	-	.	transcript "121"	
Adh	FGenesCGG3	CDS	396385	397468	.	-	.	transcript "121"	
Adh	FGenesCGG3	CDS	397532	397671	.	-	.	transcript "121"	
Adh	FGenesCGG3	start_codon	397669	397671	.	-	.	transcript "121"	
Adh	FGenesCGG3	CDS	400338	400923	.	+	.	transcript "122"	
Adh	FGenesCGG3	start_codon	400338	400340	.	+	.	transcript "122"	
Adh	FGenesCGG3	CDS	401350	401713	.	+	.	transcript "122"	
Adh	FGenesCGG3	CDS	401775	402341	.	+	.	transcript "122"	
Adh	FGenesCGG3	CDS	402399	402539	.	+	.	transcript "122"	
Adh	FGenesCGG3	CDS	402607	402779	.	+	.	transcript "122"	
Adh	FGenesCGG3	CDS	402844	402860	.	+	.	transcript "122"	
Adh	FGenesCGG3	stop_codon	402858	402860	.	+	.	transcript "122"	
Adh	FGenesCGG3	CDS	403203	403277	.	+	.	transcript "123"	
Adh	FGenesCGG3	start_codon	403203	403205	.	+	.	transcript "123"	
Adh	FGenesCGG3	CDS	403468	404414	.	+	.	transcript "123"	
Adh	FGenesCGG3	CDS	404467	405027	.	+	.	transcript "123"	
Adh	FGenesCGG3	CDS	405085	405391	.	+	.	transcript "123"	
Adh	FGenesCGG3	stop_codon	405389	405391	.	+	.	transcript "123"	
Adh	FGenesCGG3	CDS	403813	404414	.	+	.	transcript "124"	
Adh	FGenesCGG3	start_codon	403813	403815	.	+	.	transcript "124"	
Adh	FGenesCGG3	CDS	404467	405027	.	+	.	transcript "124"	
Adh	FGenesCGG3	CDS	405169	405391	.	+	.	transcript "124"	
Adh	FGenesCGG3	stop_codon	405389	405391	.	+	.	transcript "124"	
Adh	FGenesCGG3	CDS	405952	406314	.	+	.	transcript "125"	
Adh	FGenesCGG3	start_codon	405952	405954	.	+	.	transcript "125"	
Adh	FGenesCGG3	stop_codon	406312	406314	.	+	.	transcript "125"	
Adh	FGenesCGG3	CDS	408759	409001	.	+	.	transcript "126"	
Adh	FGenesCGG3	start_codon	408759	408761	.	+	.	transcript "126"	
Adh	FGenesCGG3	CDS	409150	409656	.	+	.	transcript "126"	
Adh	FGenesCGG3	CDS	410157	410315	.	+	.	transcript "126"	
Adh	FGenesCGG3	CDS	410372	410612	.	+	.	transcript "126"	
Adh	FGenesCGG3	CDS	410677	411401	.	+	.	transcript "126"	
Adh	FGenesCGG3	CDS	411728	411831	.	+	.	transcript "126"	
Adh	FGenesCGG3	CDS	411898	411996	.	+	.	transcript "126"	
Adh	FGenesCGG3	CDS	412708	412711	.	+	.	transcript "126"	
Adh	FGenesCGG3	stop_codon	412709	412711	.	+	.	transcript "126"	
Adh	FGenesCGG3	CDS	408868	408960	.	+	.	transcript "127"	
Adh	FGenesCGG3	start_codon	408868	408870	.	+	.	transcript "127"	
Adh	FGenesCGG3	CDS	409150	409656	.	+	.	transcript "127"	
Adh	FGenesCGG3	CDS	410157	410315	.	+	.	transcript "127"	
Adh	FGenesCGG3	CDS	410372	410612	.	+	.	transcript "127"	
Adh	FGenesCGG3	CDS	410926	411401	.	+	.	transcript "127"	
Adh	FGenesCGG3	CDS	411728	411831	.	+	.	transcript "127"	
Adh	FGenesCGG3	CDS	411898	411996	.	+	.	transcript "127"	
Adh	FGenesCGG3	CDS	413437	413494	.	+	.	transcript "127"	
Adh	FGenesCGG3	stop_codon	413492	413494	.	+	.	transcript "127"	
Adh	FGenesCGG3	CDS	414711	415055	.	-	.	transcript "128"	
Adh	FGenesCGG3	stop_codon	414711	414713	.	-	.	transcript "128"	
Adh	FGenesCGG3	CDS	415356	415519	.	-	.	transcript "128"	
Adh	FGenesCGG3	CDS	415584	416211	.	-	.	transcript "128"	
Adh	FGenesCGG3	CDS	416276	416749	.	-	.	transcript "128"	
Adh	FGenesCGG3	CDS	417100	417111	.	-	.	transcript "128"	
Adh	FGenesCGG3	start_codon	417109	417111	.	-	.	transcript "128"	
Adh	FGenesCGG3	CDS	415576	416319	.	-	.	transcript "129"	
Adh	FGenesCGG3	start_codon	416317	416319	.	-	.	transcript "129"	
Adh	FGenesCGG3	stop_codon	415576	415578	.	-	.	transcript "129"	
Adh	FGenesCGG3	CDS	417380	417492	.	+	.	transcript "130"	
Adh	FGenesCGG3	start_codon	417380	417382	.	+	.	transcript "130"	
Adh	FGenesCGG3	CDS	420781	420901	.	+	.	transcript "130"	
Adh	FGenesCGG3	CDS	423538	423693	.	+	.	transcript "130"	
Adh	FGenesCGG3	stop_codon	423691	423693	.	+	.	transcript "130"	
Adh	FGenesCGG3	CDS	424562	424570	.	-	.	transcript "131"	
Adh	FGenesCGG3	stop_codon	424562	424564	.	-	.	transcript "131"	
Adh	FGenesCGG3	CDS	424891	424974	.	-	.	transcript "131"	
Adh	FGenesCGG3	start_codon	424972	424974	.	-	.	transcript "131"	
Adh	FGenesCGG3	CDS	426746	427546	.	-	.	transcript "132"	
Adh	FGenesCGG3	stop_codon	426746	426748	.	-	.	transcript "132"	
Adh	FGenesCGG3	CDS	432888	432947	.	-	.	transcript "132"	
Adh	FGenesCGG3	start_codon	432945	432947	.	-	.	transcript "132"	
Adh	FGenesCGG3	CDS	426746	427546	.	-	.	transcript "133"	
Adh	FGenesCGG3	stop_codon	426746	426748	.	-	.	transcript "133"	
Adh	FGenesCGG3	CDS	428348	428359	.	-	.	transcript "133"	
Adh	FGenesCGG3	start_codon	428357	428359	.	-	.	transcript "133"	
Adh	FGenesCGG3	CDS	433219	433516	.	-	.	transcript "134"	
Adh	FGenesCGG3	stop_codon	433219	433221	.	-	.	transcript "134"	
Adh	FGenesCGG3	CDS	434188	434216	.	-	.	transcript "134"	
Adh	FGenesCGG3	start_codon	434214	434216	.	-	.	transcript "134"	
Adh	FGenesCGG3	CDS	438671	438716	.	-	.	transcript "135"	
Adh	FGenesCGG3	stop_codon	438671	438673	.	-	.	transcript "135"	
Adh	FGenesCGG3	CDS	438983	439800	.	-	.	transcript "135"	
Adh	FGenesCGG3	CDS	440839	440850	.	-	.	transcript "135"	
Adh	FGenesCGG3	start_codon	440848	440850	.	-	.	transcript "135"	
Adh	FGenesCGG3	CDS	438994	439176	.	+	.	transcript "136"	
Adh	FGenesCGG3	start_codon	438994	438996	.	+	.	transcript "136"	
Adh	FGenesCGG3	CDS	439499	439600	.	+	.	transcript "136"	
Adh	FGenesCGG3	CDS	448492	448607	.	+	.	transcript "136"	
Adh	FGenesCGG3	CDS	449015	449225	.	+	.	transcript "136"	
Adh	FGenesCGG3	CDS	451744	451902	.	+	.	transcript "136"	
Adh	FGenesCGG3	CDS	453313	453459	.	+	.	transcript "136"	
Adh	FGenesCGG3	CDS	455021	455702	.	+	.	transcript "136"	
Adh	FGenesCGG3	CDS	455870	456267	.	+	.	transcript "136"	
Adh	FGenesCGG3	stop_codon	456265	456267	.	+	.	transcript "136"	
Adh	FGenesCGG3	CDS	448386	448432	.	+	.	transcript "137"	
Adh	FGenesCGG3	start_codon	448386	448388	.	+	.	transcript "137"	
Adh	FGenesCGG3	CDS	448467	448607	.	+	.	transcript "137"	
Adh	FGenesCGG3	CDS	449015	449330	.	+	.	transcript "137"	
Adh	FGenesCGG3	stop_codon	449328	449330	.	+	.	transcript "137"	
Adh	FGenesCGG3	CDS	451600	451902	.	+	.	transcript "138"	
Adh	FGenesCGG3	start_codon	451600	451602	.	+	.	transcript "138"	
Adh	FGenesCGG3	CDS	451945	452184	.	+	.	transcript "138"	
Adh	FGenesCGG3	stop_codon	452182	452184	.	+	.	transcript "138"	
Adh	FGenesCGG3	CDS	454006	454011	.	+	.	transcript "139"	
Adh	FGenesCGG3	start_codon	454006	454008	.	+	.	transcript "139"	
Adh	FGenesCGG3	CDS	454152	454325	.	+	.	transcript "139"	
Adh	FGenesCGG3	CDS	454581	454755	.	+	.	transcript "139"	
Adh	FGenesCGG3	CDS	454814	454931	.	+	.	transcript "139"	
Adh	FGenesCGG3	CDS	454999	455702	.	+	.	transcript "139"	
Adh	FGenesCGG3	CDS	455870	456267	.	+	.	transcript "139"	
Adh	FGenesCGG3	stop_codon	456265	456267	.	+	.	transcript "139"	
Adh	FGenesCGG3	CDS	457168	457395	.	-	.	transcript "140"	
Adh	FGenesCGG3	stop_codon	457168	457170	.	-	.	transcript "140"	
Adh	FGenesCGG3	CDS	458987	459146	.	-	.	transcript "140"	
Adh	FGenesCGG3	CDS	459225	459761	.	-	.	transcript "140"	
Adh	FGenesCGG3	CDS	460256	460608	.	-	.	transcript "140"	
Adh	FGenesCGG3	CDS	462179	462584	.	-	.	transcript "140"	
Adh	FGenesCGG3	CDS	462646	463209	.	-	.	transcript "140"	
Adh	FGenesCGG3	CDS	463368	463657	.	-	.	transcript "140"	
Adh	FGenesCGG3	start_codon	463655	463657	.	-	.	transcript "140"	
Adh	FGenesCGG3	CDS	457298	457488	.	+	.	transcript "141"	
Adh	FGenesCGG3	start_codon	457298	457300	.	+	.	transcript "141"	
Adh	FGenesCGG3	CDS	457649	458206	.	+	.	transcript "141"	
Adh	FGenesCGG3	CDS	458285	458481	.	+	.	transcript "141"	
Adh	FGenesCGG3	CDS	458547	458692	.	+	.	transcript "141"	
Adh	FGenesCGG3	stop_codon	458690	458692	.	+	.	transcript "141"	
Adh	FGenesCGG3	CDS	458837	459146	.	-	.	transcript "142"	
Adh	FGenesCGG3	stop_codon	458837	458839	.	-	.	transcript "142"	
Adh	FGenesCGG3	CDS	459225	459761	.	-	.	transcript "142"	
Adh	FGenesCGG3	CDS	460256	460674	.	-	.	transcript "142"	
Adh	FGenesCGG3	start_codon	460672	460674	.	-	.	transcript "142"	
Adh	FGenesCGG3	CDS	461236	461443	.	-	.	transcript "143"	
Adh	FGenesCGG3	stop_codon	461236	461238	.	-	.	transcript "143"	
Adh	FGenesCGG3	CDS	461500	461660	.	-	.	transcript "143"	
Adh	FGenesCGG3	start_codon	461658	461660	.	-	.	transcript "143"	
Adh	FGenesCGG3	CDS	462092	462584	.	-	.	transcript "144"	
Adh	FGenesCGG3	stop_codon	462092	462094	.	-	.	transcript "144"	
Adh	FGenesCGG3	CDS	462646	463209	.	-	.	transcript "144"	
Adh	FGenesCGG3	CDS	463368	463657	.	-	.	transcript "144"	
Adh	FGenesCGG3	start_codon	463655	463657	.	-	.	transcript "144"	
Adh	FGenesCGG3	CDS	464308	464615	.	+	.	transcript "145"	
Adh	FGenesCGG3	start_codon	464308	464310	.	+	.	transcript "145"	
Adh	FGenesCGG3	CDS	464888	465434	.	+	.	transcript "145"	
Adh	FGenesCGG3	stop_codon	465432	465434	.	+	.	transcript "145"	
Adh	FGenesCGG3	CDS	464850	465352	.	-	.	transcript "146"	
Adh	FGenesCGG3	stop_codon	464850	464852	.	-	.	transcript "146"	
Adh	FGenesCGG3	CDS	466129	466360	.	-	.	transcript "146"	
Adh	FGenesCGG3	CDS	466540	466638	.	-	.	transcript "146"	
Adh	FGenesCGG3	start_codon	466636	466638	.	-	.	transcript "146"	
Adh	FGenesCGG3	CDS	467979	469628	.	-	.	transcript "147"	
Adh	FGenesCGG3	stop_codon	467979	467981	.	-	.	transcript "147"	
Adh	FGenesCGG3	CDS	469682	469686	.	-	.	transcript "147"	
Adh	FGenesCGG3	CDS	470967	471022	.	-	.	transcript "147"	
Adh	FGenesCGG3	start_codon	471020	471022	.	-	.	transcript "147"	
Adh	FGenesCGG3	CDS	467979	469205	.	-	.	transcript "148"	
Adh	FGenesCGG3	stop_codon	467979	467981	.	-	.	transcript "148"	
Adh	FGenesCGG3	CDS	469452	469628	.	-	.	transcript "148"	
Adh	FGenesCGG3	CDS	469727	469786	.	-	.	transcript "148"	
Adh	FGenesCGG3	CDS	470226	470438	.	-	.	transcript "148"	
Adh	FGenesCGG3	start_codon	470436	470438	.	-	.	transcript "148"	
Adh	FGenesCGG3	CDS	471109	471296	.	+	.	transcript "149"	
Adh	FGenesCGG3	start_codon	471109	471111	.	+	.	transcript "149"	
Adh	FGenesCGG3	CDS	471441	471687	.	+	.	transcript "149"	
Adh	FGenesCGG3	CDS	471752	471856	.	+	.	transcript "149"	
Adh	FGenesCGG3	CDS	471944	472490	.	+	.	transcript "149"	
Adh	FGenesCGG3	CDS	472557	472823	.	+	.	transcript "149"	
Adh	FGenesCGG3	CDS	472965	473128	.	+	.	transcript "149"	
Adh	FGenesCGG3	stop_codon	473126	473128	.	+	.	transcript "149"	
Adh	FGenesCGG3	CDS	473959	474023	.	+	.	transcript "150"	
Adh	FGenesCGG3	start_codon	473959	473961	.	+	.	transcript "150"	
Adh	FGenesCGG3	CDS	474087	474189	.	+	.	transcript "150"	
Adh	FGenesCGG3	CDS	474251	474306	.	+	.	transcript "150"	
Adh	FGenesCGG3	CDS	474365	475283	.	+	.	transcript "150"	
Adh	FGenesCGG3	CDS	475427	476389	.	+	.	transcript "150"	
Adh	FGenesCGG3	stop_codon	476387	476389	.	+	.	transcript "150"	
Adh	FGenesCGG3	CDS	474118	474189	.	+	.	transcript "151"	
Adh	FGenesCGG3	start_codon	474118	474120	.	+	.	transcript "151"	
Adh	FGenesCGG3	CDS	474251	474306	.	+	.	transcript "151"	
Adh	FGenesCGG3	CDS	474696	475283	.	+	.	transcript "151"	
Adh	FGenesCGG3	CDS	475427	475685	.	+	.	transcript "151"	
Adh	FGenesCGG3	stop_codon	475683	475685	.	+	.	transcript "151"	
Adh	FGenesCGG3	CDS	477171	477490	.	-	.	transcript "152"	
Adh	FGenesCGG3	stop_codon	477171	477173	.	-	.	transcript "152"	
Adh	FGenesCGG3	CDS	477548	479329	.	-	.	transcript "152"	
Adh	FGenesCGG3	CDS	479386	479753	.	-	.	transcript "152"	
Adh	FGenesCGG3	CDS	479815	479958	.	-	.	transcript "152"	
Adh	FGenesCGG3	CDS	480016	480081	.	-	.	transcript "152"	
Adh	FGenesCGG3	CDS	480147	480287	.	-	.	transcript "152"	
Adh	FGenesCGG3	CDS	480343	480480	.	-	.	transcript "152"	
Adh	FGenesCGG3	CDS	481570	481638	.	-	.	transcript "152"	
Adh	FGenesCGG3	CDS	483386	483457	.	-	.	transcript "152"	
Adh	FGenesCGG3	CDS	483532	483603	.	-	.	transcript "152"	
Adh	FGenesCGG3	CDS	484195	484338	.	-	.	transcript "152"	
Adh	FGenesCGG3	CDS	484664	484807	.	-	.	transcript "152"	
Adh	FGenesCGG3	CDS	485391	485462	.	-	.	transcript "152"	
Adh	FGenesCGG3	CDS	486686	487236	.	-	.	transcript "152"	
Adh	FGenesCGG3	start_codon	487234	487236	.	-	.	transcript "152"	
Adh	FGenesCGG3	CDS	477171	477259	.	-	.	transcript "153"	
Adh	FGenesCGG3	stop_codon	477171	477173	.	-	.	transcript "153"	
Adh	FGenesCGG3	CDS	477548	478826	.	-	.	transcript "153"	
Adh	FGenesCGG3	CDS	479190	479329	.	-	.	transcript "153"	
Adh	FGenesCGG3	CDS	479386	479753	.	-	.	transcript "153"	
Adh	FGenesCGG3	CDS	480343	480468	.	-	.	transcript "153"	
Adh	FGenesCGG3	CDS	481570	481638	.	-	.	transcript "153"	
Adh	FGenesCGG3	CDS	483386	483435	.	-	.	transcript "153"	
Adh	FGenesCGG3	start_codon	483433	483435	.	-	.	transcript "153"	
Adh	FGenesCGG3	CDS	484191	484338	.	-	.	transcript "154"	
Adh	FGenesCGG3	stop_codon	484191	484193	.	-	.	transcript "154"	
Adh	FGenesCGG3	CDS	484664	484807	.	-	.	transcript "154"	
Adh	FGenesCGG3	CDS	485391	485462	.	-	.	transcript "154"	
Adh	FGenesCGG3	CDS	486686	486955	.	-	.	transcript "154"	
Adh	FGenesCGG3	CDS	495731	495914	.	-	.	transcript "154"	
Adh	FGenesCGG3	CDS	497805	497820	.	-	.	transcript "154"	
Adh	FGenesCGG3	start_codon	497818	497820	.	-	.	transcript "154"	
Adh	FGenesCGG3	CDS	498520	498979	.	+	.	transcript "155"	
Adh	FGenesCGG3	start_codon	498520	498522	.	+	.	transcript "155"	
Adh	FGenesCGG3	CDS	499082	499159	.	+	.	transcript "155"	
Adh	FGenesCGG3	CDS	499280	499593	.	+	.	transcript "155"	
Adh	FGenesCGG3	stop_codon	499591	499593	.	+	.	transcript "155"	
Adh	FGenesCGG3	CDS	498520	498979	.	+	.	transcript "156"	
Adh	FGenesCGG3	start_codon	498520	498522	.	+	.	transcript "156"	
Adh	FGenesCGG3	CDS	499082	499159	.	+	.	transcript "156"	
Adh	FGenesCGG3	CDS	499280	499593	.	+	.	transcript "156"	
Adh	FGenesCGG3	stop_codon	499591	499593	.	+	.	transcript "156"	
Adh	FGenesCGG3	CDS	500581	500834	.	-	.	transcript "157"	
Adh	FGenesCGG3	stop_codon	500581	500583	.	-	.	transcript "157"	
Adh	FGenesCGG3	CDS	500941	500992	.	-	.	transcript "157"	
Adh	FGenesCGG3	start_codon	500990	500992	.	-	.	transcript "157"	
Adh	FGenesCGG3	CDS	501793	501853	.	+	.	transcript "158"	
Adh	FGenesCGG3	start_codon	501793	501795	.	+	.	transcript "158"	
Adh	FGenesCGG3	CDS	501915	502055	.	+	.	transcript "158"	
Adh	FGenesCGG3	CDS	502293	502441	.	+	.	transcript "158"	
Adh	FGenesCGG3	stop_codon	502439	502441	.	+	.	transcript "158"	
Adh	FGenesCGG3	CDS	505505	505549	.	+	.	transcript "159"	
Adh	FGenesCGG3	start_codon	505505	505507	.	+	.	transcript "159"	
Adh	FGenesCGG3	CDS	506822	506887	.	+	.	transcript "159"	
Adh	FGenesCGG3	CDS	509536	509783	.	+	.	transcript "159"	
Adh	FGenesCGG3	CDS	509881	510226	.	+	.	transcript "159"	
Adh	FGenesCGG3	CDS	510287	510786	.	+	.	transcript "159"	
Adh	FGenesCGG3	CDS	511784	512375	.	+	.	transcript "159"	
Adh	FGenesCGG3	CDS	512435	512758	.	+	.	transcript "159"	
Adh	FGenesCGG3	stop_codon	512756	512758	.	+	.	transcript "159"	
Adh	FGenesCGG3	CDS	506876	506887	.	+	.	transcript "160"	
Adh	FGenesCGG3	start_codon	506876	506878	.	+	.	transcript "160"	
Adh	FGenesCGG3	CDS	507216	507581	.	+	.	transcript "160"	
Adh	FGenesCGG3	stop_codon	507579	507581	.	+	.	transcript "160"	
Adh	FGenesCGG3	CDS	509545	509783	.	+	.	transcript "161"	
Adh	FGenesCGG3	start_codon	509545	509547	.	+	.	transcript "161"	
Adh	FGenesCGG3	CDS	509881	510226	.	+	.	transcript "161"	
Adh	FGenesCGG3	CDS	510287	510786	.	+	.	transcript "161"	
Adh	FGenesCGG3	CDS	511784	512375	.	+	.	transcript "161"	
Adh	FGenesCGG3	CDS	512435	512758	.	+	.	transcript "161"	
Adh	FGenesCGG3	stop_codon	512756	512758	.	+	.	transcript "161"	
Adh	FGenesCGG3	CDS	513238	514050	.	-	.	transcript "162"	
Adh	FGenesCGG3	start_codon	514048	514050	.	-	.	transcript "162"	
Adh	FGenesCGG3	stop_codon	513238	513240	.	-	.	transcript "162"	
Adh	FGenesCGG3	CDS	513374	513598	.	-	.	transcript "163"	
Adh	FGenesCGG3	stop_codon	513374	513376	.	-	.	transcript "163"	
Adh	FGenesCGG3	CDS	513676	513921	.	-	.	transcript "163"	
Adh	FGenesCGG3	start_codon	513919	513921	.	-	.	transcript "163"	
Adh	FGenesCGG3	CDS	520781	521850	.	+	.	transcript "164"	
Adh	FGenesCGG3	start_codon	520781	520783	.	+	.	transcript "164"	
Adh	FGenesCGG3	CDS	522013	522988	.	+	.	transcript "164"	
Adh	FGenesCGG3	stop_codon	522986	522988	.	+	.	transcript "164"	
Adh	FGenesCGG3	CDS	520781	521850	.	+	.	transcript "165"	
Adh	FGenesCGG3	start_codon	520781	520783	.	+	.	transcript "165"	
Adh	FGenesCGG3	CDS	522013	522988	.	+	.	transcript "165"	
Adh	FGenesCGG3	stop_codon	522986	522988	.	+	.	transcript "165"	
Adh	FGenesCGG3	CDS	523395	523601	.	-	.	transcript "166"	
Adh	FGenesCGG3	stop_codon	523395	523397	.	-	.	transcript "166"	
Adh	FGenesCGG3	CDS	523705	524253	.	-	.	transcript "166"	
Adh	FGenesCGG3	CDS	524438	525283	.	-	.	transcript "166"	
Adh	FGenesCGG3	start_codon	525281	525283	.	-	.	transcript "166"	
Adh	FGenesCGG3	CDS	524381	525283	.	-	.	transcript "167"	
Adh	FGenesCGG3	start_codon	525281	525283	.	-	.	transcript "167"	
Adh	FGenesCGG3	stop_codon	524381	524383	.	-	.	transcript "167"	
Adh	FGenesCGG3	CDS	527046	527116	.	+	.	transcript "168"	
Adh	FGenesCGG3	start_codon	527046	527048	.	+	.	transcript "168"	
Adh	FGenesCGG3	CDS	528099	528231	.	+	.	transcript "168"	
Adh	FGenesCGG3	stop_codon	528229	528231	.	+	.	transcript "168"	
Adh	FGenesCGG3	CDS	532377	532602	.	+	.	transcript "169"	
Adh	FGenesCGG3	start_codon	532377	532379	.	+	.	transcript "169"	
Adh	FGenesCGG3	CDS	532643	532709	.	+	.	transcript "169"	
Adh	FGenesCGG3	CDS	535070	535178	.	+	.	transcript "169"	
Adh	FGenesCGG3	stop_codon	535176	535178	.	+	.	transcript "169"	
Adh	FGenesCGG3	CDS	532399	532709	.	+	.	transcript "170"	
Adh	FGenesCGG3	start_codon	532399	532401	.	+	.	transcript "170"	
Adh	FGenesCGG3	CDS	533739	534006	.	+	.	transcript "170"	
Adh	FGenesCGG3	stop_codon	534004	534006	.	+	.	transcript "170"	
Adh	FGenesCGG3	CDS	536184	536483	.	-	.	transcript "171"	
Adh	FGenesCGG3	stop_codon	536184	536186	.	-	.	transcript "171"	
Adh	FGenesCGG3	CDS	536647	536913	.	-	.	transcript "171"	
Adh	FGenesCGG3	start_codon	536911	536913	.	-	.	transcript "171"	
Adh	FGenesCGG3	CDS	541380	542513	.	+	.	transcript "172"	
Adh	FGenesCGG3	start_codon	541380	541382	.	+	.	transcript "172"	
Adh	FGenesCGG3	stop_codon	542511	542513	.	+	.	transcript "172"	
Adh	FGenesCGG3	CDS	541380	542513	.	+	.	transcript "173"	
Adh	FGenesCGG3	start_codon	541380	541382	.	+	.	transcript "173"	
Adh	FGenesCGG3	stop_codon	542511	542513	.	+	.	transcript "173"	
Adh	FGenesCGG3	CDS	545425	545490	.	+	.	transcript "174"	
Adh	FGenesCGG3	start_codon	545425	545427	.	+	.	transcript "174"	
Adh	FGenesCGG3	CDS	546083	546190	.	+	.	transcript "174"	
Adh	FGenesCGG3	stop_codon	546188	546190	.	+	.	transcript "174"	
Adh	FGenesCGG3	CDS	551715	551771	.	-	.	transcript "175"	
Adh	FGenesCGG3	stop_codon	551715	551717	.	-	.	transcript "175"	
Adh	FGenesCGG3	CDS	552580	552717	.	-	.	transcript "175"	
Adh	FGenesCGG3	start_codon	552715	552717	.	-	.	transcript "175"	
Adh	FGenesCGG3	CDS	553684	554064	.	-	.	transcript "176"	
Adh	FGenesCGG3	start_codon	554062	554064	.	-	.	transcript "176"	
Adh	FGenesCGG3	stop_codon	553684	553686	.	-	.	transcript "176"	
Adh	FGenesCGG3	CDS	555360	555824	.	+	.	transcript "177"	
Adh	FGenesCGG3	start_codon	555360	555362	.	+	.	transcript "177"	
Adh	FGenesCGG3	CDS	555920	556258	.	+	.	transcript "177"	
Adh	FGenesCGG3	stop_codon	556256	556258	.	+	.	transcript "177"	
Adh	FGenesCGG3	CDS	555360	555824	.	+	.	transcript "178"	
Adh	FGenesCGG3	start_codon	555360	555362	.	+	.	transcript "178"	
Adh	FGenesCGG3	CDS	555920	556258	.	+	.	transcript "178"	
Adh	FGenesCGG3	stop_codon	556256	556258	.	+	.	transcript "178"	
Adh	FGenesCGG3	CDS	558072	558251	.	+	.	transcript "179"	
Adh	FGenesCGG3	start_codon	558072	558074	.	+	.	transcript "179"	
Adh	FGenesCGG3	CDS	559602	559781	.	+	.	transcript "179"	
Adh	FGenesCGG3	stop_codon	559779	559781	.	+	.	transcript "179"	
Adh	FGenesCGG3	CDS	559322	559347	.	-	.	transcript "180"	
Adh	FGenesCGG3	stop_codon	559322	559324	.	-	.	transcript "180"	
Adh	FGenesCGG3	CDS	559641	559746	.	-	.	transcript "180"	
Adh	FGenesCGG3	start_codon	559744	559746	.	-	.	transcript "180"	
Adh	FGenesCGG3	CDS	561780	562023	.	-	.	transcript "181"	
Adh	FGenesCGG3	stop_codon	561780	561782	.	-	.	transcript "181"	
Adh	FGenesCGG3	CDS	562979	563050	.	-	.	transcript "181"	
Adh	FGenesCGG3	CDS	565610	565665	.	-	.	transcript "181"	
Adh	FGenesCGG3	start_codon	565663	565665	.	-	.	transcript "181"	
Adh	FGenesCGG3	CDS	562189	562240	.	+	.	transcript "182"	
Adh	FGenesCGG3	start_codon	562189	562191	.	+	.	transcript "182"	
Adh	FGenesCGG3	CDS	562616	562755	.	+	.	transcript "182"	
Adh	FGenesCGG3	CDS	563258	563387	.	+	.	transcript "182"	
Adh	FGenesCGG3	CDS	563616	563797	.	+	.	transcript "182"	
Adh	FGenesCGG3	stop_codon	563795	563797	.	+	.	transcript "182"	
Adh	FGenesCGG3	CDS	562642	562755	.	+	.	transcript "183"	
Adh	FGenesCGG3	CDS	570329	570664	.	+	.	transcript "183"	
Adh	FGenesCGG3	CDS	570872	570947	.	+	.	transcript "183"	
Adh	FGenesCGG3	CDS	574289	574483	.	+	.	transcript "183"	
Adh	FGenesCGG3	CDS	575409	575495	.	+	.	transcript "183"	
Adh	FGenesCGG3	CDS	577207	577316	.	+	.	transcript "183"	
Adh	FGenesCGG3	CDS	581726	581877	.	+	.	transcript "183"	
Adh	FGenesCGG3	CDS	568740	568831	.	-	.	transcript "184"	
Adh	FGenesCGG3	stop_codon	568740	568742	.	-	.	transcript "184"	
Adh	FGenesCGG3	CDS	569153	569300	.	-	.	transcript "184"	
Adh	FGenesCGG3	start_codon	569298	569300	.	-	.	transcript "184"	
Adh	FGenesCGG3	CDS	570015	570098	.	+	.	transcript "185"	
Adh	FGenesCGG3	start_codon	570015	570017	.	+	.	transcript "185"	
Adh	FGenesCGG3	CDS	570329	570703	.	+	.	transcript "185"	
Adh	FGenesCGG3	CDS	570872	570947	.	+	.	transcript "185"	
Adh	FGenesCGG3	CDS	574289	574483	.	+	.	transcript "185"	
Adh	FGenesCGG3	CDS	575409	575533	.	+	.	transcript "185"	
Adh	FGenesCGG3	stop_codon	575531	575533	.	+	.	transcript "185"	
Adh	FGenesCGG3	CDS	570386	570664	.	+	.	transcript "186"	
Adh	FGenesCGG3	start_codon	570386	570388	.	+	.	transcript "186"	
Adh	FGenesCGG3	CDS	571348	571455	.	+	.	transcript "186"	
Adh	FGenesCGG3	CDS	572257	572268	.	+	.	transcript "186"	
Adh	FGenesCGG3	stop_codon	572266	572268	.	+	.	transcript "186"	
Adh	FGenesCGG3	CDS	574810	574871	.	+	.	transcript "187"	
Adh	FGenesCGG3	start_codon	574810	574812	.	+	.	transcript "187"	
Adh	FGenesCGG3	CDS	575409	575495	.	+	.	transcript "187"	
Adh	FGenesCGG3	CDS	587141	587213	.	+	.	transcript "187"	
Adh	FGenesCGG3	CDS	589303	589377	.	+	.	transcript "187"	
Adh	FGenesCGG3	stop_codon	589375	589377	.	+	.	transcript "187"	
Adh	FGenesCGG3	CDS	577305	577316	.	+	.	transcript "188"	
Adh	FGenesCGG3	start_codon	577305	577307	.	+	.	transcript "188"	
Adh	FGenesCGG3	CDS	577459	577659	.	+	.	transcript "188"	
Adh	FGenesCGG3	stop_codon	577657	577659	.	+	.	transcript "188"	
Adh	FGenesCGG3	CDS	580207	580278	.	+	.	transcript "189"	
Adh	FGenesCGG3	start_codon	580207	580209	.	+	.	transcript "189"	
Adh	FGenesCGG3	CDS	581726	581877	.	+	.	transcript "189"	
Adh	FGenesCGG3	CDS	582235	582357	.	+	.	transcript "189"	
Adh	FGenesCGG3	CDS	582472	582610	.	+	.	transcript "189"	
Adh	FGenesCGG3	CDS	582857	583009	.	+	.	transcript "189"	
Adh	FGenesCGG3	stop_codon	583007	583009	.	+	.	transcript "189"	
Adh	FGenesCGG3	CDS	593868	594029	.	-	.	transcript "190"	
Adh	FGenesCGG3	start_codon	594027	594029	.	-	.	transcript "190"	
Adh	FGenesCGG3	stop_codon	593868	593870	.	-	.	transcript "190"	
Adh	FGenesCGG3	CDS	594119	594266	.	+	.	transcript "191"	
Adh	FGenesCGG3	start_codon	594119	594121	.	+	.	transcript "191"	
Adh	FGenesCGG3	CDS	595938	595982	.	+	.	transcript "191"	
Adh	FGenesCGG3	CDS	598008	598066	.	+	.	transcript "191"	
Adh	FGenesCGG3	CDS	598466	598796	.	+	.	transcript "191"	
Adh	FGenesCGG3	CDS	598857	599119	.	+	.	transcript "191"	
Adh	FGenesCGG3	CDS	599219	600433	.	+	.	transcript "191"	
Adh	FGenesCGG3	stop_codon	600431	600433	.	+	.	transcript "191"	
Adh	FGenesCGG3	CDS	595464	595743	.	-	.	transcript "192"	
Adh	FGenesCGG3	stop_codon	595464	595466	.	-	.	transcript "192"	
Adh	FGenesCGG3	CDS	596150	596217	.	-	.	transcript "192"	
Adh	FGenesCGG3	start_codon	596215	596217	.	-	.	transcript "192"	
Adh	FGenesCGG3	CDS	598403	598796	.	+	.	transcript "193"	
Adh	FGenesCGG3	start_codon	598403	598405	.	+	.	transcript "193"	
Adh	FGenesCGG3	CDS	598857	599119	.	+	.	transcript "193"	
Adh	FGenesCGG3	CDS	599219	600403	.	+	.	transcript "193"	
Adh	FGenesCGG3	CDS	601476	601487	.	+	.	transcript "193"	
Adh	FGenesCGG3	stop_codon	601485	601487	.	+	.	transcript "193"	
Adh	FGenesCGG3	CDS	601945	602354	.	-	.	transcript "194"	
Adh	FGenesCGG3	stop_codon	601945	601947	.	-	.	transcript "194"	
Adh	FGenesCGG3	CDS	602559	602889	.	-	.	transcript "194"	
Adh	FGenesCGG3	CDS	603886	604323	.	-	.	transcript "194"	
Adh	FGenesCGG3	CDS	607752	607819	.	-	.	transcript "194"	
Adh	FGenesCGG3	CDS	615333	615618	.	-	.	transcript "194"	
Adh	FGenesCGG3	CDS	616137	616184	.	-	.	transcript "194"	
Adh	FGenesCGG3	CDS	619451	619606	.	-	.	transcript "194"	
Adh	FGenesCGG3	CDS	619825	619938	.	-	.	transcript "194"	
Adh	FGenesCGG3	CDS	627803	627966	.	-	.	transcript "194"	
Adh	FGenesCGG3	CDS	628785	628852	.	-	.	transcript "194"	
Adh	FGenesCGG3	CDS	629799	629926	.	-	.	transcript "194"	
Adh	FGenesCGG3	start_codon	629924	629926	.	-	.	transcript "194"	
Adh	FGenesCGG3	CDS	601945	602889	.	-	.	transcript "195"	
Adh	FGenesCGG3	stop_codon	601945	601947	.	-	.	transcript "195"	
Adh	FGenesCGG3	CDS	602944	603000	.	-	.	transcript "195"	
Adh	FGenesCGG3	start_codon	602998	603000	.	-	.	transcript "195"	
Adh	FGenesCGG3	CDS	603442	604323	.	-	.	transcript "196"	
Adh	FGenesCGG3	stop_codon	603442	603444	.	-	.	transcript "196"	
Adh	FGenesCGG3	CDS	605361	605437	.	-	.	transcript "196"	
Adh	FGenesCGG3	CDS	605570	605825	.	-	.	transcript "196"	
Adh	FGenesCGG3	CDS	606937	607149	.	-	.	transcript "196"	
Adh	FGenesCGG3	start_codon	607147	607149	.	-	.	transcript "196"	
Adh	FGenesCGG3	CDS	615277	615618	.	-	.	transcript "197"	
Adh	FGenesCGG3	stop_codon	615277	615279	.	-	.	transcript "197"	
Adh	FGenesCGG3	CDS	616137	616184	.	-	.	transcript "197"	
Adh	FGenesCGG3	CDS	616273	616278	.	-	.	transcript "197"	
Adh	FGenesCGG3	start_codon	616276	616278	.	-	.	transcript "197"	
Adh	FGenesCGG3	CDS	616815	616952	.	+	.	transcript "198"	
Adh	FGenesCGG3	start_codon	616815	616817	.	+	.	transcript "198"	
Adh	FGenesCGG3	stop_codon	616950	616952	.	+	.	transcript "198"	
Adh	FGenesCGG3	CDS	620744	620914	.	-	.	transcript "199"	
Adh	FGenesCGG3	start_codon	620912	620914	.	-	.	transcript "199"	
Adh	FGenesCGG3	stop_codon	620744	620746	.	-	.	transcript "199"	
Adh	FGenesCGG3	CDS	625527	625549	.	+	.	transcript "200"	
Adh	FGenesCGG3	start_codon	625527	625529	.	+	.	transcript "200"	
Adh	FGenesCGG3	CDS	627680	628220	.	+	.	transcript "200"	
Adh	FGenesCGG3	CDS	628666	628884	.	+	.	transcript "200"	
Adh	FGenesCGG3	CDS	629137	629196	.	+	.	transcript "200"	
Adh	FGenesCGG3	stop_codon	629194	629196	.	+	.	transcript "200"	
Adh	FGenesCGG3	CDS	635015	635193	.	-	.	transcript "201"	
Adh	FGenesCGG3	stop_codon	635015	635017	.	-	.	transcript "201"	
Adh	FGenesCGG3	CDS	635867	635903	.	-	.	transcript "201"	
Adh	FGenesCGG3	start_codon	635901	635903	.	-	.	transcript "201"	
Adh	FGenesCGG3	CDS	636233	636494	.	-	.	transcript "202"	
Adh	FGenesCGG3	stop_codon	636233	636235	.	-	.	transcript "202"	
Adh	FGenesCGG3	CDS	637903	637994	.	-	.	transcript "202"	
Adh	FGenesCGG3	start_codon	637992	637994	.	-	.	transcript "202"	
Adh	FGenesCGG3	CDS	636233	636494	.	-	.	transcript "203"	
Adh	FGenesCGG3	stop_codon	636233	636235	.	-	.	transcript "203"	
Adh	FGenesCGG3	CDS	637626	637676	.	-	.	transcript "203"	
Adh	FGenesCGG3	CDS	639947	639998	.	-	.	transcript "203"	
Adh	FGenesCGG3	CDS	642934	642997	.	-	.	transcript "203"	
Adh	FGenesCGG3	start_codon	642995	642997	.	-	.	transcript "203"	
Adh	FGenesCGG3	CDS	639175	639609	.	+	.	transcript "204"	
Adh	FGenesCGG3	start_codon	639175	639177	.	+	.	transcript "204"	
Adh	FGenesCGG3	stop_codon	639607	639609	.	+	.	transcript "204"	
Adh	FGenesCGG3	CDS	645844	645912	.	+	.	transcript "205"	
Adh	FGenesCGG3	start_codon	645844	645846	.	+	.	transcript "205"	
Adh	FGenesCGG3	CDS	650611	651153	.	+	.	transcript "205"	
Adh	FGenesCGG3	CDS	651278	651478	.	+	.	transcript "205"	
Adh	FGenesCGG3	CDS	651583	652282	.	+	.	transcript "205"	
Adh	FGenesCGG3	CDS	652397	652722	.	+	.	transcript "205"	
Adh	FGenesCGG3	CDS	654408	654441	.	+	.	transcript "205"	
Adh	FGenesCGG3	CDS	655292	655918	.	+	.	transcript "205"	
Adh	FGenesCGG3	CDS	656051	656143	.	+	.	transcript "205"	
Adh	FGenesCGG3	CDS	656207	656368	.	+	.	transcript "205"	
Adh	FGenesCGG3	CDS	656501	656593	.	+	.	transcript "205"	
Adh	FGenesCGG3	CDS	656708	656922	.	+	.	transcript "205"	
Adh	FGenesCGG3	stop_codon	656920	656922	.	+	.	transcript "205"	
Adh	FGenesCGG3	CDS	649359	649372	.	+	.	transcript "206"	
Adh	FGenesCGG3	start_codon	649359	649361	.	+	.	transcript "206"	
Adh	FGenesCGG3	CDS	650568	651153	.	+	.	transcript "206"	
Adh	FGenesCGG3	CDS	651278	651478	.	+	.	transcript "206"	
Adh	FGenesCGG3	CDS	651583	652282	.	+	.	transcript "206"	
Adh	FGenesCGG3	CDS	652397	652824	.	+	.	transcript "206"	
Adh	FGenesCGG3	stop_codon	652822	652824	.	+	.	transcript "206"	
Adh	FGenesCGG3	CDS	654984	656897	.	-	.	transcript "207"	
Adh	FGenesCGG3	stop_codon	654984	654986	.	-	.	transcript "207"	
Adh	FGenesCGG3	CDS	656952	656954	.	-	.	transcript "207"	
Adh	FGenesCGG3	start_codon	656952	656954	.	-	.	transcript "207"	
Adh	FGenesCGG3	CDS	657691	658001	.	-	.	transcript "208"	
Adh	FGenesCGG3	stop_codon	657691	657693	.	-	.	transcript "208"	
Adh	FGenesCGG3	CDS	658058	658265	.	-	.	transcript "208"	
Adh	FGenesCGG3	CDS	658326	658463	.	-	.	transcript "208"	
Adh	FGenesCGG3	CDS	658526	659000	.	-	.	transcript "208"	
Adh	FGenesCGG3	CDS	659094	660852	.	-	.	transcript "208"	
Adh	FGenesCGG3	CDS	660917	661061	.	-	.	transcript "208"	
Adh	FGenesCGG3	CDS	661834	661866	.	-	.	transcript "208"	
Adh	FGenesCGG3	start_codon	661864	661866	.	-	.	transcript "208"	
Adh	FGenesCGG3	CDS	657691	658001	.	-	.	transcript "209"	
Adh	FGenesCGG3	stop_codon	657691	657693	.	-	.	transcript "209"	
Adh	FGenesCGG3	CDS	658130	658265	.	-	.	transcript "209"	
Adh	FGenesCGG3	CDS	658326	658463	.	-	.	transcript "209"	
Adh	FGenesCGG3	CDS	658526	658693	.	-	.	transcript "209"	
Adh	FGenesCGG3	start_codon	658691	658693	.	-	.	transcript "209"	
Adh	FGenesCGG3	CDS	659298	659392	.	+	.	transcript "210"	
Adh	FGenesCGG3	start_codon	659298	659300	.	+	.	transcript "210"	
Adh	FGenesCGG3	CDS	660112	660246	.	+	.	transcript "210"	
Adh	FGenesCGG3	CDS	661165	661349	.	+	.	transcript "210"	
Adh	FGenesCGG3	CDS	666826	666847	.	+	.	transcript "210"	
Adh	FGenesCGG3	CDS	668430	668616	.	+	.	transcript "210"	
Adh	FGenesCGG3	stop_codon	668614	668616	.	+	.	transcript "210"	
Adh	FGenesCGG3	CDS	669220	669469	.	-	.	transcript "211"	
Adh	FGenesCGG3	stop_codon	669220	669222	.	-	.	transcript "211"	
Adh	FGenesCGG3	CDS	674723	674754	.	-	.	transcript "211"	
Adh	FGenesCGG3	start_codon	674752	674754	.	-	.	transcript "211"	
Adh	FGenesCGG3	CDS	672131	672256	.	+	.	transcript "212"	
Adh	FGenesCGG3	start_codon	672131	672133	.	+	.	transcript "212"	
Adh	FGenesCGG3	stop_codon	672254	672256	.	+	.	transcript "212"	
Adh	FGenesCGG3	CDS	676875	676982	.	+	.	transcript "213"	
Adh	FGenesCGG3	start_codon	676875	676877	.	+	.	transcript "213"	
Adh	FGenesCGG3	stop_codon	676980	676982	.	+	.	transcript "213"	
Adh	FGenesCGG3	CDS	679874	680889	.	-	.	transcript "214"	
Adh	FGenesCGG3	stop_codon	679874	679876	.	-	.	transcript "214"	
Adh	FGenesCGG3	CDS	682600	682771	.	-	.	transcript "214"	
Adh	FGenesCGG3	CDS	682831	682969	.	-	.	transcript "214"	
Adh	FGenesCGG3	CDS	689469	689596	.	-	.	transcript "214"	
Adh	FGenesCGG3	CDS	689705	689746	.	-	.	transcript "214"	
Adh	FGenesCGG3	CDS	689811	689983	.	-	.	transcript "214"	
Adh	FGenesCGG3	CDS	690663	691029	.	-	.	transcript "214"	
Adh	FGenesCGG3	CDS	691393	691416	.	-	.	transcript "214"	
Adh	FGenesCGG3	start_codon	691414	691416	.	-	.	transcript "214"	
Adh	FGenesCGG3	CDS	679874	680889	.	-	.	transcript "215"	
Adh	FGenesCGG3	stop_codon	679874	679876	.	-	.	transcript "215"	
Adh	FGenesCGG3	CDS	681905	682015	.	-	.	transcript "215"	
Adh	FGenesCGG3	CDS	682600	682771	.	-	.	transcript "215"	
Adh	FGenesCGG3	CDS	682831	682969	.	-	.	transcript "215"	
Adh	FGenesCGG3	CDS	683154	683188	.	-	.	transcript "215"	
Adh	FGenesCGG3	start_codon	683186	683188	.	-	.	transcript "215"	
Adh	FGenesCGG3	CDS	687440	687521	.	-	.	transcript "216"	
Adh	FGenesCGG3	stop_codon	687440	687442	.	-	.	transcript "216"	
Adh	FGenesCGG3	CDS	689469	689746	.	-	.	transcript "216"	
Adh	FGenesCGG3	CDS	689811	689983	.	-	.	transcript "216"	
Adh	FGenesCGG3	CDS	690663	691029	.	-	.	transcript "216"	
Adh	FGenesCGG3	CDS	691393	691416	.	-	.	transcript "216"	
Adh	FGenesCGG3	start_codon	691414	691416	.	-	.	transcript "216"	
Adh	FGenesCGG3	CDS	694266	694399	.	+	.	transcript "217"	
Adh	FGenesCGG3	start_codon	694266	694268	.	+	.	transcript "217"	
Adh	FGenesCGG3	CDS	702582	702731	.	+	.	transcript "217"	
Adh	FGenesCGG3	CDS	718698	718938	.	+	.	transcript "217"	
Adh	FGenesCGG3	stop_codon	718936	718938	.	+	.	transcript "217"	
Adh	FGenesCGG3	CDS	709669	709681	.	+	.	transcript "218"	
Adh	FGenesCGG3	start_codon	709669	709671	.	+	.	transcript "218"	
Adh	FGenesCGG3	CDS	711348	711503	.	+	.	transcript "218"	
Adh	FGenesCGG3	CDS	711813	711937	.	+	.	transcript "218"	
Adh	FGenesCGG3	stop_codon	711935	711937	.	+	.	transcript "218"	
Adh	FGenesCGG3	CDS	717403	717437	.	-	.	transcript "219"	
Adh	FGenesCGG3	stop_codon	717403	717405	.	-	.	transcript "219"	
Adh	FGenesCGG3	CDS	717946	718024	.	-	.	transcript "219"	
Adh	FGenesCGG3	start_codon	718022	718024	.	-	.	transcript "219"	
Adh	FGenesCGG3	CDS	720743	720880	.	-	.	transcript "220"	
Adh	FGenesCGG3	stop_codon	720743	720745	.	-	.	transcript "220"	
Adh	FGenesCGG3	CDS	721551	721580	.	-	.	transcript "220"	
Adh	FGenesCGG3	start_codon	721578	721580	.	-	.	transcript "220"	
Adh	FGenesCGG3	CDS	723044	723076	.	+	.	transcript "221"	
Adh	FGenesCGG3	start_codon	723044	723046	.	+	.	transcript "221"	
Adh	FGenesCGG3	CDS	725159	725302	.	+	.	transcript "221"	
Adh	FGenesCGG3	CDS	727112	727338	.	+	.	transcript "221"	
Adh	FGenesCGG3	CDS	732694	732870	.	+	.	transcript "221"	
Adh	FGenesCGG3	CDS	734791	734838	.	+	.	transcript "221"	
Adh	FGenesCGG3	CDS	735103	735118	.	+	.	transcript "221"	
Adh	FGenesCGG3	stop_codon	735116	735118	.	+	.	transcript "221"	
Adh	FGenesCGG3	CDS	739579	739678	.	-	.	transcript "222"	
Adh	FGenesCGG3	stop_codon	739579	739581	.	-	.	transcript "222"	
Adh	FGenesCGG3	CDS	742902	743055	.	-	.	transcript "222"	
Adh	FGenesCGG3	CDS	743127	743145	.	-	.	transcript "222"	
Adh	FGenesCGG3	start_codon	743143	743145	.	-	.	transcript "222"	
Adh	FGenesCGG3	CDS	743981	744299	.	-	.	transcript "223"	
Adh	FGenesCGG3	stop_codon	743981	743983	.	-	.	transcript "223"	
Adh	FGenesCGG3	CDS	745333	745543	.	-	.	transcript "223"	
Adh	FGenesCGG3	CDS	747904	747997	.	-	.	transcript "223"	
Adh	FGenesCGG3	start_codon	747995	747997	.	-	.	transcript "223"	
Adh	FGenesCGG3	CDS	746770	747035	.	+	.	transcript "224"	
Adh	FGenesCGG3	start_codon	746770	746772	.	+	.	transcript "224"	
Adh	FGenesCGG3	CDS	747491	747584	.	+	.	transcript "224"	
Adh	FGenesCGG3	stop_codon	747582	747584	.	+	.	transcript "224"	
Adh	FGenesCGG3	CDS	749101	749175	.	+	.	transcript "225"	
Adh	FGenesCGG3	start_codon	749101	749103	.	+	.	transcript "225"	
Adh	FGenesCGG3	CDS	753465	753640	.	+	.	transcript "225"	
Adh	FGenesCGG3	CDS	755993	756089	.	+	.	transcript "225"	
Adh	FGenesCGG3	CDS	756663	756872	.	+	.	transcript "225"	
Adh	FGenesCGG3	stop_codon	756870	756872	.	+	.	transcript "225"	
Adh	FGenesCGG3	CDS	750487	750559	.	+	.	transcript "226"	
Adh	FGenesCGG3	start_codon	750487	750489	.	+	.	transcript "226"	
Adh	FGenesCGG3	CDS	750798	750862	.	+	.	transcript "226"	
Adh	FGenesCGG3	stop_codon	750860	750862	.	+	.	transcript "226"	
Adh	FGenesCGG3	CDS	752866	752914	.	+	.	transcript "227"	
Adh	FGenesCGG3	start_codon	752866	752868	.	+	.	transcript "227"	
Adh	FGenesCGG3	CDS	754035	754129	.	+	.	transcript "227"	
Adh	FGenesCGG3	CDS	754797	754879	.	+	.	transcript "227"	
Adh	FGenesCGG3	CDS	755993	756089	.	+	.	transcript "227"	
Adh	FGenesCGG3	CDS	756663	756872	.	+	.	transcript "227"	
Adh	FGenesCGG3	stop_codon	756870	756872	.	+	.	transcript "227"	
Adh	FGenesCGG3	CDS	757457	757859	.	+	.	transcript "228"	
Adh	FGenesCGG3	start_codon	757457	757459	.	+	.	transcript "228"	
Adh	FGenesCGG3	CDS	758794	759002	.	+	.	transcript "228"	
Adh	FGenesCGG3	stop_codon	759000	759002	.	+	.	transcript "228"	
Adh	FGenesCGG3	CDS	758346	758494	.	-	.	transcript "229"	
Adh	FGenesCGG3	stop_codon	758346	758348	.	-	.	transcript "229"	
Adh	FGenesCGG3	CDS	758657	758855	.	-	.	transcript "229"	
Adh	FGenesCGG3	start_codon	758853	758855	.	-	.	transcript "229"	
Adh	FGenesCGG3	CDS	760504	760595	.	-	.	transcript "230"	
Adh	FGenesCGG3	stop_codon	760504	760506	.	-	.	transcript "230"	
Adh	FGenesCGG3	CDS	760717	760726	.	-	.	transcript "230"	
Adh	FGenesCGG3	start_codon	760724	760726	.	-	.	transcript "230"	
Adh	FGenesCGG3	CDS	762767	762963	.	+	.	transcript "231"	
Adh	FGenesCGG3	start_codon	762767	762769	.	+	.	transcript "231"	
Adh	FGenesCGG3	CDS	768619	768676	.	+	.	transcript "231"	
Adh	FGenesCGG3	CDS	770544	770847	.	+	.	transcript "231"	
Adh	FGenesCGG3	CDS	771955	772295	.	+	.	transcript "231"	
Adh	FGenesCGG3	CDS	779692	781583	.	+	.	transcript "231"	
Adh	FGenesCGG3	CDS	781886	782694	.	+	.	transcript "231"	
Adh	FGenesCGG3	CDS	791586	791666	.	+	.	transcript "231"	
Adh	FGenesCGG3	CDS	802039	802157	.	+	.	transcript "231"	
Adh	FGenesCGG3	CDS	802790	802914	.	+	.	transcript "231"	
Adh	FGenesCGG3	CDS	809050	809272	.	+	.	transcript "231"	
Adh	FGenesCGG3	stop_codon	809270	809272	.	+	.	transcript "231"	
Adh	FGenesCGG3	CDS	771216	771615	.	+	.	transcript "232"	
Adh	FGenesCGG3	start_codon	771216	771218	.	+	.	transcript "232"	
Adh	FGenesCGG3	CDS	771955	772295	.	+	.	transcript "232"	
Adh	FGenesCGG3	CDS	773603	773614	.	+	.	transcript "232"	
Adh	FGenesCGG3	stop_codon	773612	773614	.	+	.	transcript "232"	
Adh	FGenesCGG3	CDS	771285	771386	.	+	.	transcript "233"	
Adh	FGenesCGG3	CDS	772047	772295	.	+	.	transcript "233"	
Adh	FGenesCGG3	CDS	779692	781583	.	+	.	transcript "233"	
Adh	FGenesCGG3	CDS	781886	781966	.	+	.	transcript "233"	
Adh	FGenesCGG3	CDS	781997	782694	.	+	.	transcript "233"	
Adh	FGenesCGG3	CDS	801976	802914	.	+	.	transcript "233"	
Adh	FGenesCGG3	CDS	813291	814049	.	+	.	transcript "233"	
Adh	FGenesCGG3	CDS	814794	814981	.	+	.	transcript "233"	
Adh	FGenesCGG3	CDS	815046	815442	.	+	.	transcript "233"	
Adh	FGenesCGG3	CDS	815528	815648	.	+	.	transcript "233"	
Adh	FGenesCGG3	CDS	815697	817215	.	+	.	transcript "233"	
Adh	FGenesCGG3	CDS	817273	818025	.	+	.	transcript "233"	
Adh	FGenesCGG3	CDS	818664	819290	.	+	.	transcript "233"	
Adh	FGenesCGG3	CDS	820171	820789	.	+	.	transcript "233"	
Adh	FGenesCGG3	CDS	820846	820979	.	+	.	transcript "233"	
Adh	FGenesCGG3	CDS	821037	821265	.	+	.	transcript "233"	
Adh	FGenesCGG3	CDS	776892	777080	.	-	.	transcript "234"	
Adh	FGenesCGG3	stop_codon	776892	776894	.	-	.	transcript "234"	
Adh	FGenesCGG3	CDS	777991	778035	.	-	.	transcript "234"	
Adh	FGenesCGG3	start_codon	778033	778035	.	-	.	transcript "234"	
Adh	FGenesCGG3	CDS	778866	778901	.	+	.	transcript "235"	
Adh	FGenesCGG3	start_codon	778866	778868	.	+	.	transcript "235"	
Adh	FGenesCGG3	CDS	779692	781583	.	+	.	transcript "235"	
Adh	FGenesCGG3	CDS	781886	782694	.	+	.	transcript "235"	
Adh	FGenesCGG3	CDS	783624	783727	.	+	.	transcript "235"	
Adh	FGenesCGG3	stop_codon	783725	783727	.	+	.	transcript "235"	
Adh	FGenesCGG3	CDS	786291	786427	.	-	.	transcript "236"	
Adh	FGenesCGG3	stop_codon	786291	786293	.	-	.	transcript "236"	
Adh	FGenesCGG3	CDS	786632	786758	.	-	.	transcript "236"	
Adh	FGenesCGG3	CDS	787968	788261	.	-	.	transcript "236"	
Adh	FGenesCGG3	start_codon	788259	788261	.	-	.	transcript "236"	
Adh	FGenesCGG3	CDS	790057	790146	.	-	.	transcript "237"	
Adh	FGenesCGG3	stop_codon	790057	790059	.	-	.	transcript "237"	
Adh	FGenesCGG3	CDS	790613	790678	.	-	.	transcript "237"	
Adh	FGenesCGG3	start_codon	790676	790678	.	-	.	transcript "237"	
Adh	FGenesCGG3	CDS	801924	802736	.	+	.	transcript "238"	
Adh	FGenesCGG3	start_codon	801924	801926	.	+	.	transcript "238"	
Adh	FGenesCGG3	stop_codon	802734	802736	.	+	.	transcript "238"	
Adh	FGenesCGG3	CDS	803172	803299	.	-	.	transcript "239"	
Adh	FGenesCGG3	stop_codon	803172	803174	.	-	.	transcript "239"	
Adh	FGenesCGG3	CDS	803973	804081	.	-	.	transcript "239"	
Adh	FGenesCGG3	start_codon	804079	804081	.	-	.	transcript "239"	
Adh	FGenesCGG3	CDS	811756	811788	.	-	.	transcript "240"	
Adh	FGenesCGG3	stop_codon	811756	811758	.	-	.	transcript "240"	
Adh	FGenesCGG3	CDS	812774	812923	.	-	.	transcript "240"	
Adh	FGenesCGG3	start_codon	812921	812923	.	-	.	transcript "240"	
Adh	FGenesCGG3	CDS	812113	812412	.	-	.	transcript "241"	
Adh	FGenesCGG3	start_codon	812410	812412	.	-	.	transcript "241"	
Adh	FGenesCGG3	stop_codon	812113	812115	.	-	.	transcript "241"	
Adh	FGenesCGG3	CDS	812924	812990	.	+	.	transcript "242"	
Adh	FGenesCGG3	start_codon	812924	812926	.	+	.	transcript "242"	
Adh	FGenesCGG3	CDS	813291	814650	.	+	.	transcript "242"	
Adh	FGenesCGG3	CDS	814726	814981	.	+	.	transcript "242"	
Adh	FGenesCGG3	CDS	815046	815442	.	+	.	transcript "242"	
Adh	FGenesCGG3	CDS	815528	817215	.	+	.	transcript "242"	
Adh	FGenesCGG3	CDS	817273	818025	.	+	.	transcript "242"	
Adh	FGenesCGG3	CDS	818086	818367	.	+	.	transcript "242"	
Adh	FGenesCGG3	CDS	818447	818574	.	+	.	transcript "242"	
Adh	FGenesCGG3	CDS	818633	819290	.	+	.	transcript "242"	
Adh	FGenesCGG3	CDS	820171	820789	.	+	.	transcript "242"	
Adh	FGenesCGG3	CDS	820846	820979	.	+	.	transcript "242"	
Adh	FGenesCGG3	CDS	821037	821265	.	+	.	transcript "242"	
Adh	FGenesCGG3	CDS	821333	821487	.	+	.	transcript "242"	
Adh	FGenesCGG3	stop_codon	821485	821487	.	+	.	transcript "242"	
Adh	FGenesCGG3	CDS	813931	814049	.	+	.	transcript "243"	
Adh	FGenesCGG3	start_codon	813931	813933	.	+	.	transcript "243"	
Adh	FGenesCGG3	CDS	814726	814981	.	+	.	transcript "243"	
Adh	FGenesCGG3	CDS	815046	815442	.	+	.	transcript "243"	
Adh	FGenesCGG3	CDS	815528	815844	.	+	.	transcript "243"	
Adh	FGenesCGG3	CDS	815959	817215	.	+	.	transcript "243"	
Adh	FGenesCGG3	CDS	817273	818025	.	+	.	transcript "243"	
Adh	FGenesCGG3	CDS	818086	818367	.	+	.	transcript "243"	
Adh	FGenesCGG3	CDS	818447	818574	.	+	.	transcript "243"	
Adh	FGenesCGG3	CDS	818633	819290	.	+	.	transcript "243"	
Adh	FGenesCGG3	CDS	820171	820789	.	+	.	transcript "243"	
Adh	FGenesCGG3	CDS	820846	820979	.	+	.	transcript "243"	
Adh	FGenesCGG3	CDS	822175	822454	.	+	.	transcript "243"	
Adh	FGenesCGG3	CDS	822511	822848	.	+	.	transcript "243"	
Adh	FGenesCGG3	CDS	822907	824011	.	+	.	transcript "243"	
Adh	FGenesCGG3	CDS	824074	824324	.	+	.	transcript "243"	
Adh	FGenesCGG3	CDS	824409	824822	.	+	.	transcript "243"	
Adh	FGenesCGG3	CDS	824951	825688	.	+	.	transcript "243"	
Adh	FGenesCGG3	CDS	825804	826423	.	+	.	transcript "243"	
Adh	FGenesCGG3	CDS	826499	826653	.	+	.	transcript "243"	
Adh	FGenesCGG3	CDS	826714	826921	.	+	.	transcript "243"	
Adh	FGenesCGG3	CDS	826980	827087	.	+	.	transcript "243"	
Adh	FGenesCGG3	CDS	827148	827511	.	+	.	transcript "243"	
Adh	FGenesCGG3	stop_codon	827509	827511	.	+	.	transcript "243"	
Adh	FGenesCGG3	CDS	822205	822454	.	+	.	transcript "244"	
Adh	FGenesCGG3	start_codon	822205	822207	.	+	.	transcript "244"	
Adh	FGenesCGG3	CDS	822511	822848	.	+	.	transcript "244"	
Adh	FGenesCGG3	CDS	822907	824011	.	+	.	transcript "244"	
Adh	FGenesCGG3	CDS	824074	824822	.	+	.	transcript "244"	
Adh	FGenesCGG3	CDS	824885	825688	.	+	.	transcript "244"	
Adh	FGenesCGG3	CDS	825804	826423	.	+	.	transcript "244"	
Adh	FGenesCGG3	CDS	826499	826653	.	+	.	transcript "244"	
Adh	FGenesCGG3	CDS	826714	826921	.	+	.	transcript "244"	
Adh	FGenesCGG3	CDS	826980	827087	.	+	.	transcript "244"	
Adh	FGenesCGG3	CDS	827148	827511	.	+	.	transcript "244"	
Adh	FGenesCGG3	stop_codon	827509	827511	.	+	.	transcript "244"	
Adh	FGenesCGG3	CDS	828047	828306	.	+	.	transcript "245"	
Adh	FGenesCGG3	start_codon	828047	828049	.	+	.	transcript "245"	
Adh	FGenesCGG3	CDS	828490	828493	.	+	.	transcript "245"	
Adh	FGenesCGG3	stop_codon	828491	828493	.	+	.	transcript "245"	
Adh	FGenesCGG3	CDS	829045	829051	.	-	.	transcript "246"	
Adh	FGenesCGG3	stop_codon	829045	829047	.	-	.	transcript "246"	
Adh	FGenesCGG3	CDS	829219	829427	.	-	.	transcript "246"	
Adh	FGenesCGG3	CDS	829580	829591	.	-	.	transcript "246"	
Adh	FGenesCGG3	start_codon	829589	829591	.	-	.	transcript "246"	
Adh	FGenesCGG3	CDS	832137	833130	.	+	.	transcript "247"	
Adh	FGenesCGG3	start_codon	832137	832139	.	+	.	transcript "247"	
Adh	FGenesCGG3	CDS	835043	835158	.	+	.	transcript "247"	
Adh	FGenesCGG3	CDS	835203	835312	.	+	.	transcript "247"	
Adh	FGenesCGG3	CDS	836979	837106	.	+	.	transcript "247"	
Adh	FGenesCGG3	CDS	837764	837859	.	+	.	transcript "247"	
Adh	FGenesCGG3	CDS	837919	838152	.	+	.	transcript "247"	
Adh	FGenesCGG3	CDS	838217	838981	.	+	.	transcript "247"	
Adh	FGenesCGG3	CDS	840111	840169	.	+	.	transcript "247"	
Adh	FGenesCGG3	stop_codon	840167	840169	.	+	.	transcript "247"	
Adh	FGenesCGG3	CDS	832137	833672	.	+	.	transcript "248"	
Adh	FGenesCGG3	start_codon	832137	832139	.	+	.	transcript "248"	
Adh	FGenesCGG3	stop_codon	833670	833672	.	+	.	transcript "248"	
Adh	FGenesCGG3	CDS	834884	834897	.	+	.	transcript "249"	
Adh	FGenesCGG3	start_codon	834884	834886	.	+	.	transcript "249"	
Adh	FGenesCGG3	CDS	835043	835312	.	+	.	transcript "249"	
Adh	FGenesCGG3	CDS	836514	837106	.	+	.	transcript "249"	
Adh	FGenesCGG3	CDS	837173	837428	.	+	.	transcript "249"	
Adh	FGenesCGG3	CDS	837486	837859	.	+	.	transcript "249"	
Adh	FGenesCGG3	CDS	837919	838152	.	+	.	transcript "249"	
Adh	FGenesCGG3	CDS	838217	839076	.	+	.	transcript "249"	
Adh	FGenesCGG3	stop_codon	839074	839076	.	+	.	transcript "249"	
Adh	FGenesCGG3	CDS	839671	840390	.	-	.	transcript "250"	
Adh	FGenesCGG3	start_codon	840388	840390	.	-	.	transcript "250"	
Adh	FGenesCGG3	stop_codon	839671	839673	.	-	.	transcript "250"	
Adh	FGenesCGG3	CDS	841091	841333	.	-	.	transcript "251"	
Adh	FGenesCGG3	stop_codon	841091	841093	.	-	.	transcript "251"	
Adh	FGenesCGG3	CDS	841389	841969	.	-	.	transcript "251"	
Adh	FGenesCGG3	CDS	842034	842442	.	-	.	transcript "251"	
Adh	FGenesCGG3	start_codon	842440	842442	.	-	.	transcript "251"	
Adh	FGenesCGG3	CDS	841091	841333	.	-	.	transcript "252"	
Adh	FGenesCGG3	stop_codon	841091	841093	.	-	.	transcript "252"	
Adh	FGenesCGG3	CDS	841389	841969	.	-	.	transcript "252"	
Adh	FGenesCGG3	CDS	842034	842109	.	-	.	transcript "252"	
Adh	FGenesCGG3	start_codon	842107	842109	.	-	.	transcript "252"	
Adh	FGenesCGG3	CDS	842968	843375	.	-	.	transcript "253"	
Adh	FGenesCGG3	stop_codon	842968	842970	.	-	.	transcript "253"	
Adh	FGenesCGG3	CDS	843445	843518	.	-	.	transcript "253"	
Adh	FGenesCGG3	CDS	847272	847372	.	-	.	transcript "253"	
Adh	FGenesCGG3	CDS	847433	848154	.	-	.	transcript "253"	
Adh	FGenesCGG3	CDS	848208	848348	.	-	.	transcript "253"	
Adh	FGenesCGG3	start_codon	848346	848348	.	-	.	transcript "253"	
Adh	FGenesCGG3	CDS	842968	843375	.	-	.	transcript "254"	
Adh	FGenesCGG3	stop_codon	842968	842970	.	-	.	transcript "254"	
Adh	FGenesCGG3	CDS	843445	843518	.	-	.	transcript "254"	
Adh	FGenesCGG3	CDS	843799	843808	.	-	.	transcript "254"	
Adh	FGenesCGG3	start_codon	843806	843808	.	-	.	transcript "254"	
Adh	FGenesCGG3	CDS	845892	846081	.	+	.	transcript "255"	
Adh	FGenesCGG3	start_codon	845892	845894	.	+	.	transcript "255"	
Adh	FGenesCGG3	CDS	846134	846339	.	+	.	transcript "255"	
Adh	FGenesCGG3	stop_codon	846337	846339	.	+	.	transcript "255"	
Adh	FGenesCGG3	CDS	846397	847372	.	-	.	transcript "256"	
Adh	FGenesCGG3	stop_codon	846397	846399	.	-	.	transcript "256"	
Adh	FGenesCGG3	CDS	847433	848154	.	-	.	transcript "256"	
Adh	FGenesCGG3	CDS	848208	848498	.	-	.	transcript "256"	
Adh	FGenesCGG3	start_codon	848496	848498	.	-	.	transcript "256"	
Adh	FGenesCGG3	CDS	851077	851190	.	+	.	transcript "257"	
Adh	FGenesCGG3	start_codon	851077	851079	.	+	.	transcript "257"	
Adh	FGenesCGG3	CDS	851256	851436	.	+	.	transcript "257"	
Adh	FGenesCGG3	CDS	851491	851673	.	+	.	transcript "257"	
Adh	FGenesCGG3	CDS	851742	851919	.	+	.	transcript "257"	
Adh	FGenesCGG3	stop_codon	851917	851919	.	+	.	transcript "257"	
Adh	FGenesCGG3	CDS	853116	855014	.	+	.	transcript "258"	
Adh	FGenesCGG3	start_codon	853116	853118	.	+	.	transcript "258"	
Adh	FGenesCGG3	stop_codon	855012	855014	.	+	.	transcript "258"	
Adh	FGenesCGG3	CDS	853119	855014	.	+	.	transcript "259"	
Adh	FGenesCGG3	start_codon	853119	853121	.	+	.	transcript "259"	
Adh	FGenesCGG3	stop_codon	855012	855014	.	+	.	transcript "259"	
Adh	FGenesCGG3	CDS	855874	855922	.	+	.	transcript "260"	
Adh	FGenesCGG3	start_codon	855874	855876	.	+	.	transcript "260"	
Adh	FGenesCGG3	CDS	855982	856031	.	+	.	transcript "260"	
Adh	FGenesCGG3	stop_codon	856029	856031	.	+	.	transcript "260"	
Adh	FGenesCGG3	CDS	856092	856876	.	+	.	transcript "261"	
Adh	FGenesCGG3	start_codon	856092	856094	.	+	.	transcript "261"	
Adh	FGenesCGG3	CDS	856942	858029	.	+	.	transcript "261"	
Adh	FGenesCGG3	CDS	858109	858341	.	+	.	transcript "261"	
Adh	FGenesCGG3	CDS	858418	858966	.	+	.	transcript "261"	
Adh	FGenesCGG3	stop_codon	858964	858966	.	+	.	transcript "261"	
Adh	FGenesCGG3	CDS	860352	860389	.	+	.	transcript "262"	
Adh	FGenesCGG3	start_codon	860352	860354	.	+	.	transcript "262"	
Adh	FGenesCGG3	CDS	861377	861535	.	+	.	transcript "262"	
Adh	FGenesCGG3	CDS	870713	870959	.	+	.	transcript "262"	
Adh	FGenesCGG3	stop_codon	870957	870959	.	+	.	transcript "262"	
Adh	FGenesCGG3	CDS	864677	865018	.	-	.	transcript "263"	
Adh	FGenesCGG3	stop_codon	864677	864679	.	-	.	transcript "263"	
Adh	FGenesCGG3	CDS	865295	865345	.	-	.	transcript "263"	
Adh	FGenesCGG3	start_codon	865343	865345	.	-	.	transcript "263"	
Adh	FGenesCGG3	CDS	870684	870866	.	-	.	transcript "264"	
Adh	FGenesCGG3	start_codon	870864	870866	.	-	.	transcript "264"	
Adh	FGenesCGG3	stop_codon	870684	870686	.	-	.	transcript "264"	
Adh	FGenesCGG3	CDS	872557	872818	.	-	.	transcript "265"	
Adh	FGenesCGG3	stop_codon	872557	872559	.	-	.	transcript "265"	
Adh	FGenesCGG3	CDS	872891	873131	.	-	.	transcript "265"	
Adh	FGenesCGG3	CDS	873191	873321	.	-	.	transcript "265"	
Adh	FGenesCGG3	CDS	873388	873527	.	-	.	transcript "265"	
Adh	FGenesCGG3	CDS	873583	874093	.	-	.	transcript "265"	
Adh	FGenesCGG3	CDS	874278	874541	.	-	.	transcript "265"	
Adh	FGenesCGG3	CDS	874599	874870	.	-	.	transcript "265"	
Adh	FGenesCGG3	start_codon	874868	874870	.	-	.	transcript "265"	
Adh	FGenesCGG3	CDS	880130	880375	.	+	.	transcript "266"	
Adh	FGenesCGG3	start_codon	880130	880132	.	+	.	transcript "266"	
Adh	FGenesCGG3	CDS	880538	880627	.	+	.	transcript "266"	
Adh	FGenesCGG3	stop_codon	880625	880627	.	+	.	transcript "266"	
Adh	FGenesCGG3	CDS	880500	880651	.	-	.	transcript "267"	
Adh	FGenesCGG3	stop_codon	880500	880502	.	-	.	transcript "267"	
Adh	FGenesCGG3	CDS	883002	883287	.	-	.	transcript "267"	
Adh	FGenesCGG3	start_codon	883285	883287	.	-	.	transcript "267"	
Adh	FGenesCGG3	CDS	880859	881091	.	-	.	transcript "268"	
Adh	FGenesCGG3	stop_codon	880859	880861	.	-	.	transcript "268"	
Adh	FGenesCGG3	CDS	883002	883191	.	-	.	transcript "268"	
Adh	FGenesCGG3	CDS	883357	883413	.	-	.	transcript "268"	
Adh	FGenesCGG3	CDS	883872	883874	.	-	.	transcript "268"	
Adh	FGenesCGG3	start_codon	883872	883874	.	-	.	transcript "268"	
Adh	FGenesCGG3	CDS	884916	885676	.	-	.	transcript "269"	
Adh	FGenesCGG3	stop_codon	884916	884918	.	-	.	transcript "269"	
Adh	FGenesCGG3	CDS	885967	886798	.	-	.	transcript "269"	
Adh	FGenesCGG3	CDS	902105	902141	.	-	.	transcript "269"	
Adh	FGenesCGG3	CDS	904085	904200	.	-	.	transcript "269"	
Adh	FGenesCGG3	start_codon	904198	904200	.	-	.	transcript "269"	
Adh	FGenesCGG3	CDS	884916	885676	.	-	.	transcript "270"	
Adh	FGenesCGG3	stop_codon	884916	884918	.	-	.	transcript "270"	
Adh	FGenesCGG3	CDS	885967	886798	.	-	.	transcript "270"	
Adh	FGenesCGG3	CDS	887175	887252	.	-	.	transcript "270"	
Adh	FGenesCGG3	start_codon	887250	887252	.	-	.	transcript "270"	
Adh	FGenesCGG3	CDS	907735	907832	.	-	.	transcript "271"	
Adh	FGenesCGG3	stop_codon	907735	907737	.	-	.	transcript "271"	
Adh	FGenesCGG3	CDS	908216	908267	.	-	.	transcript "271"	
Adh	FGenesCGG3	start_codon	908265	908267	.	-	.	transcript "271"	
Adh	FGenesCGG3	CDS	909825	909970	.	-	.	transcript "272"	
Adh	FGenesCGG3	stop_codon	909825	909827	.	-	.	transcript "272"	
Adh	FGenesCGG3	CDS	913325	913565	.	-	.	transcript "272"	
Adh	FGenesCGG3	start_codon	913563	913565	.	-	.	transcript "272"	
Adh	FGenesCGG3	CDS	910572	910742	.	-	.	transcript "273"	
Adh	FGenesCGG3	stop_codon	910572	910574	.	-	.	transcript "273"	
Adh	FGenesCGG3	CDS	910801	911055	.	-	.	transcript "273"	
Adh	FGenesCGG3	start_codon	911053	911055	.	-	.	transcript "273"	
Adh	FGenesCGG3	CDS	918151	918795	.	-	.	transcript "274"	
Adh	FGenesCGG3	stop_codon	918151	918153	.	-	.	transcript "274"	
Adh	FGenesCGG3	CDS	921839	921968	.	-	.	transcript "274"	
Adh	FGenesCGG3	CDS	927072	927193	.	-	.	transcript "274"	
Adh	FGenesCGG3	start_codon	927191	927193	.	-	.	transcript "274"	
Adh	FGenesCGG3	CDS	918151	918795	.	-	.	transcript "275"	
Adh	FGenesCGG3	stop_codon	918151	918153	.	-	.	transcript "275"	
Adh	FGenesCGG3	CDS	918858	918869	.	-	.	transcript "275"	
Adh	FGenesCGG3	start_codon	918867	918869	.	-	.	transcript "275"	
Adh	FGenesCGG3	CDS	928269	928304	.	-	.	transcript "276"	
Adh	FGenesCGG3	stop_codon	928269	928271	.	-	.	transcript "276"	
Adh	FGenesCGG3	CDS	930526	930606	.	-	.	transcript "276"	
Adh	FGenesCGG3	start_codon	930604	930606	.	-	.	transcript "276"	
Adh	FGenesCGG3	CDS	930979	931038	.	+	.	transcript "277"	
Adh	FGenesCGG3	start_codon	930979	930981	.	+	.	transcript "277"	
Adh	FGenesCGG3	CDS	932245	932466	.	+	.	transcript "277"	
Adh	FGenesCGG3	stop_codon	932464	932466	.	+	.	transcript "277"	
Adh	FGenesCGG3	CDS	934251	934385	.	-	.	transcript "278"	
Adh	FGenesCGG3	stop_codon	934251	934253	.	-	.	transcript "278"	
Adh	FGenesCGG3	CDS	934678	934704	.	-	.	transcript "278"	
Adh	FGenesCGG3	start_codon	934702	934704	.	-	.	transcript "278"	
Adh	FGenesCGG3	CDS	937116	937129	.	-	.	transcript "279"	
Adh	FGenesCGG3	stop_codon	937116	937118	.	-	.	transcript "279"	
Adh	FGenesCGG3	CDS	937497	937554	.	-	.	transcript "279"	
Adh	FGenesCGG3	CDS	941351	941470	.	-	.	transcript "279"	
Adh	FGenesCGG3	start_codon	941468	941470	.	-	.	transcript "279"	
Adh	FGenesCGG3	CDS	944218	944529	.	-	.	transcript "280"	
Adh	FGenesCGG3	stop_codon	944218	944220	.	-	.	transcript "280"	
Adh	FGenesCGG3	CDS	944917	945163	.	-	.	transcript "280"	
Adh	FGenesCGG3	CDS	947200	947366	.	-	.	transcript "280"	
Adh	FGenesCGG3	start_codon	947364	947366	.	-	.	transcript "280"	
Adh	FGenesCGG3	CDS	945056	945150	.	+	.	transcript "281"	
Adh	FGenesCGG3	start_codon	945056	945058	.	+	.	transcript "281"	
Adh	FGenesCGG3	CDS	949292	949350	.	+	.	transcript "281"	
Adh	FGenesCGG3	CDS	949394	949779	.	+	.	transcript "281"	
Adh	FGenesCGG3	stop_codon	949777	949779	.	+	.	transcript "281"	
Adh	FGenesCGG3	CDS	951472	951760	.	-	.	transcript "282"	
Adh	FGenesCGG3	stop_codon	951472	951474	.	-	.	transcript "282"	
Adh	FGenesCGG3	CDS	955104	955289	.	-	.	transcript "282"	
Adh	FGenesCGG3	CDS	958832	958886	.	-	.	transcript "282"	
Adh	FGenesCGG3	CDS	960014	960167	.	-	.	transcript "282"	
Adh	FGenesCGG3	start_codon	960165	960167	.	-	.	transcript "282"	
Adh	FGenesCGG3	CDS	961162	962655	.	-	.	transcript "283"	
Adh	FGenesCGG3	start_codon	962653	962655	.	-	.	transcript "283"	
Adh	FGenesCGG3	stop_codon	961162	961164	.	-	.	transcript "283"	
Adh	FGenesCGG3	CDS	963824	963923	.	-	.	transcript "284"	
Adh	FGenesCGG3	stop_codon	963824	963826	.	-	.	transcript "284"	
Adh	FGenesCGG3	CDS	964369	964444	.	-	.	transcript "284"	
Adh	FGenesCGG3	CDS	965231	965579	.	-	.	transcript "284"	
Adh	FGenesCGG3	start_codon	965577	965579	.	-	.	transcript "284"	
Adh	FGenesCGG3	CDS	964272	964449	.	+	.	transcript "285"	
Adh	FGenesCGG3	start_codon	964272	964274	.	+	.	transcript "285"	
Adh	FGenesCGG3	CDS	965180	965196	.	+	.	transcript "285"	
Adh	FGenesCGG3	CDS	965417	965686	.	+	.	transcript "285"	
Adh	FGenesCGG3	stop_codon	965684	965686	.	+	.	transcript "285"	
Adh	FGenesCGG3	CDS	971207	971303	.	+	.	transcript "286"	
Adh	FGenesCGG3	start_codon	971207	971209	.	+	.	transcript "286"	
Adh	FGenesCGG3	CDS	974363	974523	.	+	.	transcript "286"	
Adh	FGenesCGG3	stop_codon	974521	974523	.	+	.	transcript "286"	
Adh	FGenesCGG3	CDS	971434	971529	.	-	.	transcript "287"	
Adh	FGenesCGG3	stop_codon	971434	971436	.	-	.	transcript "287"	
Adh	FGenesCGG3	CDS	972865	972925	.	-	.	transcript "287"	
Adh	FGenesCGG3	CDS	973892	973911	.	-	.	transcript "287"	
Adh	FGenesCGG3	start_codon	973909	973911	.	-	.	transcript "287"	
Adh	FGenesCGG3	CDS	977517	977637	.	+	.	transcript "288"	
Adh	FGenesCGG3	start_codon	977517	977519	.	+	.	transcript "288"	
Adh	FGenesCGG3	CDS	979569	979743	.	+	.	transcript "288"	
Adh	FGenesCGG3	CDS	980979	981168	.	+	.	transcript "288"	
Adh	FGenesCGG3	stop_codon	981166	981168	.	+	.	transcript "288"	
Adh	FGenesCGG3	CDS	978607	978632	.	+	.	transcript "289"	
Adh	FGenesCGG3	start_codon	978607	978609	.	+	.	transcript "289"	
Adh	FGenesCGG3	CDS	979459	979743	.	+	.	transcript "289"	
Adh	FGenesCGG3	CDS	979878	980124	.	+	.	transcript "289"	
Adh	FGenesCGG3	stop_codon	980122	980124	.	+	.	transcript "289"	
Adh	FGenesCGG3	CDS	980240	980419	.	-	.	transcript "290"	
Adh	FGenesCGG3	start_codon	980417	980419	.	-	.	transcript "290"	
Adh	FGenesCGG3	stop_codon	980240	980242	.	-	.	transcript "290"	
Adh	FGenesCGG3	CDS	981345	981373	.	+	.	transcript "291"	
Adh	FGenesCGG3	start_codon	981345	981347	.	+	.	transcript "291"	
Adh	FGenesCGG3	CDS	981685	981793	.	+	.	transcript "291"	
Adh	FGenesCGG3	CDS	981935	982019	.	+	.	transcript "291"	
Adh	FGenesCGG3	CDS	982441	982481	.	+	.	transcript "291"	
Adh	FGenesCGG3	stop_codon	982479	982481	.	+	.	transcript "291"	
Adh	FGenesCGG3	CDS	984088	984804	.	+	.	transcript "292"	
Adh	FGenesCGG3	start_codon	984088	984090	.	+	.	transcript "292"	
Adh	FGenesCGG3	stop_codon	984802	984804	.	+	.	transcript "292"	
Adh	FGenesCGG3	CDS	984981	985070	.	+	.	transcript "293"	
Adh	FGenesCGG3	start_codon	984981	984983	.	+	.	transcript "293"	
Adh	FGenesCGG3	CDS	985373	986896	.	+	.	transcript "293"	
Adh	FGenesCGG3	stop_codon	986894	986896	.	+	.	transcript "293"	
Adh	FGenesCGG3	CDS	990948	990977	.	-	.	transcript "294"	
Adh	FGenesCGG3	stop_codon	990948	990950	.	-	.	transcript "294"	
Adh	FGenesCGG3	CDS	997414	997461	.	-	.	transcript "294"	
Adh	FGenesCGG3	CDS	998267	998341	.	-	.	transcript "294"	
Adh	FGenesCGG3	start_codon	998339	998341	.	-	.	transcript "294"	
Adh	FGenesCGG3	CDS	999524	999730	.	+	.	transcript "295"	
Adh	FGenesCGG3	start_codon	999524	999526	.	+	.	transcript "295"	
Adh	FGenesCGG3	CDS	1001509	1001644	.	+	.	transcript "295"	
Adh	FGenesCGG3	CDS	1001778	1001794	.	+	.	transcript "295"	
Adh	FGenesCGG3	stop_codon	1001792	1001794	.	+	.	transcript "295"	
Adh	FGenesCGG3	CDS	1002644	1002767	.	-	.	transcript "296"	
Adh	FGenesCGG3	stop_codon	1002644	1002646	.	-	.	transcript "296"	
Adh	FGenesCGG3	CDS	1003293	1003318	.	-	.	transcript "296"	
Adh	FGenesCGG3	start_codon	1003316	1003318	.	-	.	transcript "296"	
Adh	FGenesCGG3	CDS	1006438	1006597	.	-	.	transcript "297"	
Adh	FGenesCGG3	stop_codon	1006438	1006440	.	-	.	transcript "297"	
Adh	FGenesCGG3	CDS	1007537	1007583	.	-	.	transcript "297"	
Adh	FGenesCGG3	start_codon	1007581	1007583	.	-	.	transcript "297"	
Adh	FGenesCGG3	CDS	1006438	1006597	.	-	.	transcript "298"	
Adh	FGenesCGG3	stop_codon	1006438	1006440	.	-	.	transcript "298"	
Adh	FGenesCGG3	CDS	1007013	1007285	.	-	.	transcript "298"	
Adh	FGenesCGG3	CDS	1007537	1007583	.	-	.	transcript "298"	
Adh	FGenesCGG3	start_codon	1007581	1007583	.	-	.	transcript "298"	
Adh	FGenesCGG3	CDS	1010327	1010366	.	+	.	transcript "299"	
Adh	FGenesCGG3	start_codon	1010327	1010329	.	+	.	transcript "299"	
Adh	FGenesCGG3	CDS	1012157	1012254	.	+	.	transcript "299"	
Adh	FGenesCGG3	CDS	1012569	1012679	.	+	.	transcript "299"	
Adh	FGenesCGG3	stop_codon	1012677	1012679	.	+	.	transcript "299"	
Adh	FGenesCGG3	CDS	1012748	1012807	.	+	.	transcript "300"	
Adh	FGenesCGG3	start_codon	1012748	1012750	.	+	.	transcript "300"	
Adh	FGenesCGG3	CDS	1013394	1013756	.	+	.	transcript "300"	
Adh	FGenesCGG3	stop_codon	1013754	1013756	.	+	.	transcript "300"	
Adh	FGenesCGG3	CDS	1013753	1013890	.	+	.	transcript "301"	
Adh	FGenesCGG3	start_codon	1013753	1013755	.	+	.	transcript "301"	
Adh	FGenesCGG3	CDS	1018766	1018852	.	+	.	transcript "301"	
Adh	FGenesCGG3	CDS	1018978	1019148	.	+	.	transcript "301"	
Adh	FGenesCGG3	CDS	1020632	1020691	.	+	.	transcript "301"	
Adh	FGenesCGG3	CDS	1023921	1023986	.	+	.	transcript "301"	
Adh	FGenesCGG3	CDS	1036483	1036590	.	+	.	transcript "301"	
Adh	FGenesCGG3	CDS	1039058	1039394	.	+	.	transcript "301"	
Adh	FGenesCGG3	CDS	1039891	1039919	.	+	.	transcript "301"	
Adh	FGenesCGG3	stop_codon	1039917	1039919	.	+	.	transcript "301"	
Adh	FGenesCGG3	CDS	1016392	1016748	.	-	.	transcript "302"	
Adh	FGenesCGG3	start_codon	1016746	1016748	.	-	.	transcript "302"	
Adh	FGenesCGG3	stop_codon	1016392	1016394	.	-	.	transcript "302"	
Adh	FGenesCGG3	CDS	1018661	1018717	.	+	.	transcript "303"	
Adh	FGenesCGG3	start_codon	1018661	1018663	.	+	.	transcript "303"	
Adh	FGenesCGG3	CDS	1018766	1018852	.	+	.	transcript "303"	
Adh	FGenesCGG3	CDS	1018978	1019148	.	+	.	transcript "303"	
Adh	FGenesCGG3	CDS	1020742	1020744	.	+	.	transcript "303"	
Adh	FGenesCGG3	stop_codon	1020742	1020744	.	+	.	transcript "303"	
Adh	FGenesCGG3	CDS	1028879	1028892	.	+	.	transcript "304"	
Adh	FGenesCGG3	start_codon	1028879	1028881	.	+	.	transcript "304"	
Adh	FGenesCGG3	CDS	1029082	1029114	.	+	.	transcript "304"	
Adh	FGenesCGG3	CDS	1029282	1029579	.	+	.	transcript "304"	
Adh	FGenesCGG3	stop_codon	1029577	1029579	.	+	.	transcript "304"	
Adh	FGenesCGG3	CDS	1033390	1033524	.	+	.	transcript "305"	
Adh	FGenesCGG3	start_codon	1033390	1033392	.	+	.	transcript "305"	
Adh	FGenesCGG3	CDS	1034159	1034527	.	+	.	transcript "305"	
Adh	FGenesCGG3	stop_codon	1034525	1034527	.	+	.	transcript "305"	
Adh	FGenesCGG3	CDS	1041376	1041530	.	-	.	transcript "306"	
Adh	FGenesCGG3	stop_codon	1041376	1041378	.	-	.	transcript "306"	
Adh	FGenesCGG3	CDS	1041602	1041989	.	-	.	transcript "306"	
Adh	FGenesCGG3	CDS	1042386	1042550	.	-	.	transcript "306"	
Adh	FGenesCGG3	start_codon	1042548	1042550	.	-	.	transcript "306"	
Adh	FGenesCGG3	CDS	1041376	1041530	.	-	.	transcript "307"	
Adh	FGenesCGG3	stop_codon	1041376	1041378	.	-	.	transcript "307"	
Adh	FGenesCGG3	CDS	1041602	1041989	.	-	.	transcript "307"	
Adh	FGenesCGG3	CDS	1042386	1042688	.	-	.	transcript "307"	
Adh	FGenesCGG3	start_codon	1042686	1042688	.	-	.	transcript "307"	
Adh	FGenesCGG3	CDS	1043983	1044034	.	+	.	transcript "308"	
Adh	FGenesCGG3	start_codon	1043983	1043985	.	+	.	transcript "308"	
Adh	FGenesCGG3	CDS	1044927	1045031	.	+	.	transcript "308"	
Adh	FGenesCGG3	CDS	1051376	1051545	.	+	.	transcript "308"	
Adh	FGenesCGG3	stop_codon	1051543	1051545	.	+	.	transcript "308"	
Adh	FGenesCGG3	CDS	1044250	1044433	.	-	.	transcript "309"	
Adh	FGenesCGG3	stop_codon	1044250	1044252	.	-	.	transcript "309"	
Adh	FGenesCGG3	CDS	1045118	1045317	.	-	.	transcript "309"	
Adh	FGenesCGG3	start_codon	1045315	1045317	.	-	.	transcript "309"	
Adh	FGenesCGG3	CDS	1046547	1046945	.	-	.	transcript "310"	
Adh	FGenesCGG3	start_codon	1046943	1046945	.	-	.	transcript "310"	
Adh	FGenesCGG3	stop_codon	1046547	1046549	.	-	.	transcript "310"	
Adh	FGenesCGG3	CDS	1051748	1051953	.	-	.	transcript "311"	
Adh	FGenesCGG3	stop_codon	1051748	1051750	.	-	.	transcript "311"	
Adh	FGenesCGG3	CDS	1052984	1053041	.	-	.	transcript "311"	
Adh	FGenesCGG3	start_codon	1053039	1053041	.	-	.	transcript "311"	
Adh	FGenesCGG3	CDS	1053924	1054119	.	-	.	transcript "312"	
Adh	FGenesCGG3	stop_codon	1053924	1053926	.	-	.	transcript "312"	
Adh	FGenesCGG3	CDS	1056391	1056509	.	-	.	transcript "312"	
Adh	FGenesCGG3	start_codon	1056507	1056509	.	-	.	transcript "312"	
Adh	FGenesCGG3	CDS	1056859	1057314	.	-	.	transcript "313"	
Adh	FGenesCGG3	start_codon	1057312	1057314	.	-	.	transcript "313"	
Adh	FGenesCGG3	stop_codon	1056859	1056861	.	-	.	transcript "313"	
Adh	FGenesCGG3	CDS	1058746	1058849	.	-	.	transcript "314"	
Adh	FGenesCGG3	stop_codon	1058746	1058748	.	-	.	transcript "314"	
Adh	FGenesCGG3	CDS	1061433	1061529	.	-	.	transcript "314"	
Adh	FGenesCGG3	start_codon	1061527	1061529	.	-	.	transcript "314"	
Adh	FGenesCGG3	CDS	1059672	1059803	.	-	.	transcript "315"	
Adh	FGenesCGG3	stop_codon	1059672	1059674	.	-	.	transcript "315"	
Adh	FGenesCGG3	CDS	1060487	1060708	.	-	.	transcript "315"	
Adh	FGenesCGG3	start_codon	1060706	1060708	.	-	.	transcript "315"	
Adh	FGenesCGG3	CDS	1062780	1062829	.	-	.	transcript "316"	
Adh	FGenesCGG3	stop_codon	1062780	1062782	.	-	.	transcript "316"	
Adh	FGenesCGG3	CDS	1064248	1064380	.	-	.	transcript "316"	
Adh	FGenesCGG3	CDS	1066071	1066136	.	-	.	transcript "316"	
Adh	FGenesCGG3	start_codon	1066134	1066136	.	-	.	transcript "316"	
Adh	FGenesCGG3	CDS	1063870	1064189	.	-	.	transcript "317"	
Adh	FGenesCGG3	stop_codon	1063870	1063872	.	-	.	transcript "317"	
Adh	FGenesCGG3	CDS	1064248	1064380	.	-	.	transcript "317"	
Adh	FGenesCGG3	CDS	1066071	1066136	.	-	.	transcript "317"	
Adh	FGenesCGG3	start_codon	1066134	1066136	.	-	.	transcript "317"	
Adh	FGenesCGG3	CDS	1067301	1067476	.	+	.	transcript "318"	
Adh	FGenesCGG3	start_codon	1067301	1067303	.	+	.	transcript "318"	
Adh	FGenesCGG3	CDS	1068882	1069125	.	+	.	transcript "318"	
Adh	FGenesCGG3	stop_codon	1069123	1069125	.	+	.	transcript "318"	
Adh	FGenesCGG3	CDS	1070893	1070904	.	+	.	transcript "319"	
Adh	FGenesCGG3	start_codon	1070893	1070895	.	+	.	transcript "319"	
Adh	FGenesCGG3	CDS	1071569	1071758	.	+	.	transcript "319"	
Adh	FGenesCGG3	CDS	1071980	1072023	.	+	.	transcript "319"	
Adh	FGenesCGG3	stop_codon	1072021	1072023	.	+	.	transcript "319"	
Adh	FGenesCGG3	CDS	1072985	1073201	.	-	.	transcript "320"	
Adh	FGenesCGG3	stop_codon	1072985	1072987	.	-	.	transcript "320"	
Adh	FGenesCGG3	CDS	1074525	1074572	.	-	.	transcript "320"	
Adh	FGenesCGG3	CDS	1078191	1078324	.	-	.	transcript "320"	
Adh	FGenesCGG3	start_codon	1078322	1078324	.	-	.	transcript "320"	
Adh	FGenesCGG3	CDS	1075461	1075695	.	+	.	transcript "321"	
Adh	FGenesCGG3	start_codon	1075461	1075463	.	+	.	transcript "321"	
Adh	FGenesCGG3	CDS	1078475	1078592	.	+	.	transcript "321"	
Adh	FGenesCGG3	CDS	1079921	1080080	.	+	.	transcript "321"	
Adh	FGenesCGG3	stop_codon	1080078	1080080	.	+	.	transcript "321"	
Adh	FGenesCGG3	CDS	1078969	1079068	.	+	.	transcript "322"	
Adh	FGenesCGG3	start_codon	1078969	1078971	.	+	.	transcript "322"	
Adh	FGenesCGG3	CDS	1080019	1080080	.	+	.	transcript "322"	
Adh	FGenesCGG3	stop_codon	1080078	1080080	.	+	.	transcript "322"	
Adh	FGenesCGG3	CDS	1080893	1081134	.	+	.	transcript "323"	
Adh	FGenesCGG3	start_codon	1080893	1080895	.	+	.	transcript "323"	
Adh	FGenesCGG3	CDS	1081212	1081254	.	+	.	transcript "323"	
Adh	FGenesCGG3	stop_codon	1081252	1081254	.	+	.	transcript "323"	
Adh	FGenesCGG3	CDS	1081723	1081893	.	-	.	transcript "324"	
Adh	FGenesCGG3	stop_codon	1081723	1081725	.	-	.	transcript "324"	
Adh	FGenesCGG3	CDS	1081958	1081969	.	-	.	transcript "324"	
Adh	FGenesCGG3	start_codon	1081967	1081969	.	-	.	transcript "324"	
Adh	FGenesCGG3	CDS	1081770	1081824	.	-	.	transcript "325"	
Adh	FGenesCGG3	stop_codon	1081770	1081772	.	-	.	transcript "325"	
Adh	FGenesCGG3	CDS	1084155	1084220	.	-	.	transcript "325"	
Adh	FGenesCGG3	CDS	1084268	1084722	.	-	.	transcript "325"	
Adh	FGenesCGG3	start_codon	1084720	1084722	.	-	.	transcript "325"	
Adh	FGenesCGG3	CDS	1083400	1083793	.	-	.	transcript "326"	
Adh	FGenesCGG3	stop_codon	1083400	1083402	.	-	.	transcript "326"	
Adh	FGenesCGG3	CDS	1084155	1084220	.	-	.	transcript "326"	
Adh	FGenesCGG3	CDS	1084268	1084890	.	-	.	transcript "326"	
Adh	FGenesCGG3	start_codon	1084888	1084890	.	-	.	transcript "326"	
Adh	FGenesCGG3	CDS	1087246	1087412	.	-	.	transcript "327"	
Adh	FGenesCGG3	stop_codon	1087246	1087248	.	-	.	transcript "327"	
Adh	FGenesCGG3	CDS	1088060	1088105	.	-	.	transcript "327"	
Adh	FGenesCGG3	start_codon	1088103	1088105	.	-	.	transcript "327"	
Adh	FGenesCGG3	CDS	1088808	1088855	.	+	.	transcript "328"	
Adh	FGenesCGG3	start_codon	1088808	1088810	.	+	.	transcript "328"	
Adh	FGenesCGG3	CDS	1089151	1089354	.	+	.	transcript "328"	
Adh	FGenesCGG3	stop_codon	1089352	1089354	.	+	.	transcript "328"	
Adh	FGenesCGG3	CDS	1088960	1089373	.	+	.	transcript "329"	
Adh	FGenesCGG3	start_codon	1088960	1088962	.	+	.	transcript "329"	
Adh	FGenesCGG3	stop_codon	1089371	1089373	.	+	.	transcript "329"	
Adh	FGenesCGG3	CDS	1090172	1090411	.	-	.	transcript "330"	
Adh	FGenesCGG3	stop_codon	1090172	1090174	.	-	.	transcript "330"	
Adh	FGenesCGG3	CDS	1091369	1091479	.	-	.	transcript "330"	
Adh	FGenesCGG3	CDS	1095422	1095533	.	-	.	transcript "330"	
Adh	FGenesCGG3	CDS	1095586	1095735	.	-	.	transcript "330"	
Adh	FGenesCGG3	CDS	1095848	1095987	.	-	.	transcript "330"	
Adh	FGenesCGG3	CDS	1096062	1096196	.	-	.	transcript "330"	
Adh	FGenesCGG3	CDS	1096326	1096643	.	-	.	transcript "330"	
Adh	FGenesCGG3	CDS	1096737	1096913	.	-	.	transcript "330"	
Adh	FGenesCGG3	CDS	1097106	1097794	.	-	.	transcript "330"	
Adh	FGenesCGG3	CDS	1098455	1098979	.	-	.	transcript "330"	
Adh	FGenesCGG3	CDS	1100544	1100565	.	-	.	transcript "330"	
Adh	FGenesCGG3	CDS	1101376	1101526	.	-	.	transcript "330"	
Adh	FGenesCGG3	CDS	1104415	1104995	.	-	.	transcript "330"	
Adh	FGenesCGG3	CDS	1105586	1105651	.	-	.	transcript "330"	
Adh	FGenesCGG3	CDS	1106188	1106223	.	-	.	transcript "330"	
Adh	FGenesCGG3	start_codon	1106221	1106223	.	-	.	transcript "330"	
Adh	FGenesCGG3	CDS	1094528	1094610	.	-	.	transcript "331"	
Adh	FGenesCGG3	stop_codon	1094528	1094530	.	-	.	transcript "331"	
Adh	FGenesCGG3	CDS	1094867	1095215	.	-	.	transcript "331"	
Adh	FGenesCGG3	CDS	1095422	1095533	.	-	.	transcript "331"	
Adh	FGenesCGG3	CDS	1095586	1095735	.	-	.	transcript "331"	
Adh	FGenesCGG3	CDS	1095848	1095987	.	-	.	transcript "331"	
Adh	FGenesCGG3	CDS	1096062	1096196	.	-	.	transcript "331"	
Adh	FGenesCGG3	CDS	1096326	1098979	.	-	.	transcript "331"	
Adh	FGenesCGG3	CDS	1100157	1100179	.	-	.	transcript "331"	
Adh	FGenesCGG3	CDS	1101376	1101526	.	-	.	transcript "331"	
Adh	FGenesCGG3	CDS	1101569	1102085	.	-	.	transcript "331"	
Adh	FGenesCGG3	CDS	1102589	1102710	.	-	.	transcript "331"	
Adh	FGenesCGG3	CDS	1102937	1103103	.	-	.	transcript "331"	
Adh	FGenesCGG3	CDS	1103581	1103641	.	-	.	transcript "331"	
Adh	FGenesCGG3	CDS	1104419	1104995	.	-	.	transcript "331"	
Adh	FGenesCGG3	CDS	1105586	1105651	.	-	.	transcript "331"	
Adh	FGenesCGG3	CDS	1106188	1106223	.	-	.	transcript "331"	
Adh	FGenesCGG3	start_codon	1106221	1106223	.	-	.	transcript "331"	
Adh	FGenesCGG3	CDS	1108795	1108850	.	+	.	transcript "332"	
Adh	FGenesCGG3	start_codon	1108795	1108797	.	+	.	transcript "332"	
Adh	FGenesCGG3	CDS	1109096	1109339	.	+	.	transcript "332"	
Adh	FGenesCGG3	stop_codon	1109337	1109339	.	+	.	transcript "332"	
Adh	FGenesCGG3	CDS	1110074	1110172	.	+	.	transcript "333"	
Adh	FGenesCGG3	start_codon	1110074	1110076	.	+	.	transcript "333"	
Adh	FGenesCGG3	CDS	1110238	1110642	.	+	.	transcript "333"	
Adh	FGenesCGG3	CDS	1110713	1110979	.	+	.	transcript "333"	
Adh	FGenesCGG3	stop_codon	1110977	1110979	.	+	.	transcript "333"	
Adh	FGenesCGG3	CDS	1111283	1111378	.	+	.	transcript "334"	
Adh	FGenesCGG3	start_codon	1111283	1111285	.	+	.	transcript "334"	
Adh	FGenesCGG3	CDS	1111805	1112209	.	+	.	transcript "334"	
Adh	FGenesCGG3	CDS	1112261	1112578	.	+	.	transcript "334"	
Adh	FGenesCGG3	stop_codon	1112576	1112578	.	+	.	transcript "334"	
Adh	FGenesCGG3	CDS	1112598	1112613	.	+	.	transcript "335"	
Adh	FGenesCGG3	start_codon	1112598	1112600	.	+	.	transcript "335"	
Adh	FGenesCGG3	CDS	1114438	1114473	.	+	.	transcript "335"	
Adh	FGenesCGG3	CDS	1116315	1116461	.	+	.	transcript "335"	
Adh	FGenesCGG3	CDS	1116582	1116646	.	+	.	transcript "335"	
Adh	FGenesCGG3	CDS	1118529	1118546	.	+	.	transcript "335"	
Adh	FGenesCGG3	stop_codon	1118544	1118546	.	+	.	transcript "335"	
Adh	FGenesCGG3	CDS	1114892	1114897	.	+	.	transcript "336"	
Adh	FGenesCGG3	start_codon	1114892	1114894	.	+	.	transcript "336"	
Adh	FGenesCGG3	CDS	1115003	1115497	.	+	.	transcript "336"	
Adh	FGenesCGG3	stop_codon	1115495	1115497	.	+	.	transcript "336"	
Adh	FGenesCGG3	CDS	1115807	1115987	.	+	.	transcript "337"	
Adh	FGenesCGG3	start_codon	1115807	1115809	.	+	.	transcript "337"	
Adh	FGenesCGG3	CDS	1116315	1116493	.	+	.	transcript "337"	
Adh	FGenesCGG3	stop_codon	1116491	1116493	.	+	.	transcript "337"	
Adh	FGenesCGG3	CDS	1117507	1117614	.	-	.	transcript "338"	
Adh	FGenesCGG3	start_codon	1117612	1117614	.	-	.	transcript "338"	
Adh	FGenesCGG3	stop_codon	1117507	1117509	.	-	.	transcript "338"	
Adh	FGenesCGG3	CDS	1119285	1119435	.	-	.	transcript "339"	
Adh	FGenesCGG3	stop_codon	1119285	1119287	.	-	.	transcript "339"	
Adh	FGenesCGG3	CDS	1123358	1123453	.	-	.	transcript "339"	
Adh	FGenesCGG3	CDS	1125780	1125835	.	-	.	transcript "339"	
Adh	FGenesCGG3	CDS	1126318	1126341	.	-	.	transcript "339"	
Adh	FGenesCGG3	start_codon	1126339	1126341	.	-	.	transcript "339"	
Adh	FGenesCGG3	CDS	1123828	1123896	.	+	.	transcript "340"	
Adh	FGenesCGG3	start_codon	1123828	1123830	.	+	.	transcript "340"	
Adh	FGenesCGG3	CDS	1124769	1124854	.	+	.	transcript "340"	
Adh	FGenesCGG3	CDS	1126366	1126660	.	+	.	transcript "340"	
Adh	FGenesCGG3	stop_codon	1126658	1126660	.	+	.	transcript "340"	
Adh	FGenesCGG3	CDS	1128657	1128863	.	-	.	transcript "341"	
Adh	FGenesCGG3	stop_codon	1128657	1128659	.	-	.	transcript "341"	
Adh	FGenesCGG3	CDS	1129050	1129166	.	-	.	transcript "341"	
Adh	FGenesCGG3	CDS	1129815	1129895	.	-	.	transcript "341"	
Adh	FGenesCGG3	CDS	1130801	1130872	.	-	.	transcript "341"	
Adh	FGenesCGG3	CDS	1131259	1131267	.	-	.	transcript "341"	
Adh	FGenesCGG3	start_codon	1131265	1131267	.	-	.	transcript "341"	
Adh	FGenesCGG3	CDS	1133008	1133068	.	+	.	transcript "342"	
Adh	FGenesCGG3	start_codon	1133008	1133010	.	+	.	transcript "342"	
Adh	FGenesCGG3	CDS	1134376	1134479	.	+	.	transcript "342"	
Adh	FGenesCGG3	stop_codon	1134477	1134479	.	+	.	transcript "342"	
Adh	FGenesCGG3	CDS	1135267	1135448	.	-	.	transcript "343"	
Adh	FGenesCGG3	stop_codon	1135267	1135269	.	-	.	transcript "343"	
Adh	FGenesCGG3	CDS	1137998	1138304	.	-	.	transcript "343"	
Adh	FGenesCGG3	CDS	1139694	1140911	.	-	.	transcript "343"	
Adh	FGenesCGG3	CDS	1141857	1142960	.	-	.	transcript "343"	
Adh	FGenesCGG3	CDS	1143657	1144044	.	-	.	transcript "343"	
Adh	FGenesCGG3	CDS	1148443	1148528	.	-	.	transcript "343"	
Adh	FGenesCGG3	CDS	1150024	1150103	.	-	.	transcript "343"	
Adh	FGenesCGG3	CDS	1153160	1153412	.	-	.	transcript "343"	
Adh	FGenesCGG3	CDS	1163535	1163787	.	-	.	transcript "343"	
Adh	FGenesCGG3	CDS	1167182	1167214	.	-	.	transcript "343"	
Adh	FGenesCGG3	CDS	1171159	1171226	.	-	.	transcript "343"	
Adh	FGenesCGG3	CDS	1173555	1173713	.	-	.	transcript "343"	
Adh	FGenesCGG3	start_codon	1173711	1173713	.	-	.	transcript "343"	
Adh	FGenesCGG3	CDS	1141505	1141523	.	+	.	transcript "344"	
Adh	FGenesCGG3	start_codon	1141505	1141507	.	+	.	transcript "344"	
Adh	FGenesCGG3	CDS	1141935	1141989	.	+	.	transcript "344"	
Adh	FGenesCGG3	CDS	1142192	1142261	.	+	.	transcript "344"	
Adh	FGenesCGG3	CDS	1142951	1142980	.	+	.	transcript "344"	
Adh	FGenesCGG3	stop_codon	1142978	1142980	.	+	.	transcript "344"	
Adh	FGenesCGG3	CDS	1145411	1145429	.	+	.	transcript "345"	
Adh	FGenesCGG3	start_codon	1145411	1145413	.	+	.	transcript "345"	
Adh	FGenesCGG3	CDS	1145597	1145940	.	+	.	transcript "345"	
Adh	FGenesCGG3	stop_codon	1145938	1145940	.	+	.	transcript "345"	
Adh	FGenesCGG3	CDS	1155605	1155784	.	-	.	transcript "346"	
Adh	FGenesCGG3	stop_codon	1155605	1155607	.	-	.	transcript "346"	
Adh	FGenesCGG3	CDS	1156755	1156778	.	-	.	transcript "346"	
Adh	FGenesCGG3	start_codon	1156776	1156778	.	-	.	transcript "346"	
Adh	FGenesCGG3	CDS	1159279	1159449	.	-	.	transcript "347"	
Adh	FGenesCGG3	stop_codon	1159279	1159281	.	-	.	transcript "347"	
Adh	FGenesCGG3	CDS	1159497	1159622	.	-	.	transcript "347"	
Adh	FGenesCGG3	start_codon	1159620	1159622	.	-	.	transcript "347"	
Adh	FGenesCGG3	CDS	1167540	1167634	.	-	.	transcript "348"	
Adh	FGenesCGG3	stop_codon	1167540	1167542	.	-	.	transcript "348"	
Adh	FGenesCGG3	CDS	1168799	1168841	.	-	.	transcript "348"	
Adh	FGenesCGG3	start_codon	1168839	1168841	.	-	.	transcript "348"	
Adh	FGenesCGG3	CDS	1174934	1175305	.	-	.	transcript "349"	
Adh	FGenesCGG3	stop_codon	1174934	1174936	.	-	.	transcript "349"	
Adh	FGenesCGG3	CDS	1175626	1175628	.	-	.	transcript "349"	
Adh	FGenesCGG3	start_codon	1175626	1175628	.	-	.	transcript "349"	
Adh	FGenesCGG3	CDS	1175110	1175230	.	-	.	transcript "350"	
Adh	FGenesCGG3	stop_codon	1175110	1175112	.	-	.	transcript "350"	
Adh	FGenesCGG3	CDS	1175626	1175647	.	-	.	transcript "350"	
Adh	FGenesCGG3	CDS	1179474	1179556	.	-	.	transcript "350"	
Adh	FGenesCGG3	CDS	1179759	1179811	.	-	.	transcript "350"	
Adh	FGenesCGG3	start_codon	1179809	1179811	.	-	.	transcript "350"	
Adh	FGenesCGG3	CDS	1178228	1178412	.	-	.	transcript "351"	
Adh	FGenesCGG3	stop_codon	1178228	1178230	.	-	.	transcript "351"	
Adh	FGenesCGG3	CDS	1179474	1179556	.	-	.	transcript "351"	
Adh	FGenesCGG3	CDS	1179759	1179811	.	-	.	transcript "351"	
Adh	FGenesCGG3	start_codon	1179809	1179811	.	-	.	transcript "351"	
Adh	FGenesCGG3	CDS	1181634	1181705	.	-	.	transcript "352"	
Adh	FGenesCGG3	stop_codon	1181634	1181636	.	-	.	transcript "352"	
Adh	FGenesCGG3	CDS	1182203	1182415	.	-	.	transcript "352"	
Adh	FGenesCGG3	start_codon	1182413	1182415	.	-	.	transcript "352"	
Adh	FGenesCGG3	CDS	1181634	1181705	.	-	.	transcript "353"	
Adh	FGenesCGG3	stop_codon	1181634	1181636	.	-	.	transcript "353"	
Adh	FGenesCGG3	CDS	1182203	1182415	.	-	.	transcript "353"	
Adh	FGenesCGG3	start_codon	1182413	1182415	.	-	.	transcript "353"	
Adh	FGenesCGG3	CDS	1189712	1189832	.	-	.	transcript "354"	
Adh	FGenesCGG3	stop_codon	1189712	1189714	.	-	.	transcript "354"	
Adh	FGenesCGG3	CDS	1192419	1192504	.	-	.	transcript "354"	
Adh	FGenesCGG3	start_codon	1192502	1192504	.	-	.	transcript "354"	
Adh	FGenesCGG3	CDS	1193513	1193554	.	+	.	transcript "355"	
Adh	FGenesCGG3	start_codon	1193513	1193515	.	+	.	transcript "355"	
Adh	FGenesCGG3	CDS	1194767	1194854	.	+	.	transcript "355"	
Adh	FGenesCGG3	CDS	1196399	1196506	.	+	.	transcript "355"	
Adh	FGenesCGG3	CDS	1196889	1197133	.	+	.	transcript "355"	
Adh	FGenesCGG3	stop_codon	1197131	1197133	.	+	.	transcript "355"	
Adh	FGenesCGG3	CDS	1198486	1198678	.	-	.	transcript "356"	
Adh	FGenesCGG3	stop_codon	1198486	1198488	.	-	.	transcript "356"	
Adh	FGenesCGG3	CDS	1201718	1201772	.	-	.	transcript "356"	
Adh	FGenesCGG3	CDS	1202082	1202112	.	-	.	transcript "356"	
Adh	FGenesCGG3	start_codon	1202110	1202112	.	-	.	transcript "356"	
Adh	FGenesCGG3	CDS	1203825	1203872	.	+	.	transcript "357"	
Adh	FGenesCGG3	start_codon	1203825	1203827	.	+	.	transcript "357"	
Adh	FGenesCGG3	CDS	1207666	1207906	.	+	.	transcript "357"	
Adh	FGenesCGG3	CDS	1209000	1209064	.	+	.	transcript "357"	
Adh	FGenesCGG3	CDS	1215532	1215591	.	+	.	transcript "357"	
Adh	FGenesCGG3	stop_codon	1215589	1215591	.	+	.	transcript "357"	
Adh	FGenesCGG3	CDS	1206476	1206487	.	+	.	transcript "358"	
Adh	FGenesCGG3	start_codon	1206476	1206478	.	+	.	transcript "358"	
Adh	FGenesCGG3	CDS	1206559	1206786	.	+	.	transcript "358"	
Adh	FGenesCGG3	stop_codon	1206784	1206786	.	+	.	transcript "358"	
Adh	FGenesCGG3	CDS	1207563	1207574	.	+	.	transcript "359"	
Adh	FGenesCGG3	start_codon	1207563	1207565	.	+	.	transcript "359"	
Adh	FGenesCGG3	CDS	1207666	1207953	.	+	.	transcript "359"	
Adh	FGenesCGG3	stop_codon	1207951	1207953	.	+	.	transcript "359"	
Adh	FGenesCGG3	CDS	1216498	1216664	.	-	.	transcript "360"	
Adh	FGenesCGG3	stop_codon	1216498	1216500	.	-	.	transcript "360"	
Adh	FGenesCGG3	CDS	1218693	1219191	.	-	.	transcript "360"	
Adh	FGenesCGG3	CDS	1219570	1220253	.	-	.	transcript "360"	
Adh	FGenesCGG3	CDS	1220453	1220973	.	-	.	transcript "360"	
Adh	FGenesCGG3	CDS	1221025	1221762	.	-	.	transcript "360"	
Adh	FGenesCGG3	CDS	1222288	1222395	.	-	.	transcript "360"	
Adh	FGenesCGG3	CDS	1222483	1223187	.	-	.	transcript "360"	
Adh	FGenesCGG3	CDS	1223350	1223459	.	-	.	transcript "360"	
Adh	FGenesCGG3	CDS	1230145	1230335	.	-	.	transcript "360"	
Adh	FGenesCGG3	start_codon	1230333	1230335	.	-	.	transcript "360"	
Adh	FGenesCGG3	CDS	1218040	1218115	.	-	.	transcript "361"	
Adh	FGenesCGG3	stop_codon	1218040	1218042	.	-	.	transcript "361"	
Adh	FGenesCGG3	CDS	1218392	1220253	.	-	.	transcript "361"	
Adh	FGenesCGG3	CDS	1220453	1221762	.	-	.	transcript "361"	
Adh	FGenesCGG3	CDS	1221977	1222190	.	-	.	transcript "361"	
Adh	FGenesCGG3	CDS	1222250	1222395	.	-	.	transcript "361"	
Adh	FGenesCGG3	CDS	1222483	1222632	.	-	.	transcript "361"	
Adh	FGenesCGG3	CDS	1222813	1223091	.	-	.	transcript "361"	
Adh	FGenesCGG3	CDS	1223350	1223779	.	-	.	transcript "361"	
Adh	FGenesCGG3	start_codon	1223777	1223779	.	-	.	transcript "361"	
Adh	FGenesCGG3	CDS	1229684	1230733	.	+	.	transcript "362"	
Adh	FGenesCGG3	start_codon	1229684	1229686	.	+	.	transcript "362"	
Adh	FGenesCGG3	stop_codon	1230731	1230733	.	+	.	transcript "362"	
Adh	FGenesCGG3	CDS	1231127	1231384	.	-	.	transcript "363"	
Adh	FGenesCGG3	stop_codon	1231127	1231129	.	-	.	transcript "363"	
Adh	FGenesCGG3	CDS	1231452	1231463	.	-	.	transcript "363"	
Adh	FGenesCGG3	start_codon	1231461	1231463	.	-	.	transcript "363"	
Adh	FGenesCGG3	CDS	1232958	1232969	.	+	.	transcript "364"	
Adh	FGenesCGG3	start_codon	1232958	1232960	.	+	.	transcript "364"	
Adh	FGenesCGG3	CDS	1233044	1233266	.	+	.	transcript "364"	
Adh	FGenesCGG3	CDS	1233548	1233591	.	+	.	transcript "364"	
Adh	FGenesCGG3	stop_codon	1233589	1233591	.	+	.	transcript "364"	
Adh	FGenesCGG3	CDS	1232958	1232969	.	+	.	transcript "365"	
Adh	FGenesCGG3	start_codon	1232958	1232960	.	+	.	transcript "365"	
Adh	FGenesCGG3	CDS	1233044	1233280	.	+	.	transcript "365"	
Adh	FGenesCGG3	stop_codon	1233278	1233280	.	+	.	transcript "365"	
Adh	FGenesCGG3	CDS	1234097	1234108	.	+	.	transcript "366"	
Adh	FGenesCGG3	start_codon	1234097	1234099	.	+	.	transcript "366"	
Adh	FGenesCGG3	CDS	1234343	1234495	.	+	.	transcript "366"	
Adh	FGenesCGG3	stop_codon	1234493	1234495	.	+	.	transcript "366"	
Adh	FGenesCGG3	CDS	1234224	1234235	.	-	.	transcript "367"	
Adh	FGenesCGG3	stop_codon	1234224	1234226	.	-	.	transcript "367"	
Adh	FGenesCGG3	CDS	1234620	1234742	.	-	.	transcript "367"	
Adh	FGenesCGG3	CDS	1237619	1237735	.	-	.	transcript "367"	
Adh	FGenesCGG3	start_codon	1237733	1237735	.	-	.	transcript "367"	
Adh	FGenesCGG3	CDS	1234611	1234742	.	-	.	transcript "368"	
Adh	FGenesCGG3	stop_codon	1234611	1234613	.	-	.	transcript "368"	
Adh	FGenesCGG3	CDS	1234830	1234847	.	-	.	transcript "368"	
Adh	FGenesCGG3	start_codon	1234845	1234847	.	-	.	transcript "368"	
Adh	FGenesCGG3	CDS	1237267	1237362	.	-	.	transcript "369"	
Adh	FGenesCGG3	stop_codon	1237267	1237269	.	-	.	transcript "369"	
Adh	FGenesCGG3	CDS	1237619	1237735	.	-	.	transcript "369"	
Adh	FGenesCGG3	start_codon	1237733	1237735	.	-	.	transcript "369"	
Adh	FGenesCGG3	CDS	1241328	1241346	.	-	.	transcript "370"	
Adh	FGenesCGG3	stop_codon	1241328	1241330	.	-	.	transcript "370"	
Adh	FGenesCGG3	CDS	1241718	1241776	.	-	.	transcript "370"	
Adh	FGenesCGG3	CDS	1243620	1243796	.	-	.	transcript "370"	
Adh	FGenesCGG3	CDS	1247880	1247921	.	-	.	transcript "370"	
Adh	FGenesCGG3	start_codon	1247919	1247921	.	-	.	transcript "370"	
Adh	FGenesCGG3	CDS	1243778	1243974	.	-	.	transcript "371"	
Adh	FGenesCGG3	stop_codon	1243778	1243780	.	-	.	transcript "371"	
Adh	FGenesCGG3	CDS	1244068	1244083	.	-	.	transcript "371"	
Adh	FGenesCGG3	start_codon	1244081	1244083	.	-	.	transcript "371"	
Adh	FGenesCGG3	CDS	1246958	1246963	.	+	.	transcript "372"	
Adh	FGenesCGG3	start_codon	1246958	1246960	.	+	.	transcript "372"	
Adh	FGenesCGG3	CDS	1247000	1247109	.	+	.	transcript "372"	
Adh	FGenesCGG3	CDS	1247684	1247936	.	+	.	transcript "372"	
Adh	FGenesCGG3	stop_codon	1247934	1247936	.	+	.	transcript "372"	
Adh	FGenesCGG3	CDS	1248774	1248848	.	-	.	transcript "373"	
Adh	FGenesCGG3	stop_codon	1248774	1248776	.	-	.	transcript "373"	
Adh	FGenesCGG3	CDS	1251025	1251381	.	-	.	transcript "373"	
Adh	FGenesCGG3	start_codon	1251379	1251381	.	-	.	transcript "373"	
Adh	FGenesCGG3	CDS	1250633	1251421	.	+	.	transcript "374"	
Adh	FGenesCGG3	start_codon	1250633	1250635	.	+	.	transcript "374"	
Adh	FGenesCGG3	stop_codon	1251419	1251421	.	+	.	transcript "374"	
Adh	FGenesCGG3	CDS	1252266	1252294	.	+	.	transcript "375"	
Adh	FGenesCGG3	start_codon	1252266	1252268	.	+	.	transcript "375"	
Adh	FGenesCGG3	CDS	1252561	1252618	.	+	.	transcript "375"	
Adh	FGenesCGG3	CDS	1252652	1253617	.	+	.	transcript "375"	
Adh	FGenesCGG3	stop_codon	1253615	1253617	.	+	.	transcript "375"	
Adh	FGenesCGG3	CDS	1252334	1252343	.	+	.	transcript "376"	
Adh	FGenesCGG3	start_codon	1252334	1252336	.	+	.	transcript "376"	
Adh	FGenesCGG3	CDS	1252515	1253617	.	+	.	transcript "376"	
Adh	FGenesCGG3	stop_codon	1253615	1253617	.	+	.	transcript "376"	
Adh	FGenesCGG3	CDS	1254101	1254274	.	-	.	transcript "377"	
Adh	FGenesCGG3	start_codon	1254272	1254274	.	-	.	transcript "377"	
Adh	FGenesCGG3	stop_codon	1254101	1254103	.	-	.	transcript "377"	
Adh	FGenesCGG3	CDS	1254252	1254332	.	-	.	transcript "378"	
Adh	FGenesCGG3	stop_codon	1254252	1254254	.	-	.	transcript "378"	
Adh	FGenesCGG3	CDS	1255013	1255090	.	-	.	transcript "378"	
Adh	FGenesCGG3	CDS	1257441	1257560	.	-	.	transcript "378"	
Adh	FGenesCGG3	CDS	1257979	1258002	.	-	.	transcript "378"	
Adh	FGenesCGG3	start_codon	1258000	1258002	.	-	.	transcript "378"	
Adh	FGenesCGG3	CDS	1255669	1256823	.	+	.	transcript "379"	
Adh	FGenesCGG3	start_codon	1255669	1255671	.	+	.	transcript "379"	
Adh	FGenesCGG3	stop_codon	1256821	1256823	.	+	.	transcript "379"	
Adh	FGenesCGG3	CDS	1260699	1260735	.	+	.	transcript "380"	
Adh	FGenesCGG3	start_codon	1260699	1260701	.	+	.	transcript "380"	
Adh	FGenesCGG3	CDS	1263338	1263382	.	+	.	transcript "380"	
Adh	FGenesCGG3	CDS	1264549	1264659	.	+	.	transcript "380"	
Adh	FGenesCGG3	CDS	1265089	1265133	.	+	.	transcript "380"	
Adh	FGenesCGG3	CDS	1265890	1266107	.	+	.	transcript "380"	
Adh	FGenesCGG3	stop_codon	1266105	1266107	.	+	.	transcript "380"	
Adh	FGenesCGG3	CDS	1263535	1264034	.	-	.	transcript "381"	
Adh	FGenesCGG3	stop_codon	1263535	1263537	.	-	.	transcript "381"	
Adh	FGenesCGG3	CDS	1264126	1264286	.	-	.	transcript "381"	
Adh	FGenesCGG3	CDS	1264559	1264638	.	-	.	transcript "381"	
Adh	FGenesCGG3	start_codon	1264636	1264638	.	-	.	transcript "381"	
Adh	FGenesCGG3	CDS	1267210	1267303	.	-	.	transcript "382"	
Adh	FGenesCGG3	stop_codon	1267210	1267212	.	-	.	transcript "382"	
Adh	FGenesCGG3	CDS	1271465	1271885	.	-	.	transcript "382"	
Adh	FGenesCGG3	CDS	1275531	1275587	.	-	.	transcript "382"	
Adh	FGenesCGG3	CDS	1280230	1280344	.	-	.	transcript "382"	
Adh	FGenesCGG3	start_codon	1280342	1280344	.	-	.	transcript "382"	
Adh	FGenesCGG3	CDS	1271377	1272140	.	-	.	transcript "383"	
Adh	FGenesCGG3	stop_codon	1271377	1271379	.	-	.	transcript "383"	
Adh	FGenesCGG3	CDS	1272217	1272395	.	-	.	transcript "383"	
Adh	FGenesCGG3	CDS	1273044	1273596	.	-	.	transcript "383"	
Adh	FGenesCGG3	CDS	1273652	1273827	.	-	.	transcript "383"	
Adh	FGenesCGG3	CDS	1273891	1273936	.	-	.	transcript "383"	
Adh	FGenesCGG3	CDS	1274014	1274248	.	-	.	transcript "383"	
Adh	FGenesCGG3	start_codon	1274246	1274248	.	-	.	transcript "383"	
Adh	FGenesCGG3	CDS	1279429	1279560	.	-	.	transcript "384"	
Adh	FGenesCGG3	start_codon	1279558	1279560	.	-	.	transcript "384"	
Adh	FGenesCGG3	stop_codon	1279429	1279431	.	-	.	transcript "384"	
Adh	FGenesCGG3	CDS	1282475	1282538	.	-	.	transcript "385"	
Adh	FGenesCGG3	stop_codon	1282475	1282477	.	-	.	transcript "385"	
Adh	FGenesCGG3	CDS	1285034	1285502	.	-	.	transcript "385"	
Adh	FGenesCGG3	CDS	1285595	1285746	.	-	.	transcript "385"	
Adh	FGenesCGG3	CDS	1289477	1289536	.	-	.	transcript "385"	
Adh	FGenesCGG3	CDS	1292542	1292594	.	-	.	transcript "385"	
Adh	FGenesCGG3	start_codon	1292592	1292594	.	-	.	transcript "385"	
Adh	FGenesCGG3	CDS	1285030	1285502	.	-	.	transcript "386"	
Adh	FGenesCGG3	stop_codon	1285030	1285032	.	-	.	transcript "386"	
Adh	FGenesCGG3	CDS	1285595	1285746	.	-	.	transcript "386"	
Adh	FGenesCGG3	CDS	1285814	1285859	.	-	.	transcript "386"	
Adh	FGenesCGG3	CDS	1286811	1286820	.	-	.	transcript "386"	
Adh	FGenesCGG3	start_codon	1286818	1286820	.	-	.	transcript "386"	
Adh	FGenesCGG3	CDS	1291155	1291388	.	-	.	transcript "387"	
Adh	FGenesCGG3	start_codon	1291386	1291388	.	-	.	transcript "387"	
Adh	FGenesCGG3	stop_codon	1291155	1291157	.	-	.	transcript "387"	
Adh	FGenesCGG3	CDS	1292100	1292633	.	+	.	transcript "388"	
Adh	FGenesCGG3	start_codon	1292100	1292102	.	+	.	transcript "388"	
Adh	FGenesCGG3	CDS	1292770	1292853	.	+	.	transcript "388"	
Adh	FGenesCGG3	stop_codon	1292851	1292853	.	+	.	transcript "388"	
Adh	FGenesCGG3	CDS	1294081	1298310	.	-	.	transcript "389"	
Adh	FGenesCGG3	start_codon	1298308	1298310	.	-	.	transcript "389"	
Adh	FGenesCGG3	stop_codon	1294081	1294083	.	-	.	transcript "389"	
Adh	FGenesCGG3	CDS	1300469	1300474	.	+	.	transcript "390"	
Adh	FGenesCGG3	start_codon	1300469	1300471	.	+	.	transcript "390"	
Adh	FGenesCGG3	CDS	1300535	1302247	.	+	.	transcript "390"	
Adh	FGenesCGG3	stop_codon	1302245	1302247	.	+	.	transcript "390"	
Adh	FGenesCGG3	CDS	1300469	1300474	.	+	.	transcript "391"	
Adh	FGenesCGG3	start_codon	1300469	1300471	.	+	.	transcript "391"	
Adh	FGenesCGG3	CDS	1300535	1301965	.	+	.	transcript "391"	
Adh	FGenesCGG3	CDS	1302472	1302540	.	+	.	transcript "391"	
Adh	FGenesCGG3	stop_codon	1302538	1302540	.	+	.	transcript "391"	
Adh	FGenesCGG3	CDS	1304186	1304348	.	-	.	transcript "392"	
Adh	FGenesCGG3	stop_codon	1304186	1304188	.	-	.	transcript "392"	
Adh	FGenesCGG3	CDS	1306484	1306527	.	-	.	transcript "392"	
Adh	FGenesCGG3	start_codon	1306525	1306527	.	-	.	transcript "392"	
Adh	FGenesCGG3	CDS	1313011	1313047	.	+	.	transcript "393"	
Adh	FGenesCGG3	start_codon	1313011	1313013	.	+	.	transcript "393"	
Adh	FGenesCGG3	CDS	1315829	1315998	.	+	.	transcript "393"	
Adh	FGenesCGG3	stop_codon	1315996	1315998	.	+	.	transcript "393"	
Adh	FGenesCGG3	CDS	1317429	1317579	.	-	.	transcript "394"	
Adh	FGenesCGG3	stop_codon	1317429	1317431	.	-	.	transcript "394"	
Adh	FGenesCGG3	CDS	1318236	1318363	.	-	.	transcript "394"	
Adh	FGenesCGG3	start_codon	1318361	1318363	.	-	.	transcript "394"	
Adh	FGenesCGG3	CDS	1318949	1319034	.	-	.	transcript "395"	
Adh	FGenesCGG3	stop_codon	1318949	1318951	.	-	.	transcript "395"	
Adh	FGenesCGG3	CDS	1319386	1319494	.	-	.	transcript "395"	
Adh	FGenesCGG3	start_codon	1319492	1319494	.	-	.	transcript "395"	
Adh	FGenesCGG3	CDS	1319530	1319593	.	+	.	transcript "396"	
Adh	FGenesCGG3	start_codon	1319530	1319532	.	+	.	transcript "396"	
Adh	FGenesCGG3	CDS	1323042	1323154	.	+	.	transcript "396"	
Adh	FGenesCGG3	CDS	1323725	1323898	.	+	.	transcript "396"	
Adh	FGenesCGG3	stop_codon	1323896	1323898	.	+	.	transcript "396"	
Adh	FGenesCGG3	CDS	1324922	1325237	.	-	.	transcript "397"	
Adh	FGenesCGG3	stop_codon	1324922	1324924	.	-	.	transcript "397"	
Adh	FGenesCGG3	CDS	1328840	1328994	.	-	.	transcript "397"	
Adh	FGenesCGG3	start_codon	1328992	1328994	.	-	.	transcript "397"	
Adh	FGenesCGG3	CDS	1325206	1325366	.	+	.	transcript "398"	
Adh	FGenesCGG3	start_codon	1325206	1325208	.	+	.	transcript "398"	
Adh	FGenesCGG3	CDS	1325688	1325692	.	+	.	transcript "398"	
Adh	FGenesCGG3	CDS	1325881	1325891	.	+	.	transcript "398"	
Adh	FGenesCGG3	CDS	1327242	1327433	.	+	.	transcript "398"	
Adh	FGenesCGG3	stop_codon	1327431	1327433	.	+	.	transcript "398"	
Adh	FGenesCGG3	CDS	1330103	1330525	.	+	.	transcript "399"	
Adh	FGenesCGG3	start_codon	1330103	1330105	.	+	.	transcript "399"	
Adh	FGenesCGG3	stop_codon	1330523	1330525	.	+	.	transcript "399"	
Adh	FGenesCGG3	CDS	1332050	1332113	.	+	.	transcript "400"	
Adh	FGenesCGG3	start_codon	1332050	1332052	.	+	.	transcript "400"	
Adh	FGenesCGG3	CDS	1332196	1332764	.	+	.	transcript "400"	
Adh	FGenesCGG3	stop_codon	1332762	1332764	.	+	.	transcript "400"	
Adh	FGenesCGG3	CDS	1333633	1333788	.	+	.	transcript "401"	
Adh	FGenesCGG3	start_codon	1333633	1333635	.	+	.	transcript "401"	
Adh	FGenesCGG3	stop_codon	1333786	1333788	.	+	.	transcript "401"	
Adh	FGenesCGG3	CDS	1334780	1335024	.	-	.	transcript "402"	
Adh	FGenesCGG3	stop_codon	1334780	1334782	.	-	.	transcript "402"	
Adh	FGenesCGG3	CDS	1335080	1335356	.	-	.	transcript "402"	
Adh	FGenesCGG3	CDS	1335416	1335735	.	-	.	transcript "402"	
Adh	FGenesCGG3	CDS	1335937	1336157	.	-	.	transcript "402"	
Adh	FGenesCGG3	CDS	1337668	1337720	.	-	.	transcript "402"	
Adh	FGenesCGG3	start_codon	1337718	1337720	.	-	.	transcript "402"	
Adh	FGenesCGG3	CDS	1334780	1335024	.	-	.	transcript "403"	
Adh	FGenesCGG3	stop_codon	1334780	1334782	.	-	.	transcript "403"	
Adh	FGenesCGG3	CDS	1335080	1335356	.	-	.	transcript "403"	
Adh	FGenesCGG3	CDS	1335416	1336157	.	-	.	transcript "403"	
Adh	FGenesCGG3	CDS	1336453	1336720	.	-	.	transcript "403"	
Adh	FGenesCGG3	CDS	1337562	1337587	.	-	.	transcript "403"	
Adh	FGenesCGG3	CDS	1337668	1338007	.	-	.	transcript "403"	
Adh	FGenesCGG3	CDS	1338337	1338640	.	-	.	transcript "403"	
Adh	FGenesCGG3	CDS	1338702	1338785	.	-	.	transcript "403"	
Adh	FGenesCGG3	start_codon	1338783	1338785	.	-	.	transcript "403"	
Adh	FGenesCGG3	CDS	1335075	1335356	.	-	.	transcript "404"	
Adh	FGenesCGG3	stop_codon	1335075	1335077	.	-	.	transcript "404"	
Adh	FGenesCGG3	CDS	1335416	1336157	.	-	.	transcript "404"	
Adh	FGenesCGG3	CDS	1336453	1336564	.	-	.	transcript "404"	
Adh	FGenesCGG3	CDS	1337714	1337917	.	-	.	transcript "404"	
Adh	FGenesCGG3	CDS	1338337	1338640	.	-	.	transcript "404"	
Adh	FGenesCGG3	CDS	1341022	1341174	.	-	.	transcript "405"	
Adh	FGenesCGG3	stop_codon	1341022	1341024	.	-	.	transcript "405"	
Adh	FGenesCGG3	CDS	1341859	1341938	.	-	.	transcript "405"	
Adh	FGenesCGG3	CDS	1343297	1343465	.	-	.	transcript "405"	
Adh	FGenesCGG3	start_codon	1343463	1343465	.	-	.	transcript "405"	
Adh	FGenesCGG3	CDS	1341905	1341938	.	-	.	transcript "406"	
Adh	FGenesCGG3	stop_codon	1341905	1341907	.	-	.	transcript "406"	
Adh	FGenesCGG3	CDS	1343297	1343455	.	-	.	transcript "406"	
Adh	FGenesCGG3	CDS	1357899	1357944	.	-	.	transcript "406"	
Adh	FGenesCGG3	CDS	1358242	1358308	.	-	.	transcript "406"	
Adh	FGenesCGG3	start_codon	1358306	1358308	.	-	.	transcript "406"	
Adh	FGenesCGG3	CDS	1343580	1343725	.	-	.	transcript "407"	
Adh	FGenesCGG3	stop_codon	1343580	1343582	.	-	.	transcript "407"	
Adh	FGenesCGG3	CDS	1344195	1344342	.	-	.	transcript "407"	
Adh	FGenesCGG3	CDS	1344504	1344695	.	-	.	transcript "407"	
Adh	FGenesCGG3	CDS	1344753	1344992	.	-	.	transcript "407"	
Adh	FGenesCGG3	CDS	1347642	1347653	.	-	.	transcript "407"	
Adh	FGenesCGG3	CDS	1351261	1351435	.	-	.	transcript "407"	
Adh	FGenesCGG3	CDS	1355116	1355236	.	-	.	transcript "407"	
Adh	FGenesCGG3	CDS	1356062	1356172	.	-	.	transcript "407"	
Adh	FGenesCGG3	CDS	1350995	1351033	.	-	.	transcript "408"	
Adh	FGenesCGG3	stop_codon	1350995	1350997	.	-	.	transcript "408"	
Adh	FGenesCGG3	CDS	1351312	1351473	.	-	.	transcript "408"	
Adh	FGenesCGG3	CDS	1351755	1351841	.	-	.	transcript "408"	
Adh	FGenesCGG3	CDS	1352099	1352104	.	-	.	transcript "408"	
Adh	FGenesCGG3	start_codon	1352102	1352104	.	-	.	transcript "408"	
Adh	FGenesCGG3	CDS	1355875	1355912	.	+	.	transcript "409"	
Adh	FGenesCGG3	start_codon	1355875	1355877	.	+	.	transcript "409"	
Adh	FGenesCGG3	CDS	1356122	1356437	.	+	.	transcript "409"	
Adh	FGenesCGG3	stop_codon	1356435	1356437	.	+	.	transcript "409"	
Adh	FGenesCGG3	CDS	1359915	1359997	.	+	.	transcript "410"	
Adh	FGenesCGG3	start_codon	1359915	1359917	.	+	.	transcript "410"	
Adh	FGenesCGG3	CDS	1361336	1361391	.	+	.	transcript "410"	
Adh	FGenesCGG3	CDS	1363483	1363640	.	+	.	transcript "410"	
Adh	FGenesCGG3	stop_codon	1363638	1363640	.	+	.	transcript "410"	
Adh	FGenesCGG3	CDS	1360897	1360989	.	+	.	transcript "411"	
Adh	FGenesCGG3	start_codon	1360897	1360899	.	+	.	transcript "411"	
Adh	FGenesCGG3	CDS	1361682	1362017	.	+	.	transcript "411"	
Adh	FGenesCGG3	stop_codon	1362015	1362017	.	+	.	transcript "411"	
Adh	FGenesCGG3	CDS	1364345	1364530	.	-	.	transcript "412"	
Adh	FGenesCGG3	stop_codon	1364345	1364347	.	-	.	transcript "412"	
Adh	FGenesCGG3	CDS	1365170	1365361	.	-	.	transcript "412"	
Adh	FGenesCGG3	CDS	1365421	1365611	.	-	.	transcript "412"	
Adh	FGenesCGG3	CDS	1365666	1365762	.	-	.	transcript "412"	
Adh	FGenesCGG3	CDS	1367386	1367388	.	-	.	transcript "412"	
Adh	FGenesCGG3	start_codon	1367386	1367388	.	-	.	transcript "412"	
Adh	FGenesCGG3	CDS	1365406	1365611	.	-	.	transcript "413"	
Adh	FGenesCGG3	stop_codon	1365406	1365408	.	-	.	transcript "413"	
Adh	FGenesCGG3	CDS	1365666	1365762	.	-	.	transcript "413"	
Adh	FGenesCGG3	CDS	1368902	1368904	.	-	.	transcript "413"	
Adh	FGenesCGG3	start_codon	1368902	1368904	.	-	.	transcript "413"	
Adh	FGenesCGG3	CDS	1368948	1369282	.	-	.	transcript "414"	
Adh	FGenesCGG3	start_codon	1369280	1369282	.	-	.	transcript "414"	
Adh	FGenesCGG3	stop_codon	1368948	1368950	.	-	.	transcript "414"	
Adh	FGenesCGG3	CDS	1370112	1370156	.	-	.	transcript "415"	
Adh	FGenesCGG3	stop_codon	1370112	1370114	.	-	.	transcript "415"	
Adh	FGenesCGG3	CDS	1370239	1370414	.	-	.	transcript "415"	
Adh	FGenesCGG3	CDS	1371872	1371921	.	-	.	transcript "415"	
Adh	FGenesCGG3	start_codon	1371919	1371921	.	-	.	transcript "415"	
Adh	FGenesCGG3	CDS	1370271	1370438	.	-	.	transcript "416"	
Adh	FGenesCGG3	start_codon	1370436	1370438	.	-	.	transcript "416"	
Adh	FGenesCGG3	stop_codon	1370271	1370273	.	-	.	transcript "416"	
Adh	FGenesCGG3	CDS	1371868	1371921	.	-	.	transcript "417"	
Adh	FGenesCGG3	start_codon	1371919	1371921	.	-	.	transcript "417"	
Adh	FGenesCGG3	stop_codon	1371868	1371870	.	-	.	transcript "417"	
Adh	FGenesCGG3	CDS	1372017	1372351	.	-	.	transcript "418"	
Adh	FGenesCGG3	start_codon	1372349	1372351	.	-	.	transcript "418"	
Adh	FGenesCGG3	stop_codon	1372017	1372019	.	-	.	transcript "418"	
Adh	FGenesCGG3	CDS	1372518	1372718	.	-	.	transcript "419"	
Adh	FGenesCGG3	stop_codon	1372518	1372520	.	-	.	transcript "419"	
Adh	FGenesCGG3	CDS	1375043	1375186	.	-	.	transcript "419"	
Adh	FGenesCGG3	start_codon	1375184	1375186	.	-	.	transcript "419"	
Adh	FGenesCGG3	CDS	1377258	1377277	.	+	.	transcript "420"	
Adh	FGenesCGG3	start_codon	1377258	1377260	.	+	.	transcript "420"	
Adh	FGenesCGG3	CDS	1377419	1377524	.	+	.	transcript "420"	
Adh	FGenesCGG3	CDS	1379608	1379662	.	+	.	transcript "420"	
Adh	FGenesCGG3	CDS	1388924	1388979	.	+	.	transcript "420"	
Adh	FGenesCGG3	stop_codon	1388977	1388979	.	+	.	transcript "420"	
Adh	FGenesCGG3	CDS	1386498	1386502	.	-	.	transcript "421"	
Adh	FGenesCGG3	stop_codon	1386498	1386500	.	-	.	transcript "421"	
Adh	FGenesCGG3	CDS	1387275	1387401	.	-	.	transcript "421"	
Adh	FGenesCGG3	start_codon	1387399	1387401	.	-	.	transcript "421"	
Adh	FGenesCGG3	CDS	1391166	1391233	.	-	.	transcript "422"	
Adh	FGenesCGG3	stop_codon	1391166	1391168	.	-	.	transcript "422"	
Adh	FGenesCGG3	CDS	1392432	1392516	.	-	.	transcript "422"	
Adh	FGenesCGG3	start_codon	1392514	1392516	.	-	.	transcript "422"	
Adh	FGenesCGG3	CDS	1398183	1398833	.	-	.	transcript "423"	
Adh	FGenesCGG3	stop_codon	1398183	1398185	.	-	.	transcript "423"	
Adh	FGenesCGG3	CDS	1401633	1401874	.	-	.	transcript "423"	
Adh	FGenesCGG3	CDS	1402535	1402643	.	-	.	transcript "423"	
Adh	FGenesCGG3	CDS	1402808	1402995	.	-	.	transcript "423"	
Adh	FGenesCGG3	CDS	1403930	1404111	.	-	.	transcript "423"	
Adh	FGenesCGG3	CDS	1405762	1405903	.	-	.	transcript "423"	
Adh	FGenesCGG3	CDS	1406801	1406882	.	-	.	transcript "423"	
Adh	FGenesCGG3	CDS	1407035	1407146	.	-	.	transcript "423"	
Adh	FGenesCGG3	CDS	1407951	1408127	.	-	.	transcript "423"	
Adh	FGenesCGG3	CDS	1408830	1408932	.	-	.	transcript "423"	
Adh	FGenesCGG3	CDS	1409173	1409185	.	-	.	transcript "423"	
Adh	FGenesCGG3	start_codon	1409183	1409185	.	-	.	transcript "423"	
Adh	FGenesCGG3	CDS	1398183	1398833	.	-	.	transcript "424"	
Adh	FGenesCGG3	stop_codon	1398183	1398185	.	-	.	transcript "424"	
Adh	FGenesCGG3	CDS	1401633	1401874	.	-	.	transcript "424"	
Adh	FGenesCGG3	CDS	1402535	1402643	.	-	.	transcript "424"	
Adh	FGenesCGG3	CDS	1402808	1402995	.	-	.	transcript "424"	
Adh	FGenesCGG3	CDS	1403930	1404111	.	-	.	transcript "424"	
Adh	FGenesCGG3	CDS	1405762	1405903	.	-	.	transcript "424"	
Adh	FGenesCGG3	CDS	1406801	1406882	.	-	.	transcript "424"	
Adh	FGenesCGG3	CDS	1407035	1407310	.	-	.	transcript "424"	
Adh	FGenesCGG3	start_codon	1407308	1407310	.	-	.	transcript "424"	
Adh	FGenesCGG3	CDS	1408317	1408329	.	-	.	transcript "425"	
Adh	FGenesCGG3	stop_codon	1408317	1408319	.	-	.	transcript "425"	
Adh	FGenesCGG3	CDS	1408830	1408932	.	-	.	transcript "425"	
Adh	FGenesCGG3	CDS	1410834	1410897	.	-	.	transcript "425"	
Adh	FGenesCGG3	CDS	1411631	1411759	.	-	.	transcript "425"	
Adh	FGenesCGG3	CDS	1412611	1412741	.	-	.	transcript "425"	
Adh	FGenesCGG3	CDS	1413022	1413046	.	-	.	transcript "425"	
Adh	FGenesCGG3	start_codon	1413044	1413046	.	-	.	transcript "425"	
Adh	FGenesCGG3	CDS	1410778	1410897	.	-	.	transcript "426"	
Adh	FGenesCGG3	stop_codon	1410778	1410780	.	-	.	transcript "426"	
Adh	FGenesCGG3	CDS	1411607	1411759	.	-	.	transcript "426"	
Adh	FGenesCGG3	CDS	1412611	1412741	.	-	.	transcript "426"	
Adh	FGenesCGG3	CDS	1413301	1413415	.	-	.	transcript "426"	
Adh	FGenesCGG3	CDS	1413798	1413866	.	-	.	transcript "426"	
Adh	FGenesCGG3	start_codon	1413864	1413866	.	-	.	transcript "426"	
Adh	FGenesCGG3	CDS	1414397	1418081	.	+	.	transcript "427"	
Adh	FGenesCGG3	start_codon	1414397	1414399	.	+	.	transcript "427"	
Adh	FGenesCGG3	CDS	1418142	1418245	.	+	.	transcript "427"	
Adh	FGenesCGG3	CDS	1419125	1419321	.	+	.	transcript "427"	
Adh	FGenesCGG3	CDS	1419378	1419918	.	+	.	transcript "427"	
Adh	FGenesCGG3	stop_codon	1419916	1419918	.	+	.	transcript "427"	
Adh	FGenesCGG3	CDS	1414397	1415978	.	+	.	transcript "428"	
Adh	FGenesCGG3	start_codon	1414397	1414399	.	+	.	transcript "428"	
Adh	FGenesCGG3	CDS	1416078	1418081	.	+	.	transcript "428"	
Adh	FGenesCGG3	CDS	1418142	1419321	.	+	.	transcript "428"	
Adh	FGenesCGG3	CDS	1419378	1419918	.	+	.	transcript "428"	
Adh	FGenesCGG3	stop_codon	1419916	1419918	.	+	.	transcript "428"	
Adh	FGenesCGG3	CDS	1421063	1421145	.	-	.	transcript "429"	
Adh	FGenesCGG3	stop_codon	1421063	1421065	.	-	.	transcript "429"	
Adh	FGenesCGG3	CDS	1422176	1422320	.	-	.	transcript "429"	
Adh	FGenesCGG3	CDS	1424531	1424676	.	-	.	transcript "429"	
Adh	FGenesCGG3	CDS	1425549	1425752	.	-	.	transcript "429"	
Adh	FGenesCGG3	CDS	1426168	1426281	.	-	.	transcript "429"	
Adh	FGenesCGG3	CDS	1426393	1426486	.	-	.	transcript "429"	
Adh	FGenesCGG3	CDS	1428573	1428690	.	-	.	transcript "429"	
Adh	FGenesCGG3	CDS	1431180	1431306	.	-	.	transcript "429"	
Adh	FGenesCGG3	CDS	1431588	1431639	.	-	.	transcript "429"	
Adh	FGenesCGG3	start_codon	1431637	1431639	.	-	.	transcript "429"	
Adh	FGenesCGG3	CDS	1421063	1421145	.	-	.	transcript "430"	
Adh	FGenesCGG3	stop_codon	1421063	1421065	.	-	.	transcript "430"	
Adh	FGenesCGG3	CDS	1422176	1422320	.	-	.	transcript "430"	
Adh	FGenesCGG3	CDS	1424531	1424676	.	-	.	transcript "430"	
Adh	FGenesCGG3	CDS	1425549	1425752	.	-	.	transcript "430"	
Adh	FGenesCGG3	CDS	1426168	1426281	.	-	.	transcript "430"	
Adh	FGenesCGG3	CDS	1426393	1426486	.	-	.	transcript "430"	
Adh	FGenesCGG3	CDS	1428573	1428690	.	-	.	transcript "430"	
Adh	FGenesCGG3	CDS	1435139	1435188	.	-	.	transcript "430"	
Adh	FGenesCGG3	start_codon	1435186	1435188	.	-	.	transcript "430"	
Adh	FGenesCGG3	CDS	1442940	1442989	.	+	.	transcript "431"	
Adh	FGenesCGG3	start_codon	1442940	1442942	.	+	.	transcript "431"	
Adh	FGenesCGG3	CDS	1443341	1443405	.	+	.	transcript "431"	
Adh	FGenesCGG3	CDS	1445532	1445710	.	+	.	transcript "431"	
Adh	FGenesCGG3	CDS	1448673	1448746	.	+	.	transcript "431"	
Adh	FGenesCGG3	CDS	1450576	1450606	.	+	.	transcript "431"	
Adh	FGenesCGG3	CDS	1450916	1450972	.	+	.	transcript "431"	
Adh	FGenesCGG3	stop_codon	1450970	1450972	.	+	.	transcript "431"	
Adh	FGenesCGG3	CDS	1443348	1443405	.	+	.	transcript "432"	
Adh	FGenesCGG3	start_codon	1443348	1443350	.	+	.	transcript "432"	
Adh	FGenesCGG3	CDS	1445532	1445710	.	+	.	transcript "432"	
Adh	FGenesCGG3	CDS	1445783	1445848	.	+	.	transcript "432"	
Adh	FGenesCGG3	stop_codon	1445846	1445848	.	+	.	transcript "432"	
Adh	FGenesCGG3	CDS	1450912	1451033	.	-	.	transcript "433"	
Adh	FGenesCGG3	stop_codon	1450912	1450914	.	-	.	transcript "433"	
Adh	FGenesCGG3	CDS	1452554	1452722	.	-	.	transcript "433"	
Adh	FGenesCGG3	start_codon	1452720	1452722	.	-	.	transcript "433"	
Adh	FGenesCGG3	CDS	1452101	1452238	.	-	.	transcript "434"	
Adh	FGenesCGG3	stop_codon	1452101	1452103	.	-	.	transcript "434"	
Adh	FGenesCGG3	CDS	1452554	1452634	.	-	.	transcript "434"	
Adh	FGenesCGG3	CDS	1453342	1453404	.	-	.	transcript "434"	
Adh	FGenesCGG3	start_codon	1453402	1453404	.	-	.	transcript "434"	
Adh	FGenesCGG3	CDS	1457726	1457826	.	+	.	transcript "435"	
Adh	FGenesCGG3	start_codon	1457726	1457728	.	+	.	transcript "435"	
Adh	FGenesCGG3	CDS	1458338	1458394	.	+	.	transcript "435"	
Adh	FGenesCGG3	CDS	1458572	1458659	.	+	.	transcript "435"	
Adh	FGenesCGG3	stop_codon	1458657	1458659	.	+	.	transcript "435"	
Adh	FGenesCGG3	CDS	1457726	1457826	.	+	.	transcript "436"	
Adh	FGenesCGG3	start_codon	1457726	1457728	.	+	.	transcript "436"	
Adh	FGenesCGG3	CDS	1458265	1458511	.	+	.	transcript "436"	
Adh	FGenesCGG3	CDS	1458572	1458694	.	+	.	transcript "436"	
Adh	FGenesCGG3	stop_codon	1458692	1458694	.	+	.	transcript "436"	
Adh	FGenesCGG3	CDS	1459322	1459333	.	-	.	transcript "437"	
Adh	FGenesCGG3	stop_codon	1459322	1459324	.	-	.	transcript "437"	
Adh	FGenesCGG3	CDS	1463041	1463106	.	-	.	transcript "437"	
Adh	FGenesCGG3	CDS	1464712	1464834	.	-	.	transcript "437"	
Adh	FGenesCGG3	start_codon	1464832	1464834	.	-	.	transcript "437"	
Adh	FGenesCGG3	CDS	1465977	1466019	.	-	.	transcript "438"	
Adh	FGenesCGG3	stop_codon	1465977	1465979	.	-	.	transcript "438"	
Adh	FGenesCGG3	CDS	1466153	1466744	.	-	.	transcript "438"	
Adh	FGenesCGG3	CDS	1466876	1467307	.	-	.	transcript "438"	
Adh	FGenesCGG3	CDS	1469796	1469805	.	-	.	transcript "438"	
Adh	FGenesCGG3	start_codon	1469803	1469805	.	-	.	transcript "438"	
Adh	FGenesCGG3	CDS	1465977	1466019	.	-	.	transcript "439"	
Adh	FGenesCGG3	stop_codon	1465977	1465979	.	-	.	transcript "439"	
Adh	FGenesCGG3	CDS	1466153	1466744	.	-	.	transcript "439"	
Adh	FGenesCGG3	CDS	1466876	1467307	.	-	.	transcript "439"	
Adh	FGenesCGG3	CDS	1473611	1473745	.	-	.	transcript "439"	
Adh	FGenesCGG3	CDS	1473857	1473914	.	-	.	transcript "439"	
Adh	FGenesCGG3	CDS	1477478	1477592	.	-	.	transcript "439"	
Adh	FGenesCGG3	CDS	1480433	1480581	.	-	.	transcript "439"	
Adh	FGenesCGG3	CDS	1480718	1480801	.	-	.	transcript "439"	
Adh	FGenesCGG3	start_codon	1480799	1480801	.	-	.	transcript "439"	
Adh	FGenesCGG3	CDS	1475691	1476936	.	+	.	transcript "440"	
Adh	FGenesCGG3	start_codon	1475691	1475693	.	+	.	transcript "440"	
Adh	FGenesCGG3	CDS	1477128	1480096	.	+	.	transcript "440"	
Adh	FGenesCGG3	stop_codon	1480094	1480096	.	+	.	transcript "440"	
Adh	FGenesCGG3	CDS	1480661	1481086	.	+	.	transcript "441"	
Adh	FGenesCGG3	start_codon	1480661	1480663	.	+	.	transcript "441"	
Adh	FGenesCGG3	stop_codon	1481084	1481086	.	+	.	transcript "441"	
Adh	FGenesCGG3	CDS	1481699	1481786	.	+	.	transcript "442"	
Adh	FGenesCGG3	start_codon	1481699	1481701	.	+	.	transcript "442"	
Adh	FGenesCGG3	CDS	1487199	1487229	.	+	.	transcript "442"	
Adh	FGenesCGG3	CDS	1491484	1491589	.	+	.	transcript "442"	
Adh	FGenesCGG3	CDS	1495620	1495919	.	+	.	transcript "442"	
Adh	FGenesCGG3	CDS	1495977	1496198	.	+	.	transcript "442"	
Adh	FGenesCGG3	stop_codon	1496196	1496198	.	+	.	transcript "442"	
Adh	FGenesCGG3	CDS	1484567	1484604	.	+	.	transcript "443"	
Adh	FGenesCGG3	start_codon	1484567	1484569	.	+	.	transcript "443"	
Adh	FGenesCGG3	CDS	1485807	1485847	.	+	.	transcript "443"	
Adh	FGenesCGG3	CDS	1487158	1487229	.	+	.	transcript "443"	
Adh	FGenesCGG3	CDS	1487417	1487607	.	+	.	transcript "443"	
Adh	FGenesCGG3	stop_codon	1487605	1487607	.	+	.	transcript "443"	
Adh	FGenesCGG3	CDS	1493680	1493718	.	+	.	transcript "444"	
Adh	FGenesCGG3	start_codon	1493680	1493682	.	+	.	transcript "444"	
Adh	FGenesCGG3	CDS	1495620	1495919	.	+	.	transcript "444"	
Adh	FGenesCGG3	CDS	1495977	1496198	.	+	.	transcript "444"	
Adh	FGenesCGG3	stop_codon	1496196	1496198	.	+	.	transcript "444"	
Adh	FGenesCGG3	CDS	1496304	1496815	.	-	.	transcript "445"	
Adh	FGenesCGG3	stop_codon	1496304	1496306	.	-	.	transcript "445"	
Adh	FGenesCGG3	CDS	1496865	1497000	.	-	.	transcript "445"	
Adh	FGenesCGG3	start_codon	1496998	1497000	.	-	.	transcript "445"	
Adh	FGenesCGG3	CDS	1496798	1496811	.	-	.	transcript "446"	
Adh	FGenesCGG3	stop_codon	1496798	1496800	.	-	.	transcript "446"	
Adh	FGenesCGG3	CDS	1496865	1497000	.	-	.	transcript "446"	
Adh	FGenesCGG3	start_codon	1496998	1497000	.	-	.	transcript "446"	
Adh	FGenesCGG3	CDS	1497576	1498121	.	+	.	transcript "447"	
Adh	FGenesCGG3	start_codon	1497576	1497578	.	+	.	transcript "447"	
Adh	FGenesCGG3	stop_codon	1498119	1498121	.	+	.	transcript "447"	
Adh	FGenesCGG3	CDS	1497918	1498117	.	-	.	transcript "448"	
Adh	FGenesCGG3	stop_codon	1497918	1497920	.	-	.	transcript "448"	
Adh	FGenesCGG3	CDS	1498540	1499046	.	-	.	transcript "448"	
Adh	FGenesCGG3	CDS	1499102	1499249	.	-	.	transcript "448"	
Adh	FGenesCGG3	start_codon	1499247	1499249	.	-	.	transcript "448"	
Adh	FGenesCGG3	CDS	1498334	1499046	.	-	.	transcript "449"	
Adh	FGenesCGG3	stop_codon	1498334	1498336	.	-	.	transcript "449"	
Adh	FGenesCGG3	CDS	1499102	1499249	.	-	.	transcript "449"	
Adh	FGenesCGG3	start_codon	1499247	1499249	.	-	.	transcript "449"	
Adh	FGenesCGG3	CDS	1499670	1500797	.	+	.	transcript "450"	
Adh	FGenesCGG3	start_codon	1499670	1499672	.	+	.	transcript "450"	
Adh	FGenesCGG3	CDS	1500954	1501010	.	+	.	transcript "450"	
Adh	FGenesCGG3	stop_codon	1501008	1501010	.	+	.	transcript "450"	
Adh	FGenesCGG3	CDS	1500039	1500301	.	+	.	transcript "451"	
Adh	FGenesCGG3	start_codon	1500039	1500041	.	+	.	transcript "451"	
Adh	FGenesCGG3	CDS	1500735	1500797	.	+	.	transcript "451"	
Adh	FGenesCGG3	CDS	1502802	1502817	.	+	.	transcript "451"	
Adh	FGenesCGG3	stop_codon	1502815	1502817	.	+	.	transcript "451"	
Adh	FGenesCGG3	CDS	1504832	1505030	.	-	.	transcript "452"	
Adh	FGenesCGG3	stop_codon	1504832	1504834	.	-	.	transcript "452"	
Adh	FGenesCGG3	CDS	1505420	1505469	.	-	.	transcript "452"	
Adh	FGenesCGG3	start_codon	1505467	1505469	.	-	.	transcript "452"	
Adh	FGenesCGG3	CDS	1505999	1506086	.	+	.	transcript "453"	
Adh	FGenesCGG3	start_codon	1505999	1506001	.	+	.	transcript "453"	
Adh	FGenesCGG3	CDS	1506806	1507048	.	+	.	transcript "453"	
Adh	FGenesCGG3	CDS	1507747	1507814	.	+	.	transcript "453"	
Adh	FGenesCGG3	stop_codon	1507812	1507814	.	+	.	transcript "453"	
Adh	FGenesCGG3	CDS	1508672	1508695	.	+	.	transcript "454"	
Adh	FGenesCGG3	start_codon	1508672	1508674	.	+	.	transcript "454"	
Adh	FGenesCGG3	CDS	1510744	1510998	.	+	.	transcript "454"	
Adh	FGenesCGG3	CDS	1511927	1511935	.	+	.	transcript "454"	
Adh	FGenesCGG3	CDS	1515041	1515175	.	+	.	transcript "454"	
Adh	FGenesCGG3	CDS	1515266	1515436	.	+	.	transcript "454"	
Adh	FGenesCGG3	CDS	1515498	1515714	.	+	.	transcript "454"	
Adh	FGenesCGG3	CDS	1515807	1515972	.	+	.	transcript "454"	
Adh	FGenesCGG3	CDS	1516036	1516279	.	+	.	transcript "454"	
Adh	FGenesCGG3	CDS	1516339	1516488	.	+	.	transcript "454"	
Adh	FGenesCGG3	CDS	1516560	1519082	.	+	.	transcript "454"	
Adh	FGenesCGG3	CDS	1519240	1519382	.	+	.	transcript "454"	
Adh	FGenesCGG3	CDS	1519441	1519564	.	+	.	transcript "454"	
Adh	FGenesCGG3	CDS	1519636	1519752	.	+	.	transcript "454"	
Adh	FGenesCGG3	CDS	1519816	1520023	.	+	.	transcript "454"	
Adh	FGenesCGG3	CDS	1520081	1520337	.	+	.	transcript "454"	
Adh	FGenesCGG3	CDS	1520398	1520535	.	+	.	transcript "454"	
Adh	FGenesCGG3	CDS	1521654	1521834	.	+	.	transcript "454"	
Adh	FGenesCGG3	CDS	1522286	1522308	.	+	.	transcript "454"	
Adh	FGenesCGG3	stop_codon	1522306	1522308	.	+	.	transcript "454"	
Adh	FGenesCGG3	CDS	1510906	1510998	.	+	.	transcript "455"	
Adh	FGenesCGG3	start_codon	1510906	1510908	.	+	.	transcript "455"	
Adh	FGenesCGG3	CDS	1515041	1515436	.	+	.	transcript "455"	
Adh	FGenesCGG3	CDS	1515498	1515714	.	+	.	transcript "455"	
Adh	FGenesCGG3	CDS	1515807	1515972	.	+	.	transcript "455"	
Adh	FGenesCGG3	CDS	1516036	1516279	.	+	.	transcript "455"	
Adh	FGenesCGG3	CDS	1516339	1516488	.	+	.	transcript "455"	
Adh	FGenesCGG3	CDS	1517398	1517471	.	+	.	transcript "455"	
Adh	FGenesCGG3	CDS	1517519	1517978	.	+	.	transcript "455"	
Adh	FGenesCGG3	CDS	1519240	1519382	.	+	.	transcript "455"	
Adh	FGenesCGG3	CDS	1519441	1519564	.	+	.	transcript "455"	
Adh	FGenesCGG3	CDS	1519897	1520023	.	+	.	transcript "455"	
Adh	FGenesCGG3	CDS	1520081	1520337	.	+	.	transcript "455"	
Adh	FGenesCGG3	CDS	1520398	1520535	.	+	.	transcript "455"	
Adh	FGenesCGG3	CDS	1521654	1521834	.	+	.	transcript "455"	
Adh	FGenesCGG3	CDS	1525347	1525496	.	+	.	transcript "455"	
Adh	FGenesCGG3	CDS	1526237	1526427	.	+	.	transcript "455"	
Adh	FGenesCGG3	stop_codon	1526425	1526427	.	+	.	transcript "455"	
Adh	FGenesCGG3	CDS	1525215	1525447	.	+	.	transcript "456"	
Adh	FGenesCGG3	start_codon	1525215	1525217	.	+	.	transcript "456"	
Adh	FGenesCGG3	CDS	1526237	1526642	.	+	.	transcript "456"	
Adh	FGenesCGG3	CDS	1526702	1527379	.	+	.	transcript "456"	
Adh	FGenesCGG3	stop_codon	1527377	1527379	.	+	.	transcript "456"	
Adh	FGenesCGG3	CDS	1527523	1527636	.	-	.	transcript "457"	
Adh	FGenesCGG3	stop_codon	1527523	1527525	.	-	.	transcript "457"	
Adh	FGenesCGG3	CDS	1527705	1528201	.	-	.	transcript "457"	
Adh	FGenesCGG3	CDS	1528291	1528426	.	-	.	transcript "457"	
Adh	FGenesCGG3	start_codon	1528424	1528426	.	-	.	transcript "457"	
Adh	FGenesCGG3	CDS	1527523	1527636	.	-	.	transcript "458"	
Adh	FGenesCGG3	stop_codon	1527523	1527525	.	-	.	transcript "458"	
Adh	FGenesCGG3	CDS	1527705	1528201	.	-	.	transcript "458"	
Adh	FGenesCGG3	CDS	1528291	1528426	.	-	.	transcript "458"	
Adh	FGenesCGG3	start_codon	1528424	1528426	.	-	.	transcript "458"	
Adh	FGenesCGG3	CDS	1529588	1529971	.	+	.	transcript "459"	
Adh	FGenesCGG3	start_codon	1529588	1529590	.	+	.	transcript "459"	
Adh	FGenesCGG3	CDS	1530746	1531626	.	+	.	transcript "459"	
Adh	FGenesCGG3	CDS	1531685	1531892	.	+	.	transcript "459"	
Adh	FGenesCGG3	CDS	1531958	1532269	.	+	.	transcript "459"	
Adh	FGenesCGG3	stop_codon	1532267	1532269	.	+	.	transcript "459"	
Adh	FGenesCGG3	CDS	1535065	1535271	.	-	.	transcript "460"	
Adh	FGenesCGG3	stop_codon	1535065	1535067	.	-	.	transcript "460"	
Adh	FGenesCGG3	CDS	1535341	1535461	.	-	.	transcript "460"	
Adh	FGenesCGG3	CDS	1535530	1535628	.	-	.	transcript "460"	
Adh	FGenesCGG3	CDS	1535739	1536304	.	-	.	transcript "460"	
Adh	FGenesCGG3	CDS	1536364	1536841	.	-	.	transcript "460"	
Adh	FGenesCGG3	CDS	1536914	1537150	.	-	.	transcript "460"	
Adh	FGenesCGG3	CDS	1537212	1538662	.	-	.	transcript "460"	
Adh	FGenesCGG3	CDS	1538758	1541113	.	-	.	transcript "460"	
Adh	FGenesCGG3	CDS	1541178	1541378	.	-	.	transcript "460"	
Adh	FGenesCGG3	CDS	1541445	1541794	.	-	.	transcript "460"	
Adh	FGenesCGG3	CDS	1542125	1542385	.	-	.	transcript "460"	
Adh	FGenesCGG3	CDS	1543065	1543082	.	-	.	transcript "460"	
Adh	FGenesCGG3	start_codon	1543080	1543082	.	-	.	transcript "460"	
Adh	FGenesCGG3	CDS	1544171	1544285	.	+	.	transcript "461"	
Adh	FGenesCGG3	start_codon	1544171	1544173	.	+	.	transcript "461"	
Adh	FGenesCGG3	CDS	1544919	1544978	.	+	.	transcript "461"	
Adh	FGenesCGG3	CDS	1546650	1546719	.	+	.	transcript "461"	
Adh	FGenesCGG3	CDS	1548145	1548319	.	+	.	transcript "461"	
Adh	FGenesCGG3	CDS	1548383	1548538	.	+	.	transcript "461"	
Adh	FGenesCGG3	stop_codon	1548536	1548538	.	+	.	transcript "461"	
Adh	FGenesCGG3	CDS	1546679	1546719	.	+	.	transcript "462"	
Adh	FGenesCGG3	start_codon	1546679	1546681	.	+	.	transcript "462"	
Adh	FGenesCGG3	CDS	1547905	1548319	.	+	.	transcript "462"	
Adh	FGenesCGG3	CDS	1548383	1548538	.	+	.	transcript "462"	
Adh	FGenesCGG3	stop_codon	1548536	1548538	.	+	.	transcript "462"	
Adh	FGenesCGG3	CDS	1549142	1550017	.	-	.	transcript "463"	
Adh	FGenesCGG3	stop_codon	1549142	1549144	.	-	.	transcript "463"	
Adh	FGenesCGG3	CDS	1550084	1550149	.	-	.	transcript "463"	
Adh	FGenesCGG3	start_codon	1550147	1550149	.	-	.	transcript "463"	
Adh	FGenesCGG3	CDS	1550647	1550827	.	-	.	transcript "464"	
Adh	FGenesCGG3	stop_codon	1550647	1550649	.	-	.	transcript "464"	
Adh	FGenesCGG3	CDS	1554518	1554599	.	-	.	transcript "464"	
Adh	FGenesCGG3	CDS	1554841	1555107	.	-	.	transcript "464"	
Adh	FGenesCGG3	CDS	1556588	1556798	.	-	.	transcript "464"	
Adh	FGenesCGG3	start_codon	1556796	1556798	.	-	.	transcript "464"	
Adh	FGenesCGG3	CDS	1554085	1554599	.	-	.	transcript "465"	
Adh	FGenesCGG3	stop_codon	1554085	1554087	.	-	.	transcript "465"	
Adh	FGenesCGG3	CDS	1554841	1555107	.	-	.	transcript "465"	
Adh	FGenesCGG3	CDS	1556588	1557000	.	-	.	transcript "465"	
Adh	FGenesCGG3	start_codon	1556998	1557000	.	-	.	transcript "465"	
Adh	FGenesCGG3	CDS	1558057	1558080	.	+	.	transcript "466"	
Adh	FGenesCGG3	start_codon	1558057	1558059	.	+	.	transcript "466"	
Adh	FGenesCGG3	CDS	1558134	1558521	.	+	.	transcript "466"	
Adh	FGenesCGG3	CDS	1561989	1562278	.	+	.	transcript "466"	
Adh	FGenesCGG3	CDS	1562338	1563081	.	+	.	transcript "466"	
Adh	FGenesCGG3	CDS	1563140	1563353	.	+	.	transcript "466"	
Adh	FGenesCGG3	CDS	1563418	1563689	.	+	.	transcript "466"	
Adh	FGenesCGG3	CDS	1563761	1563814	.	+	.	transcript "466"	
Adh	FGenesCGG3	stop_codon	1563812	1563814	.	+	.	transcript "466"	
Adh	FGenesCGG3	CDS	1568671	1568701	.	+	.	transcript "467"	
Adh	FGenesCGG3	start_codon	1568671	1568673	.	+	.	transcript "467"	
Adh	FGenesCGG3	CDS	1576691	1576943	.	+	.	transcript "467"	
Adh	FGenesCGG3	CDS	1577036	1577406	.	+	.	transcript "467"	
Adh	FGenesCGG3	CDS	1577926	1578081	.	+	.	transcript "467"	
Adh	FGenesCGG3	CDS	1580750	1580880	.	+	.	transcript "467"	
Adh	FGenesCGG3	CDS	1580946	1581227	.	+	.	transcript "467"	
Adh	FGenesCGG3	CDS	1581294	1581623	.	+	.	transcript "467"	
Adh	FGenesCGG3	CDS	1581774	1582136	.	+	.	transcript "467"	
Adh	FGenesCGG3	CDS	1582201	1582292	.	+	.	transcript "467"	
Adh	FGenesCGG3	CDS	1582550	1582687	.	+	.	transcript "467"	
Adh	FGenesCGG3	CDS	1583072	1583204	.	+	.	transcript "467"	
Adh	FGenesCGG3	stop_codon	1583202	1583204	.	+	.	transcript "467"	
Adh	FGenesCGG3	CDS	1568678	1568853	.	-	.	transcript "468"	
Adh	FGenesCGG3	stop_codon	1568678	1568680	.	-	.	transcript "468"	
Adh	FGenesCGG3	CDS	1569405	1569531	.	-	.	transcript "468"	
Adh	FGenesCGG3	start_codon	1569529	1569531	.	-	.	transcript "468"	
Adh	FGenesCGG3	CDS	1573842	1573911	.	+	.	transcript "469"	
Adh	FGenesCGG3	start_codon	1573842	1573844	.	+	.	transcript "469"	
Adh	FGenesCGG3	CDS	1576691	1576943	.	+	.	transcript "469"	
Adh	FGenesCGG3	CDS	1577036	1577406	.	+	.	transcript "469"	
Adh	FGenesCGG3	CDS	1577568	1577860	.	+	.	transcript "469"	
Adh	FGenesCGG3	CDS	1577926	1578081	.	+	.	transcript "469"	
Adh	FGenesCGG3	CDS	1580550	1580685	.	+	.	transcript "469"	
Adh	FGenesCGG3	CDS	1580750	1580880	.	+	.	transcript "469"	
Adh	FGenesCGG3	CDS	1580928	1581227	.	+	.	transcript "469"	
Adh	FGenesCGG3	CDS	1581294	1581623	.	+	.	transcript "469"	
Adh	FGenesCGG3	CDS	1581774	1582136	.	+	.	transcript "469"	
Adh	FGenesCGG3	CDS	1582201	1582292	.	+	.	transcript "469"	
Adh	FGenesCGG3	CDS	1582550	1582687	.	+	.	transcript "469"	
Adh	FGenesCGG3	CDS	1583070	1583334	.	+	.	transcript "469"	
Adh	FGenesCGG3	CDS	1584330	1584828	.	+	.	transcript "469"	
Adh	FGenesCGG3	CDS	1584949	1585094	.	+	.	transcript "469"	
Adh	FGenesCGG3	CDS	1585153	1585380	.	+	.	transcript "469"	
Adh	FGenesCGG3	stop_codon	1585378	1585380	.	+	.	transcript "469"	
Adh	FGenesCGG3	CDS	1584750	1584828	.	+	.	transcript "470"	
Adh	FGenesCGG3	start_codon	1584750	1584752	.	+	.	transcript "470"	
Adh	FGenesCGG3	CDS	1584949	1585094	.	+	.	transcript "470"	
Adh	FGenesCGG3	CDS	1585153	1585380	.	+	.	transcript "470"	
Adh	FGenesCGG3	stop_codon	1585378	1585380	.	+	.	transcript "470"	
Adh	FGenesCGG3	CDS	1586105	1586211	.	-	.	transcript "471"	
Adh	FGenesCGG3	stop_codon	1586105	1586107	.	-	.	transcript "471"	
Adh	FGenesCGG3	CDS	1587364	1587415	.	-	.	transcript "471"	
Adh	FGenesCGG3	start_codon	1587413	1587415	.	-	.	transcript "471"	
Adh	FGenesCGG3	CDS	1587055	1587061	.	+	.	transcript "472"	
Adh	FGenesCGG3	start_codon	1587055	1587057	.	+	.	transcript "472"	
Adh	FGenesCGG3	CDS	1587264	1587423	.	+	.	transcript "472"	
Adh	FGenesCGG3	CDS	1587595	1587739	.	+	.	transcript "472"	
Adh	FGenesCGG3	stop_codon	1587737	1587739	.	+	.	transcript "472"	
Adh	FGenesCGG3	CDS	1588667	1588759	.	+	.	transcript "473"	
Adh	FGenesCGG3	start_codon	1588667	1588669	.	+	.	transcript "473"	
Adh	FGenesCGG3	CDS	1592119	1592181	.	+	.	transcript "473"	
Adh	FGenesCGG3	stop_codon	1592179	1592181	.	+	.	transcript "473"	
Adh	FGenesCGG3	CDS	1591829	1592257	.	-	.	transcript "474"	
Adh	FGenesCGG3	stop_codon	1591829	1591831	.	-	.	transcript "474"	
Adh	FGenesCGG3	CDS	1593554	1593580	.	-	.	transcript "474"	
Adh	FGenesCGG3	start_codon	1593578	1593580	.	-	.	transcript "474"	
Adh	FGenesCGG3	CDS	1593013	1593223	.	+	.	transcript "475"	
Adh	FGenesCGG3	start_codon	1593013	1593015	.	+	.	transcript "475"	
Adh	FGenesCGG3	CDS	1596533	1596749	.	+	.	transcript "475"	
Adh	FGenesCGG3	CDS	1597892	1598009	.	+	.	transcript "475"	
Adh	FGenesCGG3	stop_codon	1598007	1598009	.	+	.	transcript "475"	
Adh	FGenesCGG3	CDS	1597029	1597125	.	+	.	transcript "476"	
Adh	FGenesCGG3	start_codon	1597029	1597031	.	+	.	transcript "476"	
Adh	FGenesCGG3	CDS	1597892	1598118	.	+	.	transcript "476"	
Adh	FGenesCGG3	stop_codon	1598116	1598118	.	+	.	transcript "476"	
Adh	FGenesCGG3	CDS	1599218	1600177	.	+	.	transcript "477"	
Adh	FGenesCGG3	start_codon	1599218	1599220	.	+	.	transcript "477"	
Adh	FGenesCGG3	CDS	1601744	1602565	.	+	.	transcript "477"	
Adh	FGenesCGG3	stop_codon	1602563	1602565	.	+	.	transcript "477"	
Adh	FGenesCGG3	CDS	1599236	1599880	.	+	.	transcript "478"	
Adh	FGenesCGG3	start_codon	1599236	1599238	.	+	.	transcript "478"	
Adh	FGenesCGG3	CDS	1600004	1600177	.	+	.	transcript "478"	
Adh	FGenesCGG3	CDS	1601744	1602565	.	+	.	transcript "478"	
Adh	FGenesCGG3	stop_codon	1602563	1602565	.	+	.	transcript "478"	
Adh	FGenesCGG3	CDS	1603541	1603885	.	+	.	transcript "479"	
Adh	FGenesCGG3	start_codon	1603541	1603543	.	+	.	transcript "479"	
Adh	FGenesCGG3	CDS	1603951	1605404	.	+	.	transcript "479"	
Adh	FGenesCGG3	CDS	1605651	1606718	.	+	.	transcript "479"	
Adh	FGenesCGG3	CDS	1606791	1607142	.	+	.	transcript "479"	
Adh	FGenesCGG3	CDS	1607205	1607306	.	+	.	transcript "479"	
Adh	FGenesCGG3	stop_codon	1607304	1607306	.	+	.	transcript "479"	
Adh	FGenesCGG3	CDS	1611614	1611677	.	+	.	transcript "480"	
Adh	FGenesCGG3	start_codon	1611614	1611616	.	+	.	transcript "480"	
Adh	FGenesCGG3	CDS	1611815	1612014	.	+	.	transcript "480"	
Adh	FGenesCGG3	CDS	1613840	1613968	.	+	.	transcript "480"	
Adh	FGenesCGG3	CDS	1617734	1617814	.	+	.	transcript "480"	
Adh	FGenesCGG3	CDS	1618309	1618392	.	+	.	transcript "480"	
Adh	FGenesCGG3	stop_codon	1618390	1618392	.	+	.	transcript "480"	
Adh	FGenesCGG3	CDS	1611629	1611677	.	+	.	transcript "481"	
Adh	FGenesCGG3	start_codon	1611629	1611631	.	+	.	transcript "481"	
Adh	FGenesCGG3	CDS	1611815	1612014	.	+	.	transcript "481"	
Adh	FGenesCGG3	CDS	1613840	1613968	.	+	.	transcript "481"	
Adh	FGenesCGG3	CDS	1614206	1614304	.	+	.	transcript "481"	
Adh	FGenesCGG3	stop_codon	1614302	1614304	.	+	.	transcript "481"	
Adh	FGenesCGG3	CDS	1616771	1617249	.	-	.	transcript "482"	
Adh	FGenesCGG3	stop_codon	1616771	1616773	.	-	.	transcript "482"	
Adh	FGenesCGG3	CDS	1617631	1617658	.	-	.	transcript "482"	
Adh	FGenesCGG3	start_codon	1617656	1617658	.	-	.	transcript "482"	
Adh	FGenesCGG3	CDS	1618232	1618238	.	+	.	transcript "483"	
Adh	FGenesCGG3	start_codon	1618232	1618234	.	+	.	transcript "483"	
Adh	FGenesCGG3	CDS	1618293	1618512	.	+	.	transcript "483"	
Adh	FGenesCGG3	CDS	1622406	1622601	.	+	.	transcript "483"	
Adh	FGenesCGG3	stop_codon	1622599	1622601	.	+	.	transcript "483"	
Adh	FGenesCGG3	CDS	1620847	1621063	.	-	.	transcript "484"	
Adh	FGenesCGG3	stop_codon	1620847	1620849	.	-	.	transcript "484"	
Adh	FGenesCGG3	CDS	1624939	1624997	.	-	.	transcript "484"	
Adh	FGenesCGG3	start_codon	1624995	1624997	.	-	.	transcript "484"	
Adh	FGenesCGG3	CDS	1624417	1624528	.	+	.	transcript "485"	
Adh	FGenesCGG3	start_codon	1624417	1624419	.	+	.	transcript "485"	
Adh	FGenesCGG3	CDS	1624600	1624694	.	+	.	transcript "485"	
Adh	FGenesCGG3	CDS	1625154	1625244	.	+	.	transcript "485"	
Adh	FGenesCGG3	CDS	1625733	1625818	.	+	.	transcript "485"	
Adh	FGenesCGG3	stop_codon	1625816	1625818	.	+	.	transcript "485"	
Adh	FGenesCGG3	CDS	1628213	1628396	.	-	.	transcript "486"	
Adh	FGenesCGG3	stop_codon	1628213	1628215	.	-	.	transcript "486"	
Adh	FGenesCGG3	CDS	1630152	1630237	.	-	.	transcript "486"	
Adh	FGenesCGG3	CDS	1638281	1638355	.	-	.	transcript "486"	
Adh	FGenesCGG3	start_codon	1638353	1638355	.	-	.	transcript "486"	
Adh	FGenesCGG3	CDS	1629832	1630000	.	-	.	transcript "487"	
Adh	FGenesCGG3	stop_codon	1629832	1629834	.	-	.	transcript "487"	
Adh	FGenesCGG3	CDS	1630351	1630487	.	-	.	transcript "487"	
Adh	FGenesCGG3	start_codon	1630485	1630487	.	-	.	transcript "487"	
Adh	FGenesCGG3	CDS	1634224	1634574	.	-	.	transcript "488"	
Adh	FGenesCGG3	start_codon	1634572	1634574	.	-	.	transcript "488"	
Adh	FGenesCGG3	stop_codon	1634224	1634226	.	-	.	transcript "488"	
Adh	FGenesCGG3	CDS	1635452	1635519	.	+	.	transcript "489"	
Adh	FGenesCGG3	start_codon	1635452	1635454	.	+	.	transcript "489"	
Adh	FGenesCGG3	CDS	1635635	1635929	.	+	.	transcript "489"	
Adh	FGenesCGG3	CDS	1636112	1636132	.	+	.	transcript "489"	
Adh	FGenesCGG3	stop_codon	1636130	1636132	.	+	.	transcript "489"	
Adh	FGenesCGG3	CDS	1639615	1639636	.	+	.	transcript "490"	
Adh	FGenesCGG3	start_codon	1639615	1639617	.	+	.	transcript "490"	
Adh	FGenesCGG3	CDS	1639752	1639894	.	+	.	transcript "490"	
Adh	FGenesCGG3	CDS	1641645	1641718	.	+	.	transcript "490"	
Adh	FGenesCGG3	CDS	1644355	1644391	.	+	.	transcript "490"	
Adh	FGenesCGG3	stop_codon	1644389	1644391	.	+	.	transcript "490"	
Adh	FGenesCGG3	CDS	1641089	1641141	.	+	.	transcript "491"	
Adh	FGenesCGG3	start_codon	1641089	1641091	.	+	.	transcript "491"	
Adh	FGenesCGG3	CDS	1641444	1641534	.	+	.	transcript "491"	
Adh	FGenesCGG3	stop_codon	1641532	1641534	.	+	.	transcript "491"	
Adh	FGenesCGG3	CDS	1643952	1643973	.	+	.	transcript "492"	
Adh	FGenesCGG3	start_codon	1643952	1643954	.	+	.	transcript "492"	
Adh	FGenesCGG3	CDS	1644188	1644303	.	+	.	transcript "492"	
Adh	FGenesCGG3	CDS	1644355	1644525	.	+	.	transcript "492"	
Adh	FGenesCGG3	stop_codon	1644523	1644525	.	+	.	transcript "492"	
Adh	FGenesCGG3	CDS	1644910	1645013	.	-	.	transcript "493"	
Adh	FGenesCGG3	stop_codon	1644910	1644912	.	-	.	transcript "493"	
Adh	FGenesCGG3	CDS	1645056	1645215	.	-	.	transcript "493"	
Adh	FGenesCGG3	CDS	1650273	1650449	.	-	.	transcript "493"	
Adh	FGenesCGG3	start_codon	1650447	1650449	.	-	.	transcript "493"	
Adh	FGenesCGG3	CDS	1646525	1646566	.	+	.	transcript "494"	
Adh	FGenesCGG3	start_codon	1646525	1646527	.	+	.	transcript "494"	
Adh	FGenesCGG3	CDS	1647615	1647767	.	+	.	transcript "494"	
Adh	FGenesCGG3	CDS	1649378	1649617	.	+	.	transcript "494"	
Adh	FGenesCGG3	CDS	1650237	1650425	.	+	.	transcript "494"	
Adh	FGenesCGG3	stop_codon	1650423	1650425	.	+	.	transcript "494"	
Adh	FGenesCGG3	CDS	1651072	1651167	.	-	.	transcript "495"	
Adh	FGenesCGG3	stop_codon	1651072	1651074	.	-	.	transcript "495"	
Adh	FGenesCGG3	CDS	1651337	1651403	.	-	.	transcript "495"	
Adh	FGenesCGG3	CDS	1651844	1651881	.	-	.	transcript "495"	
Adh	FGenesCGG3	start_codon	1651879	1651881	.	-	.	transcript "495"	
Adh	FGenesCGG3	CDS	1653232	1653414	.	-	.	transcript "496"	
Adh	FGenesCGG3	stop_codon	1653232	1653234	.	-	.	transcript "496"	
Adh	FGenesCGG3	CDS	1653857	1654030	.	-	.	transcript "496"	
Adh	FGenesCGG3	CDS	1654433	1654885	.	-	.	transcript "496"	
Adh	FGenesCGG3	CDS	1656725	1657133	.	-	.	transcript "496"	
Adh	FGenesCGG3	CDS	1657232	1657342	.	-	.	transcript "496"	
Adh	FGenesCGG3	CDS	1661045	1661189	.	-	.	transcript "496"	
Adh	FGenesCGG3	CDS	1667694	1667971	.	-	.	transcript "496"	
Adh	FGenesCGG3	CDS	1670593	1670681	.	-	.	transcript "496"	
Adh	FGenesCGG3	start_codon	1670679	1670681	.	-	.	transcript "496"	
Adh	FGenesCGG3	CDS	1653232	1653414	.	-	.	transcript "497"	
Adh	FGenesCGG3	stop_codon	1653232	1653234	.	-	.	transcript "497"	
Adh	FGenesCGG3	CDS	1653857	1657133	.	-	.	transcript "497"	
Adh	FGenesCGG3	CDS	1657232	1657342	.	-	.	transcript "497"	
Adh	FGenesCGG3	CDS	1661045	1661189	.	-	.	transcript "497"	
Adh	FGenesCGG3	CDS	1661787	1662009	.	-	.	transcript "497"	
Adh	FGenesCGG3	start_codon	1662007	1662009	.	-	.	transcript "497"	
Adh	FGenesCGG3	CDS	1665650	1665753	.	-	.	transcript "498"	
Adh	FGenesCGG3	stop_codon	1665650	1665652	.	-	.	transcript "498"	
Adh	FGenesCGG3	CDS	1667694	1667971	.	-	.	transcript "498"	
Adh	FGenesCGG3	CDS	1669202	1669236	.	-	.	transcript "498"	
Adh	FGenesCGG3	start_codon	1669234	1669236	.	-	.	transcript "498"	
Adh	FGenesCGG3	CDS	1671430	1671507	.	+	.	transcript "499"	
Adh	FGenesCGG3	start_codon	1671430	1671432	.	+	.	transcript "499"	
Adh	FGenesCGG3	CDS	1674761	1675045	.	+	.	transcript "499"	
Adh	FGenesCGG3	stop_codon	1675043	1675045	.	+	.	transcript "499"	
Adh	FGenesCGG3	CDS	1676518	1676645	.	-	.	transcript "500"	
Adh	FGenesCGG3	stop_codon	1676518	1676520	.	-	.	transcript "500"	
Adh	FGenesCGG3	CDS	1678182	1678266	.	-	.	transcript "500"	
Adh	FGenesCGG3	start_codon	1678264	1678266	.	-	.	transcript "500"	
Adh	FGenesCGG3	CDS	1684235	1684323	.	+	.	transcript "501"	
Adh	FGenesCGG3	start_codon	1684235	1684237	.	+	.	transcript "501"	
Adh	FGenesCGG3	CDS	1684888	1685022	.	+	.	transcript "501"	
Adh	FGenesCGG3	CDS	1688553	1688754	.	+	.	transcript "501"	
Adh	FGenesCGG3	stop_codon	1688752	1688754	.	+	.	transcript "501"	
Adh	FGenesCGG3	CDS	1690235	1690566	.	-	.	transcript "502"	
Adh	FGenesCGG3	stop_codon	1690235	1690237	.	-	.	transcript "502"	
Adh	FGenesCGG3	CDS	1691472	1691633	.	-	.	transcript "502"	
Adh	FGenesCGG3	CDS	1692478	1692547	.	-	.	transcript "502"	
Adh	FGenesCGG3	start_codon	1692545	1692547	.	-	.	transcript "502"	
Adh	FGenesCGG3	CDS	1692150	1692160	.	-	.	transcript "503"	
Adh	FGenesCGG3	stop_codon	1692150	1692152	.	-	.	transcript "503"	
Adh	FGenesCGG3	CDS	1692478	1692547	.	-	.	transcript "503"	
Adh	FGenesCGG3	start_codon	1692545	1692547	.	-	.	transcript "503"	
Adh	FGenesCGG3	CDS	1695150	1695306	.	-	.	transcript "504"	
Adh	FGenesCGG3	stop_codon	1695150	1695152	.	-	.	transcript "504"	
Adh	FGenesCGG3	CDS	1696679	1696842	.	-	.	transcript "504"	
Adh	FGenesCGG3	start_codon	1696840	1696842	.	-	.	transcript "504"	
Adh	FGenesCGG3	CDS	1695150	1695306	.	-	.	transcript "505"	
Adh	FGenesCGG3	stop_codon	1695150	1695152	.	-	.	transcript "505"	
Adh	FGenesCGG3	CDS	1695365	1695453	.	-	.	transcript "505"	
Adh	FGenesCGG3	CDS	1699056	1699124	.	-	.	transcript "505"	
Adh	FGenesCGG3	CDS	1707120	1707188	.	-	.	transcript "505"	
Adh	FGenesCGG3	start_codon	1707186	1707188	.	-	.	transcript "505"	
Adh	FGenesCGG3	CDS	1700143	1700363	.	-	.	transcript "506"	
Adh	FGenesCGG3	stop_codon	1700143	1700145	.	-	.	transcript "506"	
Adh	FGenesCGG3	CDS	1700853	1701260	.	-	.	transcript "506"	
Adh	FGenesCGG3	CDS	1702929	1702935	.	-	.	transcript "506"	
Adh	FGenesCGG3	start_codon	1702933	1702935	.	-	.	transcript "506"	
Adh	FGenesCGG3	CDS	1714333	1714509	.	+	.	transcript "507"	
Adh	FGenesCGG3	start_codon	1714333	1714335	.	+	.	transcript "507"	
Adh	FGenesCGG3	stop_codon	1714507	1714509	.	+	.	transcript "507"	
Adh	FGenesCGG3	CDS	1715683	1715797	.	+	.	transcript "508"	
Adh	FGenesCGG3	start_codon	1715683	1715685	.	+	.	transcript "508"	
Adh	FGenesCGG3	CDS	1717259	1717497	.	+	.	transcript "508"	
Adh	FGenesCGG3	stop_codon	1717495	1717497	.	+	.	transcript "508"	
Adh	FGenesCGG3	CDS	1718580	1718725	.	-	.	transcript "509"	
Adh	FGenesCGG3	stop_codon	1718580	1718582	.	-	.	transcript "509"	
Adh	FGenesCGG3	CDS	1719195	1719342	.	-	.	transcript "509"	
Adh	FGenesCGG3	CDS	1719504	1720004	.	-	.	transcript "509"	
Adh	FGenesCGG3	start_codon	1720002	1720004	.	-	.	transcript "509"	
Adh	FGenesCGG3	CDS	1718580	1718725	.	-	.	transcript "510"	
Adh	FGenesCGG3	stop_codon	1718580	1718582	.	-	.	transcript "510"	
Adh	FGenesCGG3	CDS	1719195	1719342	.	-	.	transcript "510"	
Adh	FGenesCGG3	CDS	1719504	1720004	.	-	.	transcript "510"	
Adh	FGenesCGG3	start_codon	1720002	1720004	.	-	.	transcript "510"	
Adh	FGenesCGG3	CDS	1718580	1718725	.	-	.	transcript "511"	
Adh	FGenesCGG3	stop_codon	1718580	1718582	.	-	.	transcript "511"	
Adh	FGenesCGG3	CDS	1719195	1719342	.	-	.	transcript "511"	
Adh	FGenesCGG3	CDS	1719504	1719695	.	-	.	transcript "511"	
Adh	FGenesCGG3	CDS	1719753	1719992	.	-	.	transcript "511"	
Adh	FGenesCGG3	CDS	1722642	1722653	.	-	.	transcript "511"	
Adh	FGenesCGG3	CDS	1726261	1726435	.	-	.	transcript "511"	
Adh	FGenesCGG3	CDS	1730116	1730236	.	-	.	transcript "511"	
Adh	FGenesCGG3	CDS	1731062	1731125	.	-	.	transcript "511"	
Adh	FGenesCGG3	CDS	1739099	1739187	.	-	.	transcript "511"	
Adh	FGenesCGG3	CDS	1721863	1721967	.	+	.	transcript "512"	
Adh	FGenesCGG3	start_codon	1721863	1721865	.	+	.	transcript "512"	
Adh	FGenesCGG3	CDS	1722159	1722449	.	+	.	transcript "512"	
Adh	FGenesCGG3	stop_codon	1722447	1722449	.	+	.	transcript "512"	
Adh	FGenesCGG3	CDS	1723274	1723418	.	-	.	transcript "513"	
Adh	FGenesCGG3	stop_codon	1723274	1723276	.	-	.	transcript "513"	
Adh	FGenesCGG3	CDS	1726256	1726435	.	-	.	transcript "513"	
Adh	FGenesCGG3	CDS	1730116	1730236	.	-	.	transcript "513"	
Adh	FGenesCGG3	CDS	1731062	1731172	.	-	.	transcript "513"	
Adh	FGenesCGG3	CDS	1735826	1736004	.	-	.	transcript "513"	
Adh	FGenesCGG3	CDS	1738845	1739035	.	-	.	transcript "513"	
Adh	FGenesCGG3	start_codon	1739033	1739035	.	-	.	transcript "513"	
Adh	FGenesCGG3	CDS	1726091	1726220	.	-	.	transcript "514"	
Adh	FGenesCGG3	stop_codon	1726091	1726093	.	-	.	transcript "514"	
Adh	FGenesCGG3	CDS	1726256	1726435	.	-	.	transcript "514"	
Adh	FGenesCGG3	CDS	1730116	1730236	.	-	.	transcript "514"	
Adh	FGenesCGG3	CDS	1731062	1731172	.	-	.	transcript "514"	
Adh	FGenesCGG3	CDS	1732202	1732361	.	-	.	transcript "514"	
Adh	FGenesCGG3	CDS	1732752	1732957	.	-	.	transcript "514"	
Adh	FGenesCGG3	CDS	1735826	1736004	.	-	.	transcript "514"	
Adh	FGenesCGG3	CDS	1737215	1737246	.	-	.	transcript "514"	
Adh	FGenesCGG3	start_codon	1737244	1737246	.	-	.	transcript "514"	
Adh	FGenesCGG3	CDS	1738791	1739218	.	+	.	transcript "515"	
Adh	FGenesCGG3	start_codon	1738791	1738793	.	+	.	transcript "515"	
Adh	FGenesCGG3	CDS	1740300	1740540	.	+	.	transcript "515"	
Adh	FGenesCGG3	CDS	1740659	1740939	.	+	.	transcript "515"	
Adh	FGenesCGG3	CDS	1740995	1742042	.	+	.	transcript "515"	
Adh	FGenesCGG3	CDS	1742104	1742446	.	+	.	transcript "515"	
Adh	FGenesCGG3	CDS	1742886	1743193	.	+	.	transcript "515"	
Adh	FGenesCGG3	stop_codon	1743191	1743193	.	+	.	transcript "515"	
Adh	FGenesCGG3	CDS	1740274	1740540	.	+	.	transcript "516"	
Adh	FGenesCGG3	start_codon	1740274	1740276	.	+	.	transcript "516"	
Adh	FGenesCGG3	CDS	1740659	1740939	.	+	.	transcript "516"	
Adh	FGenesCGG3	CDS	1740995	1742042	.	+	.	transcript "516"	
Adh	FGenesCGG3	CDS	1742104	1742446	.	+	.	transcript "516"	
Adh	FGenesCGG3	CDS	1742807	1743156	.	+	.	transcript "516"	
Adh	FGenesCGG3	stop_codon	1743154	1743156	.	+	.	transcript "516"	
Adh	FGenesCGG3	CDS	1744620	1745915	.	-	.	transcript "517"	
Adh	FGenesCGG3	start_codon	1745913	1745915	.	-	.	transcript "517"	
Adh	FGenesCGG3	stop_codon	1744620	1744622	.	-	.	transcript "517"	
Adh	FGenesCGG3	CDS	1744620	1745915	.	-	.	transcript "518"	
Adh	FGenesCGG3	start_codon	1745913	1745915	.	-	.	transcript "518"	
Adh	FGenesCGG3	stop_codon	1744620	1744622	.	-	.	transcript "518"	
Adh	FGenesCGG3	CDS	1746303	1746349	.	+	.	transcript "519"	
Adh	FGenesCGG3	start_codon	1746303	1746305	.	+	.	transcript "519"	
Adh	FGenesCGG3	CDS	1746401	1746842	.	+	.	transcript "519"	
Adh	FGenesCGG3	stop_codon	1746840	1746842	.	+	.	transcript "519"	
Adh	FGenesCGG3	CDS	1747065	1747230	.	-	.	transcript "520"	
Adh	FGenesCGG3	stop_codon	1747065	1747067	.	-	.	transcript "520"	
Adh	FGenesCGG3	CDS	1747825	1747952	.	-	.	transcript "520"	
Adh	FGenesCGG3	CDS	1748785	1748936	.	-	.	transcript "520"	
Adh	FGenesCGG3	CDS	1751370	1751492	.	-	.	transcript "520"	
Adh	FGenesCGG3	CDS	1751722	1751956	.	-	.	transcript "520"	
Adh	FGenesCGG3	CDS	1752027	1752149	.	-	.	transcript "520"	
Adh	FGenesCGG3	CDS	1752622	1752780	.	-	.	transcript "520"	
Adh	FGenesCGG3	CDS	1752984	1753316	.	-	.	transcript "520"	
Adh	FGenesCGG3	CDS	1753422	1753568	.	-	.	transcript "520"	
Adh	FGenesCGG3	start_codon	1753566	1753568	.	-	.	transcript "520"	
Adh	FGenesCGG3	CDS	1747065	1747238	.	-	.	transcript "521"	
Adh	FGenesCGG3	stop_codon	1747065	1747067	.	-	.	transcript "521"	
Adh	FGenesCGG3	CDS	1747451	1747682	.	-	.	transcript "521"	
Adh	FGenesCGG3	CDS	1747825	1748093	.	-	.	transcript "521"	
Adh	FGenesCGG3	CDS	1748156	1748337	.	-	.	transcript "521"	
Adh	FGenesCGG3	CDS	1748434	1748590	.	-	.	transcript "521"	
Adh	FGenesCGG3	CDS	1748785	1748943	.	-	.	transcript "521"	
Adh	FGenesCGG3	CDS	1751370	1751492	.	-	.	transcript "521"	
Adh	FGenesCGG3	CDS	1751564	1751652	.	-	.	transcript "521"	
Adh	FGenesCGG3	CDS	1751722	1751956	.	-	.	transcript "521"	
Adh	FGenesCGG3	CDS	1752027	1752278	.	-	.	transcript "521"	
Adh	FGenesCGG3	CDS	1752622	1752780	.	-	.	transcript "521"	
Adh	FGenesCGG3	CDS	1752984	1753316	.	-	.	transcript "521"	
Adh	FGenesCGG3	CDS	1753422	1753778	.	-	.	transcript "521"	
Adh	FGenesCGG3	start_codon	1753776	1753778	.	-	.	transcript "521"	
Adh	FGenesCGG3	CDS	1756026	1756178	.	-	.	transcript "522"	
Adh	FGenesCGG3	stop_codon	1756026	1756028	.	-	.	transcript "522"	
Adh	FGenesCGG3	CDS	1756248	1756386	.	-	.	transcript "522"	
Adh	FGenesCGG3	CDS	1756448	1756671	.	-	.	transcript "522"	
Adh	FGenesCGG3	CDS	1756797	1756876	.	-	.	transcript "522"	
Adh	FGenesCGG3	CDS	1757005	1757119	.	-	.	transcript "522"	
Adh	FGenesCGG3	CDS	1757182	1757352	.	-	.	transcript "522"	
Adh	FGenesCGG3	CDS	1757415	1757585	.	-	.	transcript "522"	
Adh	FGenesCGG3	CDS	1757648	1758409	.	-	.	transcript "522"	
Adh	FGenesCGG3	CDS	1758473	1758856	.	-	.	transcript "522"	
Adh	FGenesCGG3	CDS	1760557	1760616	.	-	.	transcript "522"	
Adh	FGenesCGG3	start_codon	1760614	1760616	.	-	.	transcript "522"	
Adh	FGenesCGG3	CDS	1763921	1764042	.	-	.	transcript "523"	
Adh	FGenesCGG3	stop_codon	1763921	1763923	.	-	.	transcript "523"	
Adh	FGenesCGG3	CDS	1764272	1764501	.	-	.	transcript "523"	
Adh	FGenesCGG3	CDS	1764574	1764638	.	-	.	transcript "523"	
Adh	FGenesCGG3	start_codon	1764636	1764638	.	-	.	transcript "523"	
Adh	FGenesCGG3	CDS	1763921	1764042	.	-	.	transcript "524"	
Adh	FGenesCGG3	stop_codon	1763921	1763923	.	-	.	transcript "524"	
Adh	FGenesCGG3	CDS	1764272	1764501	.	-	.	transcript "524"	
Adh	FGenesCGG3	CDS	1764574	1764638	.	-	.	transcript "524"	
Adh	FGenesCGG3	start_codon	1764636	1764638	.	-	.	transcript "524"	
Adh	FGenesCGG3	CDS	1765422	1765572	.	-	.	transcript "525"	
Adh	FGenesCGG3	stop_codon	1765422	1765424	.	-	.	transcript "525"	
Adh	FGenesCGG3	CDS	1766120	1766208	.	-	.	transcript "525"	
Adh	FGenesCGG3	start_codon	1766206	1766208	.	-	.	transcript "525"	
Adh	FGenesCGG3	CDS	1766105	1766345	.	+	.	transcript "526"	
Adh	FGenesCGG3	start_codon	1766105	1766107	.	+	.	transcript "526"	
Adh	FGenesCGG3	CDS	1766667	1766778	.	+	.	transcript "526"	
Adh	FGenesCGG3	CDS	1766849	1767131	.	+	.	transcript "526"	
Adh	FGenesCGG3	stop_codon	1767129	1767131	.	+	.	transcript "526"	
Adh	FGenesCGG3	CDS	1768096	1768298	.	-	.	transcript "527"	
Adh	FGenesCGG3	stop_codon	1768096	1768098	.	-	.	transcript "527"	
Adh	FGenesCGG3	CDS	1768894	1768989	.	-	.	transcript "527"	
Adh	FGenesCGG3	CDS	1769609	1769690	.	-	.	transcript "527"	
Adh	FGenesCGG3	start_codon	1769688	1769690	.	-	.	transcript "527"	
Adh	FGenesCGG3	CDS	1768241	1768298	.	-	.	transcript "528"	
Adh	FGenesCGG3	stop_codon	1768241	1768243	.	-	.	transcript "528"	
Adh	FGenesCGG3	CDS	1768890	1768994	.	-	.	transcript "528"	
Adh	FGenesCGG3	CDS	1769578	1769690	.	-	.	transcript "528"	
Adh	FGenesCGG3	start_codon	1769688	1769690	.	-	.	transcript "528"	
Adh	FGenesCGG3	CDS	1772171	1772258	.	+	.	transcript "529"	
Adh	FGenesCGG3	start_codon	1772171	1772173	.	+	.	transcript "529"	
Adh	FGenesCGG3	CDS	1772478	1772741	.	+	.	transcript "529"	
Adh	FGenesCGG3	CDS	1773841	1773992	.	+	.	transcript "529"	
Adh	FGenesCGG3	stop_codon	1773990	1773992	.	+	.	transcript "529"	
Adh	FGenesCGG3	CDS	1772171	1772258	.	+	.	transcript "530"	
Adh	FGenesCGG3	start_codon	1772171	1772173	.	+	.	transcript "530"	
Adh	FGenesCGG3	CDS	1772478	1772741	.	+	.	transcript "530"	
Adh	FGenesCGG3	CDS	1774740	1775557	.	+	.	transcript "530"	
Adh	FGenesCGG3	stop_codon	1775555	1775557	.	+	.	transcript "530"	
Adh	FGenesCGG3	CDS	1774679	1775557	.	+	.	transcript "531"	
Adh	FGenesCGG3	start_codon	1774679	1774681	.	+	.	transcript "531"	
Adh	FGenesCGG3	stop_codon	1775555	1775557	.	+	.	transcript "531"	
Adh	FGenesCGG3	CDS	1778386	1778730	.	+	.	transcript "532"	
Adh	FGenesCGG3	start_codon	1778386	1778388	.	+	.	transcript "532"	
Adh	FGenesCGG3	CDS	1779611	1779847	.	+	.	transcript "532"	
Adh	FGenesCGG3	stop_codon	1779845	1779847	.	+	.	transcript "532"	
Adh	FGenesCGG3	CDS	1780341	1780496	.	-	.	transcript "533"	
Adh	FGenesCGG3	stop_codon	1780341	1780343	.	-	.	transcript "533"	
Adh	FGenesCGG3	CDS	1781148	1781825	.	-	.	transcript "533"	
Adh	FGenesCGG3	start_codon	1781823	1781825	.	-	.	transcript "533"	
Adh	FGenesCGG3	CDS	1780341	1780519	.	-	.	transcript "534"	
Adh	FGenesCGG3	stop_codon	1780341	1780343	.	-	.	transcript "534"	
Adh	FGenesCGG3	CDS	1783610	1783696	.	-	.	transcript "534"	
Adh	FGenesCGG3	CDS	1784926	1785019	.	-	.	transcript "534"	
Adh	FGenesCGG3	start_codon	1785017	1785019	.	-	.	transcript "534"	
Adh	FGenesCGG3	CDS	1782285	1782330	.	+	.	transcript "535"	
Adh	FGenesCGG3	start_codon	1782285	1782287	.	+	.	transcript "535"	
Adh	FGenesCGG3	CDS	1782459	1782598	.	+	.	transcript "535"	
Adh	FGenesCGG3	CDS	1782661	1782799	.	+	.	transcript "535"	
Adh	FGenesCGG3	CDS	1782943	1783262	.	+	.	transcript "535"	
Adh	FGenesCGG3	stop_codon	1783260	1783262	.	+	.	transcript "535"	
Adh	FGenesCGG3	CDS	1785624	1785811	.	-	.	transcript "536"	
Adh	FGenesCGG3	stop_codon	1785624	1785626	.	-	.	transcript "536"	
Adh	FGenesCGG3	CDS	1786132	1786291	.	-	.	transcript "536"	
Adh	FGenesCGG3	CDS	1786326	1786409	.	-	.	transcript "536"	
Adh	FGenesCGG3	start_codon	1786407	1786409	.	-	.	transcript "536"	
Adh	FGenesCGG3	CDS	1787599	1788915	.	+	.	transcript "537"	
Adh	FGenesCGG3	start_codon	1787599	1787601	.	+	.	transcript "537"	
Adh	FGenesCGG3	stop_codon	1788913	1788915	.	+	.	transcript "537"	
Adh	FGenesCGG3	CDS	1787599	1788915	.	+	.	transcript "538"	
Adh	FGenesCGG3	start_codon	1787599	1787601	.	+	.	transcript "538"	
Adh	FGenesCGG3	stop_codon	1788913	1788915	.	+	.	transcript "538"	
Adh	FGenesCGG3	CDS	1789204	1789455	.	-	.	transcript "539"	
Adh	FGenesCGG3	start_codon	1789453	1789455	.	-	.	transcript "539"	
Adh	FGenesCGG3	stop_codon	1789204	1789206	.	-	.	transcript "539"	
Adh	FGenesCGG3	CDS	1789933	1789977	.	-	.	transcript "540"	
Adh	FGenesCGG3	stop_codon	1789933	1789935	.	-	.	transcript "540"	
Adh	FGenesCGG3	CDS	1790528	1790608	.	-	.	transcript "540"	
Adh	FGenesCGG3	start_codon	1790606	1790608	.	-	.	transcript "540"	
Adh	FGenesCGG3	CDS	1790283	1790411	.	-	.	transcript "541"	
Adh	FGenesCGG3	stop_codon	1790283	1790285	.	-	.	transcript "541"	
Adh	FGenesCGG3	CDS	1790539	1790625	.	-	.	transcript "541"	
Adh	FGenesCGG3	CDS	1792846	1792911	.	-	.	transcript "541"	
Adh	FGenesCGG3	start_codon	1792909	1792911	.	-	.	transcript "541"	
Adh	FGenesCGG3	CDS	1791363	1791380	.	+	.	transcript "542"	
Adh	FGenesCGG3	start_codon	1791363	1791365	.	+	.	transcript "542"	
Adh	FGenesCGG3	CDS	1791908	1792038	.	+	.	transcript "542"	
Adh	FGenesCGG3	CDS	1793709	1793831	.	+	.	transcript "542"	
Adh	FGenesCGG3	CDS	1797849	1797965	.	+	.	transcript "542"	
Adh	FGenesCGG3	CDS	1798329	1798437	.	+	.	transcript "542"	
Adh	FGenesCGG3	stop_codon	1798435	1798437	.	+	.	transcript "542"	
Adh	FGenesCGG3	CDS	1799569	1799708	.	-	.	transcript "543"	
Adh	FGenesCGG3	stop_codon	1799569	1799571	.	-	.	transcript "543"	
Adh	FGenesCGG3	CDS	1800740	1800830	.	-	.	transcript "543"	
Adh	FGenesCGG3	start_codon	1800828	1800830	.	-	.	transcript "543"	
Adh	FGenesCGG3	CDS	1801494	1801628	.	-	.	transcript "544"	
Adh	FGenesCGG3	stop_codon	1801494	1801496	.	-	.	transcript "544"	
Adh	FGenesCGG3	CDS	1804220	1804279	.	-	.	transcript "544"	
Adh	FGenesCGG3	start_codon	1804277	1804279	.	-	.	transcript "544"	
Adh	FGenesCGG3	CDS	1802040	1802381	.	-	.	transcript "545"	
Adh	FGenesCGG3	stop_codon	1802040	1802042	.	-	.	transcript "545"	
Adh	FGenesCGG3	CDS	1804220	1804279	.	-	.	transcript "545"	
Adh	FGenesCGG3	start_codon	1804277	1804279	.	-	.	transcript "545"	
Adh	FGenesCGG3	CDS	1805168	1805280	.	-	.	transcript "546"	
Adh	FGenesCGG3	stop_codon	1805168	1805170	.	-	.	transcript "546"	
Adh	FGenesCGG3	CDS	1807086	1807311	.	-	.	transcript "546"	
Adh	FGenesCGG3	CDS	1808019	1808476	.	-	.	transcript "546"	
Adh	FGenesCGG3	CDS	1809495	1809558	.	-	.	transcript "546"	
Adh	FGenesCGG3	start_codon	1809556	1809558	.	-	.	transcript "546"	
Adh	FGenesCGG3	CDS	1807761	1808476	.	-	.	transcript "547"	
Adh	FGenesCGG3	stop_codon	1807761	1807763	.	-	.	transcript "547"	
Adh	FGenesCGG3	CDS	1808796	1808930	.	-	.	transcript "547"	
Adh	FGenesCGG3	CDS	1809495	1809558	.	-	.	transcript "547"	
Adh	FGenesCGG3	start_codon	1809556	1809558	.	-	.	transcript "547"	
Adh	FGenesCGG3	CDS	1810719	1811121	.	-	.	transcript "548"	
Adh	FGenesCGG3	stop_codon	1810719	1810721	.	-	.	transcript "548"	
Adh	FGenesCGG3	CDS	1811467	1811600	.	-	.	transcript "548"	
Adh	FGenesCGG3	start_codon	1811598	1811600	.	-	.	transcript "548"	
Adh	FGenesCGG3	CDS	1810719	1811121	.	-	.	transcript "549"	
Adh	FGenesCGG3	stop_codon	1810719	1810721	.	-	.	transcript "549"	
Adh	FGenesCGG3	CDS	1811467	1811600	.	-	.	transcript "549"	
Adh	FGenesCGG3	start_codon	1811598	1811600	.	-	.	transcript "549"	
Adh	FGenesCGG3	CDS	1812952	1813153	.	-	.	transcript "550"	
Adh	FGenesCGG3	stop_codon	1812952	1812954	.	-	.	transcript "550"	
Adh	FGenesCGG3	CDS	1814240	1814319	.	-	.	transcript "550"	
Adh	FGenesCGG3	start_codon	1814317	1814319	.	-	.	transcript "550"	
Adh	FGenesCGG3	CDS	1812952	1813153	.	-	.	transcript "551"	
Adh	FGenesCGG3	stop_codon	1812952	1812954	.	-	.	transcript "551"	
Adh	FGenesCGG3	CDS	1814669	1814808	.	-	.	transcript "551"	
Adh	FGenesCGG3	CDS	1815706	1815765	.	-	.	transcript "551"	
Adh	FGenesCGG3	start_codon	1815763	1815765	.	-	.	transcript "551"	
Adh	FGenesCGG3	CDS	1814984	1815052	.	+	.	transcript "552"	
Adh	FGenesCGG3	start_codon	1814984	1814986	.	+	.	transcript "552"	
Adh	FGenesCGG3	CDS	1815620	1815746	.	+	.	transcript "552"	
Adh	FGenesCGG3	CDS	1816239	1816307	.	+	.	transcript "552"	
Adh	FGenesCGG3	CDS	1818085	1818200	.	+	.	transcript "552"	
Adh	FGenesCGG3	CDS	1819380	1819522	.	+	.	transcript "552"	
Adh	FGenesCGG3	CDS	1820451	1820571	.	+	.	transcript "552"	
Adh	FGenesCGG3	stop_codon	1820569	1820571	.	+	.	transcript "552"	
Adh	FGenesCGG3	CDS	1818118	1818200	.	+	.	transcript "553"	
Adh	FGenesCGG3	start_codon	1818118	1818120	.	+	.	transcript "553"	
Adh	FGenesCGG3	CDS	1819380	1819522	.	+	.	transcript "553"	
Adh	FGenesCGG3	CDS	1823033	1823073	.	+	.	transcript "553"	
Adh	FGenesCGG3	CDS	1823155	1823328	.	+	.	transcript "553"	
Adh	FGenesCGG3	stop_codon	1823326	1823328	.	+	.	transcript "553"	
Adh	FGenesCGG3	CDS	1823746	1825158	.	+	.	transcript "554"	
Adh	FGenesCGG3	start_codon	1823746	1823748	.	+	.	transcript "554"	
Adh	FGenesCGG3	stop_codon	1825156	1825158	.	+	.	transcript "554"	
Adh	FGenesCGG3	CDS	1826194	1826273	.	-	.	transcript "555"	
Adh	FGenesCGG3	stop_codon	1826194	1826196	.	-	.	transcript "555"	
Adh	FGenesCGG3	CDS	1826610	1826745	.	-	.	transcript "555"	
Adh	FGenesCGG3	start_codon	1826743	1826745	.	-	.	transcript "555"	
Adh	FGenesCGG3	CDS	1827961	1828003	.	+	.	transcript "556"	
Adh	FGenesCGG3	start_codon	1827961	1827963	.	+	.	transcript "556"	
Adh	FGenesCGG3	CDS	1828289	1828398	.	+	.	transcript "556"	
Adh	FGenesCGG3	stop_codon	1828396	1828398	.	+	.	transcript "556"	
Adh	FGenesCGG3	CDS	1833450	1833866	.	-	.	transcript "557"	
Adh	FGenesCGG3	stop_codon	1833450	1833452	.	-	.	transcript "557"	
Adh	FGenesCGG3	CDS	1837416	1837454	.	-	.	transcript "557"	
Adh	FGenesCGG3	start_codon	1837452	1837454	.	-	.	transcript "557"	
Adh	FGenesCGG3	CDS	1833450	1833866	.	-	.	transcript "558"	
Adh	FGenesCGG3	stop_codon	1833450	1833452	.	-	.	transcript "558"	
Adh	FGenesCGG3	CDS	1833976	1834113	.	-	.	transcript "558"	
Adh	FGenesCGG3	start_codon	1834111	1834113	.	-	.	transcript "558"	
Adh	FGenesCGG3	CDS	1836751	1837287	.	-	.	transcript "559"	
Adh	FGenesCGG3	start_codon	1837285	1837287	.	-	.	transcript "559"	
Adh	FGenesCGG3	stop_codon	1836751	1836753	.	-	.	transcript "559"	
Adh	FGenesCGG3	CDS	1840064	1840152	.	+	.	transcript "560"	
Adh	FGenesCGG3	start_codon	1840064	1840066	.	+	.	transcript "560"	
Adh	FGenesCGG3	CDS	1847854	1847965	.	+	.	transcript "560"	
Adh	FGenesCGG3	CDS	1850020	1850172	.	+	.	transcript "560"	
Adh	FGenesCGG3	stop_codon	1850170	1850172	.	+	.	transcript "560"	
Adh	FGenesCGG3	CDS	1841020	1841157	.	+	.	transcript "561"	
Adh	FGenesCGG3	start_codon	1841020	1841022	.	+	.	transcript "561"	
Adh	FGenesCGG3	CDS	1841432	1841476	.	+	.	transcript "561"	
Adh	FGenesCGG3	stop_codon	1841474	1841476	.	+	.	transcript "561"	
Adh	FGenesCGG3	CDS	1844161	1844346	.	+	.	transcript "562"	
Adh	FGenesCGG3	start_codon	1844161	1844163	.	+	.	transcript "562"	
Adh	FGenesCGG3	stop_codon	1844344	1844346	.	+	.	transcript "562"	
Adh	FGenesCGG3	CDS	1850650	1851240	.	-	.	transcript "563"	
Adh	FGenesCGG3	start_codon	1851238	1851240	.	-	.	transcript "563"	
Adh	FGenesCGG3	stop_codon	1850650	1850652	.	-	.	transcript "563"	
Adh	FGenesCGG3	CDS	1850822	1851129	.	-	.	transcript "564"	
Adh	FGenesCGG3	stop_codon	1850822	1850824	.	-	.	transcript "564"	
Adh	FGenesCGG3	CDS	1853037	1853316	.	-	.	transcript "564"	
Adh	FGenesCGG3	CDS	1856016	1856120	.	-	.	transcript "564"	
Adh	FGenesCGG3	start_codon	1856118	1856120	.	-	.	transcript "564"	
Adh	FGenesCGG3	CDS	1853029	1853316	.	-	.	transcript "565"	
Adh	FGenesCGG3	stop_codon	1853029	1853031	.	-	.	transcript "565"	
Adh	FGenesCGG3	CDS	1854411	1854473	.	-	.	transcript "565"	
Adh	FGenesCGG3	start_codon	1854471	1854473	.	-	.	transcript "565"	
Adh	FGenesCGG3	CDS	1857267	1857427	.	-	.	transcript "566"	
Adh	FGenesCGG3	stop_codon	1857267	1857269	.	-	.	transcript "566"	
Adh	FGenesCGG3	CDS	1858592	1858706	.	-	.	transcript "566"	
Adh	FGenesCGG3	start_codon	1858704	1858706	.	-	.	transcript "566"	
Adh	FGenesCGG3	CDS	1858470	1858706	.	-	.	transcript "567"	
Adh	FGenesCGG3	start_codon	1858704	1858706	.	-	.	transcript "567"	
Adh	FGenesCGG3	stop_codon	1858470	1858472	.	-	.	transcript "567"	
Adh	FGenesCGG3	CDS	1859414	1859698	.	+	.	transcript "568"	
Adh	FGenesCGG3	start_codon	1859414	1859416	.	+	.	transcript "568"	
Adh	FGenesCGG3	stop_codon	1859696	1859698	.	+	.	transcript "568"	
Adh	FGenesCGG3	CDS	1862393	1862491	.	-	.	transcript "569"	
Adh	FGenesCGG3	start_codon	1862489	1862491	.	-	.	transcript "569"	
Adh	FGenesCGG3	stop_codon	1862393	1862395	.	-	.	transcript "569"	
Adh	FGenesCGG3	CDS	1866720	1867213	.	+	.	transcript "570"	
Adh	FGenesCGG3	start_codon	1866720	1866722	.	+	.	transcript "570"	
Adh	FGenesCGG3	CDS	1869230	1869458	.	+	.	transcript "570"	
Adh	FGenesCGG3	CDS	1869590	1869714	.	+	.	transcript "570"	
Adh	FGenesCGG3	CDS	1871587	1871681	.	+	.	transcript "570"	
Adh	FGenesCGG3	CDS	1872202	1872347	.	+	.	transcript "570"	
Adh	FGenesCGG3	stop_codon	1872345	1872347	.	+	.	transcript "570"	
Adh	FGenesCGG3	CDS	1866753	1866824	.	+	.	transcript "571"	
Adh	FGenesCGG3	start_codon	1866753	1866755	.	+	.	transcript "571"	
Adh	FGenesCGG3	CDS	1867116	1867213	.	+	.	transcript "571"	
Adh	FGenesCGG3	CDS	1869230	1869464	.	+	.	transcript "571"	
Adh	FGenesCGG3	stop_codon	1869462	1869464	.	+	.	transcript "571"	
Adh	FGenesCGG3	CDS	1870510	1870560	.	+	.	transcript "572"	
Adh	FGenesCGG3	start_codon	1870510	1870512	.	+	.	transcript "572"	
Adh	FGenesCGG3	CDS	1871587	1871681	.	+	.	transcript "572"	
Adh	FGenesCGG3	CDS	1872971	1873244	.	+	.	transcript "572"	
Adh	FGenesCGG3	stop_codon	1873242	1873244	.	+	.	transcript "572"	
Adh	FGenesCGG3	CDS	1873004	1873304	.	-	.	transcript "573"	
Adh	FGenesCGG3	stop_codon	1873004	1873006	.	-	.	transcript "573"	
Adh	FGenesCGG3	CDS	1876024	1876403	.	-	.	transcript "573"	
Adh	FGenesCGG3	start_codon	1876401	1876403	.	-	.	transcript "573"	
Adh	FGenesCGG3	CDS	1875685	1875697	.	-	.	transcript "574"	
Adh	FGenesCGG3	stop_codon	1875685	1875687	.	-	.	transcript "574"	
Adh	FGenesCGG3	CDS	1879965	1880082	.	-	.	transcript "574"	
Adh	FGenesCGG3	CDS	1881548	1881779	.	-	.	transcript "574"	
Adh	FGenesCGG3	CDS	1885049	1885144	.	-	.	transcript "574"	
Adh	FGenesCGG3	CDS	1885417	1885503	.	-	.	transcript "574"	
Adh	FGenesCGG3	start_codon	1885501	1885503	.	-	.	transcript "574"	
Adh	FGenesCGG3	CDS	1879375	1879449	.	-	.	transcript "575"	
Adh	FGenesCGG3	stop_codon	1879375	1879377	.	-	.	transcript "575"	
Adh	FGenesCGG3	CDS	1879965	1880082	.	-	.	transcript "575"	
Adh	FGenesCGG3	CDS	1881544	1881812	.	-	.	transcript "575"	
Adh	FGenesCGG3	start_codon	1881810	1881812	.	-	.	transcript "575"	
Adh	FGenesCGG3	CDS	1884141	1884464	.	-	.	transcript "576"	
Adh	FGenesCGG3	stop_codon	1884141	1884143	.	-	.	transcript "576"	
Adh	FGenesCGG3	CDS	1885049	1885144	.	-	.	transcript "576"	
Adh	FGenesCGG3	CDS	1885417	1885599	.	-	.	transcript "576"	
Adh	FGenesCGG3	CDS	1886301	1886582	.	-	.	transcript "576"	
Adh	FGenesCGG3	CDS	1886761	1886886	.	-	.	transcript "576"	
Adh	FGenesCGG3	CDS	1887889	1887960	.	-	.	transcript "576"	
Adh	FGenesCGG3	start_codon	1887958	1887960	.	-	.	transcript "576"	
Adh	FGenesCGG3	CDS	1886268	1886582	.	-	.	transcript "577"	
Adh	FGenesCGG3	stop_codon	1886268	1886270	.	-	.	transcript "577"	
Adh	FGenesCGG3	CDS	1886761	1886886	.	-	.	transcript "577"	
Adh	FGenesCGG3	CDS	1889969	1890043	.	-	.	transcript "577"	
Adh	FGenesCGG3	CDS	1891514	1891654	.	-	.	transcript "577"	
Adh	FGenesCGG3	CDS	1891981	1892047	.	-	.	transcript "577"	
Adh	FGenesCGG3	CDS	1894287	1894310	.	-	.	transcript "577"	
Adh	FGenesCGG3	CDS	1895622	1895659	.	-	.	transcript "577"	
Adh	FGenesCGG3	start_codon	1895657	1895659	.	-	.	transcript "577"	
Adh	FGenesCGG3	CDS	1893148	1893203	.	+	.	transcript "578"	
Adh	FGenesCGG3	start_codon	1893148	1893150	.	+	.	transcript "578"	
Adh	FGenesCGG3	CDS	1893287	1893592	.	+	.	transcript "578"	
Adh	FGenesCGG3	CDS	1895334	1895406	.	+	.	transcript "578"	
Adh	FGenesCGG3	stop_codon	1895404	1895406	.	+	.	transcript "578"	
Adh	FGenesCGG3	CDS	1897048	1897102	.	+	.	transcript "579"	
Adh	FGenesCGG3	start_codon	1897048	1897050	.	+	.	transcript "579"	
Adh	FGenesCGG3	CDS	1898098	1898210	.	+	.	transcript "579"	
Adh	FGenesCGG3	CDS	1901804	1901971	.	+	.	transcript "579"	
Adh	FGenesCGG3	stop_codon	1901969	1901971	.	+	.	transcript "579"	
Adh	FGenesCGG3	CDS	1899840	1900045	.	-	.	transcript "580"	
Adh	FGenesCGG3	stop_codon	1899840	1899842	.	-	.	transcript "580"	
Adh	FGenesCGG3	CDS	1900302	1900392	.	-	.	transcript "580"	
Adh	FGenesCGG3	start_codon	1900390	1900392	.	-	.	transcript "580"	
Adh	FGenesCGG3	CDS	1901266	1901360	.	-	.	transcript "581"	
Adh	FGenesCGG3	stop_codon	1901266	1901268	.	-	.	transcript "581"	
Adh	FGenesCGG3	CDS	1901973	1902060	.	-	.	transcript "581"	
Adh	FGenesCGG3	start_codon	1902058	1902060	.	-	.	transcript "581"	
Adh	FGenesCGG3	CDS	1902896	1903148	.	-	.	transcript "582"	
Adh	FGenesCGG3	stop_codon	1902896	1902898	.	-	.	transcript "582"	
Adh	FGenesCGG3	CDS	1903221	1903310	.	-	.	transcript "582"	
Adh	FGenesCGG3	CDS	1907691	1907752	.	-	.	transcript "582"	
Adh	FGenesCGG3	start_codon	1907750	1907752	.	-	.	transcript "582"	
Adh	FGenesCGG3	CDS	1909513	1909645	.	-	.	transcript "583"	
Adh	FGenesCGG3	stop_codon	1909513	1909515	.	-	.	transcript "583"	
Adh	FGenesCGG3	CDS	1912285	1912316	.	-	.	transcript "583"	
Adh	FGenesCGG3	start_codon	1912314	1912316	.	-	.	transcript "583"	
Adh	FGenesCGG3	CDS	1913374	1914932	.	-	.	transcript "584"	
Adh	FGenesCGG3	stop_codon	1913374	1913376	.	-	.	transcript "584"	
Adh	FGenesCGG3	CDS	1914995	1915082	.	-	.	transcript "584"	
Adh	FGenesCGG3	start_codon	1915080	1915082	.	-	.	transcript "584"	
Adh	FGenesCGG3	CDS	1913374	1914932	.	-	.	transcript "585"	
Adh	FGenesCGG3	stop_codon	1913374	1913376	.	-	.	transcript "585"	
Adh	FGenesCGG3	CDS	1914995	1915082	.	-	.	transcript "585"	
Adh	FGenesCGG3	start_codon	1915080	1915082	.	-	.	transcript "585"	
Adh	FGenesCGG3	CDS	1916305	1916372	.	+	.	transcript "586"	
Adh	FGenesCGG3	start_codon	1916305	1916307	.	+	.	transcript "586"	
Adh	FGenesCGG3	CDS	1918239	1918386	.	+	.	transcript "586"	
Adh	FGenesCGG3	stop_codon	1918384	1918386	.	+	.	transcript "586"	
Adh	FGenesCGG3	CDS	1916525	1916604	.	+	.	transcript "587"	
Adh	FGenesCGG3	start_codon	1916525	1916527	.	+	.	transcript "587"	
Adh	FGenesCGG3	CDS	1917386	1917537	.	+	.	transcript "587"	
Adh	FGenesCGG3	CDS	1917625	1917914	.	+	.	transcript "587"	
Adh	FGenesCGG3	stop_codon	1917912	1917914	.	+	.	transcript "587"	
Adh	FGenesCGG3	CDS	1919162	1919179	.	-	.	transcript "588"	
Adh	FGenesCGG3	stop_codon	1919162	1919164	.	-	.	transcript "588"	
Adh	FGenesCGG3	CDS	1919381	1919527	.	-	.	transcript "588"	
Adh	FGenesCGG3	CDS	1920502	1920612	.	-	.	transcript "588"	
Adh	FGenesCGG3	start_codon	1920610	1920612	.	-	.	transcript "588"	
Adh	FGenesCGG3	CDS	1921799	1921812	.	+	.	transcript "589"	
Adh	FGenesCGG3	start_codon	1921799	1921801	.	+	.	transcript "589"	
Adh	FGenesCGG3	CDS	1922481	1922692	.	+	.	transcript "589"	
Adh	FGenesCGG3	CDS	1922964	1922994	.	+	.	transcript "589"	
Adh	FGenesCGG3	CDS	1923108	1924563	.	+	.	transcript "589"	
Adh	FGenesCGG3	stop_codon	1924561	1924563	.	+	.	transcript "589"	
Adh	FGenesCGG3	CDS	1923241	1924563	.	+	.	transcript "590"	
Adh	FGenesCGG3	start_codon	1923241	1923243	.	+	.	transcript "590"	
Adh	FGenesCGG3	stop_codon	1924561	1924563	.	+	.	transcript "590"	
Adh	FGenesCGG3	CDS	1925628	1925955	.	-	.	transcript "591"	
Adh	FGenesCGG3	stop_codon	1925628	1925630	.	-	.	transcript "591"	
Adh	FGenesCGG3	CDS	1926450	1926475	.	-	.	transcript "591"	
Adh	FGenesCGG3	start_codon	1926473	1926475	.	-	.	transcript "591"	
Adh	FGenesCGG3	CDS	1929411	1929652	.	+	.	transcript "592"	
Adh	FGenesCGG3	start_codon	1929411	1929413	.	+	.	transcript "592"	
Adh	FGenesCGG3	CDS	1929869	1929890	.	+	.	transcript "592"	
Adh	FGenesCGG3	stop_codon	1929888	1929890	.	+	.	transcript "592"	
Adh	FGenesCGG3	CDS	1930186	1930354	.	+	.	transcript "593"	
Adh	FGenesCGG3	start_codon	1930186	1930188	.	+	.	transcript "593"	
Adh	FGenesCGG3	CDS	1930974	1931020	.	+	.	transcript "593"	
Adh	FGenesCGG3	CDS	1931426	1931797	.	+	.	transcript "593"	
Adh	FGenesCGG3	stop_codon	1931795	1931797	.	+	.	transcript "593"	
Adh	FGenesCGG3	CDS	1931422	1931763	.	-	.	transcript "594"	
Adh	FGenesCGG3	start_codon	1931761	1931763	.	-	.	transcript "594"	
Adh	FGenesCGG3	stop_codon	1931422	1931424	.	-	.	transcript "594"	
Adh	FGenesCGG3	CDS	1933988	1934013	.	+	.	transcript "595"	
Adh	FGenesCGG3	start_codon	1933988	1933990	.	+	.	transcript "595"	
Adh	FGenesCGG3	CDS	1935491	1935551	.	+	.	transcript "595"	
Adh	FGenesCGG3	stop_codon	1935549	1935551	.	+	.	transcript "595"	
Adh	FGenesCGG3	CDS	1936713	1936794	.	+	.	transcript "596"	
Adh	FGenesCGG3	start_codon	1936713	1936715	.	+	.	transcript "596"	
Adh	FGenesCGG3	CDS	1937906	1938118	.	+	.	transcript "596"	
Adh	FGenesCGG3	CDS	1938530	1938757	.	+	.	transcript "596"	
Adh	FGenesCGG3	CDS	1939045	1939772	.	+	.	transcript "596"	
Adh	FGenesCGG3	CDS	1939851	1942443	.	+	.	transcript "596"	
Adh	FGenesCGG3	CDS	1947070	1947197	.	+	.	transcript "596"	
Adh	FGenesCGG3	CDS	1951467	1951544	.	+	.	transcript "596"	
Adh	FGenesCGG3	stop_codon	1951542	1951544	.	+	.	transcript "596"	
Adh	FGenesCGG3	CDS	1936726	1937031	.	+	.	transcript "597"	
Adh	FGenesCGG3	start_codon	1936726	1936728	.	+	.	transcript "597"	
Adh	FGenesCGG3	stop_codon	1937029	1937031	.	+	.	transcript "597"	
Adh	FGenesCGG3	CDS	1938049	1938529	.	+	.	transcript "598"	
Adh	FGenesCGG3	start_codon	1938049	1938051	.	+	.	transcript "598"	
Adh	FGenesCGG3	CDS	1938713	1938822	.	+	.	transcript "598"	
Adh	FGenesCGG3	CDS	1939045	1939074	.	+	.	transcript "598"	
Adh	FGenesCGG3	stop_codon	1939072	1939074	.	+	.	transcript "598"	
Adh	FGenesCGG3	CDS	1943873	1944024	.	-	.	transcript "599"	
Adh	FGenesCGG3	stop_codon	1943873	1943875	.	-	.	transcript "599"	
Adh	FGenesCGG3	CDS	1944094	1944103	.	-	.	transcript "599"	
Adh	FGenesCGG3	start_codon	1944101	1944103	.	-	.	transcript "599"	
Adh	FGenesCGG3	CDS	1946774	1946783	.	+	.	transcript "600"	
Adh	FGenesCGG3	start_codon	1946774	1946776	.	+	.	transcript "600"	
Adh	FGenesCGG3	CDS	1947070	1947197	.	+	.	transcript "600"	
Adh	FGenesCGG3	CDS	1947490	1947663	.	+	.	transcript "600"	
Adh	FGenesCGG3	stop_codon	1947661	1947663	.	+	.	transcript "600"	
Adh	FGenesCGG3	CDS	1950615	1950765	.	-	.	transcript "601"	
Adh	FGenesCGG3	stop_codon	1950615	1950617	.	-	.	transcript "601"	
Adh	FGenesCGG3	CDS	1951005	1951201	.	-	.	transcript "601"	
Adh	FGenesCGG3	CDS	1952872	1952877	.	-	.	transcript "601"	
Adh	FGenesCGG3	CDS	1953870	1953881	.	-	.	transcript "601"	
Adh	FGenesCGG3	start_codon	1953879	1953881	.	-	.	transcript "601"	
Adh	FGenesCGG3	CDS	1954830	1954872	.	-	.	transcript "602"	
Adh	FGenesCGG3	stop_codon	1954830	1954832	.	-	.	transcript "602"	
Adh	FGenesCGG3	CDS	1955898	1956010	.	-	.	transcript "602"	
Adh	FGenesCGG3	CDS	1959464	1959538	.	-	.	transcript "602"	
Adh	FGenesCGG3	start_codon	1959536	1959538	.	-	.	transcript "602"	
Adh	FGenesCGG3	CDS	1958995	1959071	.	+	.	transcript "603"	
Adh	FGenesCGG3	start_codon	1958995	1958997	.	+	.	transcript "603"	
Adh	FGenesCGG3	CDS	1959392	1959623	.	+	.	transcript "603"	
Adh	FGenesCGG3	stop_codon	1959621	1959623	.	+	.	transcript "603"	
Adh	FGenesCGG3	CDS	1960747	1960855	.	+	.	transcript "604"	
Adh	FGenesCGG3	start_codon	1960747	1960749	.	+	.	transcript "604"	
Adh	FGenesCGG3	CDS	1962476	1962516	.	+	.	transcript "604"	
Adh	FGenesCGG3	CDS	1962612	1962978	.	+	.	transcript "604"	
Adh	FGenesCGG3	CDS	1963353	1963651	.	+	.	transcript "604"	
Adh	FGenesCGG3	stop_codon	1963649	1963651	.	+	.	transcript "604"	
Adh	FGenesCGG3	CDS	1960747	1960855	.	+	.	transcript "605"	
Adh	FGenesCGG3	start_codon	1960747	1960749	.	+	.	transcript "605"	
Adh	FGenesCGG3	CDS	1962476	1962516	.	+	.	transcript "605"	
Adh	FGenesCGG3	CDS	1963976	1964002	.	+	.	transcript "605"	
Adh	FGenesCGG3	stop_codon	1964000	1964002	.	+	.	transcript "605"	
Adh	FGenesCGG3	CDS	1964792	1964907	.	+	.	transcript "606"	
Adh	FGenesCGG3	start_codon	1964792	1964794	.	+	.	transcript "606"	
Adh	FGenesCGG3	CDS	1965545	1965785	.	+	.	transcript "606"	
Adh	FGenesCGG3	stop_codon	1965783	1965785	.	+	.	transcript "606"	
Adh	FGenesCGG3	CDS	1966586	1967758	.	-	.	transcript "607"	
Adh	FGenesCGG3	start_codon	1967756	1967758	.	-	.	transcript "607"	
Adh	FGenesCGG3	stop_codon	1966586	1966588	.	-	.	transcript "607"	
Adh	FGenesCGG3	CDS	1967932	1968029	.	-	.	transcript "608"	
Adh	FGenesCGG3	stop_codon	1967932	1967934	.	-	.	transcript "608"	
Adh	FGenesCGG3	CDS	1969474	1969534	.	-	.	transcript "608"	
Adh	FGenesCGG3	start_codon	1969532	1969534	.	-	.	transcript "608"	
Adh	FGenesCGG3	CDS	1971949	1972119	.	-	.	transcript "609"	
Adh	FGenesCGG3	stop_codon	1971949	1971951	.	-	.	transcript "609"	
Adh	FGenesCGG3	CDS	1972570	1972802	.	-	.	transcript "609"	
Adh	FGenesCGG3	CDS	1974804	1974879	.	-	.	transcript "609"	
Adh	FGenesCGG3	start_codon	1974877	1974879	.	-	.	transcript "609"	
Adh	FGenesCGG3	CDS	1972804	1972907	.	-	.	transcript "610"	
Adh	FGenesCGG3	stop_codon	1972804	1972806	.	-	.	transcript "610"	
Adh	FGenesCGG3	CDS	1973537	1973738	.	-	.	transcript "610"	
Adh	FGenesCGG3	CDS	1973933	1974042	.	-	.	transcript "610"	
Adh	FGenesCGG3	CDS	1974222	1974267	.	-	.	transcript "610"	
Adh	FGenesCGG3	start_codon	1974265	1974267	.	-	.	transcript "610"	
Adh	FGenesCGG3	CDS	1974488	1975018	.	+	.	transcript "611"	
Adh	FGenesCGG3	start_codon	1974488	1974490	.	+	.	transcript "611"	
Adh	FGenesCGG3	stop_codon	1975016	1975018	.	+	.	transcript "611"	
Adh	FGenesCGG3	CDS	1975782	1976154	.	+	.	transcript "612"	
Adh	FGenesCGG3	start_codon	1975782	1975784	.	+	.	transcript "612"	
Adh	FGenesCGG3	CDS	1976787	1976905	.	+	.	transcript "612"	
Adh	FGenesCGG3	stop_codon	1976903	1976905	.	+	.	transcript "612"	
Adh	FGenesCGG3	CDS	1975848	1976154	.	+	.	transcript "613"	
Adh	FGenesCGG3	start_codon	1975848	1975850	.	+	.	transcript "613"	
Adh	FGenesCGG3	CDS	1976787	1976905	.	+	.	transcript "613"	
Adh	FGenesCGG3	stop_codon	1976903	1976905	.	+	.	transcript "613"	
Adh	FGenesCGG3	CDS	1978755	1978791	.	+	.	transcript "614"	
Adh	FGenesCGG3	start_codon	1978755	1978757	.	+	.	transcript "614"	
Adh	FGenesCGG3	CDS	1983628	1983835	.	+	.	transcript "614"	
Adh	FGenesCGG3	CDS	1984940	1985074	.	+	.	transcript "614"	
Adh	FGenesCGG3	CDS	1987570	1987756	.	+	.	transcript "614"	
Adh	FGenesCGG3	stop_codon	1987754	1987756	.	+	.	transcript "614"	
Adh	FGenesCGG3	CDS	1983169	1983399	.	+	.	transcript "615"	
Adh	FGenesCGG3	start_codon	1983169	1983171	.	+	.	transcript "615"	
Adh	FGenesCGG3	CDS	1983788	1983940	.	+	.	transcript "615"	
Adh	FGenesCGG3	stop_codon	1983938	1983940	.	+	.	transcript "615"	
Adh	FGenesCGG3	CDS	1988872	1989075	.	+	.	transcript "616"	
Adh	FGenesCGG3	start_codon	1988872	1988874	.	+	.	transcript "616"	
Adh	FGenesCGG3	CDS	1991768	1992877	.	+	.	transcript "616"	
Adh	FGenesCGG3	CDS	1992942	1993204	.	+	.	transcript "616"	
Adh	FGenesCGG3	CDS	1993350	1993566	.	+	.	transcript "616"	
Adh	FGenesCGG3	stop_codon	1993564	1993566	.	+	.	transcript "616"	
Adh	FGenesCGG3	CDS	1988872	1989075	.	+	.	transcript "617"	
Adh	FGenesCGG3	start_codon	1988872	1988874	.	+	.	transcript "617"	
Adh	FGenesCGG3	CDS	1991768	1992877	.	+	.	transcript "617"	
Adh	FGenesCGG3	CDS	1992942	1993204	.	+	.	transcript "617"	
Adh	FGenesCGG3	CDS	1993350	1993566	.	+	.	transcript "617"	
Adh	FGenesCGG3	stop_codon	1993564	1993566	.	+	.	transcript "617"	
Adh	FGenesCGG3	CDS	1995954	1996122	.	+	.	transcript "618"	
Adh	FGenesCGG3	start_codon	1995954	1995956	.	+	.	transcript "618"	
Adh	FGenesCGG3	CDS	1997577	1997611	.	+	.	transcript "618"	
Adh	FGenesCGG3	stop_codon	1997609	1997611	.	+	.	transcript "618"	
Adh	FGenesCGG3	CDS	1999194	1999451	.	-	.	transcript "619"	
Adh	FGenesCGG3	stop_codon	1999194	1999196	.	-	.	transcript "619"	
Adh	FGenesCGG3	CDS	2001465	2001633	.	-	.	transcript "619"	
Adh	FGenesCGG3	CDS	2007838	2007974	.	-	.	transcript "619"	
Adh	FGenesCGG3	start_codon	2007972	2007974	.	-	.	transcript "619"	
Adh	FGenesCGG3	CDS	1999210	1999539	.	-	.	transcript "620"	
Adh	FGenesCGG3	start_codon	1999537	1999539	.	-	.	transcript "620"	
Adh	FGenesCGG3	stop_codon	1999210	1999212	.	-	.	transcript "620"	
Adh	FGenesCGG3	CDS	2004868	2005045	.	-	.	transcript "621"	
Adh	FGenesCGG3	stop_codon	2004868	2004870	.	-	.	transcript "621"	
Adh	FGenesCGG3	CDS	2005830	2005974	.	-	.	transcript "621"	
Adh	FGenesCGG3	CDS	2007838	2008036	.	-	.	transcript "621"	
Adh	FGenesCGG3	CDS	2008083	2008162	.	-	.	transcript "621"	
Adh	FGenesCGG3	CDS	2008646	2008975	.	-	.	transcript "621"	
Adh	FGenesCGG3	CDS	2009178	2009181	.	-	.	transcript "621"	
Adh	FGenesCGG3	start_codon	2009179	2009181	.	-	.	transcript "621"	
Adh	FGenesCGG3	CDS	2008964	2009015	.	+	.	transcript "622"	
Adh	FGenesCGG3	start_codon	2008964	2008966	.	+	.	transcript "622"	
Adh	FGenesCGG3	CDS	2012577	2012854	.	+	.	transcript "622"	
Adh	FGenesCGG3	CDS	2014032	2014097	.	+	.	transcript "622"	
Adh	FGenesCGG3	stop_codon	2014095	2014097	.	+	.	transcript "622"	
Adh	FGenesCGG3	CDS	2017629	2017729	.	-	.	transcript "623"	
Adh	FGenesCGG3	stop_codon	2017629	2017631	.	-	.	transcript "623"	
Adh	FGenesCGG3	CDS	2018048	2018141	.	-	.	transcript "623"	
Adh	FGenesCGG3	start_codon	2018139	2018141	.	-	.	transcript "623"	
Adh	FGenesCGG3	CDS	2026323	2026348	.	+	.	transcript "624"	
Adh	FGenesCGG3	start_codon	2026323	2026325	.	+	.	transcript "624"	
Adh	FGenesCGG3	CDS	2028624	2028789	.	+	.	transcript "624"	
Adh	FGenesCGG3	CDS	2029632	2029772	.	+	.	transcript "624"	
Adh	FGenesCGG3	CDS	2033074	2033194	.	+	.	transcript "624"	
Adh	FGenesCGG3	CDS	2035398	2035486	.	+	.	transcript "624"	
Adh	FGenesCGG3	stop_codon	2035484	2035486	.	+	.	transcript "624"	
Adh	FGenesCGG3	CDS	2029133	2029152	.	+	.	transcript "625"	
Adh	FGenesCGG3	start_codon	2029133	2029135	.	+	.	transcript "625"	
Adh	FGenesCGG3	CDS	2029826	2030077	.	+	.	transcript "625"	
Adh	FGenesCGG3	CDS	2032861	2032920	.	+	.	transcript "625"	
Adh	FGenesCGG3	CDS	2033074	2033194	.	+	.	transcript "625"	
Adh	FGenesCGG3	CDS	2033564	2033689	.	+	.	transcript "625"	
Adh	FGenesCGG3	stop_codon	2033687	2033689	.	+	.	transcript "625"	
Adh	FGenesCGG3	CDS	2035641	2035774	.	+	.	transcript "626"	
Adh	FGenesCGG3	start_codon	2035641	2035643	.	+	.	transcript "626"	
Adh	FGenesCGG3	CDS	2037369	2037672	.	+	.	transcript "626"	
Adh	FGenesCGG3	stop_codon	2037670	2037672	.	+	.	transcript "626"	
Adh	FGenesCGG3	CDS	2036858	2037130	.	-	.	transcript "627"	
Adh	FGenesCGG3	stop_codon	2036858	2036860	.	-	.	transcript "627"	
Adh	FGenesCGG3	CDS	2038917	2038994	.	-	.	transcript "627"	
Adh	FGenesCGG3	start_codon	2038992	2038994	.	-	.	transcript "627"	
Adh	FGenesCGG3	CDS	2040123	2040280	.	+	.	transcript "628"	
Adh	FGenesCGG3	start_codon	2040123	2040125	.	+	.	transcript "628"	
Adh	FGenesCGG3	CDS	2040432	2040689	.	+	.	transcript "628"	
Adh	FGenesCGG3	CDS	2046730	2046916	.	+	.	transcript "628"	
Adh	FGenesCGG3	stop_codon	2046914	2046916	.	+	.	transcript "628"	
Adh	FGenesCGG3	CDS	2040123	2040280	.	+	.	transcript "629"	
Adh	FGenesCGG3	start_codon	2040123	2040125	.	+	.	transcript "629"	
Adh	FGenesCGG3	CDS	2040432	2040689	.	+	.	transcript "629"	
Adh	FGenesCGG3	CDS	2040748	2040772	.	+	.	transcript "629"	
Adh	FGenesCGG3	stop_codon	2040770	2040772	.	+	.	transcript "629"	
Adh	FGenesCGG3	CDS	2041292	2041614	.	-	.	transcript "630"	
Adh	FGenesCGG3	stop_codon	2041292	2041294	.	-	.	transcript "630"	
Adh	FGenesCGG3	CDS	2044827	2044911	.	-	.	transcript "630"	
Adh	FGenesCGG3	CDS	2045394	2045474	.	-	.	transcript "630"	
Adh	FGenesCGG3	start_codon	2045472	2045474	.	-	.	transcript "630"	
Adh	FGenesCGG3	CDS	2047890	2048264	.	-	.	transcript "631"	
Adh	FGenesCGG3	stop_codon	2047890	2047892	.	-	.	transcript "631"	
Adh	FGenesCGG3	CDS	2048500	2048526	.	-	.	transcript "631"	
Adh	FGenesCGG3	start_codon	2048524	2048526	.	-	.	transcript "631"	
Adh	FGenesCGG3	CDS	2048296	2048527	.	-	.	transcript "632"	
Adh	FGenesCGG3	stop_codon	2048296	2048298	.	-	.	transcript "632"	
Adh	FGenesCGG3	CDS	2048794	2048845	.	-	.	transcript "632"	
Adh	FGenesCGG3	CDS	2048891	2048967	.	-	.	transcript "632"	
Adh	FGenesCGG3	CDS	2049207	2049295	.	-	.	transcript "632"	
Adh	FGenesCGG3	start_codon	2049293	2049295	.	-	.	transcript "632"	
Adh	FGenesCGG3	CDS	2049248	2049415	.	+	.	transcript "633"	
Adh	FGenesCGG3	start_codon	2049248	2049250	.	+	.	transcript "633"	
Adh	FGenesCGG3	CDS	2050204	2050341	.	+	.	transcript "633"	
Adh	FGenesCGG3	CDS	2055015	2055098	.	+	.	transcript "633"	
Adh	FGenesCGG3	stop_codon	2055096	2055098	.	+	.	transcript "633"	
Adh	FGenesCGG3	CDS	2055891	2055959	.	+	.	transcript "634"	
Adh	FGenesCGG3	start_codon	2055891	2055893	.	+	.	transcript "634"	
Adh	FGenesCGG3	CDS	2056879	2056920	.	+	.	transcript "634"	
Adh	FGenesCGG3	CDS	2057280	2057330	.	+	.	transcript "634"	
Adh	FGenesCGG3	stop_codon	2057328	2057330	.	+	.	transcript "634"	
Adh	FGenesCGG3	CDS	2059194	2059847	.	-	.	transcript "635"	
Adh	FGenesCGG3	start_codon	2059845	2059847	.	-	.	transcript "635"	
Adh	FGenesCGG3	stop_codon	2059194	2059196	.	-	.	transcript "635"	
Adh	FGenesCGG3	CDS	2060482	2060539	.	-	.	transcript "636"	
Adh	FGenesCGG3	stop_codon	2060482	2060484	.	-	.	transcript "636"	
Adh	FGenesCGG3	CDS	2067212	2067288	.	-	.	transcript "636"	
Adh	FGenesCGG3	start_codon	2067286	2067288	.	-	.	transcript "636"	
Adh	FGenesCGG3	CDS	2068604	2070501	.	+	.	transcript "637"	
Adh	FGenesCGG3	start_codon	2068604	2068606	.	+	.	transcript "637"	
Adh	FGenesCGG3	CDS	2071510	2072677	.	+	.	transcript "637"	
Adh	FGenesCGG3	stop_codon	2072675	2072677	.	+	.	transcript "637"	
Adh	FGenesCGG3	CDS	2068604	2070501	.	+	.	transcript "638"	
Adh	FGenesCGG3	start_codon	2068604	2068606	.	+	.	transcript "638"	
Adh	FGenesCGG3	CDS	2071510	2072677	.	+	.	transcript "638"	
Adh	FGenesCGG3	stop_codon	2072675	2072677	.	+	.	transcript "638"	
Adh	FGenesCGG3	CDS	2074630	2074665	.	+	.	transcript "639"	
Adh	FGenesCGG3	start_codon	2074630	2074632	.	+	.	transcript "639"	
Adh	FGenesCGG3	CDS	2074709	2074983	.	+	.	transcript "639"	
Adh	FGenesCGG3	CDS	2075468	2075690	.	+	.	transcript "639"	
Adh	FGenesCGG3	stop_codon	2075688	2075690	.	+	.	transcript "639"	
Adh	FGenesCGG3	CDS	2076918	2078162	.	+	.	transcript "640"	
Adh	FGenesCGG3	start_codon	2076918	2076920	.	+	.	transcript "640"	
Adh	FGenesCGG3	stop_codon	2078160	2078162	.	+	.	transcript "640"	
Adh	FGenesCGG3	CDS	2078140	2081293	.	+	.	transcript "641"	
Adh	FGenesCGG3	start_codon	2078140	2078142	.	+	.	transcript "641"	
Adh	FGenesCGG3	stop_codon	2081291	2081293	.	+	.	transcript "641"	
Adh	FGenesCGG3	CDS	2083279	2083352	.	-	.	transcript "642"	
Adh	FGenesCGG3	stop_codon	2083279	2083281	.	-	.	transcript "642"	
Adh	FGenesCGG3	CDS	2094086	2094189	.	-	.	transcript "642"	
Adh	FGenesCGG3	CDS	2101791	2101926	.	-	.	transcript "642"	
Adh	FGenesCGG3	CDS	2104226	2104319	.	-	.	transcript "642"	
Adh	FGenesCGG3	start_codon	2104317	2104319	.	-	.	transcript "642"	
Adh	FGenesCGG3	CDS	2089504	2089812	.	-	.	transcript "643"	
Adh	FGenesCGG3	start_codon	2089810	2089812	.	-	.	transcript "643"	
Adh	FGenesCGG3	stop_codon	2089504	2089506	.	-	.	transcript "643"	
Adh	FGenesCGG3	CDS	2090883	2090930	.	+	.	transcript "644"	
Adh	FGenesCGG3	start_codon	2090883	2090885	.	+	.	transcript "644"	
Adh	FGenesCGG3	CDS	2091428	2091590	.	+	.	transcript "644"	
Adh	FGenesCGG3	CDS	2091956	2092087	.	+	.	transcript "644"	
Adh	FGenesCGG3	CDS	2092246	2092358	.	+	.	transcript "644"	
Adh	FGenesCGG3	stop_codon	2092356	2092358	.	+	.	transcript "644"	
Adh	FGenesCGG3	CDS	2096408	2096442	.	-	.	transcript "645"	
Adh	FGenesCGG3	stop_codon	2096408	2096410	.	-	.	transcript "645"	
Adh	FGenesCGG3	CDS	2096968	2097034	.	-	.	transcript "645"	
Adh	FGenesCGG3	start_codon	2097032	2097034	.	-	.	transcript "645"	
Adh	FGenesCGG3	CDS	2100551	2101358	.	-	.	transcript "646"	
Adh	FGenesCGG3	stop_codon	2100551	2100553	.	-	.	transcript "646"	
Adh	FGenesCGG3	CDS	2102194	2102639	.	-	.	transcript "646"	
Adh	FGenesCGG3	start_codon	2102637	2102639	.	-	.	transcript "646"	
Adh	FGenesCGG3	CDS	2103622	2104169	.	-	.	transcript "647"	
Adh	FGenesCGG3	stop_codon	2103622	2103624	.	-	.	transcript "647"	
Adh	FGenesCGG3	CDS	2104226	2104442	.	-	.	transcript "647"	
Adh	FGenesCGG3	start_codon	2104440	2104442	.	-	.	transcript "647"	
Adh	FGenesCGG3	CDS	2105170	2105720	.	-	.	transcript "648"	
Adh	FGenesCGG3	stop_codon	2105170	2105172	.	-	.	transcript "648"	
Adh	FGenesCGG3	CDS	2105774	2105867	.	-	.	transcript "648"	
Adh	FGenesCGG3	start_codon	2105865	2105867	.	-	.	transcript "648"	
Adh	FGenesCGG3	CDS	2105170	2105720	.	-	.	transcript "649"	
Adh	FGenesCGG3	stop_codon	2105170	2105172	.	-	.	transcript "649"	
Adh	FGenesCGG3	CDS	2105774	2105984	.	-	.	transcript "649"	
Adh	FGenesCGG3	start_codon	2105982	2105984	.	-	.	transcript "649"	
Adh	FGenesCGG3	CDS	2106653	2106860	.	+	.	transcript "650"	
Adh	FGenesCGG3	start_codon	2106653	2106655	.	+	.	transcript "650"	
Adh	FGenesCGG3	CDS	2106931	2107445	.	+	.	transcript "650"	
Adh	FGenesCGG3	stop_codon	2107443	2107445	.	+	.	transcript "650"	
Adh	FGenesCGG3	CDS	2106653	2106860	.	+	.	transcript "651"	
Adh	FGenesCGG3	start_codon	2106653	2106655	.	+	.	transcript "651"	
Adh	FGenesCGG3	CDS	2106931	2107445	.	+	.	transcript "651"	
Adh	FGenesCGG3	stop_codon	2107443	2107445	.	+	.	transcript "651"	
Adh	FGenesCGG3	CDS	2108831	2108938	.	-	.	transcript "652"	
Adh	FGenesCGG3	stop_codon	2108831	2108833	.	-	.	transcript "652"	
Adh	FGenesCGG3	CDS	2111897	2112079	.	-	.	transcript "652"	
Adh	FGenesCGG3	CDS	2112133	2112228	.	-	.	transcript "652"	
Adh	FGenesCGG3	CDS	2112328	2112843	.	-	.	transcript "652"	
Adh	FGenesCGG3	CDS	2117185	2117211	.	-	.	transcript "652"	
Adh	FGenesCGG3	start_codon	2117209	2117211	.	-	.	transcript "652"	
Adh	FGenesCGG3	CDS	2109639	2109797	.	-	.	transcript "653"	
Adh	FGenesCGG3	start_codon	2109795	2109797	.	-	.	transcript "653"	
Adh	FGenesCGG3	stop_codon	2109639	2109641	.	-	.	transcript "653"	
Adh	FGenesCGG3	CDS	2111779	2111847	.	-	.	transcript "654"	
Adh	FGenesCGG3	stop_codon	2111779	2111781	.	-	.	transcript "654"	
Adh	FGenesCGG3	CDS	2111897	2112079	.	-	.	transcript "654"	
Adh	FGenesCGG3	CDS	2112328	2113209	.	-	.	transcript "654"	
Adh	FGenesCGG3	start_codon	2113207	2113209	.	-	.	transcript "654"	
Adh	FGenesCGG3	CDS	2114074	2114182	.	-	.	transcript "655"	
Adh	FGenesCGG3	stop_codon	2114074	2114076	.	-	.	transcript "655"	
Adh	FGenesCGG3	CDS	2114974	2115499	.	-	.	transcript "655"	
Adh	FGenesCGG3	CDS	2116347	2116448	.	-	.	transcript "655"	
Adh	FGenesCGG3	CDS	2117362	2117713	.	-	.	transcript "655"	
Adh	FGenesCGG3	start_codon	2117711	2117713	.	-	.	transcript "655"	
Adh	FGenesCGG3	CDS	2118335	2118551	.	+	.	transcript "656"	
Adh	FGenesCGG3	start_codon	2118335	2118337	.	+	.	transcript "656"	
Adh	FGenesCGG3	CDS	2118614	2118966	.	+	.	transcript "656"	
Adh	FGenesCGG3	CDS	2119937	2120025	.	+	.	transcript "656"	
Adh	FGenesCGG3	CDS	2120092	2120194	.	+	.	transcript "656"	
Adh	FGenesCGG3	CDS	2120312	2121269	.	+	.	transcript "656"	
Adh	FGenesCGG3	CDS	2121336	2121745	.	+	.	transcript "656"	
Adh	FGenesCGG3	stop_codon	2121743	2121745	.	+	.	transcript "656"	
Adh	FGenesCGG3	CDS	2118335	2118551	.	+	.	transcript "657"	
Adh	FGenesCGG3	start_codon	2118335	2118337	.	+	.	transcript "657"	
Adh	FGenesCGG3	CDS	2118614	2119161	.	+	.	transcript "657"	
Adh	FGenesCGG3	stop_codon	2119159	2119161	.	+	.	transcript "657"	
Adh	FGenesCGG3	CDS	2119874	2120025	.	+	.	transcript "658"	
Adh	FGenesCGG3	start_codon	2119874	2119876	.	+	.	transcript "658"	
Adh	FGenesCGG3	CDS	2120092	2120194	.	+	.	transcript "658"	
Adh	FGenesCGG3	CDS	2120312	2121269	.	+	.	transcript "658"	
Adh	FGenesCGG3	CDS	2121336	2121745	.	+	.	transcript "658"	
Adh	FGenesCGG3	stop_codon	2121743	2121745	.	+	.	transcript "658"	
Adh	FGenesCGG3	CDS	2125843	2125928	.	+	.	transcript "659"	
Adh	FGenesCGG3	start_codon	2125843	2125845	.	+	.	transcript "659"	
Adh	FGenesCGG3	CDS	2134995	2135050	.	+	.	transcript "659"	
Adh	FGenesCGG3	CDS	2135544	2135686	.	+	.	transcript "659"	
Adh	FGenesCGG3	stop_codon	2135684	2135686	.	+	.	transcript "659"	
Adh	FGenesCGG3	CDS	2125843	2125928	.	+	.	transcript "660"	
Adh	FGenesCGG3	start_codon	2125843	2125845	.	+	.	transcript "660"	
Adh	FGenesCGG3	CDS	2127225	2127501	.	+	.	transcript "660"	
Adh	FGenesCGG3	stop_codon	2127499	2127501	.	+	.	transcript "660"	
Adh	FGenesCGG3	CDS	2137486	2137679	.	-	.	transcript "661"	
Adh	FGenesCGG3	stop_codon	2137486	2137488	.	-	.	transcript "661"	
Adh	FGenesCGG3	CDS	2137746	2137902	.	-	.	transcript "661"	
Adh	FGenesCGG3	CDS	2137961	2138116	.	-	.	transcript "661"	
Adh	FGenesCGG3	CDS	2138186	2138671	.	-	.	transcript "661"	
Adh	FGenesCGG3	CDS	2138733	2138994	.	-	.	transcript "661"	
Adh	FGenesCGG3	CDS	2139065	2139169	.	-	.	transcript "661"	
Adh	FGenesCGG3	CDS	2139350	2139382	.	-	.	transcript "661"	
Adh	FGenesCGG3	CDS	2139824	2140056	.	-	.	transcript "661"	
Adh	FGenesCGG3	CDS	2140148	2140353	.	-	.	transcript "661"	
Adh	FGenesCGG3	CDS	2140417	2140630	.	-	.	transcript "661"	
Adh	FGenesCGG3	CDS	2140705	2140838	.	-	.	transcript "661"	
Adh	FGenesCGG3	CDS	2141181	2141205	.	-	.	transcript "661"	
Adh	FGenesCGG3	CDS	2141468	2141749	.	-	.	transcript "661"	
Adh	FGenesCGG3	CDS	2141998	2142321	.	-	.	transcript "661"	
Adh	FGenesCGG3	start_codon	2142319	2142321	.	-	.	transcript "661"	
Adh	FGenesCGG3	CDS	2137486	2137679	.	-	.	transcript "662"	
Adh	FGenesCGG3	stop_codon	2137486	2137488	.	-	.	transcript "662"	
Adh	FGenesCGG3	CDS	2137746	2137902	.	-	.	transcript "662"	
Adh	FGenesCGG3	CDS	2137961	2138116	.	-	.	transcript "662"	
Adh	FGenesCGG3	CDS	2138186	2138671	.	-	.	transcript "662"	
Adh	FGenesCGG3	CDS	2138733	2138994	.	-	.	transcript "662"	
Adh	FGenesCGG3	CDS	2139065	2139169	.	-	.	transcript "662"	
Adh	FGenesCGG3	CDS	2139824	2140056	.	-	.	transcript "662"	
Adh	FGenesCGG3	CDS	2140148	2140353	.	-	.	transcript "662"	
Adh	FGenesCGG3	CDS	2140417	2140630	.	-	.	transcript "662"	
Adh	FGenesCGG3	CDS	2140705	2141412	.	-	.	transcript "662"	
Adh	FGenesCGG3	CDS	2141468	2141749	.	-	.	transcript "662"	
Adh	FGenesCGG3	CDS	2141998	2142471	.	-	.	transcript "662"	
Adh	FGenesCGG3	CDS	2142732	2142776	.	-	.	transcript "662"	
Adh	FGenesCGG3	start_codon	2142774	2142776	.	-	.	transcript "662"	
Adh	FGenesCGG3	CDS	2145807	2145957	.	+	.	transcript "663"	
Adh	FGenesCGG3	start_codon	2145807	2145809	.	+	.	transcript "663"	
Adh	FGenesCGG3	CDS	2148796	2148854	.	+	.	transcript "663"	
Adh	FGenesCGG3	stop_codon	2148852	2148854	.	+	.	transcript "663"	
Adh	FGenesCGG3	CDS	2146717	2147016	.	+	.	transcript "664"	
Adh	FGenesCGG3	start_codon	2146717	2146719	.	+	.	transcript "664"	
Adh	FGenesCGG3	stop_codon	2147014	2147016	.	+	.	transcript "664"	
Adh	FGenesCGG3	CDS	2148959	2148986	.	+	.	transcript "665"	
Adh	FGenesCGG3	start_codon	2148959	2148961	.	+	.	transcript "665"	
Adh	FGenesCGG3	CDS	2149314	2149510	.	+	.	transcript "665"	
Adh	FGenesCGG3	CDS	2149741	2150907	.	+	.	transcript "665"	
Adh	FGenesCGG3	stop_codon	2150905	2150907	.	+	.	transcript "665"	
Adh	FGenesCGG3	CDS	2150213	2150506	.	-	.	transcript "666"	
Adh	FGenesCGG3	stop_codon	2150213	2150215	.	-	.	transcript "666"	
Adh	FGenesCGG3	CDS	2151821	2151931	.	-	.	transcript "666"	
Adh	FGenesCGG3	CDS	2157869	2157973	.	-	.	transcript "666"	
Adh	FGenesCGG3	start_codon	2157971	2157973	.	-	.	transcript "666"	
Adh	FGenesCGG3	CDS	2151008	2151505	.	-	.	transcript "667"	
Adh	FGenesCGG3	stop_codon	2151008	2151010	.	-	.	transcript "667"	
Adh	FGenesCGG3	CDS	2151821	2151931	.	-	.	transcript "667"	
Adh	FGenesCGG3	CDS	2152628	2152651	.	-	.	transcript "667"	
Adh	FGenesCGG3	start_codon	2152649	2152651	.	-	.	transcript "667"	
Adh	FGenesCGG3	CDS	2154299	2154363	.	+	.	transcript "668"	
Adh	FGenesCGG3	start_codon	2154299	2154301	.	+	.	transcript "668"	
Adh	FGenesCGG3	CDS	2158289	2158329	.	+	.	transcript "668"	
Adh	FGenesCGG3	CDS	2158655	2159356	.	+	.	transcript "668"	
Adh	FGenesCGG3	CDS	2159581	2159642	.	+	.	transcript "668"	
Adh	FGenesCGG3	stop_codon	2159640	2159642	.	+	.	transcript "668"	
Adh	FGenesCGG3	CDS	2158476	2158559	.	+	.	transcript "669"	
Adh	FGenesCGG3	start_codon	2158476	2158478	.	+	.	transcript "669"	
Adh	FGenesCGG3	CDS	2158660	2159460	.	+	.	transcript "669"	
Adh	FGenesCGG3	stop_codon	2159458	2159460	.	+	.	transcript "669"	
Adh	FGenesCGG3	CDS	2163892	2164225	.	-	.	transcript "670"	
Adh	FGenesCGG3	stop_codon	2163892	2163894	.	-	.	transcript "670"	
Adh	FGenesCGG3	CDS	2167365	2167477	.	-	.	transcript "670"	
Adh	FGenesCGG3	start_codon	2167475	2167477	.	-	.	transcript "670"	
Adh	FGenesCGG3	CDS	2163892	2164261	.	-	.	transcript "671"	
Adh	FGenesCGG3	stop_codon	2163892	2163894	.	-	.	transcript "671"	
Adh	FGenesCGG3	CDS	2167365	2167477	.	-	.	transcript "671"	
Adh	FGenesCGG3	start_codon	2167475	2167477	.	-	.	transcript "671"	
Adh	FGenesCGG3	CDS	2167933	2167937	.	-	.	transcript "672"	
Adh	FGenesCGG3	stop_codon	2167933	2167935	.	-	.	transcript "672"	
Adh	FGenesCGG3	CDS	2168479	2168665	.	-	.	transcript "672"	
Adh	FGenesCGG3	start_codon	2168663	2168665	.	-	.	transcript "672"	
Adh	FGenesCGG3	CDS	2168897	2169076	.	+	.	transcript "673"	
Adh	FGenesCGG3	start_codon	2168897	2168899	.	+	.	transcript "673"	
Adh	FGenesCGG3	CDS	2170884	2171342	.	+	.	transcript "673"	
Adh	FGenesCGG3	stop_codon	2171340	2171342	.	+	.	transcript "673"	
Adh	FGenesCGG3	CDS	2173083	2173437	.	+	.	transcript "674"	
Adh	FGenesCGG3	start_codon	2173083	2173085	.	+	.	transcript "674"	
Adh	FGenesCGG3	CDS	2173976	2174061	.	+	.	transcript "674"	
Adh	FGenesCGG3	stop_codon	2174059	2174061	.	+	.	transcript "674"	
Adh	FGenesCGG3	CDS	2174093	2177290	.	+	.	transcript "675"	
Adh	FGenesCGG3	start_codon	2174093	2174095	.	+	.	transcript "675"	
Adh	FGenesCGG3	stop_codon	2177288	2177290	.	+	.	transcript "675"	
Adh	FGenesCGG3	CDS	2180707	2180982	.	-	.	transcript "676"	
Adh	FGenesCGG3	stop_codon	2180707	2180709	.	-	.	transcript "676"	
Adh	FGenesCGG3	CDS	2181100	2181325	.	-	.	transcript "676"	
Adh	FGenesCGG3	CDS	2181392	2182662	.	-	.	transcript "676"	
Adh	FGenesCGG3	CDS	2182828	2182863	.	-	.	transcript "676"	
Adh	FGenesCGG3	start_codon	2182861	2182863	.	-	.	transcript "676"	
Adh	FGenesCGG3	CDS	2182500	2182662	.	-	.	transcript "677"	
Adh	FGenesCGG3	stop_codon	2182500	2182502	.	-	.	transcript "677"	
Adh	FGenesCGG3	CDS	2189454	2189790	.	-	.	transcript "677"	
Adh	FGenesCGG3	CDS	2192598	2192617	.	-	.	transcript "677"	
Adh	FGenesCGG3	start_codon	2192615	2192617	.	-	.	transcript "677"	
Adh	FGenesCGG3	CDS	2193218	2193311	.	-	.	transcript "678"	
Adh	FGenesCGG3	stop_codon	2193218	2193220	.	-	.	transcript "678"	
Adh	FGenesCGG3	CDS	2196154	2196216	.	-	.	transcript "678"	
Adh	FGenesCGG3	CDS	2196505	2196560	.	-	.	transcript "678"	
Adh	FGenesCGG3	CDS	2197573	2197656	.	-	.	transcript "678"	
Adh	FGenesCGG3	start_codon	2197654	2197656	.	-	.	transcript "678"	
Adh	FGenesCGG3	CDS	2198511	2198637	.	+	.	transcript "679"	
Adh	FGenesCGG3	start_codon	2198511	2198513	.	+	.	transcript "679"	
Adh	FGenesCGG3	CDS	2199081	2199241	.	+	.	transcript "679"	
Adh	FGenesCGG3	CDS	2199824	2199925	.	+	.	transcript "679"	
Adh	FGenesCGG3	stop_codon	2199923	2199925	.	+	.	transcript "679"	
Adh	FGenesCGG3	CDS	2201531	2201677	.	-	.	transcript "680"	
Adh	FGenesCGG3	stop_codon	2201531	2201533	.	-	.	transcript "680"	
Adh	FGenesCGG3	CDS	2202376	2202477	.	-	.	transcript "680"	
Adh	FGenesCGG3	CDS	2202575	2202742	.	-	.	transcript "680"	
Adh	FGenesCGG3	start_codon	2202740	2202742	.	-	.	transcript "680"	
Adh	FGenesCGG3	CDS	2201531	2201677	.	-	.	transcript "681"	
Adh	FGenesCGG3	stop_codon	2201531	2201533	.	-	.	transcript "681"	
Adh	FGenesCGG3	CDS	2202376	2202477	.	-	.	transcript "681"	
Adh	FGenesCGG3	CDS	2202548	2202802	.	-	.	transcript "681"	
Adh	FGenesCGG3	start_codon	2202800	2202802	.	-	.	transcript "681"	
Adh	FGenesCGG3	CDS	2204183	2205278	.	+	.	transcript "682"	
Adh	FGenesCGG3	start_codon	2204183	2204185	.	+	.	transcript "682"	
Adh	FGenesCGG3	CDS	2205332	2207403	.	+	.	transcript "682"	
Adh	FGenesCGG3	stop_codon	2207401	2207403	.	+	.	transcript "682"	
Adh	FGenesCGG3	CDS	2204183	2205278	.	+	.	transcript "683"	
Adh	FGenesCGG3	start_codon	2204183	2204185	.	+	.	transcript "683"	
Adh	FGenesCGG3	CDS	2205332	2207403	.	+	.	transcript "683"	
Adh	FGenesCGG3	stop_codon	2207401	2207403	.	+	.	transcript "683"	
Adh	FGenesCGG3	CDS	2208922	2209531	.	-	.	transcript "684"	
Adh	FGenesCGG3	stop_codon	2208922	2208924	.	-	.	transcript "684"	
Adh	FGenesCGG3	CDS	2209593	2209904	.	-	.	transcript "684"	
Adh	FGenesCGG3	CDS	2209967	2211186	.	-	.	transcript "684"	
Adh	FGenesCGG3	CDS	2211243	2211671	.	-	.	transcript "684"	
Adh	FGenesCGG3	CDS	2212036	2212168	.	-	.	transcript "684"	
Adh	FGenesCGG3	CDS	2212228	2212400	.	-	.	transcript "684"	
Adh	FGenesCGG3	start_codon	2212398	2212400	.	-	.	transcript "684"	
Adh	FGenesCGG3	CDS	2213076	2213095	.	+	.	transcript "685"	
Adh	FGenesCGG3	start_codon	2213076	2213078	.	+	.	transcript "685"	
Adh	FGenesCGG3	CDS	2214033	2214273	.	+	.	transcript "685"	
Adh	FGenesCGG3	stop_codon	2214271	2214273	.	+	.	transcript "685"	
Adh	FGenesCGG3	CDS	2214270	2214308	.	+	.	transcript "686"	
Adh	FGenesCGG3	start_codon	2214270	2214272	.	+	.	transcript "686"	
Adh	FGenesCGG3	CDS	2214900	2214962	.	+	.	transcript "686"	
Adh	FGenesCGG3	stop_codon	2214960	2214962	.	+	.	transcript "686"	
Adh	FGenesCGG3	CDS	2216202	2216561	.	+	.	transcript "687"	
Adh	FGenesCGG3	start_codon	2216202	2216204	.	+	.	transcript "687"	
Adh	FGenesCGG3	CDS	2216609	2217034	.	+	.	transcript "687"	
Adh	FGenesCGG3	CDS	2217099	2217403	.	+	.	transcript "687"	
Adh	FGenesCGG3	CDS	2217501	2217537	.	+	.	transcript "687"	
Adh	FGenesCGG3	stop_codon	2217535	2217537	.	+	.	transcript "687"	
Adh	FGenesCGG3	CDS	2216202	2216447	.	+	.	transcript "688"	
Adh	FGenesCGG3	start_codon	2216202	2216204	.	+	.	transcript "688"	
Adh	FGenesCGG3	CDS	2216609	2217034	.	+	.	transcript "688"	
Adh	FGenesCGG3	CDS	2217099	2217419	.	+	.	transcript "688"	
Adh	FGenesCGG3	stop_codon	2217417	2217419	.	+	.	transcript "688"	
Adh	FGenesCGG3	CDS	2218461	2218494	.	-	.	transcript "689"	
Adh	FGenesCGG3	stop_codon	2218461	2218463	.	-	.	transcript "689"	
Adh	FGenesCGG3	CDS	2218559	2218905	.	-	.	transcript "689"	
Adh	FGenesCGG3	CDS	2218966	2220057	.	-	.	transcript "689"	
Adh	FGenesCGG3	start_codon	2220055	2220057	.	-	.	transcript "689"	
Adh	FGenesCGG3	CDS	2218461	2218494	.	-	.	transcript "690"	
Adh	FGenesCGG3	stop_codon	2218461	2218463	.	-	.	transcript "690"	
Adh	FGenesCGG3	CDS	2218559	2218905	.	-	.	transcript "690"	
Adh	FGenesCGG3	CDS	2218966	2219871	.	-	.	transcript "690"	
Adh	FGenesCGG3	CDS	2219932	2220057	.	-	.	transcript "690"	
Adh	FGenesCGG3	start_codon	2220055	2220057	.	-	.	transcript "690"	
Adh	FGenesCGG3	CDS	2220565	2222197	.	-	.	transcript "691"	
Adh	FGenesCGG3	stop_codon	2220565	2220567	.	-	.	transcript "691"	
Adh	FGenesCGG3	CDS	2222257	2222379	.	-	.	transcript "691"	
Adh	FGenesCGG3	CDS	2222435	2222667	.	-	.	transcript "691"	
Adh	FGenesCGG3	CDS	2222723	2222818	.	-	.	transcript "691"	
Adh	FGenesCGG3	CDS	2222876	2222890	.	-	.	transcript "691"	
Adh	FGenesCGG3	start_codon	2222888	2222890	.	-	.	transcript "691"	
Adh	FGenesCGG3	CDS	2220565	2222197	.	-	.	transcript "692"	
Adh	FGenesCGG3	stop_codon	2220565	2220567	.	-	.	transcript "692"	
Adh	FGenesCGG3	CDS	2222257	2222379	.	-	.	transcript "692"	
Adh	FGenesCGG3	CDS	2222435	2222667	.	-	.	transcript "692"	
Adh	FGenesCGG3	CDS	2222723	2222818	.	-	.	transcript "692"	
Adh	FGenesCGG3	CDS	2223403	2223531	.	-	.	transcript "692"	
Adh	FGenesCGG3	CDS	2223874	2223936	.	-	.	transcript "692"	
Adh	FGenesCGG3	start_codon	2223934	2223936	.	-	.	transcript "692"	
Adh	FGenesCGG3	CDS	2223170	2223346	.	-	.	transcript "693"	
Adh	FGenesCGG3	stop_codon	2223170	2223172	.	-	.	transcript "693"	
Adh	FGenesCGG3	CDS	2223403	2223577	.	-	.	transcript "693"	
Adh	FGenesCGG3	CDS	2223854	2224229	.	-	.	transcript "693"	
Adh	FGenesCGG3	CDS	2224289	2224367	.	-	.	transcript "693"	
Adh	FGenesCGG3	start_codon	2224365	2224367	.	-	.	transcript "693"	
Adh	FGenesCGG3	CDS	2230462	2230631	.	-	.	transcript "694"	
Adh	FGenesCGG3	stop_codon	2230462	2230464	.	-	.	transcript "694"	
Adh	FGenesCGG3	CDS	2231499	2231709	.	-	.	transcript "694"	
Adh	FGenesCGG3	CDS	2231747	2231749	.	-	.	transcript "694"	
Adh	FGenesCGG3	start_codon	2231747	2231749	.	-	.	transcript "694"	
Adh	FGenesCGG3	CDS	2232060	2232072	.	-	.	transcript "695"	
Adh	FGenesCGG3	stop_codon	2232060	2232062	.	-	.	transcript "695"	
Adh	FGenesCGG3	CDS	2234428	2234591	.	-	.	transcript "695"	
Adh	FGenesCGG3	start_codon	2234589	2234591	.	-	.	transcript "695"	
Adh	FGenesCGG3	CDS	2236081	2237533	.	+	.	transcript "696"	
Adh	FGenesCGG3	start_codon	2236081	2236083	.	+	.	transcript "696"	
Adh	FGenesCGG3	CDS	2237747	2237952	.	+	.	transcript "696"	
Adh	FGenesCGG3	CDS	2238104	2238184	.	+	.	transcript "696"	
Adh	FGenesCGG3	CDS	2238625	2239302	.	+	.	transcript "696"	
Adh	FGenesCGG3	CDS	2239864	2241876	.	+	.	transcript "696"	
Adh	FGenesCGG3	stop_codon	2241874	2241876	.	+	.	transcript "696"	
Adh	FGenesCGG3	CDS	2236081	2241876	.	+	.	transcript "697"	
Adh	FGenesCGG3	start_codon	2236081	2236083	.	+	.	transcript "697"	
Adh	FGenesCGG3	stop_codon	2241874	2241876	.	+	.	transcript "697"	
Adh	FGenesCGG3	CDS	2248133	2248214	.	-	.	transcript "698"	
Adh	FGenesCGG3	stop_codon	2248133	2248135	.	-	.	transcript "698"	
Adh	FGenesCGG3	CDS	2251550	2251668	.	-	.	transcript "698"	
Adh	FGenesCGG3	start_codon	2251666	2251668	.	-	.	transcript "698"	
Adh	FGenesCGG3	CDS	2253350	2253637	.	+	.	transcript "699"	
Adh	FGenesCGG3	start_codon	2253350	2253352	.	+	.	transcript "699"	
Adh	FGenesCGG3	stop_codon	2253635	2253637	.	+	.	transcript "699"	
Adh	FGenesCGG3	CDS	2254301	2254361	.	+	.	transcript "700"	
Adh	FGenesCGG3	start_codon	2254301	2254303	.	+	.	transcript "700"	
Adh	FGenesCGG3	CDS	2256486	2256551	.	+	.	transcript "700"	
Adh	FGenesCGG3	CDS	2260898	2260923	.	+	.	transcript "700"	
Adh	FGenesCGG3	CDS	2262386	2262523	.	+	.	transcript "700"	
Adh	FGenesCGG3	stop_codon	2262521	2262523	.	+	.	transcript "700"	
Adh	FGenesCGG3	CDS	2257078	2257201	.	+	.	transcript "701"	
Adh	FGenesCGG3	start_codon	2257078	2257080	.	+	.	transcript "701"	
Adh	FGenesCGG3	CDS	2257568	2257662	.	+	.	transcript "701"	
Adh	FGenesCGG3	stop_codon	2257660	2257662	.	+	.	transcript "701"	
Adh	FGenesCGG3	CDS	2263166	2263696	.	-	.	transcript "702"	
Adh	FGenesCGG3	stop_codon	2263166	2263168	.	-	.	transcript "702"	
Adh	FGenesCGG3	CDS	2263755	2263955	.	-	.	transcript "702"	
Adh	FGenesCGG3	start_codon	2263953	2263955	.	-	.	transcript "702"	
Adh	FGenesCGG3	CDS	2263166	2263696	.	-	.	transcript "703"	
Adh	FGenesCGG3	stop_codon	2263166	2263168	.	-	.	transcript "703"	
Adh	FGenesCGG3	CDS	2263755	2263928	.	-	.	transcript "703"	
Adh	FGenesCGG3	start_codon	2263926	2263928	.	-	.	transcript "703"	
Adh	FGenesCGG3	CDS	2264594	2264686	.	+	.	transcript "704"	
Adh	FGenesCGG3	start_codon	2264594	2264596	.	+	.	transcript "704"	
Adh	FGenesCGG3	CDS	2270793	2270949	.	+	.	transcript "704"	
Adh	FGenesCGG3	CDS	2280575	2281032	.	+	.	transcript "704"	
Adh	FGenesCGG3	stop_codon	2281030	2281032	.	+	.	transcript "704"	
Adh	FGenesCGG3	CDS	2278813	2278820	.	+	.	transcript "705"	
Adh	FGenesCGG3	start_codon	2278813	2278815	.	+	.	transcript "705"	
Adh	FGenesCGG3	CDS	2279357	2279436	.	+	.	transcript "705"	
Adh	FGenesCGG3	CDS	2280638	2281032	.	+	.	transcript "705"	
Adh	FGenesCGG3	stop_codon	2281030	2281032	.	+	.	transcript "705"	
Adh	FGenesCGG3	CDS	2282083	2282238	.	-	.	transcript "706"	
Adh	FGenesCGG3	stop_codon	2282083	2282085	.	-	.	transcript "706"	
Adh	FGenesCGG3	CDS	2285074	2285261	.	-	.	transcript "706"	
Adh	FGenesCGG3	CDS	2286518	2286850	.	-	.	transcript "706"	
Adh	FGenesCGG3	CDS	2291643	2291727	.	-	.	transcript "706"	
Adh	FGenesCGG3	CDS	2303477	2303587	.	-	.	transcript "706"	
Adh	FGenesCGG3	start_codon	2303585	2303587	.	-	.	transcript "706"	
Adh	FGenesCGG3	CDS	2282647	2282710	.	+	.	transcript "707"	
Adh	FGenesCGG3	start_codon	2282647	2282649	.	+	.	transcript "707"	
Adh	FGenesCGG3	CDS	2283361	2283638	.	+	.	transcript "707"	
Adh	FGenesCGG3	stop_codon	2283636	2283638	.	+	.	transcript "707"	
Adh	FGenesCGG3	CDS	2284485	2284627	.	-	.	transcript "708"	
Adh	FGenesCGG3	stop_codon	2284485	2284487	.	-	.	transcript "708"	
Adh	FGenesCGG3	CDS	2286518	2287433	.	-	.	transcript "708"	
Adh	FGenesCGG3	start_codon	2287431	2287433	.	-	.	transcript "708"	
Adh	FGenesCGG3	CDS	2288758	2289095	.	-	.	transcript "709"	
Adh	FGenesCGG3	stop_codon	2288758	2288760	.	-	.	transcript "709"	
Adh	FGenesCGG3	CDS	2291112	2291221	.	-	.	transcript "709"	
Adh	FGenesCGG3	CDS	2291657	2291901	.	-	.	transcript "709"	
Adh	FGenesCGG3	CDS	2293110	2293139	.	-	.	transcript "709"	
Adh	FGenesCGG3	start_codon	2293137	2293139	.	-	.	transcript "709"	
Adh	FGenesCGG3	CDS	2297812	2298032	.	-	.	transcript "710"	
Adh	FGenesCGG3	stop_codon	2297812	2297814	.	-	.	transcript "710"	
Adh	FGenesCGG3	CDS	2299021	2299069	.	-	.	transcript "710"	
Adh	FGenesCGG3	start_codon	2299067	2299069	.	-	.	transcript "710"	
Adh	FGenesCGG3	CDS	2303372	2303375	.	+	.	transcript "711"	
Adh	FGenesCGG3	start_codon	2303372	2303374	.	+	.	transcript "711"	
Adh	FGenesCGG3	CDS	2303428	2304641	.	+	.	transcript "711"	
Adh	FGenesCGG3	stop_codon	2304639	2304641	.	+	.	transcript "711"	
Adh	FGenesCGG3	CDS	2305038	2305397	.	+	.	transcript "712"	
Adh	FGenesCGG3	start_codon	2305038	2305040	.	+	.	transcript "712"	
Adh	FGenesCGG3	CDS	2305489	2305763	.	+	.	transcript "712"	
Adh	FGenesCGG3	CDS	2305829	2306951	.	+	.	transcript "712"	
Adh	FGenesCGG3	stop_codon	2306949	2306951	.	+	.	transcript "712"	
Adh	FGenesCGG3	CDS	2305254	2305397	.	+	.	transcript "713"	
Adh	FGenesCGG3	start_codon	2305254	2305256	.	+	.	transcript "713"	
Adh	FGenesCGG3	CDS	2305489	2305763	.	+	.	transcript "713"	
Adh	FGenesCGG3	CDS	2305829	2306951	.	+	.	transcript "713"	
Adh	FGenesCGG3	stop_codon	2306949	2306951	.	+	.	transcript "713"	
Adh	FGenesCGG3	CDS	2308690	2308818	.	-	.	transcript "714"	
Adh	FGenesCGG3	stop_codon	2308690	2308692	.	-	.	transcript "714"	
Adh	FGenesCGG3	CDS	2308864	2308920	.	-	.	transcript "714"	
Adh	FGenesCGG3	start_codon	2308918	2308920	.	-	.	transcript "714"	
Adh	FGenesCGG3	CDS	2309520	2309676	.	+	.	transcript "715"	
Adh	FGenesCGG3	start_codon	2309520	2309522	.	+	.	transcript "715"	
Adh	FGenesCGG3	CDS	2310116	2310282	.	+	.	transcript "715"	
Adh	FGenesCGG3	stop_codon	2310280	2310282	.	+	.	transcript "715"	
Adh	FGenesCGG3	CDS	2310880	2310893	.	-	.	transcript "716"	
Adh	FGenesCGG3	stop_codon	2310880	2310882	.	-	.	transcript "716"	
Adh	FGenesCGG3	CDS	2311611	2311711	.	-	.	transcript "716"	
Adh	FGenesCGG3	CDS	2313467	2313611	.	-	.	transcript "716"	
Adh	FGenesCGG3	CDS	2313807	2313838	.	-	.	transcript "716"	
Adh	FGenesCGG3	CDS	2314158	2314280	.	-	.	transcript "716"	
Adh	FGenesCGG3	CDS	2314613	2314635	.	-	.	transcript "716"	
Adh	FGenesCGG3	start_codon	2314633	2314635	.	-	.	transcript "716"	
Adh	FGenesCGG3	CDS	2311273	2311472	.	-	.	transcript "717"	
Adh	FGenesCGG3	stop_codon	2311273	2311275	.	-	.	transcript "717"	
Adh	FGenesCGG3	CDS	2311611	2311711	.	-	.	transcript "717"	
Adh	FGenesCGG3	CDS	2313949	2314030	.	-	.	transcript "717"	
Adh	FGenesCGG3	CDS	2314386	2314545	.	-	.	transcript "717"	
Adh	FGenesCGG3	start_codon	2314543	2314545	.	-	.	transcript "717"	
Adh	FGenesCGG3	CDS	2315767	2315925	.	-	.	transcript "718"	
Adh	FGenesCGG3	stop_codon	2315767	2315769	.	-	.	transcript "718"	
Adh	FGenesCGG3	CDS	2315991	2316098	.	-	.	transcript "718"	
Adh	FGenesCGG3	start_codon	2316096	2316098	.	-	.	transcript "718"	
Adh	FGenesCGG3	CDS	2315767	2315925	.	-	.	transcript "719"	
Adh	FGenesCGG3	stop_codon	2315767	2315769	.	-	.	transcript "719"	
Adh	FGenesCGG3	CDS	2315991	2316098	.	-	.	transcript "719"	
Adh	FGenesCGG3	start_codon	2316096	2316098	.	-	.	transcript "719"	
Adh	FGenesCGG3	CDS	2318127	2318166	.	+	.	transcript "720"	
Adh	FGenesCGG3	start_codon	2318127	2318129	.	+	.	transcript "720"	
Adh	FGenesCGG3	CDS	2318424	2318543	.	+	.	transcript "720"	
Adh	FGenesCGG3	CDS	2323204	2323381	.	+	.	transcript "720"	
Adh	FGenesCGG3	CDS	2326621	2326642	.	+	.	transcript "720"	
Adh	FGenesCGG3	stop_codon	2326640	2326642	.	+	.	transcript "720"	
Adh	FGenesCGG3	CDS	2328290	2328403	.	-	.	transcript "721"	
Adh	FGenesCGG3	stop_codon	2328290	2328292	.	-	.	transcript "721"	
Adh	FGenesCGG3	CDS	2328611	2329967	.	-	.	transcript "721"	
Adh	FGenesCGG3	CDS	2330026	2330181	.	-	.	transcript "721"	
Adh	FGenesCGG3	CDS	2330235	2330353	.	-	.	transcript "721"	
Adh	FGenesCGG3	CDS	2331101	2331310	.	-	.	transcript "721"	
Adh	FGenesCGG3	start_codon	2331308	2331310	.	-	.	transcript "721"	
Adh	FGenesCGG3	CDS	2328290	2328403	.	-	.	transcript "722"	
Adh	FGenesCGG3	stop_codon	2328290	2328292	.	-	.	transcript "722"	
Adh	FGenesCGG3	CDS	2328611	2328712	.	-	.	transcript "722"	
Adh	FGenesCGG3	CDS	2329400	2329751	.	-	.	transcript "722"	
Adh	FGenesCGG3	CDS	2330026	2330135	.	-	.	transcript "722"	
Adh	FGenesCGG3	start_codon	2330133	2330135	.	-	.	transcript "722"	
Adh	FGenesCGG3	CDS	2333538	2333675	.	-	.	transcript "723"	
Adh	FGenesCGG3	stop_codon	2333538	2333540	.	-	.	transcript "723"	
Adh	FGenesCGG3	CDS	2333741	2333848	.	-	.	transcript "723"	
Adh	FGenesCGG3	start_codon	2333846	2333848	.	-	.	transcript "723"	
Adh	FGenesCGG3	CDS	2333538	2333675	.	-	.	transcript "724"	
Adh	FGenesCGG3	stop_codon	2333538	2333540	.	-	.	transcript "724"	
Adh	FGenesCGG3	CDS	2333741	2333848	.	-	.	transcript "724"	
Adh	FGenesCGG3	start_codon	2333846	2333848	.	-	.	transcript "724"	
Adh	FGenesCGG3	CDS	2334703	2334741	.	+	.	transcript "725"	
Adh	FGenesCGG3	start_codon	2334703	2334705	.	+	.	transcript "725"	
Adh	FGenesCGG3	CDS	2337060	2337081	.	+	.	transcript "725"	
Adh	FGenesCGG3	CDS	2337332	2337479	.	+	.	transcript "725"	
Adh	FGenesCGG3	CDS	2338580	2339258	.	+	.	transcript "725"	
Adh	FGenesCGG3	stop_codon	2339256	2339258	.	+	.	transcript "725"	
Adh	FGenesCGG3	CDS	2335716	2335977	.	+	.	transcript "726"	
Adh	FGenesCGG3	start_codon	2335716	2335718	.	+	.	transcript "726"	
Adh	FGenesCGG3	CDS	2338239	2338498	.	+	.	transcript "726"	
Adh	FGenesCGG3	CDS	2338580	2338789	.	+	.	transcript "726"	
Adh	FGenesCGG3	stop_codon	2338787	2338789	.	+	.	transcript "726"	
Adh	FGenesCGG3	CDS	2339377	2340420	.	-	.	transcript "727"	
Adh	FGenesCGG3	stop_codon	2339377	2339379	.	-	.	transcript "727"	
Adh	FGenesCGG3	CDS	2340535	2341630	.	-	.	transcript "727"	
Adh	FGenesCGG3	CDS	2341682	2341790	.	-	.	transcript "727"	
Adh	FGenesCGG3	CDS	2341855	2341911	.	-	.	transcript "727"	
Adh	FGenesCGG3	CDS	2341973	2341993	.	-	.	transcript "727"	
Adh	FGenesCGG3	CDS	2342049	2342274	.	-	.	transcript "727"	
Adh	FGenesCGG3	CDS	2342341	2342602	.	-	.	transcript "727"	
Adh	FGenesCGG3	CDS	2342664	2343851	.	-	.	transcript "727"	
Adh	FGenesCGG3	CDS	2344801	2344922	.	-	.	transcript "727"	
Adh	FGenesCGG3	CDS	2345026	2345085	.	-	.	transcript "727"	
Adh	FGenesCGG3	start_codon	2345083	2345085	.	-	.	transcript "727"	
Adh	FGenesCGG3	CDS	2339377	2339919	.	-	.	transcript "728"	
Adh	FGenesCGG3	stop_codon	2339377	2339379	.	-	.	transcript "728"	
Adh	FGenesCGG3	CDS	2339965	2340420	.	-	.	transcript "728"	
Adh	FGenesCGG3	CDS	2340535	2341102	.	-	.	transcript "728"	
Adh	FGenesCGG3	CDS	2341682	2341790	.	-	.	transcript "728"	
Adh	FGenesCGG3	CDS	2341855	2341911	.	-	.	transcript "728"	
Adh	FGenesCGG3	CDS	2342049	2342274	.	-	.	transcript "728"	
Adh	FGenesCGG3	CDS	2342341	2342602	.	-	.	transcript "728"	
Adh	FGenesCGG3	CDS	2342664	2342801	.	-	.	transcript "728"	
Adh	FGenesCGG3	CDS	2343282	2343851	.	-	.	transcript "728"	
Adh	FGenesCGG3	CDS	2345479	2345612	.	-	.	transcript "728"	
Adh	FGenesCGG3	start_codon	2345610	2345612	.	-	.	transcript "728"	
Adh	FGenesCGG3	CDS	2345614	2345681	.	+	.	transcript "729"	
Adh	FGenesCGG3	start_codon	2345614	2345616	.	+	.	transcript "729"	
Adh	FGenesCGG3	CDS	2346544	2346942	.	+	.	transcript "729"	
Adh	FGenesCGG3	CDS	2347013	2347323	.	+	.	transcript "729"	
Adh	FGenesCGG3	CDS	2347420	2347473	.	+	.	transcript "729"	
Adh	FGenesCGG3	CDS	2348527	2348545	.	+	.	transcript "729"	
Adh	FGenesCGG3	CDS	2348812	2348821	.	+	.	transcript "729"	
Adh	FGenesCGG3	stop_codon	2348819	2348821	.	+	.	transcript "729"	
Adh	FGenesCGG3	CDS	2347047	2347323	.	+	.	transcript "730"	
Adh	FGenesCGG3	start_codon	2347047	2347049	.	+	.	transcript "730"	
Adh	FGenesCGG3	CDS	2347420	2347676	.	+	.	transcript "730"	
Adh	FGenesCGG3	stop_codon	2347674	2347676	.	+	.	transcript "730"	
Adh	FGenesCGG3	CDS	2348982	2349115	.	-	.	transcript "731"	
Adh	FGenesCGG3	stop_codon	2348982	2348984	.	-	.	transcript "731"	
Adh	FGenesCGG3	CDS	2349859	2349928	.	-	.	transcript "731"	
Adh	FGenesCGG3	CDS	2351995	2352026	.	-	.	transcript "731"	
Adh	FGenesCGG3	CDS	2352080	2352190	.	-	.	transcript "731"	
Adh	FGenesCGG3	CDS	2356993	2357164	.	-	.	transcript "731"	
Adh	FGenesCGG3	CDS	2357224	2357346	.	-	.	transcript "731"	
Adh	FGenesCGG3	CDS	2357543	2357674	.	-	.	transcript "731"	
Adh	FGenesCGG3	CDS	2358742	2358953	.	-	.	transcript "731"	
Adh	FGenesCGG3	CDS	2360543	2360594	.	-	.	transcript "731"	
Adh	FGenesCGG3	start_codon	2360592	2360594	.	-	.	transcript "731"	
Adh	FGenesCGG3	CDS	2349595	2349890	.	-	.	transcript "732"	
Adh	FGenesCGG3	stop_codon	2349595	2349597	.	-	.	transcript "732"	
Adh	FGenesCGG3	CDS	2349968	2350879	.	-	.	transcript "732"	
Adh	FGenesCGG3	CDS	2351363	2351376	.	-	.	transcript "732"	
Adh	FGenesCGG3	CDS	2351765	2352026	.	-	.	transcript "732"	
Adh	FGenesCGG3	CDS	2352080	2353053	.	-	.	transcript "732"	
Adh	FGenesCGG3	CDS	2353442	2353506	.	-	.	transcript "732"	
Adh	FGenesCGG3	start_codon	2353504	2353506	.	-	.	transcript "732"	
Adh	FGenesCGG3	CDS	2356352	2356488	.	-	.	transcript "733"	
Adh	FGenesCGG3	stop_codon	2356352	2356354	.	-	.	transcript "733"	
Adh	FGenesCGG3	CDS	2356993	2357164	.	-	.	transcript "733"	
Adh	FGenesCGG3	CDS	2357224	2357495	.	-	.	transcript "733"	
Adh	FGenesCGG3	CDS	2357539	2357674	.	-	.	transcript "733"	
Adh	FGenesCGG3	CDS	2358742	2358953	.	-	.	transcript "733"	
Adh	FGenesCGG3	CDS	2359791	2359824	.	-	.	transcript "733"	
Adh	FGenesCGG3	start_codon	2359822	2359824	.	-	.	transcript "733"	
Adh	FGenesCGG3	CDS	2362427	2362591	.	-	.	transcript "734"	
Adh	FGenesCGG3	stop_codon	2362427	2362429	.	-	.	transcript "734"	
Adh	FGenesCGG3	CDS	2365363	2365383	.	-	.	transcript "734"	
Adh	FGenesCGG3	start_codon	2365381	2365383	.	-	.	transcript "734"	
Adh	FGenesCGG3	CDS	2365121	2365132	.	+	.	transcript "735"	
Adh	FGenesCGG3	start_codon	2365121	2365123	.	+	.	transcript "735"	
Adh	FGenesCGG3	CDS	2365172	2365471	.	+	.	transcript "735"	
Adh	FGenesCGG3	stop_codon	2365469	2365471	.	+	.	transcript "735"	
Adh	FGenesCGG3	CDS	2365908	2365956	.	-	.	transcript "736"	
Adh	FGenesCGG3	stop_codon	2365908	2365910	.	-	.	transcript "736"	
Adh	FGenesCGG3	CDS	2366015	2366148	.	-	.	transcript "736"	
Adh	FGenesCGG3	start_codon	2366146	2366148	.	-	.	transcript "736"	
Adh	FGenesCGG3	CDS	2366992	2366996	.	+	.	transcript "737"	
Adh	FGenesCGG3	start_codon	2366992	2366994	.	+	.	transcript "737"	
Adh	FGenesCGG3	CDS	2367795	2368068	.	+	.	transcript "737"	
Adh	FGenesCGG3	stop_codon	2368066	2368068	.	+	.	transcript "737"	
Adh	FGenesCGG3	CDS	2367613	2367685	.	+	.	transcript "738"	
Adh	FGenesCGG3	start_codon	2367613	2367615	.	+	.	transcript "738"	
Adh	FGenesCGG3	CDS	2369947	2370155	.	+	.	transcript "738"	
Adh	FGenesCGG3	stop_codon	2370153	2370155	.	+	.	transcript "738"	
Adh	FGenesCGG3	CDS	2369370	2369660	.	+	.	transcript "739"	
Adh	FGenesCGG3	start_codon	2369370	2369372	.	+	.	transcript "739"	
Adh	FGenesCGG3	stop_codon	2369658	2369660	.	+	.	transcript "739"	
Adh	FGenesCGG3	CDS	2370938	2371224	.	-	.	transcript "740"	
Adh	FGenesCGG3	stop_codon	2370938	2370940	.	-	.	transcript "740"	
Adh	FGenesCGG3	CDS	2372488	2372584	.	-	.	transcript "740"	
Adh	FGenesCGG3	start_codon	2372582	2372584	.	-	.	transcript "740"	
Adh	FGenesCGG3	CDS	2370938	2371207	.	-	.	transcript "741"	
Adh	FGenesCGG3	start_codon	2371205	2371207	.	-	.	transcript "741"	
Adh	FGenesCGG3	stop_codon	2370938	2370940	.	-	.	transcript "741"	
Adh	FGenesCGG3	CDS	2371986	2372032	.	+	.	transcript "742"	
Adh	FGenesCGG3	start_codon	2371986	2371988	.	+	.	transcript "742"	
Adh	FGenesCGG3	CDS	2372631	2372919	.	+	.	transcript "742"	
Adh	FGenesCGG3	stop_codon	2372917	2372919	.	+	.	transcript "742"	
Adh	FGenesCGG3	CDS	2374085	2374324	.	+	.	transcript "743"	
Adh	FGenesCGG3	start_codon	2374085	2374087	.	+	.	transcript "743"	
Adh	FGenesCGG3	CDS	2374356	2376636	.	+	.	transcript "743"	
Adh	FGenesCGG3	CDS	2376903	2376916	.	+	.	transcript "743"	
Adh	FGenesCGG3	stop_codon	2376914	2376916	.	+	.	transcript "743"	
Adh	FGenesCGG3	CDS	2374323	2376878	.	+	.	transcript "744"	
Adh	FGenesCGG3	start_codon	2374323	2374325	.	+	.	transcript "744"	
Adh	FGenesCGG3	stop_codon	2376876	2376878	.	+	.	transcript "744"	
Adh	FGenesCGG3	CDS	2377464	2377673	.	-	.	transcript "745"	
Adh	FGenesCGG3	start_codon	2377671	2377673	.	-	.	transcript "745"	
Adh	FGenesCGG3	stop_codon	2377464	2377466	.	-	.	transcript "745"	
Adh	FGenesCGG3	CDS	2388666	2388811	.	-	.	transcript "746"	
Adh	FGenesCGG3	stop_codon	2388666	2388668	.	-	.	transcript "746"	
Adh	FGenesCGG3	CDS	2390039	2390108	.	-	.	transcript "746"	
Adh	FGenesCGG3	start_codon	2390106	2390108	.	-	.	transcript "746"	
Adh	FGenesCGG3	CDS	2391676	2391819	.	+	.	transcript "747"	
Adh	FGenesCGG3	start_codon	2391676	2391678	.	+	.	transcript "747"	
Adh	FGenesCGG3	CDS	2392136	2392737	.	+	.	transcript "747"	
Adh	FGenesCGG3	CDS	2392800	2393095	.	+	.	transcript "747"	
Adh	FGenesCGG3	CDS	2393155	2393360	.	+	.	transcript "747"	
Adh	FGenesCGG3	stop_codon	2393358	2393360	.	+	.	transcript "747"	
Adh	FGenesCGG3	CDS	2392553	2392737	.	+	.	transcript "748"	
Adh	FGenesCGG3	start_codon	2392553	2392555	.	+	.	transcript "748"	
Adh	FGenesCGG3	CDS	2392800	2393095	.	+	.	transcript "748"	
Adh	FGenesCGG3	CDS	2393155	2393333	.	+	.	transcript "748"	
Adh	FGenesCGG3	CDS	2397806	2397864	.	+	.	transcript "748"	
Adh	FGenesCGG3	CDS	2398534	2398819	.	+	.	transcript "748"	
Adh	FGenesCGG3	stop_codon	2398817	2398819	.	+	.	transcript "748"	
Adh	FGenesCGG3	CDS	2394140	2394451	.	-	.	transcript "749"	
Adh	FGenesCGG3	stop_codon	2394140	2394142	.	-	.	transcript "749"	
Adh	FGenesCGG3	CDS	2394576	2394629	.	-	.	transcript "749"	
Adh	FGenesCGG3	start_codon	2394627	2394629	.	-	.	transcript "749"	
Adh	FGenesCGG3	CDS	2400780	2400843	.	+	.	transcript "750"	
Adh	FGenesCGG3	start_codon	2400780	2400782	.	+	.	transcript "750"	
Adh	FGenesCGG3	CDS	2402303	2402354	.	+	.	transcript "750"	
Adh	FGenesCGG3	CDS	2407292	2407393	.	+	.	transcript "750"	
Adh	FGenesCGG3	CDS	2407456	2407845	.	+	.	transcript "750"	
Adh	FGenesCGG3	CDS	2407960	2408288	.	+	.	transcript "750"	
Adh	FGenesCGG3	CDS	2408358	2408611	.	+	.	transcript "750"	
Adh	FGenesCGG3	stop_codon	2408609	2408611	.	+	.	transcript "750"	
Adh	FGenesCGG3	CDS	2400780	2400843	.	+	.	transcript "751"	
Adh	FGenesCGG3	start_codon	2400780	2400782	.	+	.	transcript "751"	
Adh	FGenesCGG3	CDS	2401763	2401771	.	+	.	transcript "751"	
Adh	FGenesCGG3	CDS	2402980	2403026	.	+	.	transcript "751"	
Adh	FGenesCGG3	stop_codon	2403024	2403026	.	+	.	transcript "751"	
Adh	FGenesCGG3	CDS	2407202	2407236	.	+	.	transcript "752"	
Adh	FGenesCGG3	start_codon	2407202	2407204	.	+	.	transcript "752"	
Adh	FGenesCGG3	CDS	2407292	2407393	.	+	.	transcript "752"	
Adh	FGenesCGG3	CDS	2407447	2407845	.	+	.	transcript "752"	
Adh	FGenesCGG3	CDS	2407960	2408288	.	+	.	transcript "752"	
Adh	FGenesCGG3	CDS	2408358	2408611	.	+	.	transcript "752"	
Adh	FGenesCGG3	stop_codon	2408609	2408611	.	+	.	transcript "752"	
Adh	FGenesCGG3	CDS	2409196	2409250	.	-	.	transcript "753"	
Adh	FGenesCGG3	stop_codon	2409196	2409198	.	-	.	transcript "753"	
Adh	FGenesCGG3	CDS	2410287	2410349	.	-	.	transcript "753"	
Adh	FGenesCGG3	CDS	2414488	2414663	.	-	.	transcript "753"	
Adh	FGenesCGG3	start_codon	2414661	2414663	.	-	.	transcript "753"	
Adh	FGenesCGG3	CDS	2414352	2414531	.	-	.	transcript "754"	
Adh	FGenesCGG3	stop_codon	2414352	2414354	.	-	.	transcript "754"	
Adh	FGenesCGG3	CDS	2415472	2415600	.	-	.	transcript "754"	
Adh	FGenesCGG3	start_codon	2415598	2415600	.	-	.	transcript "754"	
Adh	FGenesCGG3	CDS	2415482	2415817	.	+	.	transcript "755"	
Adh	FGenesCGG3	start_codon	2415482	2415484	.	+	.	transcript "755"	
Adh	FGenesCGG3	CDS	2417682	2417822	.	+	.	transcript "755"	
Adh	FGenesCGG3	stop_codon	2417820	2417822	.	+	.	transcript "755"	
Adh	FGenesCGG3	CDS	2418628	2418751	.	+	.	transcript "756"	
Adh	FGenesCGG3	start_codon	2418628	2418630	.	+	.	transcript "756"	
Adh	FGenesCGG3	CDS	2420241	2420297	.	+	.	transcript "756"	
Adh	FGenesCGG3	CDS	2424440	2424492	.	+	.	transcript "756"	
Adh	FGenesCGG3	CDS	2427632	2427808	.	+	.	transcript "756"	
Adh	FGenesCGG3	stop_codon	2427806	2427808	.	+	.	transcript "756"	
Adh	FGenesCGG3	CDS	2421375	2421629	.	-	.	transcript "757"	
Adh	FGenesCGG3	start_codon	2421627	2421629	.	-	.	transcript "757"	
Adh	FGenesCGG3	stop_codon	2421375	2421377	.	-	.	transcript "757"	
Adh	FGenesCGG3	CDS	2428833	2429381	.	+	.	transcript "758"	
Adh	FGenesCGG3	start_codon	2428833	2428835	.	+	.	transcript "758"	
Adh	FGenesCGG3	stop_codon	2429379	2429381	.	+	.	transcript "758"	
Adh	FGenesCGG3	CDS	2429192	2429367	.	-	.	transcript "759"	
Adh	FGenesCGG3	stop_codon	2429192	2429194	.	-	.	transcript "759"	
Adh	FGenesCGG3	CDS	2436908	2437046	.	-	.	transcript "759"	
Adh	FGenesCGG3	start_codon	2437044	2437046	.	-	.	transcript "759"	
Adh	FGenesCGG3	CDS	2439978	2440098	.	+	.	transcript "760"	
Adh	FGenesCGG3	start_codon	2439978	2439980	.	+	.	transcript "760"	
Adh	FGenesCGG3	CDS	2444164	2444213	.	+	.	transcript "760"	
Adh	FGenesCGG3	CDS	2445360	2445435	.	+	.	transcript "760"	
Adh	FGenesCGG3	CDS	2445792	2445848	.	+	.	transcript "760"	
Adh	FGenesCGG3	CDS	2449650	2449792	.	+	.	transcript "760"	
Adh	FGenesCGG3	stop_codon	2449790	2449792	.	+	.	transcript "760"	
Adh	FGenesCGG3	CDS	2445489	2445494	.	+	.	transcript "761"	
Adh	FGenesCGG3	start_codon	2445489	2445491	.	+	.	transcript "761"	
Adh	FGenesCGG3	CDS	2445792	2445848	.	+	.	transcript "761"	
Adh	FGenesCGG3	CDS	2446577	2446681	.	+	.	transcript "761"	
Adh	FGenesCGG3	stop_codon	2446679	2446681	.	+	.	transcript "761"	
Adh	FGenesCGG3	CDS	2449548	2449879	.	-	.	transcript "762"	
Adh	FGenesCGG3	stop_codon	2449548	2449550	.	-	.	transcript "762"	
Adh	FGenesCGG3	CDS	2452399	2452705	.	-	.	transcript "762"	
Adh	FGenesCGG3	start_codon	2452703	2452705	.	-	.	transcript "762"	
Adh	FGenesCGG3	CDS	2450961	2450977	.	+	.	transcript "763"	
Adh	FGenesCGG3	start_codon	2450961	2450963	.	+	.	transcript "763"	
Adh	FGenesCGG3	CDS	2451225	2451400	.	+	.	transcript "763"	
Adh	FGenesCGG3	CDS	2451457	2451572	.	+	.	transcript "763"	
Adh	FGenesCGG3	stop_codon	2451570	2451572	.	+	.	transcript "763"	
Adh	FGenesCGG3	CDS	2453955	2454115	.	+	.	transcript "764"	
Adh	FGenesCGG3	start_codon	2453955	2453957	.	+	.	transcript "764"	
Adh	FGenesCGG3	CDS	2454348	2454498	.	+	.	transcript "764"	
Adh	FGenesCGG3	stop_codon	2454496	2454498	.	+	.	transcript "764"	
Adh	FGenesCGG3	CDS	2454209	2454275	.	+	.	transcript "765"	
Adh	FGenesCGG3	start_codon	2454209	2454211	.	+	.	transcript "765"	
Adh	FGenesCGG3	CDS	2458269	2458406	.	+	.	transcript "765"	
Adh	FGenesCGG3	CDS	2458487	2458537	.	+	.	transcript "765"	
Adh	FGenesCGG3	CDS	2460093	2460229	.	+	.	transcript "765"	
Adh	FGenesCGG3	stop_codon	2460227	2460229	.	+	.	transcript "765"	
Adh	FGenesCGG3	CDS	2461004	2461079	.	-	.	transcript "766"	
Adh	FGenesCGG3	stop_codon	2461004	2461006	.	-	.	transcript "766"	
Adh	FGenesCGG3	CDS	2461126	2461214	.	-	.	transcript "766"	
Adh	FGenesCGG3	CDS	2464913	2464957	.	-	.	transcript "766"	
Adh	FGenesCGG3	start_codon	2464955	2464957	.	-	.	transcript "766"	
Adh	FGenesCGG3	CDS	2462232	2462239	.	+	.	transcript "767"	
Adh	FGenesCGG3	start_codon	2462232	2462234	.	+	.	transcript "767"	
Adh	FGenesCGG3	CDS	2463403	2463547	.	+	.	transcript "767"	
Adh	FGenesCGG3	CDS	2463909	2463968	.	+	.	transcript "767"	
Adh	FGenesCGG3	stop_codon	2463966	2463968	.	+	.	transcript "767"	
Adh	FGenesCGG3	CDS	2465772	2465965	.	+	.	transcript "768"	
Adh	FGenesCGG3	start_codon	2465772	2465774	.	+	.	transcript "768"	
Adh	FGenesCGG3	CDS	2466655	2466742	.	+	.	transcript "768"	
Adh	FGenesCGG3	stop_codon	2466740	2466742	.	+	.	transcript "768"	
Adh	FGenesCGG3	CDS	2468501	2468536	.	+	.	transcript "769"	
Adh	FGenesCGG3	start_codon	2468501	2468503	.	+	.	transcript "769"	
Adh	FGenesCGG3	CDS	2473988	2474080	.	+	.	transcript "769"	
Adh	FGenesCGG3	CDS	2479652	2479721	.	+	.	transcript "769"	
Adh	FGenesCGG3	CDS	2481639	2481850	.	+	.	transcript "769"	
Adh	FGenesCGG3	CDS	2483447	2483582	.	+	.	transcript "769"	
Adh	FGenesCGG3	CDS	2483839	2484080	.	+	.	transcript "769"	
Adh	FGenesCGG3	stop_codon	2484078	2484080	.	+	.	transcript "769"	
Adh	FGenesCGG3	CDS	2480542	2480707	.	+	.	transcript "770"	
Adh	FGenesCGG3	start_codon	2480542	2480544	.	+	.	transcript "770"	
Adh	FGenesCGG3	CDS	2481639	2481850	.	+	.	transcript "770"	
Adh	FGenesCGG3	CDS	2483447	2483582	.	+	.	transcript "770"	
Adh	FGenesCGG3	CDS	2483839	2483972	.	+	.	transcript "770"	
Adh	FGenesCGG3	CDS	2484693	2484860	.	+	.	transcript "770"	
Adh	FGenesCGG3	CDS	2486400	2486522	.	+	.	transcript "770"	
Adh	FGenesCGG3	CDS	2486596	2486785	.	+	.	transcript "770"	
Adh	FGenesCGG3	CDS	2488134	2488789	.	+	.	transcript "770"	
Adh	FGenesCGG3	stop_codon	2488787	2488789	.	+	.	transcript "770"	
Adh	FGenesCGG3	CDS	2484964	2485146	.	+	.	transcript "771"	
Adh	FGenesCGG3	start_codon	2484964	2484966	.	+	.	transcript "771"	
Adh	FGenesCGG3	CDS	2486400	2486522	.	+	.	transcript "771"	
Adh	FGenesCGG3	CDS	2486596	2486785	.	+	.	transcript "771"	
Adh	FGenesCGG3	CDS	2488134	2488789	.	+	.	transcript "771"	
Adh	FGenesCGG3	stop_codon	2488787	2488789	.	+	.	transcript "771"	
Adh	FGenesCGG3	CDS	2493314	2493620	.	+	.	transcript "772"	
Adh	FGenesCGG3	start_codon	2493314	2493316	.	+	.	transcript "772"	
Adh	FGenesCGG3	CDS	2493682	2493731	.	+	.	transcript "772"	
Adh	FGenesCGG3	CDS	2494047	2494116	.	+	.	transcript "772"	
Adh	FGenesCGG3	CDS	2494180	2494259	.	+	.	transcript "772"	
Adh	FGenesCGG3	CDS	2494325	2494651	.	+	.	transcript "772"	
Adh	FGenesCGG3	CDS	2495100	2495225	.	+	.	transcript "772"	
Adh	FGenesCGG3	CDS	2495286	2495667	.	+	.	transcript "772"	
Adh	FGenesCGG3	CDS	2495861	2496988	.	+	.	transcript "772"	
Adh	FGenesCGG3	CDS	2497217	2497464	.	+	.	transcript "772"	
Adh	FGenesCGG3	stop_codon	2497462	2497464	.	+	.	transcript "772"	
Adh	FGenesCGG3	CDS	2498140	2498225	.	+	.	transcript "773"	
Adh	FGenesCGG3	start_codon	2498140	2498142	.	+	.	transcript "773"	
Adh	FGenesCGG3	stop_codon	2498223	2498225	.	+	.	transcript "773"	
Adh	FGenesCGG3	CDS	2505534	2505597	.	+	.	transcript "774"	
Adh	FGenesCGG3	start_codon	2505534	2505536	.	+	.	transcript "774"	
Adh	FGenesCGG3	CDS	2524357	2524565	.	+	.	transcript "774"	
Adh	FGenesCGG3	CDS	2525929	2526064	.	+	.	transcript "774"	
Adh	FGenesCGG3	CDS	2527415	2527548	.	+	.	transcript "774"	
Adh	FGenesCGG3	CDS	2529073	2529195	.	+	.	transcript "774"	
Adh	FGenesCGG3	CDS	2529260	2529455	.	+	.	transcript "774"	
Adh	FGenesCGG3	CDS	2529735	2530156	.	+	.	transcript "774"	
Adh	FGenesCGG3	stop_codon	2530154	2530156	.	+	.	transcript "774"	
Adh	FGenesCGG3	CDS	2543484	2543523	.	-	.	transcript "775"	
Adh	FGenesCGG3	stop_codon	2543484	2543486	.	-	.	transcript "775"	
Adh	FGenesCGG3	CDS	2545664	2545920	.	-	.	transcript "775"	
Adh	FGenesCGG3	CDS	2546581	2546780	.	-	.	transcript "775"	
Adh	FGenesCGG3	CDS	2549514	2549619	.	-	.	transcript "775"	
Adh	FGenesCGG3	start_codon	2549617	2549619	.	-	.	transcript "775"	
Adh	FGenesCGG3	CDS	2544295	2545124	.	+	.	transcript "776"	
Adh	FGenesCGG3	start_codon	2544295	2544297	.	+	.	transcript "776"	
Adh	FGenesCGG3	CDS	2545309	2545387	.	+	.	transcript "776"	
Adh	FGenesCGG3	stop_codon	2545385	2545387	.	+	.	transcript "776"	
Adh	FGenesCGG3	CDS	2554336	2554403	.	+	.	transcript "777"	
Adh	FGenesCGG3	start_codon	2554336	2554338	.	+	.	transcript "777"	
Adh	FGenesCGG3	CDS	2562534	2562798	.	+	.	transcript "777"	
Adh	FGenesCGG3	stop_codon	2562796	2562798	.	+	.	transcript "777"	
Adh	FGenesCGG3	CDS	2555594	2555861	.	-	.	transcript "778"	
Adh	FGenesCGG3	stop_codon	2555594	2555596	.	-	.	transcript "778"	
Adh	FGenesCGG3	CDS	2556218	2556261	.	-	.	transcript "778"	
Adh	FGenesCGG3	start_codon	2556259	2556261	.	-	.	transcript "778"	
Adh	FGenesCGG3	CDS	2569149	2569180	.	+	.	transcript "779"	
Adh	FGenesCGG3	start_codon	2569149	2569151	.	+	.	transcript "779"	
Adh	FGenesCGG3	CDS	2569457	2569589	.	+	.	transcript "779"	
Adh	FGenesCGG3	stop_codon	2569587	2569589	.	+	.	transcript "779"	
Adh	FGenesCGG3	CDS	2571734	2571827	.	-	.	transcript "780"	
Adh	FGenesCGG3	stop_codon	2571734	2571736	.	-	.	transcript "780"	
Adh	FGenesCGG3	CDS	2577184	2577290	.	-	.	transcript "780"	
Adh	FGenesCGG3	CDS	2579129	2579323	.	-	.	transcript "780"	
Adh	FGenesCGG3	CDS	2580473	2580721	.	-	.	transcript "780"	
Adh	FGenesCGG3	start_codon	2580719	2580721	.	-	.	transcript "780"	
Adh	FGenesCGG3	CDS	2578429	2578595	.	-	.	transcript "781"	
Adh	FGenesCGG3	stop_codon	2578429	2578431	.	-	.	transcript "781"	
Adh	FGenesCGG3	CDS	2578763	2578778	.	-	.	transcript "781"	
Adh	FGenesCGG3	start_codon	2578776	2578778	.	-	.	transcript "781"	
Adh	FGenesCGG3	CDS	2582975	2583547	.	+	.	transcript "782"	
Adh	FGenesCGG3	start_codon	2582975	2582977	.	+	.	transcript "782"	
Adh	FGenesCGG3	stop_codon	2583545	2583547	.	+	.	transcript "782"	
Adh	FGenesCGG3	CDS	2583284	2583361	.	+	.	transcript "783"	
Adh	FGenesCGG3	start_codon	2583284	2583286	.	+	.	transcript "783"	
Adh	FGenesCGG3	CDS	2583401	2583446	.	+	.	transcript "783"	
Adh	FGenesCGG3	CDS	2588736	2588803	.	+	.	transcript "783"	
Adh	FGenesCGG3	CDS	2591903	2592084	.	+	.	transcript "783"	
Adh	FGenesCGG3	CDS	2592491	2594357	.	+	.	transcript "783"	
Adh	FGenesCGG3	stop_codon	2594355	2594357	.	+	.	transcript "783"	
Adh	FGenesCGG3	CDS	2584077	2584353	.	-	.	transcript "784"	
Adh	FGenesCGG3	stop_codon	2584077	2584079	.	-	.	transcript "784"	
Adh	FGenesCGG3	CDS	2584421	2584453	.	-	.	transcript "784"	
Adh	FGenesCGG3	CDS	2585086	2585177	.	-	.	transcript "784"	
Adh	FGenesCGG3	start_codon	2585175	2585177	.	-	.	transcript "784"	
Adh	FGenesCGG3	CDS	2590910	2591237	.	+	.	transcript "785"	
Adh	FGenesCGG3	start_codon	2590910	2590912	.	+	.	transcript "785"	
Adh	FGenesCGG3	CDS	2591682	2592084	.	+	.	transcript "785"	
Adh	FGenesCGG3	CDS	2594131	2594140	.	+	.	transcript "785"	
Adh	FGenesCGG3	stop_codon	2594138	2594140	.	+	.	transcript "785"	
Adh	FGenesCGG3	CDS	2595467	2595538	.	-	.	transcript "786"	
Adh	FGenesCGG3	stop_codon	2595467	2595469	.	-	.	transcript "786"	
Adh	FGenesCGG3	CDS	2597248	2597299	.	-	.	transcript "786"	
Adh	FGenesCGG3	CDS	2597822	2598057	.	-	.	transcript "786"	
Adh	FGenesCGG3	start_codon	2598055	2598057	.	-	.	transcript "786"	
Adh	FGenesCGG3	CDS	2595904	2596179	.	-	.	transcript "787"	
Adh	FGenesCGG3	start_codon	2596177	2596179	.	-	.	transcript "787"	
Adh	FGenesCGG3	stop_codon	2595904	2595906	.	-	.	transcript "787"	
Adh	FGenesCGG3	CDS	2597332	2597479	.	-	.	transcript "788"	
Adh	FGenesCGG3	stop_codon	2597332	2597334	.	-	.	transcript "788"	
Adh	FGenesCGG3	CDS	2597822	2598019	.	-	.	transcript "788"	
Adh	FGenesCGG3	CDS	2598863	2598873	.	-	.	transcript "788"	
Adh	FGenesCGG3	start_codon	2598871	2598873	.	-	.	transcript "788"	
Adh	FGenesCGG3	CDS	2604868	2607939	.	-	.	transcript "789"	
Adh	FGenesCGG3	start_codon	2607937	2607939	.	-	.	transcript "789"	
Adh	FGenesCGG3	stop_codon	2604868	2604870	.	-	.	transcript "789"	
Adh	FGenesCGG3	CDS	2607999	2609243	.	-	.	transcript "790"	
Adh	FGenesCGG3	start_codon	2609241	2609243	.	-	.	transcript "790"	
Adh	FGenesCGG3	stop_codon	2607999	2608001	.	-	.	transcript "790"	
Adh	FGenesCGG3	CDS	2609738	2609955	.	-	.	transcript "791"	
Adh	FGenesCGG3	stop_codon	2609738	2609740	.	-	.	transcript "791"	
Adh	FGenesCGG3	CDS	2610787	2610919	.	-	.	transcript "791"	
Adh	FGenesCGG3	start_codon	2610917	2610919	.	-	.	transcript "791"	
Adh	FGenesCGG3	CDS	2609911	2609955	.	-	.	transcript "792"	
Adh	FGenesCGG3	stop_codon	2609911	2609913	.	-	.	transcript "792"	
Adh	FGenesCGG3	CDS	2610337	2610462	.	-	.	transcript "792"	
Adh	FGenesCGG3	start_codon	2610460	2610462	.	-	.	transcript "792"	
Adh	FGenesCGG3	CDS	2610624	2610673	.	-	.	transcript "793"	
Adh	FGenesCGG3	stop_codon	2610624	2610626	.	-	.	transcript "793"	
Adh	FGenesCGG3	CDS	2611621	2611652	.	-	.	transcript "793"	
Adh	FGenesCGG3	CDS	2612372	2612738	.	-	.	transcript "793"	
Adh	FGenesCGG3	CDS	2613845	2613936	.	-	.	transcript "793"	
Adh	FGenesCGG3	CDS	2614085	2614126	.	-	.	transcript "793"	
Adh	FGenesCGG3	CDS	2614407	2614420	.	-	.	transcript "793"	
Adh	FGenesCGG3	start_codon	2614418	2614420	.	-	.	transcript "793"	
Adh	FGenesCGG3	CDS	2611437	2611527	.	+	.	transcript "794"	
Adh	FGenesCGG3	start_codon	2611437	2611439	.	+	.	transcript "794"	
Adh	FGenesCGG3	CDS	2618283	2618419	.	+	.	transcript "794"	
Adh	FGenesCGG3	stop_codon	2618417	2618419	.	+	.	transcript "794"	
Adh	FGenesCGG3	CDS	2619967	2620307	.	+	.	transcript "795"	
Adh	FGenesCGG3	start_codon	2619967	2619969	.	+	.	transcript "795"	
Adh	FGenesCGG3	CDS	2621231	2622507	.	+	.	transcript "795"	
Adh	FGenesCGG3	CDS	2622578	2622803	.	+	.	transcript "795"	
Adh	FGenesCGG3	CDS	2622977	2623082	.	+	.	transcript "795"	
Adh	FGenesCGG3	CDS	2623709	2623781	.	+	.	transcript "795"	
Adh	FGenesCGG3	CDS	2624114	2624266	.	+	.	transcript "795"	
Adh	FGenesCGG3	CDS	2624694	2624875	.	+	.	transcript "795"	
Adh	FGenesCGG3	CDS	2624976	2625495	.	+	.	transcript "795"	
Adh	FGenesCGG3	CDS	2625559	2625784	.	+	.	transcript "795"	
Adh	FGenesCGG3	CDS	2625851	2626052	.	+	.	transcript "795"	
Adh	FGenesCGG3	CDS	2626124	2626333	.	+	.	transcript "795"	
Adh	FGenesCGG3	CDS	2626392	2626510	.	+	.	transcript "795"	
Adh	FGenesCGG3	CDS	2626595	2626653	.	+	.	transcript "795"	
Adh	FGenesCGG3	CDS	2627634	2627751	.	+	.	transcript "795"	
Adh	FGenesCGG3	CDS	2628166	2628295	.	+	.	transcript "795"	
Adh	FGenesCGG3	CDS	2628460	2628626	.	+	.	transcript "795"	
Adh	FGenesCGG3	CDS	2628718	2628805	.	+	.	transcript "795"	
Adh	FGenesCGG3	CDS	2629398	2629505	.	+	.	transcript "795"	
Adh	FGenesCGG3	CDS	2632038	2632090	.	+	.	transcript "795"	
Adh	FGenesCGG3	CDS	2632152	2632298	.	+	.	transcript "795"	
Adh	FGenesCGG3	CDS	2632363	2632834	.	+	.	transcript "795"	
Adh	FGenesCGG3	CDS	2632889	2632972	.	+	.	transcript "795"	
Adh	FGenesCGG3	CDS	2633028	2633093	.	+	.	transcript "795"	
Adh	FGenesCGG3	CDS	2633149	2633337	.	+	.	transcript "795"	
Adh	FGenesCGG3	CDS	2633397	2633645	.	+	.	transcript "795"	
Adh	FGenesCGG3	CDS	2633706	2634365	.	+	.	transcript "795"	
Adh	FGenesCGG3	CDS	2634452	2634885	.	+	.	transcript "795"	
Adh	FGenesCGG3	CDS	2635370	2635410	.	+	.	transcript "795"	
Adh	FGenesCGG3	CDS	2638284	2638414	.	+	.	transcript "795"	
Adh	FGenesCGG3	CDS	2638470	2639006	.	+	.	transcript "795"	
Adh	FGenesCGG3	stop_codon	2639004	2639006	.	+	.	transcript "795"	
Adh	FGenesCGG3	CDS	2643894	2643992	.	-	.	transcript "796"	
Adh	FGenesCGG3	stop_codon	2643894	2643896	.	-	.	transcript "796"	
Adh	FGenesCGG3	CDS	2651612	2651703	.	-	.	transcript "796"	
Adh	FGenesCGG3	CDS	2651787	2651890	.	-	.	transcript "796"	
Adh	FGenesCGG3	CDS	2652007	2652161	.	-	.	transcript "796"	
Adh	FGenesCGG3	start_codon	2652159	2652161	.	-	.	transcript "796"	
Adh	FGenesCGG3	CDS	2651366	2651383	.	+	.	transcript "797"	
Adh	FGenesCGG3	start_codon	2651366	2651368	.	+	.	transcript "797"	
Adh	FGenesCGG3	CDS	2651670	2651894	.	+	.	transcript "797"	
Adh	FGenesCGG3	stop_codon	2651892	2651894	.	+	.	transcript "797"	
Adh	FGenesCGG3	CDS	2654023	2654334	.	-	.	transcript "798"	
Adh	FGenesCGG3	stop_codon	2654023	2654025	.	-	.	transcript "798"	
Adh	FGenesCGG3	CDS	2654553	2654831	.	-	.	transcript "798"	
Adh	FGenesCGG3	CDS	2655328	2655375	.	-	.	transcript "798"	
Adh	FGenesCGG3	CDS	2657978	2658090	.	-	.	transcript "798"	
Adh	FGenesCGG3	CDS	2658302	2658374	.	-	.	transcript "798"	
Adh	FGenesCGG3	start_codon	2658372	2658374	.	-	.	transcript "798"	
Adh	FGenesCGG3	CDS	2659550	2659612	.	+	.	transcript "799"	
Adh	FGenesCGG3	start_codon	2659550	2659552	.	+	.	transcript "799"	
Adh	FGenesCGG3	CDS	2661136	2661318	.	+	.	transcript "799"	
Adh	FGenesCGG3	CDS	2661378	2662292	.	+	.	transcript "799"	
Adh	FGenesCGG3	CDS	2664895	2664990	.	+	.	transcript "799"	
Adh	FGenesCGG3	CDS	2680678	2680784	.	+	.	transcript "799"	
Adh	FGenesCGG3	CDS	2684880	2685693	.	+	.	transcript "799"	
Adh	FGenesCGG3	CDS	2685736	2686209	.	+	.	transcript "799"	
Adh	FGenesCGG3	CDS	2686394	2686570	.	+	.	transcript "799"	
Adh	FGenesCGG3	CDS	2686628	2686705	.	+	.	transcript "799"	
Adh	FGenesCGG3	CDS	2686770	2687146	.	+	.	transcript "799"	
Adh	FGenesCGG3	CDS	2687211	2687359	.	+	.	transcript "799"	
Adh	FGenesCGG3	CDS	2687415	2687920	.	+	.	transcript "799"	
Adh	FGenesCGG3	CDS	2687988	2688230	.	+	.	transcript "799"	
Adh	FGenesCGG3	CDS	2688302	2688395	.	+	.	transcript "799"	
Adh	FGenesCGG3	CDS	2688462	2688883	.	+	.	transcript "799"	
Adh	FGenesCGG3	CDS	2689076	2689183	.	+	.	transcript "799"	
Adh	FGenesCGG3	stop_codon	2689181	2689183	.	+	.	transcript "799"	
Adh	FGenesCGG3	CDS	2660427	2660483	.	+	.	transcript "800"	
Adh	FGenesCGG3	start_codon	2660427	2660429	.	+	.	transcript "800"	
Adh	FGenesCGG3	CDS	2660839	2661318	.	+	.	transcript "800"	
Adh	FGenesCGG3	CDS	2661378	2662292	.	+	.	transcript "800"	
Adh	FGenesCGG3	CDS	2662762	2663049	.	+	.	transcript "800"	
Adh	FGenesCGG3	stop_codon	2663047	2663049	.	+	.	transcript "800"	
Adh	FGenesCGG3	CDS	2664541	2664671	.	-	.	transcript "801"	
Adh	FGenesCGG3	stop_codon	2664541	2664543	.	-	.	transcript "801"	
Adh	FGenesCGG3	CDS	2664725	2664737	.	-	.	transcript "801"	
Adh	FGenesCGG3	start_codon	2664735	2664737	.	-	.	transcript "801"	
Adh	FGenesCGG3	CDS	2671791	2672099	.	-	.	transcript "802"	
Adh	FGenesCGG3	start_codon	2672097	2672099	.	-	.	transcript "802"	
Adh	FGenesCGG3	stop_codon	2671791	2671793	.	-	.	transcript "802"	
Adh	FGenesCGG3	CDS	2673820	2673880	.	+	.	transcript "803"	
Adh	FGenesCGG3	start_codon	2673820	2673822	.	+	.	transcript "803"	
Adh	FGenesCGG3	CDS	2674174	2674421	.	+	.	transcript "803"	
Adh	FGenesCGG3	stop_codon	2674419	2674421	.	+	.	transcript "803"	
Adh	FGenesCGG3	CDS	2681334	2681494	.	+	.	transcript "804"	
Adh	FGenesCGG3	start_codon	2681334	2681336	.	+	.	transcript "804"	
Adh	FGenesCGG3	CDS	2684880	2686209	.	+	.	transcript "804"	
Adh	FGenesCGG3	CDS	2686394	2686570	.	+	.	transcript "804"	
Adh	FGenesCGG3	CDS	2686628	2686705	.	+	.	transcript "804"	
Adh	FGenesCGG3	CDS	2686770	2687146	.	+	.	transcript "804"	
Adh	FGenesCGG3	CDS	2687211	2687359	.	+	.	transcript "804"	
Adh	FGenesCGG3	CDS	2687415	2687920	.	+	.	transcript "804"	
Adh	FGenesCGG3	CDS	2687988	2688230	.	+	.	transcript "804"	
Adh	FGenesCGG3	CDS	2688302	2688395	.	+	.	transcript "804"	
Adh	FGenesCGG3	CDS	2688462	2688883	.	+	.	transcript "804"	
Adh	FGenesCGG3	CDS	2689073	2689183	.	+	.	transcript "804"	
Adh	FGenesCGG3	stop_codon	2689181	2689183	.	+	.	transcript "804"	
Adh	FGenesCGG3	CDS	2691341	2694259	.	+	.	transcript "805"	
Adh	FGenesCGG3	start_codon	2691341	2691343	.	+	.	transcript "805"	
Adh	FGenesCGG3	stop_codon	2694257	2694259	.	+	.	transcript "805"	
Adh	FGenesCGG3	CDS	2696335	2696446	.	-	.	transcript "806"	
Adh	FGenesCGG3	stop_codon	2696335	2696337	.	-	.	transcript "806"	
Adh	FGenesCGG3	CDS	2696513	2696701	.	-	.	transcript "806"	
Adh	FGenesCGG3	CDS	2697862	2698028	.	-	.	transcript "806"	
Adh	FGenesCGG3	CDS	2698091	2698210	.	-	.	transcript "806"	
Adh	FGenesCGG3	start_codon	2698208	2698210	.	-	.	transcript "806"	
Adh	FGenesCGG3	CDS	2701003	2701093	.	+	.	transcript "807"	
Adh	FGenesCGG3	start_codon	2701003	2701005	.	+	.	transcript "807"	
Adh	FGenesCGG3	CDS	2702327	2702447	.	+	.	transcript "807"	
Adh	FGenesCGG3	CDS	2703179	2703470	.	+	.	transcript "807"	
Adh	FGenesCGG3	stop_codon	2703468	2703470	.	+	.	transcript "807"	
Adh	FGenesCGG3	CDS	2703311	2703493	.	+	.	transcript "808"	
Adh	FGenesCGG3	start_codon	2703311	2703313	.	+	.	transcript "808"	
Adh	FGenesCGG3	stop_codon	2703491	2703493	.	+	.	transcript "808"	
Adh	FGenesCGG3	CDS	2707374	2707439	.	+	.	transcript "809"	
Adh	FGenesCGG3	start_codon	2707374	2707376	.	+	.	transcript "809"	
Adh	FGenesCGG3	CDS	2707509	2708522	.	+	.	transcript "809"	
Adh	FGenesCGG3	stop_codon	2708520	2708522	.	+	.	transcript "809"	
Adh	FGenesCGG3	CDS	2707413	2707439	.	+	.	transcript "810"	
Adh	FGenesCGG3	start_codon	2707413	2707415	.	+	.	transcript "810"	
Adh	FGenesCGG3	CDS	2707509	2708522	.	+	.	transcript "810"	
Adh	FGenesCGG3	stop_codon	2708520	2708522	.	+	.	transcript "810"	
Adh	FGenesCGG3	CDS	2709485	2710765	.	-	.	transcript "811"	
Adh	FGenesCGG3	start_codon	2710763	2710765	.	-	.	transcript "811"	
Adh	FGenesCGG3	stop_codon	2709485	2709487	.	-	.	transcript "811"	
Adh	FGenesCGG3	CDS	2711460	2711538	.	+	.	transcript "812"	
Adh	FGenesCGG3	start_codon	2711460	2711462	.	+	.	transcript "812"	
Adh	FGenesCGG3	CDS	2711599	2711717	.	+	.	transcript "812"	
Adh	FGenesCGG3	CDS	2711781	2711853	.	+	.	transcript "812"	
Adh	FGenesCGG3	CDS	2711910	2712440	.	+	.	transcript "812"	
Adh	FGenesCGG3	CDS	2712522	2712646	.	+	.	transcript "812"	
Adh	FGenesCGG3	stop_codon	2712644	2712646	.	+	.	transcript "812"	
Adh	FGenesCGG3	CDS	2712059	2712440	.	+	.	transcript "813"	
Adh	FGenesCGG3	start_codon	2712059	2712061	.	+	.	transcript "813"	
Adh	FGenesCGG3	CDS	2712522	2712646	.	+	.	transcript "813"	
Adh	FGenesCGG3	stop_codon	2712644	2712646	.	+	.	transcript "813"	
Adh	FGenesCGG3	CDS	2714781	2716001	.	-	.	transcript "814"	
Adh	FGenesCGG3	start_codon	2715999	2716001	.	-	.	transcript "814"	
Adh	FGenesCGG3	stop_codon	2714781	2714783	.	-	.	transcript "814"	
Adh	FGenesCGG3	CDS	2714781	2716277	.	-	.	transcript "815"	
Adh	FGenesCGG3	stop_codon	2714781	2714783	.	-	.	transcript "815"	
Adh	FGenesCGG3	CDS	2716683	2716697	.	-	.	transcript "815"	
Adh	FGenesCGG3	start_codon	2716695	2716697	.	-	.	transcript "815"	
Adh	FGenesCGG3	CDS	2717205	2717314	.	-	.	transcript "816"	
Adh	FGenesCGG3	stop_codon	2717205	2717207	.	-	.	transcript "816"	
Adh	FGenesCGG3	CDS	2717614	2717668	.	-	.	transcript "816"	
Adh	FGenesCGG3	start_codon	2717666	2717668	.	-	.	transcript "816"	
Adh	FGenesCGG3	CDS	2719125	2719242	.	+	.	transcript "817"	
Adh	FGenesCGG3	start_codon	2719125	2719127	.	+	.	transcript "817"	
Adh	FGenesCGG3	CDS	2722831	2722961	.	+	.	transcript "817"	
Adh	FGenesCGG3	stop_codon	2722959	2722961	.	+	.	transcript "817"	
Adh	FGenesCGG3	CDS	2725026	2725040	.	-	.	transcript "818"	
Adh	FGenesCGG3	stop_codon	2725026	2725028	.	-	.	transcript "818"	
Adh	FGenesCGG3	CDS	2728123	2728429	.	-	.	transcript "818"	
Adh	FGenesCGG3	CDS	2736358	2736449	.	-	.	transcript "818"	
Adh	FGenesCGG3	start_codon	2736447	2736449	.	-	.	transcript "818"	
Adh	FGenesCGG3	CDS	2727450	2727611	.	-	.	transcript "819"	
Adh	FGenesCGG3	stop_codon	2727450	2727452	.	-	.	transcript "819"	
Adh	FGenesCGG3	CDS	2728123	2728429	.	-	.	transcript "819"	
Adh	FGenesCGG3	CDS	2729070	2729083	.	-	.	transcript "819"	
Adh	FGenesCGG3	start_codon	2729081	2729083	.	-	.	transcript "819"	
Adh	FGenesCGG3	CDS	2731305	2731640	.	+	.	transcript "820"	
Adh	FGenesCGG3	start_codon	2731305	2731307	.	+	.	transcript "820"	
Adh	FGenesCGG3	stop_codon	2731638	2731640	.	+	.	transcript "820"	
Adh	FGenesCGG3	CDS	2735102	2735105	.	-	.	transcript "821"	
Adh	FGenesCGG3	stop_codon	2735102	2735104	.	-	.	transcript "821"	
Adh	FGenesCGG3	CDS	2736358	2736449	.	-	.	transcript "821"	
Adh	FGenesCGG3	start_codon	2736447	2736449	.	-	.	transcript "821"	
Adh	FGenesCGG3	CDS	2737704	2737731	.	+	.	transcript "822"	
Adh	FGenesCGG3	start_codon	2737704	2737706	.	+	.	transcript "822"	
Adh	FGenesCGG3	CDS	2737860	2738132	.	+	.	transcript "822"	
Adh	FGenesCGG3	CDS	2738403	2739461	.	+	.	transcript "822"	
Adh	FGenesCGG3	CDS	2739531	2740039	.	+	.	transcript "822"	
Adh	FGenesCGG3	stop_codon	2740037	2740039	.	+	.	transcript "822"	
Adh	FGenesCGG3	CDS	2737907	2738132	.	+	.	transcript "823"	
Adh	FGenesCGG3	start_codon	2737907	2737909	.	+	.	transcript "823"	
Adh	FGenesCGG3	CDS	2738403	2739055	.	+	.	transcript "823"	
Adh	FGenesCGG3	CDS	2739266	2739461	.	+	.	transcript "823"	
Adh	FGenesCGG3	CDS	2739531	2739970	.	+	.	transcript "823"	
Adh	FGenesCGG3	CDS	2740608	2741090	.	+	.	transcript "823"	
Adh	FGenesCGG3	stop_codon	2741088	2741090	.	+	.	transcript "823"	
Adh	FGenesCGG3	CDS	2740542	2741090	.	+	.	transcript "824"	
Adh	FGenesCGG3	start_codon	2740542	2740544	.	+	.	transcript "824"	
Adh	FGenesCGG3	stop_codon	2741088	2741090	.	+	.	transcript "824"	
Adh	FGenesCGG3	CDS	2741387	2741990	.	-	.	transcript "825"	
Adh	FGenesCGG3	stop_codon	2741387	2741389	.	-	.	transcript "825"	
Adh	FGenesCGG3	CDS	2742220	2742230	.	-	.	transcript "825"	
Adh	FGenesCGG3	start_codon	2742228	2742230	.	-	.	transcript "825"	
Adh	FGenesCGG3	CDS	2741949	2742007	.	+	.	transcript "826"	
Adh	FGenesCGG3	start_codon	2741949	2741951	.	+	.	transcript "826"	
Adh	FGenesCGG3	CDS	2742269	2742500	.	+	.	transcript "826"	
Adh	FGenesCGG3	stop_codon	2742498	2742500	.	+	.	transcript "826"	
Adh	FGenesCGG3	CDS	2743611	2745122	.	+	.	transcript "827"	
Adh	FGenesCGG3	start_codon	2743611	2743613	.	+	.	transcript "827"	
Adh	FGenesCGG3	stop_codon	2745120	2745122	.	+	.	transcript "827"	
Adh	FGenesCGG3	CDS	2743611	2745122	.	+	.	transcript "828"	
Adh	FGenesCGG3	start_codon	2743611	2743613	.	+	.	transcript "828"	
Adh	FGenesCGG3	stop_codon	2745120	2745122	.	+	.	transcript "828"	
Adh	FGenesCGG3	CDS	2746815	2747453	.	-	.	transcript "829"	
Adh	FGenesCGG3	stop_codon	2746815	2746817	.	-	.	transcript "829"	
Adh	FGenesCGG3	CDS	2748132	2748572	.	-	.	transcript "829"	
Adh	FGenesCGG3	start_codon	2748570	2748572	.	-	.	transcript "829"	
Adh	FGenesCGG3	CDS	2746815	2747453	.	-	.	transcript "830"	
Adh	FGenesCGG3	stop_codon	2746815	2746817	.	-	.	transcript "830"	
Adh	FGenesCGG3	CDS	2748132	2748373	.	-	.	transcript "830"	
Adh	FGenesCGG3	CDS	2748503	2748572	.	-	.	transcript "830"	
Adh	FGenesCGG3	start_codon	2748570	2748572	.	-	.	transcript "830"	
Adh	FGenesCGG3	CDS	2749571	2749696	.	+	.	transcript "831"	
Adh	FGenesCGG3	start_codon	2749571	2749573	.	+	.	transcript "831"	
Adh	FGenesCGG3	CDS	2749753	2750868	.	+	.	transcript "831"	
Adh	FGenesCGG3	stop_codon	2750866	2750868	.	+	.	transcript "831"	
Adh	FGenesCGG3	CDS	2750059	2750868	.	+	.	transcript "832"	
Adh	FGenesCGG3	start_codon	2750059	2750061	.	+	.	transcript "832"	
Adh	FGenesCGG3	stop_codon	2750866	2750868	.	+	.	transcript "832"	
Adh	FGenesCGG3	CDS	2751337	2751465	.	-	.	transcript "833"	
Adh	FGenesCGG3	stop_codon	2751337	2751339	.	-	.	transcript "833"	
Adh	FGenesCGG3	CDS	2751521	2751711	.	-	.	transcript "833"	
Adh	FGenesCGG3	CDS	2751778	2751871	.	-	.	transcript "833"	
Adh	FGenesCGG3	CDS	2752031	2752033	.	-	.	transcript "833"	
Adh	FGenesCGG3	start_codon	2752031	2752033	.	-	.	transcript "833"	
Adh	FGenesCGG3	CDS	2752612	2752742	.	+	.	transcript "834"	
Adh	FGenesCGG3	start_codon	2752612	2752614	.	+	.	transcript "834"	
Adh	FGenesCGG3	CDS	2752822	2752985	.	+	.	transcript "834"	
Adh	FGenesCGG3	CDS	2753042	2753322	.	+	.	transcript "834"	
Adh	FGenesCGG3	CDS	2753625	2754008	.	+	.	transcript "834"	
Adh	FGenesCGG3	stop_codon	2754006	2754008	.	+	.	transcript "834"	
Adh	FGenesCGG3	CDS	2752612	2752742	.	+	.	transcript "835"	
Adh	FGenesCGG3	start_codon	2752612	2752614	.	+	.	transcript "835"	
Adh	FGenesCGG3	CDS	2752822	2752985	.	+	.	transcript "835"	
Adh	FGenesCGG3	CDS	2753042	2753322	.	+	.	transcript "835"	
Adh	FGenesCGG3	CDS	2753382	2753565	.	+	.	transcript "835"	
Adh	FGenesCGG3	CDS	2753620	2754004	.	+	.	transcript "835"	
Adh	FGenesCGG3	CDS	2754057	2754364	.	+	.	transcript "835"	
Adh	FGenesCGG3	CDS	2754423	2754557	.	+	.	transcript "835"	
Adh	FGenesCGG3	CDS	2754615	2754739	.	+	.	transcript "835"	
Adh	FGenesCGG3	stop_codon	2754737	2754739	.	+	.	transcript "835"	
Adh	FGenesCGG3	CDS	2755219	2755580	.	-	.	transcript "836"	
Adh	FGenesCGG3	stop_codon	2755219	2755221	.	-	.	transcript "836"	
Adh	FGenesCGG3	CDS	2755775	2755883	.	-	.	transcript "836"	
Adh	FGenesCGG3	CDS	2755954	2756092	.	-	.	transcript "836"	
Adh	FGenesCGG3	CDS	2756201	2756274	.	-	.	transcript "836"	
Adh	FGenesCGG3	start_codon	2756272	2756274	.	-	.	transcript "836"	
Adh	FGenesCGG3	CDS	2755219	2755580	.	-	.	transcript "837"	
Adh	FGenesCGG3	stop_codon	2755219	2755221	.	-	.	transcript "837"	
Adh	FGenesCGG3	CDS	2755775	2755883	.	-	.	transcript "837"	
Adh	FGenesCGG3	CDS	2755954	2756022	.	-	.	transcript "837"	
Adh	FGenesCGG3	start_codon	2756020	2756022	.	-	.	transcript "837"	
Adh	FGenesCGG3	CDS	2756920	2757388	.	+	.	transcript "838"	
Adh	FGenesCGG3	start_codon	2756920	2756922	.	+	.	transcript "838"	
Adh	FGenesCGG3	stop_codon	2757386	2757388	.	+	.	transcript "838"	
Adh	FGenesCGG3	CDS	2757391	2757589	.	+	.	transcript "839"	
Adh	FGenesCGG3	start_codon	2757391	2757393	.	+	.	transcript "839"	
Adh	FGenesCGG3	CDS	2757658	2758391	.	+	.	transcript "839"	
Adh	FGenesCGG3	stop_codon	2758389	2758391	.	+	.	transcript "839"	
Adh	FGenesCGG3	CDS	2759163	2759190	.	-	.	transcript "840"	
Adh	FGenesCGG3	stop_codon	2759163	2759165	.	-	.	transcript "840"	
Adh	FGenesCGG3	CDS	2759260	2759403	.	-	.	transcript "840"	
Adh	FGenesCGG3	CDS	2759527	2759639	.	-	.	transcript "840"	
Adh	FGenesCGG3	CDS	2759701	2759850	.	-	.	transcript "840"	
Adh	FGenesCGG3	start_codon	2759848	2759850	.	-	.	transcript "840"	
Adh	FGenesCGG3	CDS	2760361	2760672	.	+	.	transcript "841"	
Adh	FGenesCGG3	start_codon	2760361	2760363	.	+	.	transcript "841"	
Adh	FGenesCGG3	CDS	2760766	2761087	.	+	.	transcript "841"	
Adh	FGenesCGG3	CDS	2761141	2762087	.	+	.	transcript "841"	
Adh	FGenesCGG3	stop_codon	2762085	2762087	.	+	.	transcript "841"	
Adh	FGenesCGG3	CDS	2762639	2762710	.	-	.	transcript "842"	
Adh	FGenesCGG3	stop_codon	2762639	2762641	.	-	.	transcript "842"	
Adh	FGenesCGG3	CDS	2763711	2763968	.	-	.	transcript "842"	
Adh	FGenesCGG3	CDS	2764030	2764118	.	-	.	transcript "842"	
Adh	FGenesCGG3	CDS	2772220	2772430	.	-	.	transcript "842"	
Adh	FGenesCGG3	CDS	2772600	2772777	.	-	.	transcript "842"	
Adh	FGenesCGG3	CDS	2773593	2774287	.	-	.	transcript "842"	
Adh	FGenesCGG3	start_codon	2774285	2774287	.	-	.	transcript "842"	
Adh	FGenesCGG3	CDS	2790007	2791503	.	-	.	transcript "843"	
Adh	FGenesCGG3	start_codon	2791501	2791503	.	-	.	transcript "843"	
Adh	FGenesCGG3	stop_codon	2790007	2790009	.	-	.	transcript "843"	
Adh	FGenesCGG3	CDS	2791866	2792011	.	-	.	transcript "844"	
Adh	FGenesCGG3	stop_codon	2791866	2791868	.	-	.	transcript "844"	
Adh	FGenesCGG3	CDS	2792082	2792601	.	-	.	transcript "844"	
Adh	FGenesCGG3	start_codon	2792599	2792601	.	-	.	transcript "844"	
Adh	FGenesCGG3	CDS	2791866	2792011	.	-	.	transcript "845"	
Adh	FGenesCGG3	stop_codon	2791866	2791868	.	-	.	transcript "845"	
Adh	FGenesCGG3	CDS	2792082	2792601	.	-	.	transcript "845"	
Adh	FGenesCGG3	start_codon	2792599	2792601	.	-	.	transcript "845"	
Adh	FGenesCGG3	CDS	2793626	2798713	.	-	.	transcript "846"	
Adh	FGenesCGG3	start_codon	2798711	2798713	.	-	.	transcript "846"	
Adh	FGenesCGG3	stop_codon	2793626	2793628	.	-	.	transcript "846"	
Adh	FGenesCGG3	CDS	2793626	2797232	.	-	.	transcript "847"	
Adh	FGenesCGG3	stop_codon	2793626	2793628	.	-	.	transcript "847"	
Adh	FGenesCGG3	CDS	2797321	2797393	.	-	.	transcript "847"	
Adh	FGenesCGG3	CDS	2798167	2798572	.	-	.	transcript "847"	
Adh	FGenesCGG3	CDS	2800138	2800200	.	-	.	transcript "847"	
Adh	FGenesCGG3	start_codon	2800198	2800200	.	-	.	transcript "847"	
Adh	FGenesCGG3	CDS	2800880	2800913	.	+	.	transcript "848"	
Adh	FGenesCGG3	start_codon	2800880	2800882	.	+	.	transcript "848"	
Adh	FGenesCGG3	CDS	2802395	2802813	.	+	.	transcript "848"	
Adh	FGenesCGG3	stop_codon	2802811	2802813	.	+	.	transcript "848"	
Adh	FGenesCGG3	CDS	2802355	2802394	.	+	.	transcript "849"	
Adh	FGenesCGG3	start_codon	2802355	2802357	.	+	.	transcript "849"	
Adh	FGenesCGG3	CDS	2802443	2802813	.	+	.	transcript "849"	
Adh	FGenesCGG3	stop_codon	2802811	2802813	.	+	.	transcript "849"	
Adh	FGenesCGG3	CDS	2804442	2805672	.	-	.	transcript "850"	
Adh	FGenesCGG3	stop_codon	2804442	2804444	.	-	.	transcript "850"	
Adh	FGenesCGG3	CDS	2809152	2809186	.	-	.	transcript "850"	
Adh	FGenesCGG3	start_codon	2809184	2809186	.	-	.	transcript "850"	
Adh	FGenesCGG3	CDS	2804442	2805730	.	-	.	transcript "851"	
Adh	FGenesCGG3	stop_codon	2804442	2804444	.	-	.	transcript "851"	
Adh	FGenesCGG3	CDS	2805800	2805812	.	-	.	transcript "851"	
Adh	FGenesCGG3	start_codon	2805810	2805812	.	-	.	transcript "851"	
Adh	FGenesCGG3	CDS	2815178	2815829	.	+	.	transcript "852"	
Adh	FGenesCGG3	start_codon	2815178	2815180	.	+	.	transcript "852"	
Adh	FGenesCGG3	CDS	2815894	2816135	.	+	.	transcript "852"	
Adh	FGenesCGG3	stop_codon	2816133	2816135	.	+	.	transcript "852"	
Adh	FGenesCGG3	CDS	2815262	2815829	.	+	.	transcript "853"	
Adh	FGenesCGG3	start_codon	2815262	2815264	.	+	.	transcript "853"	
Adh	FGenesCGG3	CDS	2815894	2816001	.	+	.	transcript "853"	
Adh	FGenesCGG3	CDS	2820072	2820220	.	+	.	transcript "853"	
Adh	FGenesCGG3	stop_codon	2820218	2820220	.	+	.	transcript "853"	
Adh	FGenesCGG3	CDS	2820855	2820910	.	-	.	transcript "854"	
Adh	FGenesCGG3	stop_codon	2820855	2820857	.	-	.	transcript "854"	
Adh	FGenesCGG3	CDS	2821872	2822040	.	-	.	transcript "854"	
Adh	FGenesCGG3	start_codon	2822038	2822040	.	-	.	transcript "854"	
Adh	FGenesCGG3	CDS	2822231	2822237	.	-	.	transcript "855"	
Adh	FGenesCGG3	stop_codon	2822231	2822233	.	-	.	transcript "855"	
Adh	FGenesCGG3	CDS	2823059	2823129	.	-	.	transcript "855"	
Adh	FGenesCGG3	start_codon	2823127	2823129	.	-	.	transcript "855"	
Adh	FGenesCGG3	CDS	2825682	2825833	.	-	.	transcript "856"	
Adh	FGenesCGG3	stop_codon	2825682	2825684	.	-	.	transcript "856"	
Adh	FGenesCGG3	CDS	2829004	2829191	.	-	.	transcript "856"	
Adh	FGenesCGG3	CDS	2829637	2829727	.	-	.	transcript "856"	
Adh	FGenesCGG3	CDS	2831482	2831626	.	-	.	transcript "856"	
Adh	FGenesCGG3	start_codon	2831624	2831626	.	-	.	transcript "856"	
Adh	FGenesCGG3	CDS	2829115	2829211	.	-	.	transcript "857"	
Adh	FGenesCGG3	stop_codon	2829115	2829117	.	-	.	transcript "857"	
Adh	FGenesCGG3	CDS	2829637	2829731	.	-	.	transcript "857"	
Adh	FGenesCGG3	CDS	2831055	2831120	.	-	.	transcript "857"	
Adh	FGenesCGG3	start_codon	2831118	2831120	.	-	.	transcript "857"	
Adh	FGenesCGG3	CDS	2835018	2835056	.	+	.	transcript "858"	
Adh	FGenesCGG3	start_codon	2835018	2835020	.	+	.	transcript "858"	
Adh	FGenesCGG3	CDS	2840422	2840772	.	+	.	transcript "858"	
Adh	FGenesCGG3	CDS	2841783	2841806	.	+	.	transcript "858"	
Adh	FGenesCGG3	stop_codon	2841804	2841806	.	+	.	transcript "858"	
Adh	FGenesCGG3	CDS	2843195	2843379	.	-	.	transcript "859"	
Adh	FGenesCGG3	stop_codon	2843195	2843197	.	-	.	transcript "859"	
Adh	FGenesCGG3	CDS	2844448	2844499	.	-	.	transcript "859"	
Adh	FGenesCGG3	CDS	2848754	2848909	.	-	.	transcript "859"	
Adh	FGenesCGG3	start_codon	2848907	2848909	.	-	.	transcript "859"	
Adh	FGenesCGG3	CDS	2845972	2846128	.	-	.	transcript "860"	
Adh	FGenesCGG3	stop_codon	2845972	2845974	.	-	.	transcript "860"	
Adh	FGenesCGG3	CDS	2848102	2848427	.	-	.	transcript "860"	
Adh	FGenesCGG3	CDS	2849124	2849126	.	-	.	transcript "860"	
Adh	FGenesCGG3	start_codon	2849124	2849126	.	-	.	transcript "860"	
Adh	FGenesCGG3	CDS	2849759	2849784	.	-	.	transcript "861"	
Adh	FGenesCGG3	stop_codon	2849759	2849761	.	-	.	transcript "861"	
Adh	FGenesCGG3	CDS	2853744	2854099	.	-	.	transcript "861"	
Adh	FGenesCGG3	CDS	2854197	2855213	.	-	.	transcript "861"	
Adh	FGenesCGG3	CDS	2861277	2861353	.	-	.	transcript "861"	
Adh	FGenesCGG3	start_codon	2861351	2861353	.	-	.	transcript "861"	
Adh	FGenesCGG3	CDS	2853052	2853132	.	-	.	transcript "862"	
Adh	FGenesCGG3	stop_codon	2853052	2853054	.	-	.	transcript "862"	
Adh	FGenesCGG3	CDS	2853349	2853362	.	-	.	transcript "862"	
Adh	FGenesCGG3	CDS	2853744	2854099	.	-	.	transcript "862"	
Adh	FGenesCGG3	CDS	2854197	2855206	.	-	.	transcript "862"	
Adh	FGenesCGG3	CDS	2856104	2856265	.	-	.	transcript "862"	
Adh	FGenesCGG3	start_codon	2856263	2856265	.	-	.	transcript "862"	
Adh	FGenesCGG3	CDS	2860250	2860510	.	-	.	transcript "863"	
Adh	FGenesCGG3	stop_codon	2860250	2860252	.	-	.	transcript "863"	
Adh	FGenesCGG3	CDS	2860680	2860700	.	-	.	transcript "863"	
Adh	FGenesCGG3	start_codon	2860698	2860700	.	-	.	transcript "863"	
Adh	FGenesCGG3	CDS	2862982	2863110	.	-	.	transcript "864"	
Adh	FGenesCGG3	stop_codon	2862982	2862984	.	-	.	transcript "864"	
Adh	FGenesCGG3	CDS	2864786	2864881	.	-	.	transcript "864"	
Adh	FGenesCGG3	CDS	2865247	2865339	.	-	.	transcript "864"	
Adh	FGenesCGG3	start_codon	2865337	2865339	.	-	.	transcript "864"	
Adh	FGenesCGG3	CDS	2869663	2869682	.	+	.	transcript "865"	
Adh	FGenesCGG3	start_codon	2869663	2869665	.	+	.	transcript "865"	
Adh	FGenesCGG3	CDS	2872476	2872590	.	+	.	transcript "865"	
Adh	FGenesCGG3	CDS	2880718	2880820	.	+	.	transcript "865"	
Adh	FGenesCGG3	CDS	2882019	2882485	.	+	.	transcript "865"	
Adh	FGenesCGG3	stop_codon	2882483	2882485	.	+	.	transcript "865"	
Adh	FGenesCGG3	CDS	2870618	2870720	.	+	.	transcript "866"	
Adh	FGenesCGG3	start_codon	2870618	2870620	.	+	.	transcript "866"	
Adh	FGenesCGG3	CDS	2871302	2871404	.	+	.	transcript "866"	
Adh	FGenesCGG3	CDS	2871694	2871796	.	+	.	transcript "866"	
Adh	FGenesCGG3	CDS	2872615	2872677	.	+	.	transcript "866"	
Adh	FGenesCGG3	stop_codon	2872675	2872677	.	+	.	transcript "866"	
Adh	FGenesCGG3	CDS	2884147	2884181	.	-	.	transcript "867"	
Adh	FGenesCGG3	stop_codon	2884147	2884149	.	-	.	transcript "867"	
Adh	FGenesCGG3	CDS	2886895	2887018	.	-	.	transcript "867"	
Adh	FGenesCGG3	CDS	2894311	2894337	.	-	.	transcript "867"	
Adh	FGenesCGG3	start_codon	2894335	2894337	.	-	.	transcript "867"	
Adh	FGenesCGG3	CDS	2886167	2886382	.	+	.	transcript "868"	
Adh	FGenesCGG3	start_codon	2886167	2886169	.	+	.	transcript "868"	
Adh	FGenesCGG3	CDS	2886911	2887024	.	+	.	transcript "868"	
Adh	FGenesCGG3	stop_codon	2887022	2887024	.	+	.	transcript "868"	
Adh	FGenesCGG3	CDS	2894587	2895247	.	+	.	transcript "869"	
Adh	FGenesCGG3	start_codon	2894587	2894589	.	+	.	transcript "869"	
Adh	FGenesCGG3	CDS	2895319	2895977	.	+	.	transcript "869"	
Adh	FGenesCGG3	stop_codon	2895975	2895977	.	+	.	transcript "869"	
Adh	FGenesCGG3	CDS	2896655	2896763	.	+	.	transcript "870"	
Adh	FGenesCGG3	start_codon	2896655	2896657	.	+	.	transcript "870"	
Adh	FGenesCGG3	CDS	2898444	2899001	.	+	.	transcript "870"	
Adh	FGenesCGG3	CDS	2899061	2899716	.	+	.	transcript "870"	
Adh	FGenesCGG3	stop_codon	2899714	2899716	.	+	.	transcript "870"	
Adh	FGenesCGG3	CDS	2900448	2900565	.	+	.	transcript "871"	
Adh	FGenesCGG3	start_codon	2900448	2900450	.	+	.	transcript "871"	
Adh	FGenesCGG3	CDS	2900634	2901185	.	+	.	transcript "871"	
Adh	FGenesCGG3	CDS	2901452	2902048	.	+	.	transcript "871"	
Adh	FGenesCGG3	CDS	2902973	2903168	.	+	.	transcript "871"	
Adh	FGenesCGG3	CDS	2904175	2904292	.	+	.	transcript "871"	
Adh	FGenesCGG3	stop_codon	2904290	2904292	.	+	.	transcript "871"	
Adh	FGenesCGG3	CDS	2907647	2908054	.	-	.	transcript "872"	
Adh	FGenesCGG3	stop_codon	2907647	2907649	.	-	.	transcript "872"	
Adh	FGenesCGG3	CDS	2911759	2911898	.	-	.	transcript "872"	
Adh	FGenesCGG3	CDS	2914999	2915119	.	-	.	transcript "872"	
Adh	FGenesCGG3	start_codon	2915117	2915119	.	-	.	transcript "872"	
Adh	FGenesCGG3	CDS	2910870	2910893	.	+	.	transcript "873"	
Adh	FGenesCGG3	start_codon	2910870	2910872	.	+	.	transcript "873"	
Adh	FGenesCGG3	CDS	2911776	2911922	.	+	.	transcript "873"	
Adh	FGenesCGG3	stop_codon	2911920	2911922	.	+	.	transcript "873"	
Adh	FGenesCGG3	CDS	2913888	2914163	.	-	.	transcript "874"	
Adh	FGenesCGG3	stop_codon	2913888	2913890	.	-	.	transcript "874"	
Adh	FGenesCGG3	CDS	2914965	2914976	.	-	.	transcript "874"	
Adh	FGenesCGG3	CDS	2916867	2916878	.	-	.	transcript "874"	
Adh	FGenesCGG3	CDS	2916879	2917012	.	-	.	transcript "875"	
Adh	FGenesCGG3	stop_codon	2916879	2916881	.	-	.	transcript "875"	
Adh	FGenesCGG3	CDS	2917311	2917504	.	-	.	transcript "875"	
Adh	FGenesCGG3	CDS	2917751	2917988	.	-	.	transcript "875"	
Adh	FGenesCGG3	CDS	2918253	2918513	.	-	.	transcript "875"	
#
# reordered by hartzell --- Tue Jul  6 12:00:30 PDT 1999
# run through:
#    sort +9 +3 -n
#    replaced ATG with start_codon
#    replaced STOP with stop_codon 
#    replaced hmmgene with HMMGene
#
# compfly: 1. replaced "adh.contig" with "Adh" Jul 30 (MR)
#          2. removed "intron" annotations Jul 30 (MR)
#          3. 3UTR and 5UTR removed
#
Adh	HMMGene	start_codon	21599	21601	.	+	.	transcript "+1"
Adh	HMMGene	CDS	21599	21979	0.661	+	.	transcript "+1"
Adh	HMMGene	CDS	22140	22295	0.669	+	.	transcript "+1"
Adh	HMMGene	stop_codon	22293	22295	.	+	.	transcript "+1"
Adh	HMMGene	start_codon	264992	264994	.	+	.	transcript "+10"
Adh	HMMGene	CDS	264992	264997	0.669	+	.	transcript "+10"
Adh	HMMGene	CDS	265061	266322	0.669	+	.	transcript "+10"
Adh	HMMGene	CDS	266392	266619	0.669	+	.	transcript "+10"
Adh	HMMGene	CDS	266684	266867	0.659	+	.	transcript "+10"
Adh	HMMGene	CDS	266935	267081	0.661	+	.	transcript "+10"
Adh	HMMGene	CDS	267134	267163	0.662	+	.	transcript "+10"
Adh	HMMGene	stop_codon	267161	267163	.	+	.	transcript "+10"
Adh	HMMGene	start_codon	2524359	2524361	.	+	.	transcript "+100"
Adh	HMMGene	CDS	2524359	2524565	0.919	+	.	transcript "+100"
Adh	HMMGene	CDS	2525929	2526064	0.501	+	.	transcript "+100"
Adh	HMMGene	CDS	2527415	2527548	0.998	+	.	transcript "+100"
Adh	HMMGene	CDS	2529073	2529195	1.000	+	.	transcript "+100"
Adh	HMMGene	CDS	2529260	2529455	1.000	+	.	transcript "+100"
Adh	HMMGene	CDS	2529735	2530156	0.525	+	.	transcript "+100"
Adh	HMMGene	stop_codon	2530154	2530156	.	+	.	transcript "+100"
Adh	HMMGene	start_codon	2544295	2544297	.	+	.	transcript "+101"
Adh	HMMGene	CDS	2544295	2545115	0.762	+	.	transcript "+101"
Adh	HMMGene	CDS	2545169	2545175	0.749	+	.	transcript "+101"
Adh	HMMGene	stop_codon	2545173	2545175	.	+	.	transcript "+101"
Adh	HMMGene	start_codon	2578307	2578309	.	+	.	transcript "+102"
Adh	HMMGene	CDS	2578307	2578403	0.876	+	.	transcript "+102"
Adh	HMMGene	CDS	2583075	2583547	0.580	+	.	transcript "+102"
Adh	HMMGene	stop_codon	2583545	2583547	.	+	.	transcript "+102"
Adh	HMMGene	CDS	2619518	2620103	1	+	.	transcript "+103"
Adh	HMMGene	CDS	2621231	2622507	1	+	.	transcript "+103"
Adh	HMMGene	CDS	2622578	2622803	1	+	.	transcript "+103"
Adh	HMMGene	CDS	2622977	2623082	1	+	.	transcript "+103"
Adh	HMMGene	CDS	2624122	2624266	1	+	.	transcript "+103"
Adh	HMMGene	CDS	2624694	2624875	1	+	.	transcript "+103"
Adh	HMMGene	CDS	2624976	2625495	1	+	.	transcript "+103"
Adh	HMMGene	CDS	2625559	2625784	1	+	.	transcript "+103"
Adh	HMMGene	CDS	2625851	2626065	1	+	.	transcript "+103"
Adh	HMMGene	CDS	2626104	2626333	1	+	.	transcript "+103"
Adh	HMMGene	CDS	2626392	2626510	1	+	.	transcript "+103"
Adh	HMMGene	CDS	2626595	2626653	1	+	.	transcript "+103"
Adh	HMMGene	CDS	2626937	2627063	1	+	.	transcript "+103"
Adh	HMMGene	CDS	2628166	2628325	1	+	.	transcript "+103"
Adh	HMMGene	stop_codon	2628323	2628325	.	+	.	transcript "+103"
Adh	HMMGene	start_codon	2632081	2632083	.	+	.	transcript "+104"
Adh	HMMGene	CDS	2632081	2632298	1	+	.	transcript "+104"
Adh	HMMGene	CDS	2632363	2632834	1	+	.	transcript "+104"
Adh	HMMGene	CDS	2632889	2632972	1	+	.	transcript "+104"
Adh	HMMGene	CDS	2633028	2633093	1	+	.	transcript "+104"
Adh	HMMGene	CDS	2633149	2633337	1	+	.	transcript "+104"
Adh	HMMGene	CDS	2633397	2633645	1	+	.	transcript "+104"
Adh	HMMGene	CDS	2633706	2634369	1	+	.	transcript "+104"
Adh	HMMGene	CDS	2634452	2634480	1	+	.	transcript "+104"
Adh	HMMGene	CDS	2634545	2634885	1	+	.	transcript "+104"
Adh	HMMGene	CDS	2635370	2635410	1	+	.	transcript "+104"
Adh	HMMGene	CDS	2638284	2638414	1	+	.	transcript "+104"
Adh	HMMGene	CDS	2638470	2639006	1	+	.	transcript "+104"
Adh	HMMGene	stop_codon	2639004	2639006	.	+	.	transcript "+104"
Adh	HMMGene	start_codon	2660938	2660940	.	+	.	transcript "+105"
Adh	HMMGene	CDS	2660938	2661318	1	+	.	transcript "+105"
Adh	HMMGene	CDS	2661378	2662292	1	+	.	transcript "+105"
Adh	HMMGene	CDS	2662390	2662437	1	+	.	transcript "+105"
Adh	HMMGene	CDS	2681403	2681494	1	+	.	transcript "+105"
Adh	HMMGene	CDS	2684880	2686209	1	+	.	transcript "+105"
Adh	HMMGene	CDS	2686394	2686570	1	+	.	transcript "+105"
Adh	HMMGene	CDS	2686628	2686705	1	+	.	transcript "+105"
Adh	HMMGene	CDS	2686770	2687146	1	+	.	transcript "+105"
Adh	HMMGene	CDS	2687211	2687359	1	+	.	transcript "+105"
Adh	HMMGene	CDS	2687415	2687920	1	+	.	transcript "+105"
Adh	HMMGene	CDS	2687988	2688230	1	+	.	transcript "+105"
Adh	HMMGene	CDS	2688342	2688375	1	+	.	transcript "+105"
Adh	HMMGene	CDS	2688462	2688883	1	+	.	transcript "+105"
Adh	HMMGene	CDS	2689073	2689183	1	+	.	transcript "+105"
Adh	HMMGene	stop_codon	2689181	2689183	.	+	.	transcript "+105"
Adh	HMMGene	start_codon	2707374	2707376	.	+	.	transcript "+106"
Adh	HMMGene	CDS	2707374	2707439	1	+	.	transcript "+106"
Adh	HMMGene	CDS	2707509	2708522	1	+	.	transcript "+106"
Adh	HMMGene	stop_codon	2708520	2708522	.	+	.	transcript "+106"
Adh	HMMGene	start_codon	2711888	2711890	.	+	.	transcript "+107"
Adh	HMMGene	CDS	2711888	2712440	1	+	.	transcript "+107"
Adh	HMMGene	CDS	2712522	2712600	1	+	.	transcript "+107"
Adh	HMMGene	CDS	2713900	2713921	1	+	.	transcript "+107"
Adh	HMMGene	stop_codon	2713919	2713921	.	+	.	transcript "+107"
Adh	HMMGene	start_codon	2728978	2728980	.	+	.	transcript "+108"
Adh	HMMGene	CDS	2728978	2728998	1	+	.	transcript "+108"
Adh	HMMGene	CDS	2731223	2731272	1	+	.	transcript "+108"
Adh	HMMGene	CDS	2731334	2731606	1	+	.	transcript "+108"
Adh	HMMGene	CDS	2732777	2732813	1	+	.	transcript "+108"
Adh	HMMGene	stop_codon	2732811	2732813	.	+	.	transcript "+108"
Adh	HMMGene	start_codon	2737704	2737706	.	+	.	transcript "+109"
Adh	HMMGene	CDS	2737704	2737731	1	+	.	transcript "+109"
Adh	HMMGene	CDS	2737860	2738132	1	+	.	transcript "+109"
Adh	HMMGene	CDS	2738403	2739461	1	+	.	transcript "+109"
Adh	HMMGene	CDS	2739531	2740039	1	+	.	transcript "+109"
Adh	HMMGene	stop_codon	2740037	2740039	.	+	.	transcript "+109"
Adh	HMMGene	start_codon	272187	272189	.	+	.	transcript "+11"
Adh	HMMGene	CDS	272187	272272	0.391	+	.	transcript "+11"
Adh	HMMGene	CDS	274717	275848	0.668	+	.	transcript "+11"
Adh	HMMGene	stop_codon	275846	275848	.	+	.	transcript "+11"
Adh	HMMGene	start_codon	2740542	2740544	.	+	.	transcript "+110"
Adh	HMMGene	CDS	2740542	2741090	1	+	.	transcript "+110"
Adh	HMMGene	stop_codon	2741088	2741090	.	+	.	transcript "+110"
Adh	HMMGene	start_codon	2743611	2743613	.	+	.	transcript "+111"
Adh	HMMGene	CDS	2743611	2745122	1	+	.	transcript "+111"
Adh	HMMGene	stop_codon	2745120	2745122	.	+	.	transcript "+111"
Adh	HMMGene	start_codon	2749655	2749657	.	+	.	transcript "+112"
Adh	HMMGene	CDS	2749655	2749696	1	+	.	transcript "+112"
Adh	HMMGene	CDS	2749753	2750868	1	+	.	transcript "+112"
Adh	HMMGene	stop_codon	2750866	2750868	.	+	.	transcript "+112"
Adh	HMMGene	start_codon	2752612	2752614	.	+	.	transcript "+113"
Adh	HMMGene	CDS	2752612	2752742	1	+	.	transcript "+113"
Adh	HMMGene	CDS	2752822	2752985	1	+	.	transcript "+113"
Adh	HMMGene	CDS	2753042	2753322	1	+	.	transcript "+113"
Adh	HMMGene	CDS	2753382	2753565	1	+	.	transcript "+113"
Adh	HMMGene	CDS	2754071	2754364	1	+	.	transcript "+113"
Adh	HMMGene	CDS	2754423	2754557	1	+	.	transcript "+113"
Adh	HMMGene	CDS	2755105	2755115	1	+	.	transcript "+113"
Adh	HMMGene	stop_codon	2755113	2755115	.	+	.	transcript "+113"
Adh	HMMGene	start_codon	2756920	2756922	.	+	.	transcript "+114"
Adh	HMMGene	CDS	2756920	2757589	1	+	.	transcript "+114"
Adh	HMMGene	CDS	2757658	2758391	1	+	.	transcript "+114"
Adh	HMMGene	stop_codon	2758389	2758391	.	+	.	transcript "+114"
Adh	HMMGene	start_codon	2760361	2760363	.	+	.	transcript "+115"
Adh	HMMGene	CDS	2760361	2760672	1	+	.	transcript "+115"
Adh	HMMGene	CDS	2760766	2761087	1	+	.	transcript "+115"
Adh	HMMGene	CDS	2761141	2762087	1	+	.	transcript "+115"
Adh	HMMGene	stop_codon	2762085	2762087	.	+	.	transcript "+115"
Adh	HMMGene	start_codon	2776429	2776431	.	+	.	transcript "+116"
Adh	HMMGene	CDS	2776429	2777295	0.940	+	.	transcript "+116"
Adh	HMMGene	stop_codon	2777293	2777295	.	+	.	transcript "+116"
Adh	HMMGene	start_codon	2779268	2779270	.	+	.	transcript "+117"
Adh	HMMGene	CDS	2779268	2779279	1.000	+	.	transcript "+117"
Adh	HMMGene	CDS	2779339	2779566	1.000	+	.	transcript "+117"
Adh	HMMGene	stop_codon	2779564	2779566	.	+	.	transcript "+117"
Adh	HMMGene	start_codon	2802355	2802357	.	+	.	transcript "+118"
Adh	HMMGene	CDS	2802355	2802394	1.000	+	.	transcript "+118"
Adh	HMMGene	CDS	2802473	2802813	1.000	+	.	transcript "+118"
Adh	HMMGene	stop_codon	2802811	2802813	.	+	.	transcript "+118"
Adh	HMMGene	start_codon	2815178	2815180	.	+	.	transcript "+119"
Adh	HMMGene	CDS	2815178	2815829	0.999	+	.	transcript "+119"
Adh	HMMGene	CDS	2815894	2816135	0.871	+	.	transcript "+119"
Adh	HMMGene	stop_codon	2816133	2816135	.	+	.	transcript "+119"
Adh	HMMGene	start_codon	277921	277923	.	+	.	transcript "+12"
Adh	HMMGene	CDS	277921	278103	0.669	+	.	transcript "+12"
Adh	HMMGene	CDS	278222	278345	0.667	+	.	transcript "+12"
Adh	HMMGene	CDS	278537	278737	0.669	+	.	transcript "+12"
Adh	HMMGene	CDS	278802	279272	0.669	+	.	transcript "+12"
Adh	HMMGene	CDS	279331	279483	0.664	+	.	transcript "+12"
Adh	HMMGene	CDS	279548	279726	0.666	+	.	transcript "+12"
Adh	HMMGene	CDS	280031	280247	0.668	+	.	transcript "+12"
Adh	HMMGene	CDS	280310	280610	0.669	+	.	transcript "+12"
Adh	HMMGene	CDS	280674	280986	0.669	+	.	transcript "+12"
Adh	HMMGene	CDS	281051	281202	0.621	+	.	transcript "+12"
Adh	HMMGene	CDS	281264	281447	0.669	+	.	transcript "+12"
Adh	HMMGene	CDS	281550	281787	0.666	+	.	transcript "+12"
Adh	HMMGene	CDS	281848	282471	0.669	+	.	transcript "+12"
Adh	HMMGene	CDS	282539	283453	0.518	+	.	transcript "+12"
Adh	HMMGene	CDS	283498	283524	0.296	+	.	transcript "+12"
Adh	HMMGene	CDS	283577	284003	0.667	+	.	transcript "+12"
Adh	HMMGene	CDS	284969	285346	0.669	+	.	transcript "+12"
Adh	HMMGene	CDS	285416	286886	0.669	+	.	transcript "+12"
Adh	HMMGene	stop_codon	286884	286886	.	+	.	transcript "+12"
Adh	HMMGene	start_codon	2894587	2894589	.	+	.	transcript "+120"
Adh	HMMGene	CDS	2894587	2895247	0.868	+	.	transcript "+120"
Adh	HMMGene	CDS	2895319	2895977	0.999	+	.	transcript "+120"
Adh	HMMGene	stop_codon	2895975	2895977	.	+	.	transcript "+120"
Adh	HMMGene	start_codon	2896737	2896739	.	+	.	transcript "+121"
Adh	HMMGene	CDS	2896737	2896767	1.000	+	.	transcript "+121"
Adh	HMMGene	CDS	2898444	2899001	0.999	+	.	transcript "+121"
Adh	HMMGene	CDS	2899061	2899716	0.999	+	.	transcript "+121"
Adh	HMMGene	stop_codon	2899714	2899716	.	+	.	transcript "+121"
Adh	HMMGene	start_codon	2900448	2900450	.	+	.	transcript "+122"
Adh	HMMGene	CDS	2900448	2900565	1.000	+	.	transcript "+122"
Adh	HMMGene	CDS	2900634	2901185	0.993	+	.	transcript "+122"
Adh	HMMGene	CDS	2901452	2902107	0.993	+	.	transcript "+122"
Adh	HMMGene	stop_codon	2902105	2902107	.	+	.	transcript "+122"
Adh	HMMGene	start_codon	287599	287601	.	+	.	transcript "+13"
Adh	HMMGene	CDS	287599	288379	0.631	+	.	transcript "+13"
Adh	HMMGene	CDS	288647	292689	0.668	+	.	transcript "+13"
Adh	HMMGene	CDS	292759	292896	0.669	+	.	transcript "+13"
Adh	HMMGene	stop_codon	292894	292896	.	+	.	transcript "+13"
Adh	HMMGene	start_codon	297680	297682	.	+	.	transcript "+14"
Adh	HMMGene	CDS	297680	297713	0.669	+	.	transcript "+14"
Adh	HMMGene	CDS	302560	302718	0.669	+	.	transcript "+14"
Adh	HMMGene	CDS	302786	303405	0.669	+	.	transcript "+14"
Adh	HMMGene	stop_codon	303403	303405	.	+	.	transcript "+14"
Adh	HMMGene	start_codon	305396	305398	.	+	.	transcript "+15"
Adh	HMMGene	CDS	305396	305516	0.669	+	.	transcript "+15"
Adh	HMMGene	CDS	305577	305737	0.669	+	.	transcript "+15"
Adh	HMMGene	CDS	305803	306108	0.669	+	.	transcript "+15"
Adh	HMMGene	CDS	306230	306385	0.669	+	.	transcript "+15"
Adh	HMMGene	stop_codon	306383	306385	.	+	.	transcript "+15"
Adh	HMMGene	start_codon	307965	307967	.	+	.	transcript "+16"
Adh	HMMGene	CDS	307965	309056	0.595	+	.	transcript "+16"
Adh	HMMGene	CDS	309110	309467	0.669	+	.	transcript "+16"
Adh	HMMGene	CDS	309530	310452	0.669	+	.	transcript "+16"
Adh	HMMGene	CDS	310517	311365	0.669	+	.	transcript "+16"
Adh	HMMGene	CDS	311428	312318	0.669	+	.	transcript "+16"
Adh	HMMGene	CDS	312387	313046	0.598	+	.	transcript "+16"
Adh	HMMGene	stop_codon	313044	313046	.	+	.	transcript "+16"
Adh	HMMGene	start_codon	315138	315140	.	+	.	transcript "+17"
Adh	HMMGene	CDS	315138	315899	0.669	+	.	transcript "+17"
Adh	HMMGene	CDS	316433	316800	0.664	+	.	transcript "+17"
Adh	HMMGene	CDS	316865	317462	0.664	+	.	transcript "+17"
Adh	HMMGene	stop_codon	317460	317462	.	+	.	transcript "+17"
Adh	HMMGene	start_codon	323788	323790	.	+	.	transcript "+18"
Adh	HMMGene	CDS	323788	324885	0.664	+	.	transcript "+18"
Adh	HMMGene	CDS	324939	325223	0.664	+	.	transcript "+18"
Adh	HMMGene	stop_codon	325221	325223	.	+	.	transcript "+18"
Adh	HMMGene	start_codon	327175	327177	.	+	.	transcript "+19"
Adh	HMMGene	CDS	327175	328002	0.664	+	.	transcript "+19"
Adh	HMMGene	stop_codon	328000	328002	.	+	.	transcript "+19"
Adh	HMMGene	start_codon	34783	34785	.	+	.	transcript "+2"
Adh	HMMGene	CDS	34783	34822	0.351	+	.	transcript "+2"
Adh	HMMGene	CDS	34884	35332	0.642	+	.	transcript "+2"
Adh	HMMGene	stop_codon	35330	35332	.	+	.	transcript "+2"
Adh	HMMGene	start_codon	329808	329810	.	+	.	transcript "+20"
Adh	HMMGene	CDS	329808	330183	0.664	+	.	transcript "+20"
Adh	HMMGene	CDS	330421	330434	0.103	+	.	transcript "+20"
Adh	HMMGene	stop_codon	330432	330434	.	+	.	transcript "+20"
Adh	HMMGene	start_codon	340529	340531	.	+	.	transcript "+21"
Adh	HMMGene	CDS	340529	340634	0.663	+	.	transcript "+21"
Adh	HMMGene	CDS	340705	340870	0.664	+	.	transcript "+21"
Adh	HMMGene	CDS	340926	341517	0.664	+	.	transcript "+21"
Adh	HMMGene	stop_codon	341515	341517	.	+	.	transcript "+21"
Adh	HMMGene	start_codon	341713	341715	.	+	.	transcript "+22"
Adh	HMMGene	CDS	341713	341857	0.664	+	.	transcript "+22"
Adh	HMMGene	CDS	342003	342751	0.658	+	.	transcript "+22"
Adh	HMMGene	stop_codon	342749	342751	.	+	.	transcript "+22"
Adh	HMMGene	start_codon	343169	343171	.	+	.	transcript "+23"
Adh	HMMGene	CDS	343169	343368	0.658	+	.	transcript "+23"
Adh	HMMGene	CDS	343432	343984	0.661	+	.	transcript "+23"
Adh	HMMGene	stop_codon	343982	343984	.	+	.	transcript "+23"
Adh	HMMGene	start_codon	373286	373288	.	+	.	transcript "+24"
Adh	HMMGene	CDS	373286	373457	1	+	.	transcript "+24"
Adh	HMMGene	CDS	385051	385283	1	+	.	transcript "+24"
Adh	HMMGene	CDS	388780	388921	1	+	.	transcript "+24"
Adh	HMMGene	CDS	389006	389140	1	+	.	transcript "+24"
Adh	HMMGene	CDS	389208	390512	1	+	.	transcript "+24"
Adh	HMMGene	CDS	390556	390673	1	+	.	transcript "+24"
Adh	HMMGene	CDS	390737	391112	1	+	.	transcript "+24"
Adh	HMMGene	CDS	391177	391500	1	+	.	transcript "+24"
Adh	HMMGene	stop_codon	391498	391500	.	+	.	transcript "+24"
Adh	HMMGene	start_codon	400338	400340	.	+	.	transcript "+25"
Adh	HMMGene	CDS	400338	400923	1	+	.	transcript "+25"
Adh	HMMGene	CDS	401350	401713	1	+	.	transcript "+25"
Adh	HMMGene	CDS	401775	402327	1	+	.	transcript "+25"
Adh	HMMGene	CDS	402424	402539	1	+	.	transcript "+25"
Adh	HMMGene	CDS	402607	402779	1.000	+	.	transcript "+25"
Adh	HMMGene	CDS	402844	402860	1.000	+	.	transcript "+25"
Adh	HMMGene	stop_codon	402858	402860	.	+	.	transcript "+25"
Adh	HMMGene	start_codon	403391	403393	.	+	.	transcript "+26"
Adh	HMMGene	CDS	403391	403411	0.865	+	.	transcript "+26"
Adh	HMMGene	CDS	403468	404414	1.000	+	.	transcript "+26"
Adh	HMMGene	CDS	404467	405027	0.998	+	.	transcript "+26"
Adh	HMMGene	CDS	405085	405391	0.999	+	.	transcript "+26"
Adh	HMMGene	stop_codon	405389	405391	.	+	.	transcript "+26"
Adh	HMMGene	start_codon	405952	405954	.	+	.	transcript "+27"
Adh	HMMGene	CDS	405952	406314	0.999	+	.	transcript "+27"
Adh	HMMGene	stop_codon	406312	406314	.	+	.	transcript "+27"
Adh	HMMGene	start_codon	408759	408761	.	+	.	transcript "+28"
Adh	HMMGene	CDS	408759	409001	0.999	+	.	transcript "+28"
Adh	HMMGene	CDS	409150	409656	0.999	+	.	transcript "+28"
Adh	HMMGene	CDS	410157	410315	0.718	+	.	transcript "+28"
Adh	HMMGene	CDS	410372	410612	0.823	+	.	transcript "+28"
Adh	HMMGene	CDS	410677	411416	0.080	+	.	transcript "+28"
Adh	HMMGene	CDS	411728	411831	0.126	+	.	transcript "+28"
Adh	HMMGene	CDS	414096	414102	0.071	+	.	transcript "+28"
Adh	HMMGene	stop_codon	414100	414102	.	+	.	transcript "+28"
Adh	HMMGene	start_codon	448386	448388	.	+	.	transcript "+29"
Adh	HMMGene	CDS	448386	448432	0.257	+	.	transcript "+29"
Adh	HMMGene	CDS	448467	448607	0.998	+	.	transcript "+29"
Adh	HMMGene	CDS	449015	449232	0.403	+	.	transcript "+29"
Adh	HMMGene	CDS	451667	451902	0.686	+	.	transcript "+29"
Adh	HMMGene	CDS	454581	454759	0.107	+	.	transcript "+29"
Adh	HMMGene	CDS	454999	455702	0.915	+	.	transcript "+29"
Adh	HMMGene	CDS	455870	456263	0.871	+	.	transcript "+29"
Adh	HMMGene	CDS	457279	457488	0.874	+	.	transcript "+29"
Adh	HMMGene	CDS	457649	458206	0.998	+	.	transcript "+29"
Adh	HMMGene	CDS	458285	458479	0.925	+	.	transcript "+29"
Adh	HMMGene	CDS	458547	458802	0.747	+	.	transcript "+29"
Adh	HMMGene	stop_codon	458800	458802	.	+	.	transcript "+29"
Adh	HMMGene	start_codon	36410	36412	.	+	.	transcript "+3"
Adh	HMMGene	CDS	36410	37315	0.663	+	.	transcript "+3"
Adh	HMMGene	stop_codon	37313	37315	.	+	.	transcript "+3"
Adh	HMMGene	start_codon	464308	464310	.	+	.	transcript "+30"
Adh	HMMGene	CDS	464308	464615	0.972	+	.	transcript "+30"
Adh	HMMGene	CDS	464888	465434	0.835	+	.	transcript "+30"
Adh	HMMGene	stop_codon	465432	465434	.	+	.	transcript "+30"
Adh	HMMGene	start_codon	471109	471111	.	+	.	transcript "+31"
Adh	HMMGene	CDS	471109	471296	1.000	+	.	transcript "+31"
Adh	HMMGene	CDS	471441	471687	1.000	+	.	transcript "+31"
Adh	HMMGene	CDS	471752	471856	1.000	+	.	transcript "+31"
Adh	HMMGene	CDS	471944	472490	1.000	+	.	transcript "+31"
Adh	HMMGene	CDS	472557	472823	1.000	+	.	transcript "+31"
Adh	HMMGene	CDS	472965	473128	1.000	+	.	transcript "+31"
Adh	HMMGene	stop_codon	473126	473128	.	+	.	transcript "+31"
Adh	HMMGene	start_codon	473959	473961	.	+	.	transcript "+32"
Adh	HMMGene	CDS	473959	474023	0.697	+	.	transcript "+32"
Adh	HMMGene	CDS	474087	474189	0.696	+	.	transcript "+32"
Adh	HMMGene	CDS	474251	474306	0.999	+	.	transcript "+32"
Adh	HMMGene	CDS	474341	475283	0.547	+	.	transcript "+32"
Adh	HMMGene	CDS	475427	476389	0.998	+	.	transcript "+32"
Adh	HMMGene	stop_codon	476387	476389	.	+	.	transcript "+32"
Adh	HMMGene	start_codon	506876	506878	.	+	.	transcript "+33"
Adh	HMMGene	CDS	506876	506887	0.155	+	.	transcript "+33"
Adh	HMMGene	CDS	509536	509783	0.245	+	.	transcript "+33"
Adh	HMMGene	CDS	509881	510226	1.000	+	.	transcript "+33"
Adh	HMMGene	CDS	510287	510775	0.998	+	.	transcript "+33"
Adh	HMMGene	CDS	511630	511658	0.998	+	.	transcript "+33"
Adh	HMMGene	CDS	511784	512375	1.000	+	.	transcript "+33"
Adh	HMMGene	CDS	512435	512758	1.000	+	.	transcript "+33"
Adh	HMMGene	stop_codon	512756	512758	.	+	.	transcript "+33"
Adh	HMMGene	start_codon	520781	520783	.	+	.	transcript "+34"
Adh	HMMGene	CDS	520781	521850	1.000	+	.	transcript "+34"
Adh	HMMGene	CDS	522013	522984	0.636	+	.	transcript "+34"
Adh	HMMGene	CDS	528099	528231	0.781	+	.	transcript "+34"
Adh	HMMGene	stop_codon	528229	528231	.	+	.	transcript "+34"
Adh	HMMGene	start_codon	541380	541382	.	+	.	transcript "+35"
Adh	HMMGene	CDS	541380	542513	0.986	+	.	transcript "+35"
Adh	HMMGene	stop_codon	542511	542513	.	+	.	transcript "+35"
Adh	HMMGene	start_codon	555360	555362	.	+	.	transcript "+36"
Adh	HMMGene	CDS	555360	555824	0.998	+	.	transcript "+36"
Adh	HMMGene	CDS	555920	556168	0.730	+	.	transcript "+36"
Adh	HMMGene	CDS	570329	570728	0.922	+	.	transcript "+36"
Adh	HMMGene	CDS	574289	574483	0.991	+	.	transcript "+36"
Adh	HMMGene	CDS	575409	575495	0.439	+	.	transcript "+36"
Adh	HMMGene	CDS	577942	577964	0.047	+	.	transcript "+36"
Adh	HMMGene	stop_codon	577962	577964	.	+	.	transcript "+36"
Adh	HMMGene	start_codon	598403	598405	.	+	.	transcript "+37"
Adh	HMMGene	CDS	598403	598796	0.997	+	.	transcript "+37"
Adh	HMMGene	CDS	598857	599119	0.999	+	.	transcript "+37"
Adh	HMMGene	CDS	599219	600433	0.976	+	.	transcript "+37"
Adh	HMMGene	stop_codon	600431	600433	.	+	.	transcript "+37"
Adh	HMMGene	start_codon	650075	650077	.	+	.	transcript "+38"
Adh	HMMGene	CDS	650075	650110	0.504	+	.	transcript "+38"
Adh	HMMGene	CDS	650611	651153	0.997	+	.	transcript "+38"
Adh	HMMGene	CDS	651278	651478	0.998	+	.	transcript "+38"
Adh	HMMGene	CDS	651583	652282	1.000	+	.	transcript "+38"
Adh	HMMGene	CDS	652397	652824	0.961	+	.	transcript "+38"
Adh	HMMGene	stop_codon	652822	652824	.	+	.	transcript "+38"
Adh	HMMGene	start_codon	757457	757459	.	+	.	transcript "+39"
Adh	HMMGene	CDS	757457	757873	0.650	+	.	transcript "+39"
Adh	HMMGene	stop_codon	757871	757873	.	+	.	transcript "+39"
Adh	HMMGene	start_codon	54448	54450	.	+	.	transcript "+4"
Adh	HMMGene	CDS	54448	55365	0.519	+	.	transcript "+4"
Adh	HMMGene	CDS	59029	59049	0.236	+	.	transcript "+4"
Adh	HMMGene	stop_codon	59047	59049	.	+	.	transcript "+4"
Adh	HMMGene	start_codon	771216	771218	.	+	.	transcript "+40"
Adh	HMMGene	CDS	771216	771615	0.980	+	.	transcript "+40"
Adh	HMMGene	CDS	771955	772295	1.000	+	.	transcript "+40"
Adh	HMMGene	CDS	779692	781583	1.000	+	.	transcript "+40"
Adh	HMMGene	CDS	781778	781853	0.999	+	.	transcript "+40"
Adh	HMMGene	CDS	781893	782726	0.604	+	.	transcript "+40"
Adh	HMMGene	stop_codon	782724	782726	.	+	.	transcript "+40"
Adh	HMMGene	start_codon	801924	801926	.	+	.	transcript "+41"
Adh	HMMGene	CDS	801924	802961	0.921	+	.	transcript "+41"
Adh	HMMGene	stop_codon	802959	802961	.	+	.	transcript "+41"
Adh	HMMGene	start_codon	808300	808302	.	+	.	transcript "+42"
Adh	HMMGene	CDS	808300	808365	0.283	+	.	transcript "+42"
Adh	HMMGene	CDS	813257	814650	0.478	+	.	transcript "+42"
Adh	HMMGene	CDS	814726	814981	0.998	+	.	transcript "+42"
Adh	HMMGene	CDS	815046	815442	1.000	+	.	transcript "+42"
Adh	HMMGene	CDS	815528	817215	1.000	+	.	transcript "+42"
Adh	HMMGene	CDS	817273	818025	1.000	+	.	transcript "+42"
Adh	HMMGene	CDS	818086	818367	1.000	+	.	transcript "+42"
Adh	HMMGene	CDS	818447	818574	0.987	+	.	transcript "+42"
Adh	HMMGene	CDS	818633	819290	1.000	+	.	transcript "+42"
Adh	HMMGene	CDS	820171	820789	1.000	+	.	transcript "+42"
Adh	HMMGene	CDS	820846	820979	1.000	+	.	transcript "+42"
Adh	HMMGene	CDS	821037	821265	0.998	+	.	transcript "+42"
Adh	HMMGene	CDS	821333	821459	0.003	+	.	transcript "+42"
Adh	HMMGene	CDS	822240	822498	0.002	+	.	transcript "+42"
Adh	HMMGene	CDS	822567	822848	0.324	+	.	transcript "+42"
Adh	HMMGene	CDS	822907	824011	0.996	+	.	transcript "+42"
Adh	HMMGene	CDS	824074	824822	0.999	+	.	transcript "+42"
Adh	HMMGene	CDS	824885	825693	0.642	+	.	transcript "+42"
Adh	HMMGene	CDS	825920	826423	0.534	+	.	transcript "+42"
Adh	HMMGene	CDS	826499	826653	0.664	+	.	transcript "+42"
Adh	HMMGene	CDS	826714	826921	0.711	+	.	transcript "+42"
Adh	HMMGene	CDS	826980	827087	0.996	+	.	transcript "+42"
Adh	HMMGene	CDS	827148	827511	0.991	+	.	transcript "+42"
Adh	HMMGene	stop_codon	827509	827511	.	+	.	transcript "+42"
Adh	HMMGene	start_codon	828047	828049	.	+	.	transcript "+43"
Adh	HMMGene	CDS	828047	828306	0.990	+	.	transcript "+43"
Adh	HMMGene	CDS	832073	833672	0.153	+	.	transcript "+43"
Adh	HMMGene	stop_codon	833670	833672	.	+	.	transcript "+43"
Adh	HMMGene	start_codon	835092	835094	.	+	.	transcript "+44"
Adh	HMMGene	CDS	835092	835312	0.978	+	.	transcript "+44"
Adh	HMMGene	CDS	836514	837106	0.962	+	.	transcript "+44"
Adh	HMMGene	CDS	837173	837428	0.987	+	.	transcript "+44"
Adh	HMMGene	CDS	837486	837859	1.000	+	.	transcript "+44"
Adh	HMMGene	CDS	837919	838152	1.000	+	.	transcript "+44"
Adh	HMMGene	CDS	838217	839076	1.000	+	.	transcript "+44"
Adh	HMMGene	stop_codon	839074	839076	.	+	.	transcript "+44"
Adh	HMMGene	start_codon	845892	845894	.	+	.	transcript "+45"
Adh	HMMGene	CDS	845892	846081	0.992	+	.	transcript "+45"
Adh	HMMGene	CDS	846134	846339	0.989	+	.	transcript "+45"
Adh	HMMGene	stop_codon	846337	846339	.	+	.	transcript "+45"
Adh	HMMGene	start_codon	851085	851087	.	+	.	transcript "+46"
Adh	HMMGene	CDS	851085	851190	0.992	+	.	transcript "+46"
Adh	HMMGene	CDS	851256	851436	0.551	+	.	transcript "+46"
Adh	HMMGene	CDS	851491	851673	0.551	+	.	transcript "+46"
Adh	HMMGene	CDS	851742	851919	1.000	+	.	transcript "+46"
Adh	HMMGene	stop_codon	851917	851919	.	+	.	transcript "+46"
Adh	HMMGene	start_codon	853119	853121	.	+	.	transcript "+47"
Adh	HMMGene	CDS	853119	855014	0.591	+	.	transcript "+47"
Adh	HMMGene	stop_codon	855012	855014	.	+	.	transcript "+47"
Adh	HMMGene	start_codon	855874	855876	.	+	.	transcript "+48"
Adh	HMMGene	CDS	855874	855937	0.555	+	.	transcript "+48"
Adh	HMMGene	CDS	855982	856031	1.000	+	.	transcript "+48"
Adh	HMMGene	CDS	856092	856876	1.000	+	.	transcript "+48"
Adh	HMMGene	CDS	856942	858029	1.000	+	.	transcript "+48"
Adh	HMMGene	CDS	858109	858341	1.000	+	.	transcript "+48"
Adh	HMMGene	CDS	858418	858966	1.000	+	.	transcript "+48"
Adh	HMMGene	stop_codon	858964	858966	.	+	.	transcript "+48"
Adh	HMMGene	start_codon	984981	984983	.	+	.	transcript "+49"
Adh	HMMGene	CDS	984981	985070	1.000	+	.	transcript "+49"
Adh	HMMGene	CDS	985373	986896	0.996	+	.	transcript "+49"
Adh	HMMGene	stop_codon	986894	986896	.	+	.	transcript "+49"
Adh	HMMGene	start_codon	121768	121770	.	+	.	transcript "+5"
Adh	HMMGene	CDS	121768	121846	0.473	+	.	transcript "+5"
Adh	HMMGene	CDS	124458	124936	0.669	+	.	transcript "+5"
Adh	HMMGene	CDS	127146	127292	0.669	+	.	transcript "+5"
Adh	HMMGene	CDS	127771	127931	0.669	+	.	transcript "+5"
Adh	HMMGene	CDS	127991	128225	0.669	+	.	transcript "+5"
Adh	HMMGene	CDS	128296	129342	0.595	+	.	transcript "+5"
Adh	HMMGene	CDS	129401	129965	0.669	+	.	transcript "+5"
Adh	HMMGene	CDS	131040	131248	0.662	+	.	transcript "+5"
Adh	HMMGene	stop_codon	131246	131248	.	+	.	transcript "+5"
Adh	HMMGene	start_codon	1018661	1018663	.	+	.	transcript "+50"
Adh	HMMGene	CDS	1018661	1018717	0.861	+	.	transcript "+50"
Adh	HMMGene	CDS	1018766	1018799	0.141	+	.	transcript "+50"
Adh	HMMGene	CDS	1024614	1024648	0.001	+	.	transcript "+50"
Adh	HMMGene	stop_codon	1024646	1024648	.	+	.	transcript "+50"
Adh	HMMGene	start_codon	1099868	1099870	.	+	.	transcript "+51"
Adh	HMMGene	CDS	1099868	1099941	0.744	+	.	transcript "+51"
Adh	HMMGene	CDS	1103544	1103658	0.039	+	.	transcript "+51"
Adh	HMMGene	stop_codon	1103656	1103658	.	+	.	transcript "+51"
Adh	HMMGene	start_codon	1110074	1110076	.	+	.	transcript "+52"
Adh	HMMGene	CDS	1110074	1110172	1.000	+	.	transcript "+52"
Adh	HMMGene	CDS	1110238	1110642	1.000	+	.	transcript "+52"
Adh	HMMGene	CDS	1110713	1110979	1.000	+	.	transcript "+52"
Adh	HMMGene	stop_codon	1110977	1110979	.	+	.	transcript "+52"
Adh	HMMGene	start_codon	1111283	1111285	.	+	.	transcript "+53"
Adh	HMMGene	CDS	1111283	1111378	0.997	+	.	transcript "+53"
Adh	HMMGene	CDS	1111805	1112209	0.978	+	.	transcript "+53"
Adh	HMMGene	CDS	1112261	1112578	1.000	+	.	transcript "+53"
Adh	HMMGene	stop_codon	1112576	1112578	.	+	.	transcript "+53"
Adh	HMMGene	start_codon	1151931	1151933	.	+	.	transcript "+54"
Adh	HMMGene	CDS	1151931	1152002	0.566	+	.	transcript "+54"
Adh	HMMGene	stop_codon	1152000	1152002	.	+	.	transcript "+54"
Adh	HMMGene	start_codon	1207563	1207565	.	+	.	transcript "+55"
Adh	HMMGene	CDS	1207563	1207574	1.000	+	.	transcript "+55"
Adh	HMMGene	CDS	1207666	1207953	0.999	+	.	transcript "+55"
Adh	HMMGene	stop_codon	1207951	1207953	.	+	.	transcript "+55"
Adh	HMMGene	start_codon	1229684	1229686	.	+	.	transcript "+56"
Adh	HMMGene	CDS	1229684	1230733	0.910	+	.	transcript "+56"
Adh	HMMGene	stop_codon	1230731	1230733	.	+	.	transcript "+56"
Adh	HMMGene	start_codon	1232958	1232960	.	+	.	transcript "+57"
Adh	HMMGene	CDS	1232958	1232969	0.451	+	.	transcript "+57"
Adh	HMMGene	CDS	1233044	1233280	0.451	+	.	transcript "+57"
Adh	HMMGene	stop_codon	1233278	1233280	.	+	.	transcript "+57"
Adh	HMMGene	start_codon	1250633	1250635	.	+	.	transcript "+58"
Adh	HMMGene	CDS	1250633	1251421	0.990	+	.	transcript "+58"
Adh	HMMGene	stop_codon	1251419	1251421	.	+	.	transcript "+58"
Adh	HMMGene	start_codon	1252523	1252525	.	+	.	transcript "+59"
Adh	HMMGene	CDS	1252523	1253617	0.979	+	.	transcript "+59"
Adh	HMMGene	stop_codon	1253615	1253617	.	+	.	transcript "+59"
Adh	HMMGene	start_codon	159578	159580	.	+	.	transcript "+6"
Adh	HMMGene	CDS	159578	159874	0.614	+	.	transcript "+6"
Adh	HMMGene	CDS	161727	162105	0.669	+	.	transcript "+6"
Adh	HMMGene	CDS	162442	162557	0.669	+	.	transcript "+6"
Adh	HMMGene	CDS	162616	163137	0.669	+	.	transcript "+6"
Adh	HMMGene	CDS	163297	163527	0.669	+	.	transcript "+6"
Adh	HMMGene	stop_codon	163525	163527	.	+	.	transcript "+6"
Adh	HMMGene	start_codon	1255669	1255671	.	+	.	transcript "+60"
Adh	HMMGene	CDS	1255669	1256823	1.000	+	.	transcript "+60"
Adh	HMMGene	stop_codon	1256821	1256823	.	+	.	transcript "+60"
Adh	HMMGene	start_codon	1313738	1313740	.	+	.	transcript "+61"
Adh	HMMGene	CDS	1313738	1313741	0.277	+	.	transcript "+61"
Adh	HMMGene	CDS	1319145	1319185	0.333	+	.	transcript "+61"
Adh	HMMGene	stop_codon	1319183	1319185	.	+	.	transcript "+61"
Adh	HMMGene	start_codon	1388883	1388885	.	+	.	transcript "+62"
Adh	HMMGene	CDS	1388883	1388891	0.023	+	.	transcript "+62"
Adh	HMMGene	CDS	1388965	1388979	0.043	+	.	transcript "+62"
Adh	HMMGene	stop_codon	1388977	1388979	.	+	.	transcript "+62"
Adh	HMMGene	start_codon	1412363	1412365	.	+	.	transcript "+63"
Adh	HMMGene	CDS	1412363	1412556	0.926	+	.	transcript "+63"
Adh	HMMGene	CDS	1415698	1418081	0.972	+	.	transcript "+63"
Adh	HMMGene	CDS	1418142	1419321	1.000	+	.	transcript "+63"
Adh	HMMGene	CDS	1419378	1419918	1.000	+	.	transcript "+63"
Adh	HMMGene	stop_codon	1419916	1419918	.	+	.	transcript "+63"
Adh	HMMGene	start_codon	1495484	1495486	.	+	.	transcript "+64"
Adh	HMMGene	CDS	1495484	1495522	1.000	+	.	transcript "+64"
Adh	HMMGene	CDS	1495620	1495919	1.000	+	.	transcript "+64"
Adh	HMMGene	CDS	1495977	1496198	1.000	+	.	transcript "+64"
Adh	HMMGene	stop_codon	1496196	1496198	.	+	.	transcript "+64"
Adh	HMMGene	start_codon	1497576	1497578	.	+	.	transcript "+65"
Adh	HMMGene	CDS	1497576	1498121	0.880	+	.	transcript "+65"
Adh	HMMGene	stop_codon	1498119	1498121	.	+	.	transcript "+65"
Adh	HMMGene	start_codon	1499670	1499672	.	+	.	transcript "+66"
Adh	HMMGene	CDS	1499670	1500870	0.839	+	.	transcript "+66"
Adh	HMMGene	CDS	1510817	1510998	0.725	+	.	transcript "+66"
Adh	HMMGene	CDS	1515041	1515175	0.998	+	.	transcript "+66"
Adh	HMMGene	CDS	1515266	1515436	0.997	+	.	transcript "+66"
Adh	HMMGene	CDS	1515498	1515714	0.618	+	.	transcript "+66"
Adh	HMMGene	CDS	1515849	1515972	0.556	+	.	transcript "+66"
Adh	HMMGene	CDS	1516036	1516279	0.998	+	.	transcript "+66"
Adh	HMMGene	CDS	1516339	1516488	0.955	+	.	transcript "+66"
Adh	HMMGene	CDS	1517244	1518775	0.263	+	.	transcript "+66"
Adh	HMMGene	CDS	1519441	1519564	0.971	+	.	transcript "+66"
Adh	HMMGene	CDS	1519636	1519752	0.994	+	.	transcript "+66"
Adh	HMMGene	CDS	1519816	1520023	0.831	+	.	transcript "+66"
Adh	HMMGene	CDS	1520081	1520337	0.982	+	.	transcript "+66"
Adh	HMMGene	CDS	1520398	1520544	0.894	+	.	transcript "+66"
Adh	HMMGene	stop_codon	1520542	1520544	.	+	.	transcript "+66"
Adh	HMMGene	start_codon	1525215	1525217	.	+	.	transcript "+67"
Adh	HMMGene	CDS	1525215	1525447	0.877	+	.	transcript "+67"
Adh	HMMGene	CDS	1526237	1526642	1.000	+	.	transcript "+67"
Adh	HMMGene	CDS	1526702	1527379	1.000	+	.	transcript "+67"
Adh	HMMGene	stop_codon	1527377	1527379	.	+	.	transcript "+67"
Adh	HMMGene	start_codon	1529588	1529590	.	+	.	transcript "+68"
Adh	HMMGene	CDS	1529588	1529971	1.000	+	.	transcript "+68"
Adh	HMMGene	CDS	1530746	1531626	1.000	+	.	transcript "+68"
Adh	HMMGene	CDS	1531685	1531892	1.000	+	.	transcript "+68"
Adh	HMMGene	CDS	1531958	1532269	1.000	+	.	transcript "+68"
Adh	HMMGene	stop_codon	1532267	1532269	.	+	.	transcript "+68"
Adh	HMMGene	start_codon	1551462	1551464	.	+	.	transcript "+69"
Adh	HMMGene	CDS	1551462	1551470	0.005	+	.	transcript "+69"
Adh	HMMGene	CDS	1552390	1552452	0.001	+	.	transcript "+69"
Adh	HMMGene	stop_codon	1552450	1552452	.	+	.	transcript "+69"
Adh	HMMGene	start_codon	164127	164129	.	+	.	transcript "+7"
Adh	HMMGene	CDS	164127	164417	0.667	+	.	transcript "+7"
Adh	HMMGene	stop_codon	164415	164417	.	+	.	transcript "+7"
Adh	HMMGene	start_codon	1558057	1558059	.	+	.	transcript "+70"
Adh	HMMGene	CDS	1558057	1558080	1.000	+	.	transcript "+70"
Adh	HMMGene	CDS	1558134	1558521	1.000	+	.	transcript "+70"
Adh	HMMGene	CDS	1558685	1558960	0.492	+	.	transcript "+70"
Adh	HMMGene	CDS	1561989	1562278	0.744	+	.	transcript "+70"
Adh	HMMGene	CDS	1562338	1563081	1.000	+	.	transcript "+70"
Adh	HMMGene	CDS	1563140	1563353	1.000	+	.	transcript "+70"
Adh	HMMGene	CDS	1563418	1563689	1.000	+	.	transcript "+70"
Adh	HMMGene	CDS	1563761	1563814	0.986	+	.	transcript "+70"
Adh	HMMGene	stop_codon	1563812	1563814	.	+	.	transcript "+70"
Adh	HMMGene	start_codon	1565296	1565298	.	+	.	transcript "+71"
Adh	HMMGene	CDS	1565296	1565530	0.809	+	.	transcript "+71"
Adh	HMMGene	CDS	1576691	1576943	0.999	+	.	transcript "+71"
Adh	HMMGene	CDS	1577036	1577406	1.000	+	.	transcript "+71"
Adh	HMMGene	CDS	1577568	1577860	0.992	+	.	transcript "+71"
Adh	HMMGene	CDS	1577926	1578081	0.917	+	.	transcript "+71"
Adh	HMMGene	CDS	1580550	1580685	0.972	+	.	transcript "+71"
Adh	HMMGene	CDS	1580750	1580880	0.926	+	.	transcript "+71"
Adh	HMMGene	CDS	1580946	1581227	0.957	+	.	transcript "+71"
Adh	HMMGene	CDS	1581294	1581623	0.999	+	.	transcript "+71"
Adh	HMMGene	CDS	1581774	1582136	1.000	+	.	transcript "+71"
Adh	HMMGene	CDS	1582201	1582292	1.000	+	.	transcript "+71"
Adh	HMMGene	CDS	1583070	1583334	1.000	+	.	transcript "+71"
Adh	HMMGene	CDS	1584330	1584828	0.950	+	.	transcript "+71"
Adh	HMMGene	CDS	1584949	1585094	1.000	+	.	transcript "+71"
Adh	HMMGene	CDS	1585153	1585380	0.999	+	.	transcript "+71"
Adh	HMMGene	stop_codon	1585378	1585380	.	+	.	transcript "+71"
Adh	HMMGene	start_codon	1599218	1599220	.	+	.	transcript "+72"
Adh	HMMGene	CDS	1599218	1600177	0.826	+	.	transcript "+72"
Adh	HMMGene	CDS	1601693	1602527	0.117	+	.	transcript "+72"
Adh	HMMGene	CDS	1603187	1603284	0.135	+	.	transcript "+72"
Adh	HMMGene	CDS	1603379	1603885	0.127	+	.	transcript "+72"
Adh	HMMGene	CDS	1603951	1605400	0.998	+	.	transcript "+72"
Adh	HMMGene	CDS	1605435	1605494	1.000	+	.	transcript "+72"
Adh	HMMGene	CDS	1605578	1605603	1.000	+	.	transcript "+72"
Adh	HMMGene	CDS	1605661	1606718	1.000	+	.	transcript "+72"
Adh	HMMGene	CDS	1606791	1607142	1.000	+	.	transcript "+72"
Adh	HMMGene	CDS	1607205	1607306	1.000	+	.	transcript "+72"
Adh	HMMGene	stop_codon	1607304	1607306	.	+	.	transcript "+72"
Adh	HMMGene	start_codon	1738791	1738793	.	+	.	transcript "+73"
Adh	HMMGene	CDS	1738791	1739218	0.998	+	.	transcript "+73"
Adh	HMMGene	CDS	1740300	1740540	0.998	+	.	transcript "+73"
Adh	HMMGene	CDS	1740659	1740939	1.000	+	.	transcript "+73"
Adh	HMMGene	CDS	1740995	1742042	0.996	+	.	transcript "+73"
Adh	HMMGene	CDS	1742104	1742446	1.000	+	.	transcript "+73"
Adh	HMMGene	CDS	1742886	1743193	0.999	+	.	transcript "+73"
Adh	HMMGene	stop_codon	1743191	1743193	.	+	.	transcript "+73"
Adh	HMMGene	start_codon	1746303	1746305	.	+	.	transcript "+74"
Adh	HMMGene	CDS	1746303	1746349	0.998	+	.	transcript "+74"
Adh	HMMGene	CDS	1746401	1746842	1.000	+	.	transcript "+74"
Adh	HMMGene	stop_codon	1746840	1746842	.	+	.	transcript "+74"
Adh	HMMGene	start_codon	1774679	1774681	.	+	.	transcript "+75"
Adh	HMMGene	CDS	1774679	1775557	0.462	+	.	transcript "+75"
Adh	HMMGene	stop_codon	1775555	1775557	.	+	.	transcript "+75"
Adh	HMMGene	start_codon	1787599	1787601	.	+	.	transcript "+76"
Adh	HMMGene	CDS	1787599	1788915	0.968	+	.	transcript "+76"
Adh	HMMGene	stop_codon	1788913	1788915	.	+	.	transcript "+76"
Adh	HMMGene	start_codon	1823746	1823748	.	+	.	transcript "+77"
Adh	HMMGene	CDS	1823746	1825158	0.992	+	.	transcript "+77"
Adh	HMMGene	stop_codon	1825156	1825158	.	+	.	transcript "+77"
Adh	HMMGene	start_codon	1923109	1923111	.	+	.	transcript "+78"
Adh	HMMGene	CDS	1923109	1924563	0.856	+	.	transcript "+78"
Adh	HMMGene	stop_codon	1924561	1924563	.	+	.	transcript "+78"
Adh	HMMGene	start_codon	1974488	1974490	.	+	.	transcript "+79"
Adh	HMMGene	CDS	1974488	1975018	0.972	+	.	transcript "+79"
Adh	HMMGene	stop_codon	1975016	1975018	.	+	.	transcript "+79"
Adh	HMMGene	start_codon	202128	202130	.	+	.	transcript "+8"
Adh	HMMGene	CDS	202128	202646	0.493	+	.	transcript "+8"
Adh	HMMGene	CDS	202700	204199	0.669	+	.	transcript "+8"
Adh	HMMGene	stop_codon	204197	204199	.	+	.	transcript "+8"
Adh	HMMGene	start_codon	1988872	1988874	.	+	.	transcript "+80"
Adh	HMMGene	CDS	1988872	1989075	1.000	+	.	transcript "+80"
Adh	HMMGene	CDS	1991768	1992877	1.000	+	.	transcript "+80"
Adh	HMMGene	CDS	1992942	1993204	1.000	+	.	transcript "+80"
Adh	HMMGene	CDS	1993350	1993566	1.000	+	.	transcript "+80"
Adh	HMMGene	stop_codon	1993564	1993566	.	+	.	transcript "+80"
Adh	HMMGene	start_codon	2040123	2040125	.	+	.	transcript "+81"
Adh	HMMGene	CDS	2040123	2040280	1.000	+	.	transcript "+81"
Adh	HMMGene	CDS	2040432	2040693	0.891	+	.	transcript "+81"
Adh	HMMGene	stop_codon	2040691	2040693	.	+	.	transcript "+81"
Adh	HMMGene	start_codon	2068604	2068606	.	+	.	transcript "+82"
Adh	HMMGene	CDS	2068604	2070501	0.993	+	.	transcript "+82"
Adh	HMMGene	CDS	2071510	2072677	1.000	+	.	transcript "+82"
Adh	HMMGene	stop_codon	2072675	2072677	.	+	.	transcript "+82"
Adh	HMMGene	start_codon	2106963	2106965	.	+	.	transcript "+83"
Adh	HMMGene	CDS	2106963	2107415	0.768	+	.	transcript "+83"
Adh	HMMGene	CDS	2118356	2118551	0.768	+	.	transcript "+83"
Adh	HMMGene	CDS	2118614	2119161	1.000	+	.	transcript "+83"
Adh	HMMGene	stop_codon	2119159	2119161	.	+	.	transcript "+83"
Adh	HMMGene	start_codon	2119874	2119876	.	+	.	transcript "+84"
Adh	HMMGene	CDS	2119874	2120025	0.390	+	.	transcript "+84"
Adh	HMMGene	CDS	2120092	2120194	0.968	+	.	transcript "+84"
Adh	HMMGene	CDS	2120312	2121269	1.000	+	.	transcript "+84"
Adh	HMMGene	CDS	2121336	2121745	0.963	+	.	transcript "+84"
Adh	HMMGene	stop_codon	2121743	2121745	.	+	.	transcript "+84"
Adh	HMMGene	start_codon	2149035	2149037	.	+	.	transcript "+85"
Adh	HMMGene	CDS	2149035	2149037	0.413	+	.	transcript "+85"
Adh	HMMGene	CDS	2149741	2150907	0.522	+	.	transcript "+85"
Adh	HMMGene	stop_codon	2150905	2150907	.	+	.	transcript "+85"
Adh	HMMGene	start_codon	2154299	2154301	.	+	.	transcript "+86"
Adh	HMMGene	CDS	2154299	2154363	0.969	+	.	transcript "+86"
Adh	HMMGene	CDS	2158289	2158329	0.990	+	.	transcript "+86"
Adh	HMMGene	CDS	2158655	2159460	0.979	+	.	transcript "+86"
Adh	HMMGene	stop_codon	2159458	2159460	.	+	.	transcript "+86"
Adh	HMMGene	start_codon	2179005	2179007	.	+	.	transcript "+87"
Adh	HMMGene	CDS	2179005	2179181	0.226	+	.	transcript "+87"
Adh	HMMGene	stop_codon	2179179	2179181	.	+	.	transcript "+87"
Adh	HMMGene	start_codon	2183016	2183018	.	+	.	transcript "+88"
Adh	HMMGene	CDS	2183016	2183104	0.353	+	.	transcript "+88"
Adh	HMMGene	CDS	2184556	2184562	0.178	+	.	transcript "+88"
Adh	HMMGene	stop_codon	2184560	2184562	.	+	.	transcript "+88"
Adh	HMMGene	start_codon	2204183	2204185	.	+	.	transcript "+89"
Adh	HMMGene	CDS	2204183	2205278	0.971	+	.	transcript "+89"
Adh	HMMGene	CDS	2205332	2207403	1.000	+	.	transcript "+89"
Adh	HMMGene	stop_codon	2207401	2207403	.	+	.	transcript "+89"
Adh	HMMGene	start_codon	229944	229946	.	+	.	transcript "+9"
Adh	HMMGene	CDS	229944	230462	0.669	+	.	transcript "+9"
Adh	HMMGene	stop_codon	230460	230462	.	+	.	transcript "+9"
Adh	HMMGene	start_codon	2216202	2216204	.	+	.	transcript "+90"
Adh	HMMGene	CDS	2216202	2216447	1.000	+	.	transcript "+90"
Adh	HMMGene	CDS	2216609	2217034	1.000	+	.	transcript "+90"
Adh	HMMGene	CDS	2217099	2217403	0.581	+	.	transcript "+90"
Adh	HMMGene	CDS	2217501	2217537	0.834	+	.	transcript "+90"
Adh	HMMGene	stop_codon	2217535	2217537	.	+	.	transcript "+90"
Adh	HMMGene	start_codon	2303372	2303374	.	+	.	transcript "+91"
Adh	HMMGene	CDS	2303372	2303375	0.999	+	.	transcript "+91"
Adh	HMMGene	CDS	2303428	2304641	0.996	+	.	transcript "+91"
Adh	HMMGene	stop_codon	2304639	2304641	.	+	.	transcript "+91"
Adh	HMMGene	start_codon	2305038	2305040	.	+	.	transcript "+92"
Adh	HMMGene	CDS	2305038	2305397	0.999	+	.	transcript "+92"
Adh	HMMGene	CDS	2305489	2305763	1.000	+	.	transcript "+92"
Adh	HMMGene	CDS	2305829	2306951	0.975	+	.	transcript "+92"
Adh	HMMGene	stop_codon	2306949	2306951	.	+	.	transcript "+92"
Adh	HMMGene	start_codon	2367613	2367615	.	+	.	transcript "+93"
Adh	HMMGene	CDS	2367613	2367685	0.601	+	.	transcript "+93"
Adh	HMMGene	CDS	2367806	2368068	0.587	+	.	transcript "+93"
Adh	HMMGene	stop_codon	2368066	2368068	.	+	.	transcript "+93"
Adh	HMMGene	start_codon	2374085	2374087	.	+	.	transcript "+94"
Adh	HMMGene	CDS	2374085	2374294	0.973	+	.	transcript "+94"
Adh	HMMGene	CDS	2374356	2375201	0.980	+	.	transcript "+94"
Adh	HMMGene	CDS	2375254	2375481	0.887	+	.	transcript "+94"
Adh	HMMGene	stop_codon	2375479	2375481	.	+	.	transcript "+94"
Adh	HMMGene	start_codon	2392181	2392183	.	+	.	transcript "+95"
Adh	HMMGene	CDS	2392181	2392737	0.861	+	.	transcript "+95"
Adh	HMMGene	CDS	2392800	2393095	0.463	+	.	transcript "+95"
Adh	HMMGene	CDS	2395264	2395280	0.095	+	.	transcript "+95"
Adh	HMMGene	stop_codon	2395278	2395280	.	+	.	transcript "+95"
Adh	HMMGene	start_codon	2428833	2428835	.	+	.	transcript "+96"
Adh	HMMGene	CDS	2428833	2429381	1.000	+	.	transcript "+96"
Adh	HMMGene	stop_codon	2429379	2429381	.	+	.	transcript "+96"
Adh	HMMGene	start_codon	2453955	2453957	.	+	.	transcript "+97"
Adh	HMMGene	CDS	2453955	2454119	0.976	+	.	transcript "+97"
Adh	HMMGene	stop_codon	2454117	2454119	.	+	.	transcript "+97"
Adh	HMMGene	start_codon	2479715	2479717	.	+	.	transcript "+98"
Adh	HMMGene	CDS	2479715	2479721	0.730	+	.	transcript "+98"
Adh	HMMGene	CDS	2481639	2481850	0.956	+	.	transcript "+98"
Adh	HMMGene	CDS	2483447	2483582	0.999	+	.	transcript "+98"
Adh	HMMGene	CDS	2483839	2483972	0.999	+	.	transcript "+98"
Adh	HMMGene	CDS	2486400	2486522	1.000	+	.	transcript "+98"
Adh	HMMGene	CDS	2486596	2486808	0.347	+	.	transcript "+98"
Adh	HMMGene	stop_codon	2486806	2486808	.	+	.	transcript "+98"
Adh	HMMGene	start_codon	2493314	2493316	.	+	.	transcript "+99"
Adh	HMMGene	CDS	2493314	2493620	0.970	+	.	transcript "+99"
Adh	HMMGene	CDS	2493682	2493731	0.868	+	.	transcript "+99"
Adh	HMMGene	CDS	2494047	2494116	0.768	+	.	transcript "+99"
Adh	HMMGene	CDS	2494180	2494259	1.000	+	.	transcript "+99"
Adh	HMMGene	CDS	2494325	2494651	1.000	+	.	transcript "+99"
Adh	HMMGene	CDS	2495100	2495225	1.000	+	.	transcript "+99"
Adh	HMMGene	CDS	2495286	2495667	0.999	+	.	transcript "+99"
Adh	HMMGene	CDS	2495861	2496988	0.999	+	.	transcript "+99"
Adh	HMMGene	CDS	2497217	2497464	0.997	+	.	transcript "+99"
Adh	HMMGene	stop_codon	2497462	2497464	.	+	.	transcript "+99"
Adh	HMMGene	CDS	2916879	2917012	1	-	.	transcript "-1"
Adh	HMMGene	stop_codon	2916879	2916881	.	-	.	transcript "-1"
Adh	HMMGene	CDS	2917311	2917504	1	-	.	transcript "-1"
Adh	HMMGene	CDS	2917751	2917988	1	-	.	transcript "-1"
Adh	HMMGene	CDS	2918253	2918513	1	-	.	transcript "-1"
Adh	HMMGene	CDS	2746815	2747453	0.000	-	.	transcript "-10"
Adh	HMMGene	stop_codon	2746815	2746817	.	-	.	transcript "-10"
Adh	HMMGene	CDS	2748132	2748572	0.000	-	.	transcript "-10"
Adh	HMMGene	start_codon	2748570	2748572	.	-	.	transcript "-10"
Adh	HMMGene	CDS	2741387	2741990	0.000	-	.	transcript "-11"
Adh	HMMGene	stop_codon	2741387	2741389	.	-	.	transcript "-11"
Adh	HMMGene	CDS	2742497	2742597	0.000	-	.	transcript "-11"
Adh	HMMGene	start_codon	2742595	2742597	.	-	.	transcript "-11"
Adh	HMMGene	CDS	2714781	2716277	0.375	-	.	transcript "-12"
Adh	HMMGene	stop_codon	2714781	2714783	.	-	.	transcript "-12"
Adh	HMMGene	CDS	2728123	2728429	0.376	-	.	transcript "-12"
Adh	HMMGene	CDS	2736358	2736449	0.000	-	.	transcript "-12"
Adh	HMMGene	start_codon	2736447	2736449	.	-	.	transcript "-12"
Adh	HMMGene	CDS	2709485	2710765	1.000	-	.	transcript "-13"
Adh	HMMGene	stop_codon	2709485	2709487	.	-	.	transcript "-13"
Adh	HMMGene	start_codon	2710763	2710765	.	-	.	transcript "-13"
Adh	HMMGene	CDS	2698932	2698966	0.967	-	.	transcript "-14"
Adh	HMMGene	stop_codon	2698932	2698934	.	-	.	transcript "-14"
Adh	HMMGene	CDS	2699341	2699410	0.634	-	.	transcript "-14"
Adh	HMMGene	CDS	2706336	2706347	0.849	-	.	transcript "-14"
Adh	HMMGene	start_codon	2706345	2706347	.	-	.	transcript "-14"
Adh	HMMGene	CDS	2696335	2696446	0.978	-	.	transcript "-15"
Adh	HMMGene	stop_codon	2696335	2696337	.	-	.	transcript "-15"
Adh	HMMGene	CDS	2696513	2696701	0.946	-	.	transcript "-15"
Adh	HMMGene	CDS	2697862	2698028	0.952	-	.	transcript "-15"
Adh	HMMGene	CDS	2698091	2698210	0.762	-	.	transcript "-15"
Adh	HMMGene	start_codon	2698208	2698210	.	-	.	transcript "-15"
Adh	HMMGene	CDS	2639412	2639418	0.001	-	.	transcript "-16"
Adh	HMMGene	stop_codon	2639412	2639414	.	-	.	transcript "-16"
Adh	HMMGene	CDS	2640882	2640886	0.000	-	.	transcript "-16"
Adh	HMMGene	start_codon	2640884	2640886	.	-	.	transcript "-16"
Adh	HMMGene	CDS	2584165	2584353	1.000	-	.	transcript "-17"
Adh	HMMGene	stop_codon	2584165	2584167	.	-	.	transcript "-17"
Adh	HMMGene	CDS	2584435	2584453	0.326	-	.	transcript "-17"
Adh	HMMGene	CDS	2585086	2585177	0.324	-	.	transcript "-17"
Adh	HMMGene	start_codon	2585175	2585177	.	-	.	transcript "-17"
Adh	HMMGene	CDS	2339377	2340474	0.963	-	.	transcript "-18"
Adh	HMMGene	stop_codon	2339377	2339379	.	-	.	transcript "-18"
Adh	HMMGene	CDS	2340535	2341630	1.000	-	.	transcript "-18"
Adh	HMMGene	CDS	2341682	2341790	0.998	-	.	transcript "-18"
Adh	HMMGene	CDS	2341973	2341993	1.000	-	.	transcript "-18"
Adh	HMMGene	CDS	2342049	2342274	1.000	-	.	transcript "-18"
Adh	HMMGene	CDS	2342341	2342602	0.966	-	.	transcript "-18"
Adh	HMMGene	CDS	2342664	2343851	0.981	-	.	transcript "-18"
Adh	HMMGene	CDS	2348166	2348316	0.462	-	.	transcript "-18"
Adh	HMMGene	CDS	2349690	2349890	0.579	-	.	transcript "-18"
Adh	HMMGene	CDS	2349968	2350879	0.828	-	.	transcript "-18"
Adh	HMMGene	CDS	2351853	2352026	0.519	-	.	transcript "-18"
Adh	HMMGene	CDS	2352080	2352985	0.005	-	.	transcript "-18"
Adh	HMMGene	CDS	2356993	2357164	0.945	-	.	transcript "-18"
Adh	HMMGene	CDS	2357224	2357495	0.935	-	.	transcript "-18"
Adh	HMMGene	CDS	2357539	2357674	1.000	-	.	transcript "-18"
Adh	HMMGene	CDS	2358742	2358953	0.996	-	.	transcript "-18"
Adh	HMMGene	CDS	2365992	2366304	0.390	-	.	transcript "-18"
Adh	HMMGene	start_codon	2366302	2366304	.	-	.	transcript "-18"
Adh	HMMGene	CDS	2328290	2328403	0.999	-	.	transcript "-19"
Adh	HMMGene	stop_codon	2328290	2328292	.	-	.	transcript "-19"
Adh	HMMGene	CDS	2328611	2329967	0.998	-	.	transcript "-19"
Adh	HMMGene	CDS	2330026	2330248	0.525	-	.	transcript "-19"
Adh	HMMGene	CDS	2330281	2330617	0.816	-	.	transcript "-19"
Adh	HMMGene	CDS	2331726	2331734	0.814	-	.	transcript "-19"
Adh	HMMGene	start_codon	2331732	2331734	.	-	.	transcript "-19"
Adh	HMMGene	CDS	2849759	2849784	1	-	.	transcript "-2"
Adh	HMMGene	stop_codon	2849759	2849761	.	-	.	transcript "-2"
Adh	HMMGene	CDS	2853744	2854099	1	-	.	transcript "-2"
Adh	HMMGene	CDS	2854197	2855206	1	-	.	transcript "-2"
Adh	HMMGene	CDS	2856104	2856157	1	-	.	transcript "-2"
Adh	HMMGene	start_codon	2856155	2856157	.	-	.	transcript "-2"
Adh	HMMGene	CDS	2220565	2222197	1.000	-	.	transcript "-20"
Adh	HMMGene	stop_codon	2220565	2220567	.	-	.	transcript "-20"
Adh	HMMGene	CDS	2222257	2222379	0.997	-	.	transcript "-20"
Adh	HMMGene	CDS	2222435	2222667	1.000	-	.	transcript "-20"
Adh	HMMGene	CDS	2222723	2222818	0.994	-	.	transcript "-20"
Adh	HMMGene	CDS	2223874	2224229	0.964	-	.	transcript "-20"
Adh	HMMGene	CDS	2224289	2224367	0.973	-	.	transcript "-20"
Adh	HMMGene	start_codon	2224365	2224367	.	-	.	transcript "-20"
Adh	HMMGene	CDS	2218555	2218905	1.000	-	.	transcript "-21"
Adh	HMMGene	stop_codon	2218555	2218557	.	-	.	transcript "-21"
Adh	HMMGene	CDS	2218966	2219871	1.000	-	.	transcript "-21"
Adh	HMMGene	CDS	2219932	2220057	0.998	-	.	transcript "-21"
Adh	HMMGene	start_codon	2220055	2220057	.	-	.	transcript "-21"
Adh	HMMGene	CDS	2209963	2211186	0.999	-	.	transcript "-22"
Adh	HMMGene	stop_codon	2209963	2209965	.	-	.	transcript "-22"
Adh	HMMGene	CDS	2211243	2211671	0.999	-	.	transcript "-22"
Adh	HMMGene	CDS	2212036	2212168	0.977	-	.	transcript "-22"
Adh	HMMGene	CDS	2213207	2213217	0.086	-	.	transcript "-22"
Adh	HMMGene	start_codon	2213215	2213217	.	-	.	transcript "-22"
Adh	HMMGene	CDS	2208922	2209531	0.991	-	.	transcript "-23"
Adh	HMMGene	stop_codon	2208922	2208924	.	-	.	transcript "-23"
Adh	HMMGene	CDS	2209593	2209876	0.999	-	.	transcript "-23"
Adh	HMMGene	start_codon	2209874	2209876	.	-	.	transcript "-23"
Adh	HMMGene	CDS	2201531	2201677	1.000	-	.	transcript "-24"
Adh	HMMGene	stop_codon	2201531	2201533	.	-	.	transcript "-24"
Adh	HMMGene	CDS	2202376	2202477	0.997	-	.	transcript "-24"
Adh	HMMGene	CDS	2202548	2202802	1.000	-	.	transcript "-24"
Adh	HMMGene	start_codon	2202800	2202802	.	-	.	transcript "-24"
Adh	HMMGene	CDS	2180707	2181374	1.000	-	.	transcript "-25"
Adh	HMMGene	stop_codon	2180707	2180709	.	-	.	transcript "-25"
Adh	HMMGene	CDS	2181408	2182662	1.000	-	.	transcript "-25"
Adh	HMMGene	CDS	2189454	2189790	0.996	-	.	transcript "-25"
Adh	HMMGene	CDS	2192614	2192725	0.000	-	.	transcript "-25"
Adh	HMMGene	CDS	2199659	2199764	0.000	-	.	transcript "-25"
Adh	HMMGene	start_codon	2199762	2199764	.	-	.	transcript "-25"
Adh	HMMGene	CDS	2151008	2151505	0.468	-	.	transcript "-26"
Adh	HMMGene	stop_codon	2151008	2151010	.	-	.	transcript "-26"
Adh	HMMGene	CDS	2151821	2151931	0.787	-	.	transcript "-26"
Adh	HMMGene	CDS	2157831	2157893	0.287	-	.	transcript "-26"
Adh	HMMGene	start_codon	2157891	2157893	.	-	.	transcript "-26"
Adh	HMMGene	CDS	2137486	2137679	0.947	-	.	transcript "-27"
Adh	HMMGene	stop_codon	2137486	2137488	.	-	.	transcript "-27"
Adh	HMMGene	CDS	2137746	2137902	1.000	-	.	transcript "-27"
Adh	HMMGene	CDS	2137961	2138116	0.996	-	.	transcript "-27"
Adh	HMMGene	CDS	2138186	2138671	1.000	-	.	transcript "-27"
Adh	HMMGene	CDS	2138733	2138970	0.997	-	.	transcript "-27"
Adh	HMMGene	CDS	2139065	2139169	0.985	-	.	transcript "-27"
Adh	HMMGene	CDS	2139824	2140056	0.999	-	.	transcript "-27"
Adh	HMMGene	CDS	2140148	2140353	0.995	-	.	transcript "-27"
Adh	HMMGene	CDS	2140417	2140630	1.000	-	.	transcript "-27"
Adh	HMMGene	CDS	2140705	2141412	1.000	-	.	transcript "-27"
Adh	HMMGene	CDS	2141468	2141749	1.000	-	.	transcript "-27"
Adh	HMMGene	CDS	2141998	2142513	0.290	-	.	transcript "-27"
Adh	HMMGene	start_codon	2142511	2142513	.	-	.	transcript "-27"
Adh	HMMGene	CDS	2105170	2105720	1.000	-	.	transcript "-28"
Adh	HMMGene	stop_codon	2105170	2105172	.	-	.	transcript "-28"
Adh	HMMGene	CDS	2105774	2105984	0.479	-	.	transcript "-28"
Adh	HMMGene	start_codon	2105982	2105984	.	-	.	transcript "-28"
Adh	HMMGene	CDS	2103622	2104169	0.999	-	.	transcript "-29"
Adh	HMMGene	stop_codon	2103622	2103624	.	-	.	transcript "-29"
Adh	HMMGene	CDS	2104226	2104442	1.000	-	.	transcript "-29"
Adh	HMMGene	start_codon	2104440	2104442	.	-	.	transcript "-29"
Adh	HMMGene	CDS	2804442	2805730	1	-	.	transcript "-3"
Adh	HMMGene	stop_codon	2804442	2804444	.	-	.	transcript "-3"
Adh	HMMGene	CDS	2805800	2805812	1	-	.	transcript "-3"
Adh	HMMGene	start_codon	2805810	2805812	.	-	.	transcript "-3"
Adh	HMMGene	CDS	2102169	2102722	0.997	-	.	transcript "-30"
Adh	HMMGene	stop_codon	2102169	2102171	.	-	.	transcript "-30"
Adh	HMMGene	CDS	2102776	2102977	0.575	-	.	transcript "-30"
Adh	HMMGene	start_codon	2102975	2102977	.	-	.	transcript "-30"
Adh	HMMGene	CDS	2100551	2101336	1.000	-	.	transcript "-31"
Adh	HMMGene	stop_codon	2100551	2100553	.	-	.	transcript "-31"
Adh	HMMGene	start_codon	2101334	2101336	.	-	.	transcript "-31"
Adh	HMMGene	CDS	1966319	1966327	0.402	-	.	transcript "-32"
Adh	HMMGene	stop_codon	1966319	1966321	.	-	.	transcript "-32"
Adh	HMMGene	CDS	1966485	1966560	0.345	-	.	transcript "-32"
Adh	HMMGene	CDS	1966590	1967758	0.850	-	.	transcript "-32"
Adh	HMMGene	start_codon	1967756	1967758	.	-	.	transcript "-32"
Adh	HMMGene	CDS	1934702	1934731	0.130	-	.	transcript "-33"
Adh	HMMGene	stop_codon	1934702	1934704	.	-	.	transcript "-33"
Adh	HMMGene	CDS	1934862	1934888	0.139	-	.	transcript "-33"
Adh	HMMGene	start_codon	1934886	1934888	.	-	.	transcript "-33"
Adh	HMMGene	CDS	1913374	1914932	1.000	-	.	transcript "-34"
Adh	HMMGene	stop_codon	1913374	1913376	.	-	.	transcript "-34"
Adh	HMMGene	CDS	1914995	1915082	0.999	-	.	transcript "-34"
Adh	HMMGene	start_codon	1915080	1915082	.	-	.	transcript "-34"
Adh	HMMGene	CDS	1850650	1851240	0.949	-	.	transcript "-35"
Adh	HMMGene	stop_codon	1850650	1850652	.	-	.	transcript "-35"
Adh	HMMGene	start_codon	1851238	1851240	.	-	.	transcript "-35"
Adh	HMMGene	CDS	1807761	1808498	0.996	-	.	transcript "-36"
Adh	HMMGene	stop_codon	1807761	1807763	.	-	.	transcript "-36"
Adh	HMMGene	start_codon	1808496	1808498	.	-	.	transcript "-36"
Adh	HMMGene	CDS	1781133	1781780	0.337	-	.	transcript "-37"
Adh	HMMGene	stop_codon	1781133	1781135	.	-	.	transcript "-37"
Adh	HMMGene	start_codon	1781778	1781780	.	-	.	transcript "-37"
Adh	HMMGene	CDS	1763921	1764031	0.853	-	.	transcript "-38"
Adh	HMMGene	stop_codon	1763921	1763923	.	-	.	transcript "-38"
Adh	HMMGene	CDS	1764285	1764501	0.995	-	.	transcript "-38"
Adh	HMMGene	CDS	1764574	1764638	0.950	-	.	transcript "-38"
Adh	HMMGene	start_codon	1764636	1764638	.	-	.	transcript "-38"
Adh	HMMGene	CDS	1756026	1756178	1.000	-	.	transcript "-39"
Adh	HMMGene	stop_codon	1756026	1756028	.	-	.	transcript "-39"
Adh	HMMGene	CDS	1756215	1756386	0.568	-	.	transcript "-39"
Adh	HMMGene	CDS	1756448	1756671	0.997	-	.	transcript "-39"
Adh	HMMGene	CDS	1756797	1756939	1.000	-	.	transcript "-39"
Adh	HMMGene	CDS	1757005	1757119	0.995	-	.	transcript "-39"
Adh	HMMGene	CDS	1757182	1757352	0.986	-	.	transcript "-39"
Adh	HMMGene	CDS	1757415	1757585	0.999	-	.	transcript "-39"
Adh	HMMGene	CDS	1757648	1758856	1.000	-	.	transcript "-39"
Adh	HMMGene	CDS	1760557	1760616	1.000	-	.	transcript "-39"
Adh	HMMGene	start_codon	1760614	1760616	.	-	.	transcript "-39"
Adh	HMMGene	CDS	2787421	2787885	1	-	.	transcript "-4"
Adh	HMMGene	stop_codon	2787421	2787423	.	-	.	transcript "-4"
Adh	HMMGene	CDS	2787948	2788341	1	-	.	transcript "-4"
Adh	HMMGene	CDS	2788523	2788540	1	-	.	transcript "-4"
Adh	HMMGene	CDS	2788598	2788646	1	-	.	transcript "-4"
Adh	HMMGene	CDS	2788808	2789008	1	-	.	transcript "-4"
Adh	HMMGene	CDS	2789052	2789086	1	-	.	transcript "-4"
Adh	HMMGene	CDS	2789143	2789575	1	-	.	transcript "-4"
Adh	HMMGene	CDS	2790036	2790310	1	-	.	transcript "-4"
Adh	HMMGene	CDS	2791870	2792011	1	-	.	transcript "-4"
Adh	HMMGene	CDS	2792082	2792564	1	-	.	transcript "-4"
Adh	HMMGene	CDS	2793634	2795139	1	-	.	transcript "-4"
Adh	HMMGene	CDS	2795176	2798613	1	-	.	transcript "-4"
Adh	HMMGene	CDS	2801187	2801286	1	-	.	transcript "-4"
Adh	HMMGene	start_codon	2801284	2801286	.	-	.	transcript "-4"
Adh	HMMGene	CDS	1747065	1747238	1.000	-	.	transcript "-40"
Adh	HMMGene	stop_codon	1747065	1747067	.	-	.	transcript "-40"
Adh	HMMGene	CDS	1747451	1747757	0.998	-	.	transcript "-40"
Adh	HMMGene	CDS	1747825	1748093	1.000	-	.	transcript "-40"
Adh	HMMGene	CDS	1748156	1748361	0.996	-	.	transcript "-40"
Adh	HMMGene	CDS	1748434	1748590	1.000	-	.	transcript "-40"
Adh	HMMGene	CDS	1748671	1748943	0.964	-	.	transcript "-40"
Adh	HMMGene	CDS	1751370	1751492	0.613	-	.	transcript "-40"
Adh	HMMGene	CDS	1751564	1751652	0.959	-	.	transcript "-40"
Adh	HMMGene	CDS	1751722	1751956	1.000	-	.	transcript "-40"
Adh	HMMGene	CDS	1752027	1752278	1.000	-	.	transcript "-40"
Adh	HMMGene	CDS	1752622	1752780	1.000	-	.	transcript "-40"
Adh	HMMGene	CDS	1752984	1753316	0.963	-	.	transcript "-40"
Adh	HMMGene	CDS	1753422	1753778	0.999	-	.	transcript "-40"
Adh	HMMGene	start_codon	1753776	1753778	.	-	.	transcript "-40"
Adh	HMMGene	CDS	1744620	1745915	1.000	-	.	transcript "-41"
Adh	HMMGene	stop_codon	1744620	1744622	.	-	.	transcript "-41"
Adh	HMMGene	start_codon	1745913	1745915	.	-	.	transcript "-41"
Adh	HMMGene	CDS	1718580	1718725	0.999	-	.	transcript "-42"
Adh	HMMGene	stop_codon	1718580	1718582	.	-	.	transcript "-42"
Adh	HMMGene	CDS	1719195	1719342	1.000	-	.	transcript "-42"
Adh	HMMGene	CDS	1719504	1720005	0.727	-	.	transcript "-42"
Adh	HMMGene	CDS	1726256	1726435	0.779	-	.	transcript "-42"
Adh	HMMGene	CDS	1730116	1730236	1.000	-	.	transcript "-42"
Adh	HMMGene	CDS	1735826	1736004	1.000	-	.	transcript "-42"
Adh	HMMGene	CDS	1737215	1737238	0.022	-	.	transcript "-42"
Adh	HMMGene	CDS	1737322	1737375	0.009	-	.	transcript "-42"
Adh	HMMGene	CDS	1737859	1737869	0.012	-	.	transcript "-42"
Adh	HMMGene	start_codon	1737867	1737869	.	-	.	transcript "-42"
Adh	HMMGene	CDS	1653232	1653414	0.976	-	.	transcript "-43"
Adh	HMMGene	stop_codon	1653232	1653234	.	-	.	transcript "-43"
Adh	HMMGene	CDS	1653754	1653780	0.927	-	.	transcript "-43"
Adh	HMMGene	CDS	1653857	1657133	0.965	-	.	transcript "-43"
Adh	HMMGene	CDS	1661045	1661189	0.999	-	.	transcript "-43"
Adh	HMMGene	CDS	1667694	1667970	0.923	-	.	transcript "-43"
Adh	HMMGene	start_codon	1667968	1667970	.	-	.	transcript "-43"
Adh	HMMGene	CDS	1554085	1554599	1	-	.	transcript "-44"
Adh	HMMGene	stop_codon	1554085	1554087	.	-	.	transcript "-44"
Adh	HMMGene	CDS	1554841	1555107	1	-	.	transcript "-44"
Adh	HMMGene	CDS	1556588	1557321	1	-	.	transcript "-44"
Adh	HMMGene	CDS	1557651	1557682	1	-	.	transcript "-44"
Adh	HMMGene	start_codon	1557680	1557682	.	-	.	transcript "-44"
Adh	HMMGene	CDS	1549142	1550017	1	-	.	transcript "-45"
Adh	HMMGene	stop_codon	1549142	1549144	.	-	.	transcript "-45"
Adh	HMMGene	CDS	1550084	1550149	1	-	.	transcript "-45"
Adh	HMMGene	start_codon	1550147	1550149	.	-	.	transcript "-45"
Adh	HMMGene	CDS	1535065	1535271	1	-	.	transcript "-46"
Adh	HMMGene	stop_codon	1535065	1535067	.	-	.	transcript "-46"
Adh	HMMGene	CDS	1535341	1535461	1	-	.	transcript "-46"
Adh	HMMGene	CDS	1535530	1535676	1	-	.	transcript "-46"
Adh	HMMGene	CDS	1535739	1536304	1	-	.	transcript "-46"
Adh	HMMGene	CDS	1536364	1537150	1	-	.	transcript "-46"
Adh	HMMGene	CDS	1537212	1538662	1	-	.	transcript "-46"
Adh	HMMGene	CDS	1538719	1541113	1	-	.	transcript "-46"
Adh	HMMGene	CDS	1541178	1541361	1	-	.	transcript "-46"
Adh	HMMGene	CDS	1541445	1541518	1	-	.	transcript "-46"
Adh	HMMGene	CDS	1541562	1541794	1	-	.	transcript "-46"
Adh	HMMGene	CDS	1542125	1542385	1	-	.	transcript "-46"
Adh	HMMGene	CDS	1547319	1547356	1	-	.	transcript "-46"
Adh	HMMGene	CDS	1547400	1547409	1	-	.	transcript "-46"
Adh	HMMGene	start_codon	1547407	1547409	.	-	.	transcript "-46"
Adh	HMMGene	CDS	1527523	1527636	1	-	.	transcript "-47"
Adh	HMMGene	stop_codon	1527523	1527525	.	-	.	transcript "-47"
Adh	HMMGene	CDS	1527705	1528201	1	-	.	transcript "-47"
Adh	HMMGene	CDS	1528291	1528426	1	-	.	transcript "-47"
Adh	HMMGene	start_codon	1528424	1528426	.	-	.	transcript "-47"
Adh	HMMGene	CDS	1520743	1520750	1	-	.	transcript "-48"
Adh	HMMGene	stop_codon	1520743	1520745	.	-	.	transcript "-48"
Adh	HMMGene	CDS	1520822	1521371	1	-	.	transcript "-48"
Adh	HMMGene	start_codon	1521369	1521371	.	-	.	transcript "-48"
Adh	HMMGene	CDS	1498334	1499046	1	-	.	transcript "-49"
Adh	HMMGene	stop_codon	1498334	1498336	.	-	.	transcript "-49"
Adh	HMMGene	CDS	1499102	1499249	1	-	.	transcript "-49"
Adh	HMMGene	start_codon	1499247	1499249	.	-	.	transcript "-49"
Adh	HMMGene	CDS	2777390	2777609	1	-	.	transcript "-5"
Adh	HMMGene	stop_codon	2777390	2777392	.	-	.	transcript "-5"
Adh	HMMGene	CDS	2777672	2778342	1	-	.	transcript "-5"
Adh	HMMGene	start_codon	2778340	2778342	.	-	.	transcript "-5"
Adh	HMMGene	CDS	1496304	1496815	1	-	.	transcript "-50"
Adh	HMMGene	stop_codon	1496304	1496306	.	-	.	transcript "-50"
Adh	HMMGene	CDS	1496865	1497000	1	-	.	transcript "-50"
Adh	HMMGene	start_codon	1496998	1497000	.	-	.	transcript "-50"
Adh	HMMGene	CDS	1466149	1466744	0.166	-	.	transcript "-51"
Adh	HMMGene	stop_codon	1466149	1466151	.	-	.	transcript "-51"
Adh	HMMGene	CDS	1466876	1467307	1.000	-	.	transcript "-51"
Adh	HMMGene	CDS	1469439	1469463	0.742	-	.	transcript "-51"
Adh	HMMGene	CDS	1473624	1473745	0.850	-	.	transcript "-51"
Adh	HMMGene	CDS	1473857	1473914	1.000	-	.	transcript "-51"
Adh	HMMGene	CDS	1481966	1482165	1	-	.	transcript "-51"
Adh	HMMGene	CDS	1489815	1489839	1	-	.	transcript "-51"
Adh	HMMGene	CDS	1493140	1493217	1	-	.	transcript "-51"
Adh	HMMGene	start_codon	1493215	1493217	.	-	.	transcript "-51"
Adh	HMMGene	CDS	1421921	1422114	0.824	-	.	transcript "-52"
Adh	HMMGene	stop_codon	1421921	1421923	.	-	.	transcript "-52"
Adh	HMMGene	CDS	1422176	1422320	0.858	-	.	transcript "-52"
Adh	HMMGene	CDS	1424531	1424676	0.982	-	.	transcript "-52"
Adh	HMMGene	CDS	1425549	1425606	0.362	-	.	transcript "-52"
Adh	HMMGene	CDS	1426175	1426281	0.610	-	.	transcript "-52"
Adh	HMMGene	CDS	1426393	1426486	0.946	-	.	transcript "-52"
Adh	HMMGene	CDS	1428573	1428690	1.000	-	.	transcript "-52"
Adh	HMMGene	CDS	1431180	1431306	0.998	-	.	transcript "-52"
Adh	HMMGene	CDS	1434609	1434630	0.827	-	.	transcript "-52"
Adh	HMMGene	start_codon	1434628	1434630	.	-	.	transcript "-52"
Adh	HMMGene	CDS	1398183	1398833	1.000	-	.	transcript "-53"
Adh	HMMGene	stop_codon	1398183	1398185	.	-	.	transcript "-53"
Adh	HMMGene	CDS	1401633	1401874	0.601	-	.	transcript "-53"
Adh	HMMGene	CDS	1402535	1402643	0.998	-	.	transcript "-53"
Adh	HMMGene	CDS	1402808	1402995	1.000	-	.	transcript "-53"
Adh	HMMGene	CDS	1403930	1404111	0.998	-	.	transcript "-53"
Adh	HMMGene	CDS	1405762	1405903	0.999	-	.	transcript "-53"
Adh	HMMGene	CDS	1406801	1406882	0.942	-	.	transcript "-53"
Adh	HMMGene	CDS	1408904	1408932	0.266	-	.	transcript "-53"
Adh	HMMGene	CDS	1411600	1411759	0.916	-	.	transcript "-53"
Adh	HMMGene	CDS	1412461	1412741	0.879	-	.	transcript "-53"
Adh	HMMGene	CDS	1414497	1414536	0.577	-	.	transcript "-53"
Adh	HMMGene	start_codon	1414534	1414536	.	-	.	transcript "-53"
Adh	HMMGene	CDS	1371868	1371921	0.999	-	.	transcript "-54"
Adh	HMMGene	stop_codon	1371868	1371870	.	-	.	transcript "-54"
Adh	HMMGene	CDS	1371971	1372346	0.010	-	.	transcript "-54"
Adh	HMMGene	CDS	1375202	1375227	0.009	-	.	transcript "-54"
Adh	HMMGene	start_codon	1375225	1375227	.	-	.	transcript "-54"
Adh	HMMGene	CDS	1334780	1335055	1.000	-	.	transcript "-55"
Adh	HMMGene	stop_codon	1334780	1334782	.	-	.	transcript "-55"
Adh	HMMGene	CDS	1335102	1335356	1.000	-	.	transcript "-55"
Adh	HMMGene	CDS	1335416	1336157	1.000	-	.	transcript "-55"
Adh	HMMGene	CDS	1336453	1336720	0.925	-	.	transcript "-55"
Adh	HMMGene	CDS	1337556	1337587	0.728	-	.	transcript "-55"
Adh	HMMGene	CDS	1337668	1337984	0.299	-	.	transcript "-55"
Adh	HMMGene	CDS	1338299	1338640	0.538	-	.	transcript "-55"
Adh	HMMGene	CDS	1338702	1338785	1.000	-	.	transcript "-55"
Adh	HMMGene	start_codon	1338783	1338785	.	-	.	transcript "-55"
Adh	HMMGene	CDS	944218	944493	0.103	-	.	transcript "-56"
Adh	HMMGene	stop_codon	944218	944220	.	-	.	transcript "-56"
Adh	HMMGene	start_codon	944491	944493	.	-	.	transcript "-56"
Adh	HMMGene	CDS	918151	918795	0.130	-	.	transcript "-57"
Adh	HMMGene	stop_codon	918151	918153	.	-	.	transcript "-57"
Adh	HMMGene	CDS	918858	918869	0.130	-	.	transcript "-57"
Adh	HMMGene	start_codon	918867	918869	.	-	.	transcript "-57"
Adh	HMMGene	CDS	910572	910742	0.126	-	.	transcript "-58"
Adh	HMMGene	stop_codon	910572	910574	.	-	.	transcript "-58"
Adh	HMMGene	CDS	910801	911055	0.129	-	.	transcript "-58"
Adh	HMMGene	start_codon	911053	911055	.	-	.	transcript "-58"
Adh	HMMGene	CDS	884916	885676	0.129	-	.	transcript "-59"
Adh	HMMGene	stop_codon	884916	884918	.	-	.	transcript "-59"
Adh	HMMGene	CDS	885967	886798	0.073	-	.	transcript "-59"
Adh	HMMGene	CDS	893221	893259	0.080	-	.	transcript "-59"
Adh	HMMGene	start_codon	893257	893259	.	-	.	transcript "-59"
Adh	HMMGene	CDS	2762639	2762710	1	-	.	transcript "-6"
Adh	HMMGene	stop_codon	2762639	2762641	.	-	.	transcript "-6"
Adh	HMMGene	CDS	2763711	2763968	1	-	.	transcript "-6"
Adh	HMMGene	CDS	2764030	2764118	1	-	.	transcript "-6"
Adh	HMMGene	CDS	2772220	2772430	1	-	.	transcript "-6"
Adh	HMMGene	CDS	2772600	2772777	1	-	.	transcript "-6"
Adh	HMMGene	CDS	2773593	2774287	1	-	.	transcript "-6"
Adh	HMMGene	start_codon	2774285	2774287	.	-	.	transcript "-6"
Adh	HMMGene	CDS	872887	873131	0.130	-	.	transcript "-60"
Adh	HMMGene	stop_codon	872887	872889	.	-	.	transcript "-60"
Adh	HMMGene	CDS	873191	873321	0.130	-	.	transcript "-60"
Adh	HMMGene	CDS	873388	873527	0.130	-	.	transcript "-60"
Adh	HMMGene	CDS	873583	874093	0.130	-	.	transcript "-60"
Adh	HMMGene	CDS	874278	874541	0.130	-	.	transcript "-60"
Adh	HMMGene	CDS	874599	874870	0.130	-	.	transcript "-60"
Adh	HMMGene	start_codon	874868	874870	.	-	.	transcript "-60"
Adh	HMMGene	CDS	846397	847372	0.130	-	.	transcript "-61"
Adh	HMMGene	stop_codon	846397	846399	.	-	.	transcript "-61"
Adh	HMMGene	CDS	847433	848154	0.130	-	.	transcript "-61"
Adh	HMMGene	CDS	848208	848609	0.130	-	.	transcript "-61"
Adh	HMMGene	CDS	848668	848733	0.130	-	.	transcript "-61"
Adh	HMMGene	start_codon	848731	848733	.	-	.	transcript "-61"
Adh	HMMGene	CDS	839671	840448	0.099	-	.	transcript "-62"
Adh	HMMGene	stop_codon	839671	839673	.	-	.	transcript "-62"
Adh	HMMGene	CDS	841158	841333	0.090	-	.	transcript "-62"
Adh	HMMGene	CDS	841389	841969	0.130	-	.	transcript "-62"
Adh	HMMGene	CDS	842034	842434	0.024	-	.	transcript "-62"
Adh	HMMGene	CDS	842969	843375	0.033	-	.	transcript "-62"
Adh	HMMGene	CDS	843445	843516	0.065	-	.	transcript "-62"
Adh	HMMGene	start_codon	843514	843516	.	-	.	transcript "-62"
Adh	HMMGene	CDS	679874	680889	0.073	-	.	transcript "-63"
Adh	HMMGene	stop_codon	679874	679876	.	-	.	transcript "-63"
Adh	HMMGene	CDS	682600	682771	0.070	-	.	transcript "-63"
Adh	HMMGene	CDS	682831	682969	0.073	-	.	transcript "-63"
Adh	HMMGene	CDS	689469	689746	0.073	-	.	transcript "-63"
Adh	HMMGene	CDS	689811	689983	0.073	-	.	transcript "-63"
Adh	HMMGene	CDS	690663	691029	0.073	-	.	transcript "-63"
Adh	HMMGene	CDS	691481	691603	0.043	-	.	transcript "-63"
Adh	HMMGene	CDS	710763	710805	0.073	-	.	transcript "-63"
Adh	HMMGene	CDS	715790	715817	0.064	-	.	transcript "-63"
Adh	HMMGene	CDS	727930	727964	0.002	-	.	transcript "-63"
Adh	HMMGene	stop_codon	727930	727932	.	-	.	transcript "-63"
Adh	HMMGene	CDS	733100	733112	0.040	-	.	transcript "-63"
Adh	HMMGene	start_codon	733110	733112	.	-	.	transcript "-63"
Adh	HMMGene	CDS	657691	658001	0.072	-	.	transcript "-64"
Adh	HMMGene	stop_codon	657691	657693	.	-	.	transcript "-64"
Adh	HMMGene	CDS	658058	658265	0.073	-	.	transcript "-64"
Adh	HMMGene	CDS	658326	658463	0.040	-	.	transcript "-64"
Adh	HMMGene	CDS	658526	660852	0.073	-	.	transcript "-64"
Adh	HMMGene	CDS	660917	661331	0.073	-	.	transcript "-64"
Adh	HMMGene	start_codon	668255	668257	.	-	.	transcript "-64"
Adh	HMMGene	CDS	668255	668257	0.012	-	.	transcript "-64"
Adh	HMMGene	CDS	603442	604323	0.073	-	.	transcript "-65"
Adh	HMMGene	stop_codon	603442	603444	.	-	.	transcript "-65"
Adh	HMMGene	CDS	604381	604434	0.072	-	.	transcript "-65"
Adh	HMMGene	start_codon	604432	604434	.	-	.	transcript "-65"
Adh	HMMGene	CDS	601945	602889	0.073	-	.	transcript "-66"
Adh	HMMGene	stop_codon	601945	601947	.	-	.	transcript "-66"
Adh	HMMGene	CDS	602944	603000	0.073	-	.	transcript "-66"
Adh	HMMGene	start_codon	602998	603000	.	-	.	transcript "-66"
Adh	HMMGene	CDS	513238	513921	0.038	-	.	transcript "-67"
Adh	HMMGene	stop_codon	513238	513240	.	-	.	transcript "-67"
Adh	HMMGene	start_codon	513919	513921	.	-	.	transcript "-67"
Adh	HMMGene	CDS	477171	477490	0.073	-	.	transcript "-68"
Adh	HMMGene	stop_codon	477171	477173	.	-	.	transcript "-68"
Adh	HMMGene	CDS	477548	479329	0.073	-	.	transcript "-68"
Adh	HMMGene	CDS	479386	479743	0.060	-	.	transcript "-68"
Adh	HMMGene	CDS	479781	479958	0.060	-	.	transcript "-68"
Adh	HMMGene	CDS	480147	480287	0.072	-	.	transcript "-68"
Adh	HMMGene	CDS	480343	480480	0.066	-	.	transcript "-68"
Adh	HMMGene	CDS	481570	481638	0.072	-	.	transcript "-68"
Adh	HMMGene	CDS	484195	484338	0.073	-	.	transcript "-68"
Adh	HMMGene	CDS	484664	484807	0.072	-	.	transcript "-68"
Adh	HMMGene	CDS	485391	485462	0.070	-	.	transcript "-68"
Adh	HMMGene	CDS	486686	487236	0.068	-	.	transcript "-68"
Adh	HMMGene	start_codon	487234	487236	.	-	.	transcript "-68"
Adh	HMMGene	CDS	466308	466360	0.059	-	.	transcript "-69"
Adh	HMMGene	stop_codon	466308	466310	.	-	.	transcript "-69"
Adh	HMMGene	CDS	467993	469628	0.055	-	.	transcript "-69"
Adh	HMMGene	CDS	470226	470438	0.073	-	.	transcript "-69"
Adh	HMMGene	start_codon	470436	470438	.	-	.	transcript "-69"
Adh	HMMGene	CDS	2759163	2759190	0.000	-	.	transcript "-7"
Adh	HMMGene	stop_codon	2759163	2759165	.	-	.	transcript "-7"
Adh	HMMGene	CDS	2759260	2759403	0.000	-	.	transcript "-7"
Adh	HMMGene	CDS	2759527	2759639	0.000	-	.	transcript "-7"
Adh	HMMGene	CDS	2759701	2759883	0.000	-	.	transcript "-7"
Adh	HMMGene	CDS	2759966	2760008	0.000	-	.	transcript "-7"
Adh	HMMGene	CDS	2760216	2760220	0.002	-	.	transcript "-7"
Adh	HMMGene	start_codon	2760218	2760220	.	-	.	transcript "-7"
Adh	HMMGene	CDS	458837	459146	0.073	-	.	transcript "-70"
Adh	HMMGene	stop_codon	458837	458839	.	-	.	transcript "-70"
Adh	HMMGene	CDS	459225	459761	0.073	-	.	transcript "-70"
Adh	HMMGene	CDS	460256	460684	0.002	-	.	transcript "-70"
Adh	HMMGene	CDS	461258	461443	0.001	-	.	transcript "-70"
Adh	HMMGene	CDS	461500	461675	0.049	-	.	transcript "-70"
Adh	HMMGene	CDS	462179	462584	0.052	-	.	transcript "-70"
Adh	HMMGene	CDS	462646	463209	0.070	-	.	transcript "-70"
Adh	HMMGene	CDS	463368	463657	0.070	-	.	transcript "-70"
Adh	HMMGene	start_codon	463655	463657	.	-	.	transcript "-70"
Adh	HMMGene	CDS	438979	439800	0.072	-	.	transcript "-71"
Adh	HMMGene	stop_codon	438979	438981	.	-	.	transcript "-71"
Adh	HMMGene	CDS	440839	440877	0.069	-	.	transcript "-71"
Adh	HMMGene	CDS	442718	442849	0.049	-	.	transcript "-71"
Adh	HMMGene	start_codon	442847	442849	.	-	.	transcript "-71"
Adh	HMMGene	CDS	426746	427546	0.071	-	.	transcript "-72"
Adh	HMMGene	stop_codon	426746	426748	.	-	.	transcript "-72"
Adh	HMMGene	CDS	428348	428359	0.068	-	.	transcript "-72"
Adh	HMMGene	start_codon	428357	428359	.	-	.	transcript "-72"
Adh	HMMGene	CDS	415514	415519	0.067	-	.	transcript "-73"
Adh	HMMGene	stop_codon	415514	415516	.	-	.	transcript "-73"
Adh	HMMGene	CDS	415627	416211	0.067	-	.	transcript "-73"
Adh	HMMGene	CDS	416276	416749	0.073	-	.	transcript "-73"
Adh	HMMGene	CDS	417100	417111	0.072	-	.	transcript "-73"
Adh	HMMGene	start_codon	417109	417111	.	-	.	transcript "-73"
Adh	HMMGene	CDS	393573	393814	0.636	-	.	transcript "-74"
Adh	HMMGene	stop_codon	393573	393575	.	-	.	transcript "-74"
Adh	HMMGene	CDS	393894	394052	0.638	-	.	transcript "-74"
Adh	HMMGene	CDS	394383	395732	0.636	-	.	transcript "-74"
Adh	HMMGene	CDS	395826	397468	0.638	-	.	transcript "-74"
Adh	HMMGene	CDS	397532	397665	0.083	-	.	transcript "-74"
Adh	HMMGene	CDS	398131	398145	0.083	-	.	transcript "-74"
Adh	HMMGene	start_codon	398143	398145	.	-	.	transcript "-74"
Adh	HMMGene	CDS	334589	334786	0.429	-	.	transcript "-75"
Adh	HMMGene	stop_codon	334589	334591	.	-	.	transcript "-75"
Adh	HMMGene	CDS	334847	335125	0.440	-	.	transcript "-75"
Adh	HMMGene	CDS	336758	337323	0.004	-	.	transcript "-75"
Adh	HMMGene	CDS	337379	337458	0.016	-	.	transcript "-75"
Adh	HMMGene	CDS	338171	338879	0.030	-	.	transcript "-75"
Adh	HMMGene	CDS	338944	339013	0.443	-	.	transcript "-75"
Adh	HMMGene	start_codon	339011	339013	.	-	.	transcript "-75"
Adh	HMMGene	CDS	328048	328411	0.442	-	.	transcript "-76"
Adh	HMMGene	stop_codon	328048	328050	.	-	.	transcript "-76"
Adh	HMMGene	CDS	328473	328634	0.435	-	.	transcript "-76"
Adh	HMMGene	CDS	328690	328733	0.436	-	.	transcript "-76"
Adh	HMMGene	start_codon	328731	328733	.	-	.	transcript "-76"
Adh	HMMGene	CDS	326376	326822	0.442	-	.	transcript "-77"
Adh	HMMGene	stop_codon	326376	326378	.	-	.	transcript "-77"
Adh	HMMGene	start_codon	326820	326822	.	-	.	transcript "-77"
Adh	HMMGene	CDS	321967	323027	0.443	-	.	transcript "-78"
Adh	HMMGene	stop_codon	321967	321969	.	-	.	transcript "-78"
Adh	HMMGene	CDS	323097	323169	0.443	-	.	transcript "-78"
Adh	HMMGene	start_codon	323167	323169	.	-	.	transcript "-78"
Adh	HMMGene	CDS	317891	318548	0.443	-	.	transcript "-79"
Adh	HMMGene	stop_codon	317891	317893	.	-	.	transcript "-79"
Adh	HMMGene	CDS	318608	319430	0.443	-	.	transcript "-79"
Adh	HMMGene	CDS	319486	321442	0.443	-	.	transcript "-79"
Adh	HMMGene	start_codon	321440	321442	.	-	.	transcript "-79"
Adh	HMMGene	CDS	2755219	2755580	0.000	-	.	transcript "-8"
Adh	HMMGene	stop_codon	2755219	2755221	.	-	.	transcript "-8"
Adh	HMMGene	CDS	2755775	2755883	0.000	-	.	transcript "-8"
Adh	HMMGene	CDS	2755954	2756092	0.000	-	.	transcript "-8"
Adh	HMMGene	CDS	2756201	2756274	0.000	-	.	transcript "-8"
Adh	HMMGene	start_codon	2756272	2756274	.	-	.	transcript "-8"
Adh	HMMGene	CDS	303960	304299	0.419	-	.	transcript "-80"
Adh	HMMGene	stop_codon	303960	303962	.	-	.	transcript "-80"
Adh	HMMGene	CDS	304330	305201	0.443	-	.	transcript "-80"
Adh	HMMGene	start_codon	305199	305201	.	-	.	transcript "-80"
Adh	HMMGene	CDS	276361	276666	0.442	-	.	transcript "-81"
Adh	HMMGene	stop_codon	276361	276363	.	-	.	transcript "-81"
Adh	HMMGene	CDS	276748	277188	0.440	-	.	transcript "-81"
Adh	HMMGene	start_codon	277186	277188	.	-	.	transcript "-81"
Adh	HMMGene	CDS	268982	269180	0.401	-	.	transcript "-82"
Adh	HMMGene	stop_codon	268982	268984	.	-	.	transcript "-82"
Adh	HMMGene	CDS	269242	269541	0.350	-	.	transcript "-82"
Adh	HMMGene	CDS	269629	269907	0.347	-	.	transcript "-82"
Adh	HMMGene	CDS	271522	271573	0.442	-	.	transcript "-82"
Adh	HMMGene	CDS	273396	273483	0.440	-	.	transcript "-82"
Adh	HMMGene	start_codon	273481	273483	.	-	.	transcript "-82"
Adh	HMMGene	CDS	216144	216761	0.422	-	.	transcript "-83"
Adh	HMMGene	stop_codon	216144	216146	.	-	.	transcript "-83"
Adh	HMMGene	CDS	216820	217206	0.001	-	.	transcript "-83"
Adh	HMMGene	CDS	217269	217274	0.001	-	.	transcript "-83"
Adh	HMMGene	start_codon	217272	217274	.	-	.	transcript "-83"
Adh	HMMGene	CDS	171131	171141	0.023	-	.	transcript "-84"
Adh	HMMGene	stop_codon	171131	171133	.	-	.	transcript "-84"
Adh	HMMGene	CDS	177956	178015	0.417	-	.	transcript "-84"
Adh	HMMGene	CDS	178136	178300	0.443	-	.	transcript "-84"
Adh	HMMGene	CDS	181272	181409	0.443	-	.	transcript "-84"
Adh	HMMGene	CDS	183107	183551	0.351	-	.	transcript "-84"
Adh	HMMGene	CDS	183600	183635	0.351	-	.	transcript "-84"
Adh	HMMGene	CDS	183699	183764	0.442	-	.	transcript "-84"
Adh	HMMGene	CDS	183835	184040	0.443	-	.	transcript "-84"
Adh	HMMGene	CDS	184241	184282	0.440	-	.	transcript "-84"
Adh	HMMGene	CDS	185488	185648	0.319	-	.	transcript "-84"
Adh	HMMGene	CDS	185699	185862	0.297	-	.	transcript "-84"
Adh	HMMGene	start_codon	185860	185862	.	-	.	transcript "-84"
Adh	HMMGene	CDS	133458	133548	1	-	.	transcript "-85"
Adh	HMMGene	stop_codon	133458	133460	.	-	.	transcript "-85"
Adh	HMMGene	CDS	133612	134233	1	-	.	transcript "-85"
Adh	HMMGene	CDS	134862	134967	0.440	-	.	transcript "-85"
Adh	HMMGene	start_codon	134965	134967	.	-	.	transcript "-85"
Adh	HMMGene	CDS	89305	90750	0.811	-	.	transcript "-86"
Adh	HMMGene	stop_codon	89305	89307	.	-	.	transcript "-86"
Adh	HMMGene	start_codon	90748	90750	.	-	.	transcript "-86"
Adh	HMMGene	CDS	40863	40890	0.000	-	.	transcript "-87"
Adh	HMMGene	stop_codon	40863	40865	.	-	.	transcript "-87"
Adh	HMMGene	CDS	42909	42949	0.000	-	.	transcript "-87"
Adh	HMMGene	start_codon	42947	42949	.	-	.	transcript "-87"
Adh	HMMGene	CDS	35433	35749	0.953	-	.	transcript "-88"
Adh	HMMGene	stop_codon	35433	35435	.	-	.	transcript "-88"
Adh	HMMGene	CDS	35970	35991	0.836	-	.	transcript "-88"
Adh	HMMGene	CDS	36020	36226	0.836	-	.	transcript "-88"
Adh	HMMGene	start_codon	36224	36226	.	-	.	transcript "-88"
Adh	HMMGene	CDS	34649	34655	0.169	-	.	transcript "-89"
Adh	HMMGene	stop_codon	34649	34651	.	-	.	transcript "-89"
Adh	HMMGene	CDS	34708	34745	0.169	-	.	transcript "-89"
Adh	HMMGene	start_codon	34743	34745	.	-	.	transcript "-89"
Adh	HMMGene	CDS	2751337	2751465	0.000	-	.	transcript "-9"
Adh	HMMGene	stop_codon	2751337	2751339	.	-	.	transcript "-9"
Adh	HMMGene	CDS	2751521	2751741	0.000	-	.	transcript "-9"
Adh	HMMGene	CDS	2751778	2751871	0.000	-	.	transcript "-9"
Adh	HMMGene	start_codon	2752031	2752033	.	-	.	transcript "-9"
Adh	HMMGene	CDS	2752031	2752033	0.000	-	.	transcript "-9"
Adh	HMMGene	CDS	28745	28784	0.870	-	.	transcript "-90"
Adh	HMMGene	stop_codon	28745	28747	.	-	.	transcript "-90"
Adh	HMMGene	CDS	29160	29479	0.846	-	.	transcript "-90"
Adh	HMMGene	start_codon	29477	29479	.	-	.	transcript "-90"
Adh	HMMGene	CDS	16298	16304	0.072	-	.	transcript "-91"
Adh	HMMGene	stop_codon	16298	16300	.	-	.	transcript "-91"
Adh	HMMGene	CDS	17928	19318	0.698	-	.	transcript "-91"
Adh	HMMGene	CDS	19917	19976	0.494	-	.	transcript "-91"
Adh	HMMGene	start_codon	19974	19976	.	-	.	transcript "-91"
Adh	HMMGene	CDS	90	441	0.513	-	.	transcript "-92"
Adh	HMMGene	CDS	2379	2862	1.000	-	.	transcript "-92"
Adh	HMMGene	CDS	3225	3550	1.000	-	.	transcript "-92"
Adh	HMMGene	CDS	6958	7051	0.493	-	.	transcript "-92"
Adh	HMMGene	start_codon	7049	7051	.	-	.	transcript "-92"
#
# compfly: 1. Took only CDS AND exon feature entries Jul 6 (MR)
#
#
#
Adh	MAGPIEexon	CDS	1	441	.	-	2	transcript "dm_001_MP_dna_1"	
Adh	MAGPIEexon	CDS	2379	2862	.	-	2	transcript "dm_001_MP_dna_1"	
Adh	MAGPIEexon	CDS	3225	3550	.	-	1	transcript "dm_001_MP_dna_1"	
Adh	MAGPIEexon	CDS	6718	7018	.	-	1	transcript "dm_001_MP_dna_1"	
Adh	MAGPIEexon	CDS	13942	14166	0.965	-	2	transcript "dm_001_GS_dna_2"	
Adh	MAGPIEexon	CDS	15041	15203	0.928	+	1	transcript "dm_001_GS_dna_3"	
Adh	MAGPIEexon	CDS	15567	15718	0.910	+	2	transcript "dm_001_GS_dna_3"	
Adh	MAGPIEexon	CDS	16481	19746	0.784	-	2	transcript "dm_001_GS_dna_4"	
Adh	MAGPIEexon	CDS	19917	20424	0.823	-	2	transcript "dm_001_GS_dna_4"	
Adh	MAGPIEexon	CDS	21599	21979	0.795	+	1	transcript "dm_001_GS_dna_5"	
Adh	MAGPIEexon	CDS	22140	22295	0.999	+	2	transcript "dm_001_GS_dna_5"	
Adh	MAGPIEexon	CDS	22800	23189	0.797	+	2	transcript "dm_001_GS_dna_6"	
Adh	MAGPIEexon	CDS	23249	23404	0.899	+	1	transcript "dm_001_GS_dna_6"	
Adh	MAGPIEexon	CDS	23733	24033	0.248	+	2	transcript "dm_001_GS_dna_7"	
Adh	MAGPIEexon	CDS	24887	25209	0.368	+	1	transcript "dm_001_GS_dna_7"	
Adh	MAGPIEexon	CDS	25843	26166	0.216	+	0	transcript "dm_001_GS_dna_7"	
Adh	MAGPIEexon	CDS	26242	26394	0.432	+	0	transcript "dm_001_GS_dna_7"	
Adh	MAGPIEexon	CDS	26630	26971	0.663	+	1	transcript "dm_001_GS_dna_8"	
Adh	MAGPIEexon	CDS	27952	28109	0.647	+	0	transcript "dm_001_GS_dna_8"	
Adh	MAGPIEexon	CDS	28186	28303	0.855	+	0	transcript "dm_001_GS_dna_8"	
Adh	MAGPIEexon	CDS	29156	29479	0.977	-	1	transcript "dm_001_GS_dna_9"	
Adh	MAGPIEexon	CDS	32232	32319	0.395	+	2	transcript "dm_001_GS_dna_10"	
Adh	MAGPIEexon	CDS	34532	34822	0.380	+	1	transcript "dm_001_GS_dna_10"	
Adh	MAGPIEexon	CDS	34857	35107	0.227	+	2	transcript "dm_001_GS_dna_10"	
Adh	MAGPIEexon	CDS	35161	35502	0.385	+	0	transcript "dm_001_GS_dna_10"	
Adh	MAGPIEexon	CDS	35547	35771	0.601	+	2	transcript "dm_001_GS_dna_10"	
Adh	MAGPIEexon	CDS	36410	37315	0.990	+	1	transcript "dm_001_GS_dna_11"	
Adh	MAGPIEexon	CDS	39549	39631	0.622	-	1	transcript "dm_001_GS_dna_12"	
Adh	MAGPIEexon	CDS	40669	40780	0.735	-	1	transcript "dm_001_GS_dna_12"	
Adh	MAGPIEexon	CDS	42268	42476	0.444	-	0	transcript "dm_001_GS_dna_12"	
Adh	MAGPIEexon	CDS	42887	43129	0.331	-	1	transcript "dm_001_GS_dna_12"	
Adh	MAGPIEexon	CDS	45358	45421	.	+	0	transcript "dm_003_MP_dna_8"	
Adh	MAGPIEexon	CDS	45358	45421	0.210	+	0	transcript "dm_002_GS_dna_1"	
Adh	MAGPIEexon	CDS	47381	47660	0.172	-	0	transcript "dm_001_GS_dna_12"	
Adh	MAGPIEexon	CDS	49369	49475	0.345	+	0	transcript "dm_002_GS_dna_1"	
Adh	MAGPIEexon	CDS	49611	49805	0.454	+	2	transcript "dm_002_GS_dna_1"	
Adh	MAGPIEexon	CDS	52555	52587	.	+	0	transcript "dm_003_MP_dna_8"	
Adh	MAGPIEexon	CDS	56136	58711	.	+	2	transcript "dm_002_MP_dna_2"	
Adh	MAGPIEexon	CDS	63943	64092	0.850	-	2	transcript "dm_002_GS_dna_3"	
Adh	MAGPIEexon	CDS	68350	68442	0.758	+	0	transcript "dm_002_GS_dna_4"	
Adh	MAGPIEexon	CDS	68712	68900	0.807	+	2	transcript "dm_002_GS_dna_4"	
Adh	MAGPIEexon	CDS	69241	69426	0.415	+	0	transcript "dm_002_GS_dna_4"	
Adh	MAGPIEexon	CDS	71954	72014	0.793	+	1	transcript "dm_002_GS_dna_4"	
Adh	MAGPIEexon	CDS	77541	77842	0.710	+	2	transcript "dm_002_GS_dna_4"	
Adh	MAGPIEexon	CDS	80269	80583	0.878	+	0	transcript "dm_002_GS_dna_5"	
Adh	MAGPIEexon	CDS	81303	81425	0.207	-	0	transcript "dm_002_GS_dna_6"	
Adh	MAGPIEexon	CDS	86763	86944	0.691	-	1	transcript "dm_002_GS_dna_6"	
Adh	MAGPIEexon	CDS	87195	87255	0.774	-	2	transcript "dm_002_GS_dna_6"	
Adh	MAGPIEexon	CDS	90015	90612	0.072	-	2	transcript "dm_003_GS_dna_1"	
Adh	MAGPIEexon	CDS	89305	90666	0.555	-	2	transcript "dm_002_GS_dna_7"	
Adh	MAGPIEexon	CDS	91283	91459	0.027	-	1	transcript "dm_003_GS_dna_1"	
Adh	MAGPIEexon	CDS	91265	91476	0.141	-	2	transcript "dm_002_GS_dna_8"	
Adh	MAGPIEexon	CDS	92557	92587	0.141	-	1	transcript "dm_002_GS_dna_8"	
Adh	MAGPIEexon	CDS	93123	93999	0.955	-	2	transcript "dm_003_GS_dna_2"	
Adh	MAGPIEexon	CDS	93123	94111	0.702	-	1	transcript "dm_002_GS_dna_9"	
Adh	MAGPIEexon	CDS	94266	94333	0.960	-	1	transcript "dm_003_GS_dna_2"	
Adh	MAGPIEexon	CDS	95428	95781	0.964	-	2	transcript "dm_003_GS_dna_3"	
Adh	MAGPIEexon	CDS	99793	100027	0.813	+	0	transcript "dm_003_GS_dna_4"	
Adh	MAGPIEexon	CDS	101565	101657	0.977	+	2	transcript "dm_003_GS_dna_4"	
Adh	MAGPIEexon	CDS	103543	103739	.	+	0	transcript "dm_003_MP_dna_8"	
Adh	MAGPIEexon	CDS	103543	103769	0.927	+	0	transcript "dm_003_GS_dna_4"	
Adh	MAGPIEexon	CDS	103808	104330	.	+	1	transcript "dm_003_MP_dna_8"	
Adh	MAGPIEexon	CDS	103808	104330	0.967	+	1	transcript "dm_003_GS_dna_4"	
Adh	MAGPIEexon	CDS	105304	105467	0.751	+	0	transcript "dm_003_GS_dna_4"	
Adh	MAGPIEexon	CDS	107859	108115	0.004	-	1	transcript "dm_003_GS_dna_5"	
Adh	MAGPIEexon	CDS	111958	111988	0.039	-	1	transcript "dm_003_GS_dna_5"	
Adh	MAGPIEexon	CDS	112147	112308	0.050	-	2	transcript "dm_003_GS_dna_5"	
Adh	MAGPIEexon	CDS	112955	113016	0.810	+	1	transcript "dm_003_GS_dna_6"	
Adh	MAGPIEexon	CDS	113132	113493	0.007	+	1	transcript "dm_003_GS_dna_6"	
Adh	MAGPIEexon	CDS	117406	117527	0.004	+	0	transcript "dm_003_GS_dna_6"	
Adh	MAGPIEexon	CDS	118375	118425	0.035	+	0	transcript "dm_003_GS_dna_7"	
Adh	MAGPIEexon	CDS	121666	121846	0.846	+	0	transcript "dm_003_GS_dna_7"	
Adh	MAGPIEexon	CDS	121957	122121	0.602	+	0	transcript "dm_003_GS_dna_7"	
Adh	MAGPIEexon	CDS	122214	122449	0.725	+	2	transcript "dm_003_GS_dna_7"	
Adh	MAGPIEexon	CDS	124458	124936	.	+	2	transcript "dm_003_MP_dna_8"	
Adh	MAGPIEexon	CDS	127146	127292	.	+	2	transcript "dm_003_MP_dna_8"	
Adh	MAGPIEexon	CDS	127771	127931	.	+	0	transcript "dm_003_MP_dna_8"	
Adh	MAGPIEexon	CDS	127991	128225	.	+	1	transcript "dm_003_MP_dna_8"	
Adh	MAGPIEexon	CDS	128296	129342	.	+	0	transcript "dm_003_MP_dna_8"	
Adh	MAGPIEexon	CDS	129401	129965	.	+	1	transcript "dm_003_MP_dna_8"	
Adh	MAGPIEexon	CDS	130136	130401	.	+	1	transcript "dm_003_MP_dna_8"	
Adh	MAGPIEexon	CDS	131070	131190	0.126	-	2	transcript "dm_003_GS_dna_9"	
Adh	MAGPIEexon	CDS	133612	134233	0.884	-	1	transcript "dm_003_GS_dna_9"	
Adh	MAGPIEexon	CDS	134862	134967	0.696	-	2	transcript "dm_003_GS_dna_9"	
Adh	MAGPIEexon	CDS	136104	136281	0.648	-	2	transcript "dm_003_GS_dna_10"	
Adh	MAGPIEexon	CDS	136104	136281	0.731	-	2	transcript "dm_004_GS_dna_1"	
Adh	MAGPIEexon	CDS	138453	138531	0.464	-	2	transcript "dm_003_GS_dna_10"	
Adh	MAGPIEexon	CDS	138627	138669	0.289	-	2	transcript "dm_003_GS_dna_10"	
Adh	MAGPIEexon	CDS	140355	140616	0.247	-	2	transcript "dm_004_GS_dna_1"	
Adh	MAGPIEexon	CDS	143066	143297	0.400	-	0	transcript "dm_004_GS_dna_1"	
Adh	MAGPIEexon	CDS	143302	143409	0.315	-	2	transcript "dm_004_GS_dna_1"	
Adh	MAGPIEexon	CDS	144051	144192	0.543	-	2	transcript "dm_004_GS_dna_1"	
Adh	MAGPIEexon	CDS	146836	146932	0.042	-	1	transcript "dm_004_GS_dna_1"	
Adh	MAGPIEexon	CDS	152102	152345	0.001	-	0	transcript "dm_004_GS_dna_1"	
Adh	MAGPIEexon	CDS	152350	152457	0.575	-	2	transcript "dm_004_GS_dna_1"	
Adh	MAGPIEexon	CDS	153098	153239	0.842	-	0	transcript "dm_004_GS_dna_1"	
Adh	MAGPIEexon	CDS	155883	155979	0.109	-	2	transcript "dm_004_GS_dna_1"	
Adh	MAGPIEexon	CDS	156071	156188	0.046	-	0	transcript "dm_004_GS_dna_1"	
Adh	MAGPIEexon	CDS	159578	160022	0.794	+	1	transcript "dm_004_GS_dna_2"	
Adh	MAGPIEexon	CDS	161268	161449	0.592	+	2	transcript "dm_004_GS_dna_2"	
Adh	MAGPIEexon	CDS	161727	162105	0.962	+	2	transcript "dm_004_GS_dna_2"	
Adh	MAGPIEexon	CDS	162442	162557	0.978	+	0	transcript "dm_004_GS_dna_2"	
Adh	MAGPIEexon	CDS	162616	163137	0.986	+	0	transcript "dm_004_GS_dna_2"	
Adh	MAGPIEexon	CDS	164190	164417	0.167	+	2	transcript "dm_004_GS_dna_2"	
Adh	MAGPIEexon	CDS	168736	168874	0.931	-	1	transcript "dm_004_GS_dna_3"	
Adh	MAGPIEexon	CDS	170448	170530	0.601	-	1	transcript "dm_004_GS_dna_3"	
Adh	MAGPIEexon	CDS	172106	172869	0.925	-	2	transcript "dm_004_GS_dna_4"	
Adh	MAGPIEexon	CDS	177956	178015	0.991	-	1	transcript "dm_004_GS_dna_4"	
Adh	MAGPIEexon	CDS	178136	178300	0.593	-	1	transcript "dm_004_GS_dna_4"	
Adh	MAGPIEexon	CDS	179847	179900	0.356	-	0	transcript "dm_004_GS_dna_4"	
Adh	MAGPIEexon	CDS	181272	181409	0.100	-	0	transcript "dm_005_GS_dna_1"	
Adh	MAGPIEexon	CDS	181272	181409	0.681	-	0	transcript "dm_004_GS_dna_4"	
Adh	MAGPIEexon	CDS	183107	183235	0.361	-	1	transcript "dm_005_GS_dna_1"	
Adh	MAGPIEexon	CDS	183107	183235	0.945	-	1	transcript "dm_004_GS_dna_4"	
Adh	MAGPIEexon	CDS	183341	183496	0.764	-	1	transcript "dm_005_GS_dna_1"	
Adh	MAGPIEexon	CDS	183341	183496	0.880	-	1	transcript "dm_004_GS_dna_4"	
Adh	MAGPIEexon	CDS	183596	183635	0.862	-	0	transcript "dm_005_GS_dna_1"	
Adh	MAGPIEexon	CDS	183596	183635	0.878	-	0	transcript "dm_004_GS_dna_4"	
Adh	MAGPIEexon	CDS	183835	184040	0.962	-	0	transcript "dm_004_GS_dna_4"	
Adh	MAGPIEexon	CDS	183835	184040	0.963	-	0	transcript "dm_005_GS_dna_1"	
Adh	MAGPIEexon	CDS	184241	184282	0.902	-	1	transcript "dm_004_GS_dna_4"	
Adh	MAGPIEexon	CDS	184241	184282	0.945	-	1	transcript "dm_005_GS_dna_1"	
Adh	MAGPIEexon	CDS	185558	185615	0.909	-	0	transcript "dm_005_GS_dna_1"	
Adh	MAGPIEexon	CDS	193180	193242	0.921	+	0	transcript "dm_005_GS_dna_2"	
Adh	MAGPIEexon	CDS	194030	194254	0.857	+	1	transcript "dm_005_GS_dna_2"	
Adh	MAGPIEexon	CDS	194916	195252	0.380	+	2	transcript "dm_005_GS_dna_2"	
Adh	MAGPIEexon	CDS	196995	197159	0.039	+	2	transcript "dm_005_GS_dna_2"	
Adh	MAGPIEexon	CDS	201578	201633	0.054	+	1	transcript "dm_005_GS_dna_2"	
Adh	MAGPIEexon	CDS	202116	202646	0.118	+	2	transcript "dm_005_GS_dna_2"	
Adh	MAGPIEexon	CDS	202700	204199	0.870	+	1	transcript "dm_005_GS_dna_2"	
Adh	MAGPIEexon	CDS	204792	204915	0.037	-	2	transcript "dm_005_GS_dna_3"	
Adh	MAGPIEexon	CDS	205449	205575	0.031	-	2	transcript "dm_005_GS_dna_3"	
Adh	MAGPIEexon	CDS	207724	207826	0.013	-	1	transcript "dm_005_GS_dna_3"	
Adh	MAGPIEexon	CDS	210864	211181	0.179	-	0	transcript "dm_005_GS_dna_3"	
Adh	MAGPIEexon	CDS	213507	213602	0.841	-	0	transcript "dm_005_GS_dna_4"	
Adh	MAGPIEexon	CDS	216171	216761	0.206	-	0	transcript "dm_005_GS_dna_4"	
Adh	MAGPIEexon	CDS	216820	217188	0.957	-	2	transcript "dm_005_GS_dna_4"	
Adh	MAGPIEexon	CDS	220838	220908	0.748	+	1	transcript "dm_005_GS_dna_5"	
Adh	MAGPIEexon	CDS	222807	222985	0.397	+	2	transcript "dm_005_GS_dna_5"	
Adh	MAGPIEexon	CDS	224046	224203	0.999	+	2	transcript "dm_005_GS_dna_5"	
Adh	MAGPIEexon	CDS	227121	227312	0.522	+	2	transcript "dm_005_GS_dna_6"	
Adh	MAGPIEexon	CDS	227121	227312	0.662	+	2	transcript "dm_006_GS_dna_1"	
Adh	MAGPIEexon	CDS	227793	227992	0.291	+	2	transcript "dm_005_GS_dna_6"	
Adh	MAGPIEexon	CDS	227793	227992	0.475	+	2	transcript "dm_006_GS_dna_1"	
Adh	MAGPIEexon	CDS	228443	228602	0.108	+	1	transcript "dm_005_GS_dna_6"	
Adh	MAGPIEexon	CDS	229661	230462	0.377	+	1	transcript "dm_006_GS_dna_1"	
Adh	MAGPIEexon	CDS	230985	231322	0.959	-	1	transcript "dm_006_GS_dna_2"	
Adh	MAGPIEexon	CDS	231417	231549	0.047	-	2	transcript "dm_006_GS_dna_2"	
Adh	MAGPIEexon	CDS	234442	234563	0.120	-	0	transcript "dm_006_GS_dna_2"	
Adh	MAGPIEexon	CDS	235723	235990	0.215	-	1	transcript "dm_006_GS_dna_2"	
Adh	MAGPIEexon	CDS	236859	236980	0.283	-	1	transcript "dm_006_GS_dna_2"	
Adh	MAGPIEexon	CDS	237092	237123	0.436	-	2	transcript "dm_006_GS_dna_2"	
Adh	MAGPIEexon	CDS	239944	240152	0.172	-	0	transcript "dm_006_GS_dna_2"	
Adh	MAGPIEexon	CDS	243341	243540	0.971	-	2	transcript "dm_006_GS_dna_3"	
Adh	MAGPIEexon	CDS	244604	244871	0.971	-	0	transcript "dm_006_GS_dna_3"	
Adh	MAGPIEexon	CDS	246894	246946	0.949	+	2	transcript "dm_006_GS_dna_4"	
Adh	MAGPIEexon	CDS	248230	248471	0.948	+	0	transcript "dm_006_GS_dna_4"	
Adh	MAGPIEexon	CDS	249380	249471	0.347	+	1	transcript "dm_006_GS_dna_4"	
Adh	MAGPIEexon	CDS	258809	258883	0.005	+	1	transcript "dm_006_GS_dna_4"	
Adh	MAGPIEexon	CDS	265088	266322	0.898	+	1	transcript "dm_006_GS_dna_4"	
Adh	MAGPIEexon	CDS	266392	266619	0.963	+	0	transcript "dm_006_GS_dna_4"	
Adh	MAGPIEexon	CDS	266684	266867	0.935	+	1	transcript "dm_006_GS_dna_4"	
Adh	MAGPIEexon	CDS	267912	268061	0.976	+	2	transcript "dm_006_GS_dna_4"	
Adh	MAGPIEexon	CDS	268982	269157	0.662	-	2	transcript "dm_006_GS_dna_5"	
Adh	MAGPIEexon	CDS	269222	269541	0.793	-	2	transcript "dm_006_GS_dna_5"	
Adh	MAGPIEexon	CDS	269629	269907	0.986	-	2	transcript "dm_006_GS_dna_5"	
Adh	MAGPIEexon	CDS	271224	271433	0.031	-	0	transcript "dm_006_GS_dna_5"	
Adh	MAGPIEexon	CDS	271247	271438	0.347	+	1	transcript "dm_007_GS_dna_1"	
Adh	MAGPIEexon	CDS	271499	271573	0.337	-	1	transcript "dm_006_GS_dna_5"	
Adh	MAGPIEexon	CDS	272173	272256	0.460	+	0	transcript "dm_007_GS_dna_1"	
Adh	MAGPIEexon	CDS	273396	273575	0.426	-	0	transcript "dm_006_GS_dna_5"	
Adh	MAGPIEexon	CDS	274362	274480	0.334	+	2	transcript "dm_007_GS_dna_1"	
Adh	MAGPIEexon	CDS	274725	274953	0.338	-	2	transcript "dm_006_GS_dna_5"	
Adh	MAGPIEexon	CDS	274751	275848	.	+	1	transcript "dm_007_MP_dna_2"	
Adh	MAGPIEexon	CDS	276361	276696	0.992	-	2	transcript "dm_007_GS_dna_3"	
Adh	MAGPIEexon	CDS	276748	277188	0.839	-	2	transcript "dm_007_GS_dna_3"	
Adh	MAGPIEexon	CDS	277921	278103	0.999	+	0	transcript "dm_007_GS_dna_4"	
Adh	MAGPIEexon	CDS	278222	278345	0.990	+	1	transcript "dm_007_GS_dna_4"	
Adh	MAGPIEexon	CDS	278537	278737	0.999	+	1	transcript "dm_007_GS_dna_4"	
Adh	MAGPIEexon	CDS	278802	279272	0.998	+	2	transcript "dm_007_GS_dna_4"	
Adh	MAGPIEexon	CDS	279548	279726	0.996	+	1	transcript "dm_007_GS_dna_4"	
Adh	MAGPIEexon	CDS	280031	280247	0.997	+	1	transcript "dm_007_GS_dna_4"	
Adh	MAGPIEexon	CDS	280310	280610	0.999	+	1	transcript "dm_007_GS_dna_4"	
Adh	MAGPIEexon	CDS	280674	280986	0.999	+	2	transcript "dm_007_GS_dna_4"	
Adh	MAGPIEexon	CDS	281051	281202	0.732	+	1	transcript "dm_007_GS_dna_4"	
Adh	MAGPIEexon	CDS	281264	281447	0.732	+	1	transcript "dm_007_GS_dna_4"	
Adh	MAGPIEexon	CDS	281550	281787	0.999	+	2	transcript "dm_007_GS_dna_4"	
Adh	MAGPIEexon	CDS	281848	282471	0.977	+	0	transcript "dm_007_GS_dna_4"	
Adh	MAGPIEexon	CDS	282539	283541	0.848	+	1	transcript "dm_007_GS_dna_4"	
Adh	MAGPIEexon	CDS	283608	284052	0.850	+	2	transcript "dm_007_GS_dna_4"	
Adh	MAGPIEexon	CDS	284779	284915	0.830	+	0	transcript "dm_007_GS_dna_5"	
Adh	MAGPIEexon	CDS	284969	285346	0.999	+	1	transcript "dm_007_GS_dna_5"	
Adh	MAGPIEexon	CDS	285416	286886	0.987	+	1	transcript "dm_007_GS_dna_5"	
Adh	MAGPIEexon	CDS	287599	288379	0.986	+	0	transcript "dm_007_GS_dna_6"	
Adh	MAGPIEexon	CDS	288647	292689	0.998	+	1	transcript "dm_007_GS_dna_6"	
Adh	MAGPIEexon	CDS	292759	292896	0.941	+	0	transcript "dm_007_GS_dna_6"	
Adh	MAGPIEexon	CDS	297680	297713	0.811	+	1	transcript "dm_007_GS_dna_7"	
Adh	MAGPIEexon	CDS	302560	302718	0.994	+	0	transcript "dm_007_GS_dna_7"	
Adh	MAGPIEexon	CDS	302786	303405	0.999	+	1	transcript "dm_007_GS_dna_7"	
Adh	MAGPIEexon	CDS	303960	304272	0.999	-	2	transcript "dm_007_GS_dna_8"	
Adh	MAGPIEexon	CDS	304330	305201	0.999	-	0	transcript "dm_007_GS_dna_8"	
Adh	MAGPIEexon	CDS	305396	305516	0.998	+	1	transcript "dm_007_GS_dna_9"	
Adh	MAGPIEexon	CDS	305577	305737	0.999	+	2	transcript "dm_007_GS_dna_9"	
Adh	MAGPIEexon	CDS	305803	306108	0.999	+	0	transcript "dm_007_GS_dna_9"	
Adh	MAGPIEexon	CDS	306230	306385	0.218	+	1	transcript "dm_007_GS_dna_9"	
Adh	MAGPIEexon	CDS	307965	309056	.	+	2	transcript "dm_007_MP_dna_10"	
Adh	MAGPIEexon	CDS	309110	309467	.	+	1	transcript "dm_007_MP_dna_10"	
Adh	MAGPIEexon	CDS	309530	310452	.	+	1	transcript "dm_007_MP_dna_10"	
Adh	MAGPIEexon	CDS	310517	311365	.	+	1	transcript "dm_007_MP_dna_10"	
Adh	MAGPIEexon	CDS	311428	312318	.	+	0	transcript "dm_007_MP_dna_10"	
Adh	MAGPIEexon	CDS	312387	313020	.	+	2	transcript "dm_007_MP_dna_10"	
Adh	MAGPIEexon	CDS	313086	313129	.	+	2	transcript "dm_007_MP_dna_10"	
Adh	MAGPIEexon	CDS	315138	315899	.	+	2	transcript "dm_008_MP_dna_1"	
Adh	MAGPIEexon	CDS	315138	315899	0.958	+	2	transcript "dm_007_GS_dna_11"	
Adh	MAGPIEexon	CDS	316433	316800	.	+	1	transcript "dm_008_MP_dna_1"	
Adh	MAGPIEexon	CDS	316433	316800	0.999	+	1	transcript "dm_007_GS_dna_11"	
Adh	MAGPIEexon	CDS	316865	317462	.	+	1	transcript "dm_008_MP_dna_1"	
Adh	MAGPIEexon	CDS	316865	317462	0.999	+	1	transcript "dm_007_GS_dna_11"	
Adh	MAGPIEexon	CDS	317891	318548	.	-	0	transcript "dm_008_MP_dna_2"	
Adh	MAGPIEexon	CDS	317891	318548	0.994	-	0	transcript "dm_007_GS_dna_12"	
Adh	MAGPIEexon	CDS	318608	319430	.	-	0	transcript "dm_008_MP_dna_2"	
Adh	MAGPIEexon	CDS	318608	319430	0.991	-	0	transcript "dm_007_GS_dna_12"	
Adh	MAGPIEexon	CDS	319486	319939	0.912	-	1	transcript "dm_007_GS_dna_12"	
Adh	MAGPIEexon	CDS	319486	321442	.	-	1	transcript "dm_008_MP_dna_2"	
Adh	MAGPIEexon	CDS	321967	323027	.	-	0	transcript "dm_008_MP_dna_3"	
Adh	MAGPIEexon	CDS	323097	323169	.	-	2	transcript "dm_008_MP_dna_3"	
Adh	MAGPIEexon	CDS	323788	324885	.	+	0	transcript "dm_008_MP_dna_4"	
Adh	MAGPIEexon	CDS	324939	325223	.	+	2	transcript "dm_008_MP_dna_4"	
Adh	MAGPIEexon	CDS	325240	325634	.	-	0	transcript "dm_008_MP_dna_5"	
Adh	MAGPIEexon	CDS	325689	326379	.	-	2	transcript "dm_008_MP_dna_5"	
Adh	MAGPIEexon	CDS	327175	328002	.	+	0	transcript "dm_008_MP_dna_6"	
Adh	MAGPIEexon	CDS	328048	328453	0.802	-	1	transcript "dm_008_GS_dna_7"	
Adh	MAGPIEexon	CDS	328473	328606	0.868	-	1	transcript "dm_008_GS_dna_7"	
Adh	MAGPIEexon	CDS	329808	330183	0.999	+	2	transcript "dm_008_GS_dna_8"	
Adh	MAGPIEexon	CDS	331539	331615	0.738	+	2	transcript "dm_008_GS_dna_8"	
Adh	MAGPIEexon	CDS	334589	335125	0.768	-	1	transcript "dm_008_GS_dna_9"	
Adh	MAGPIEexon	CDS	336758	337317	0.723	-	2	transcript "dm_008_GS_dna_9"	
Adh	MAGPIEexon	CDS	337379	337457	0.911	-	0	transcript "dm_008_GS_dna_9"	
Adh	MAGPIEexon	CDS	338167	338879	0.951	-	0	transcript "dm_008_GS_dna_10"	
Adh	MAGPIEexon	CDS	338944	339013	0.999	-	1	transcript "dm_008_GS_dna_10"	
Adh	MAGPIEexon	CDS	340529	340634	0.996	+	1	transcript "dm_008_GS_dna_11"	
Adh	MAGPIEexon	CDS	340705	340870	0.999	+	0	transcript "dm_008_GS_dna_11"	
Adh	MAGPIEexon	CDS	340926	341517	0.999	+	2	transcript "dm_008_GS_dna_11"	
Adh	MAGPIEexon	CDS	341713	341857	0.990	+	0	transcript "dm_008_GS_dna_12"	
Adh	MAGPIEexon	CDS	342003	342751	0.984	+	2	transcript "dm_008_GS_dna_12"	
Adh	MAGPIEexon	CDS	343169	343368	0.993	+	1	transcript "dm_008_GS_dna_13"	
Adh	MAGPIEexon	CDS	343432	343984	0.683	+	0	transcript "dm_008_GS_dna_13"	
Adh	MAGPIEexon	CDS	352084	354471	.	-	2	transcript "dm_008_MP_dna_14"	
Adh	MAGPIEexon	CDS	359469	359549	0.850	-	0	transcript "dm_008_GS_dna_15"	
Adh	MAGPIEexon	CDS	359787	359893	0.551	-	1	transcript "dm_008_GS_dna_15"	
Adh	MAGPIEexon	CDS	360014	360134	0.509	-	0	transcript "dm_009_GS_dna_1"	
Adh	MAGPIEexon	CDS	360158	360259	0.670	-	1	transcript "dm_008_GS_dna_15"	
Adh	MAGPIEexon	CDS	360158	360259	0.732	-	1	transcript "dm_009_GS_dna_1"	
Adh	MAGPIEexon	CDS	361565	361765	0.496	-	1	transcript "dm_008_GS_dna_15"	
Adh	MAGPIEexon	CDS	361565	361859	0.879	-	0	transcript "dm_009_GS_dna_1"	
Adh	MAGPIEexon	CDS	362433	362535	0.949	-	2	transcript "dm_009_GS_dna_1"	
Adh	MAGPIEexon	CDS	363245	363531	0.890	-	2	transcript "dm_009_GS_dna_1"	
Adh	MAGPIEexon	CDS	363249	363531	0.460	-	2	transcript "dm_008_GS_dna_15"	
Adh	MAGPIEexon	CDS	364222	364468	0.516	-	1	transcript "dm_009_GS_dna_1"	
Adh	MAGPIEexon	CDS	364222	364468	0.641	-	1	transcript "dm_008_GS_dna_15"	
Adh	MAGPIEexon	CDS	364708	364829	0.478	-	0	transcript "dm_009_GS_dna_1"	
Adh	MAGPIEexon	CDS	364708	364829	0.538	-	0	transcript "dm_008_GS_dna_15"	
Adh	MAGPIEexon	CDS	365336	365560	0.926	-	1	transcript "dm_009_GS_dna_2"	
Adh	MAGPIEexon	CDS	368407	368477	0.458	+	0	transcript "dm_009_GS_dna_3"	
Adh	MAGPIEexon	CDS	372518	372740	0.198	+	1	transcript "dm_009_GS_dna_3"	
Adh	MAGPIEexon	CDS	373286	373457	0.608	+	1	transcript "dm_009_GS_dna_4"	
Adh	MAGPIEexon	CDS	376557	376652	0.043	+	2	transcript "dm_009_GS_dna_4"	
Adh	MAGPIEexon	CDS	379125	379228	0.025	+	2	transcript "dm_009_GS_dna_4"	
Adh	MAGPIEexon	CDS	381887	382052	0.266	+	1	transcript "dm_009_GS_dna_4"	
Adh	MAGPIEexon	CDS	385051	385283	0.037	+	0	transcript "dm_009_GS_dna_4"	
Adh	MAGPIEexon	CDS	387190	387340	0.007	+	0	transcript "dm_009_GS_dna_4"	
Adh	MAGPIEexon	CDS	387735	387997	0.010	+	2	transcript "dm_009_GS_dna_4"	
Adh	MAGPIEexon	CDS	388780	388921	0.306	+	0	transcript "dm_009_GS_dna_4"	
Adh	MAGPIEexon	CDS	389006	389140	0.999	+	1	transcript "dm_009_GS_dna_4"	
Adh	MAGPIEexon	CDS	389208	390491	0.902	+	2	transcript "dm_009_GS_dna_4"	
Adh	MAGPIEexon	CDS	390556	390673	0.999	+	0	transcript "dm_009_GS_dna_4"	
Adh	MAGPIEexon	CDS	390737	391112	0.966	+	1	transcript "dm_009_GS_dna_4"	
Adh	MAGPIEexon	CDS	391177	391500	0.978	+	0	transcript "dm_009_GS_dna_4"	
Adh	MAGPIEexon	CDS	393012	393326	0.331	-	0	transcript "dm_009_GS_dna_5"	
Adh	MAGPIEexon	CDS	393630	393814	0.502	-	1	transcript "dm_009_GS_dna_5"	
Adh	MAGPIEexon	CDS	393894	394052	0.999	-	0	transcript "dm_009_GS_dna_5"	
Adh	MAGPIEexon	CDS	394383	397468	0.998	-	1	transcript "dm_009_GS_dna_5"	
Adh	MAGPIEexon	CDS	397532	397671	0.589	-	2	transcript "dm_009_GS_dna_5"	
Adh	MAGPIEexon	CDS	400338	400923	.	+	2	transcript "dm_009_MP_dna_6"	
Adh	MAGPIEexon	CDS	401350	401713	.	+	0	transcript "dm_009_MP_dna_6"	
Adh	MAGPIEexon	CDS	401775	402341	.	+	2	transcript "dm_009_MP_dna_6"	
Adh	MAGPIEexon	CDS	402399	402539	.	+	2	transcript "dm_009_MP_dna_6"	
Adh	MAGPIEexon	CDS	402607	402780	.	+	0	transcript "dm_009_MP_dna_6"	
Adh	MAGPIEexon	CDS	405952	406314	.	+	0	transcript "dm_010_MP_dna_1"	
Adh	MAGPIEexon	CDS	408210	408401	0.294	+	2	transcript "dm_009_GS_dna_7"	
Adh	MAGPIEexon	CDS	408210	408401	0.294	+	2	transcript "dm_010_GS_dna_2"	
Adh	MAGPIEexon	CDS	408852	409001	0.343	+	2	transcript "dm_009_GS_dna_7"	
Adh	MAGPIEexon	CDS	408852	409001	0.343	+	2	transcript "dm_010_GS_dna_2"	
Adh	MAGPIEexon	CDS	409150	409656	0.726	+	0	transcript "dm_009_GS_dna_7"	
Adh	MAGPIEexon	CDS	409150	409656	0.996	+	0	transcript "dm_010_GS_dna_2"	
Adh	MAGPIEexon	CDS	410157	410315	0.989	+	2	transcript "dm_010_GS_dna_2"	
Adh	MAGPIEexon	CDS	410372	410612	0.394	+	1	transcript "dm_010_GS_dna_2"	
Adh	MAGPIEexon	CDS	410677	411401	0.986	+	0	transcript "dm_010_GS_dna_2"	
Adh	MAGPIEexon	CDS	411728	411831	0.927	+	1	transcript "dm_010_GS_dna_2"	
Adh	MAGPIEexon	CDS	411898	412000	0.812	+	0	transcript "dm_010_GS_dna_2"	
Adh	MAGPIEexon	CDS	414711	415055	0.016	-	0	transcript "dm_010_GS_dna_3"	
Adh	MAGPIEexon	CDS	415627	416211	0.020	-	2	transcript "dm_010_GS_dna_3"	
Adh	MAGPIEexon	CDS	416276	416749	0.993	-	1	transcript "dm_010_GS_dna_3"	
Adh	MAGPIEexon	CDS	417423	417621	0.460	-	2	transcript "dm_010_GS_dna_3"	
Adh	MAGPIEexon	CDS	418131	418273	0.023	-	1	transcript "dm_010_GS_dna_3"	
Adh	MAGPIEexon	CDS	424506	424832	0.040	-	0	transcript "dm_010_GS_dna_3"	
Adh	MAGPIEexon	CDS	424891	424974	0.997	-	2	transcript "dm_010_GS_dna_3"	
Adh	MAGPIEexon	CDS	426746	427525	0.891	-	1	transcript "dm_010_GS_dna_4"	
Adh	MAGPIEexon	CDS	431931	432168	0.487	-	2	transcript "dm_010_GS_dna_5"	
Adh	MAGPIEexon	CDS	433244	433516	0.536	-	1	transcript "dm_010_GS_dna_5"	
Adh	MAGPIEexon	CDS	438983	439800	0.045	-	2	transcript "dm_010_GS_dna_5"	
Adh	MAGPIEexon	CDS	440839	440850	0.950	-	2	transcript "dm_010_GS_dna_5"	
Adh	MAGPIEexon	CDS	444283	444471	0.717	-	2	transcript "dm_010_GS_dna_6"	
Adh	MAGPIEexon	CDS	444724	444768	0.637	-	2	transcript "dm_010_GS_dna_6"	
Adh	MAGPIEexon	CDS	445189	445277	0.448	+	0	transcript "dm_010_GS_dna_7"	
Adh	MAGPIEexon	CDS	446294	446429	0.369	+	1	transcript "dm_010_GS_dna_7"	
Adh	MAGPIEexon	CDS	446732	447001	0.116	+	1	transcript "dm_010_GS_dna_7"	
Adh	MAGPIEexon	CDS	448492	448607	0.157	+	0	transcript "dm_010_GS_dna_7"	
Adh	MAGPIEexon	CDS	449015	449247	0.927	+	1	transcript "dm_010_GS_dna_7"	
Adh	MAGPIEexon	CDS	451744	451902	0.274	+	0	transcript "dm_011_GS_dna_1"	
Adh	MAGPIEexon	CDS	451744	451902	0.861	+	0	transcript "dm_010_GS_dna_7"	
Adh	MAGPIEexon	CDS	452734	452909	0.009	+	0	transcript "dm_010_GS_dna_7"	
Adh	MAGPIEexon	CDS	452734	452909	0.173	+	0	transcript "dm_011_GS_dna_1"	
Adh	MAGPIEexon	CDS	454581	454755	0.009	+	2	transcript "dm_010_GS_dna_7"	
Adh	MAGPIEexon	CDS	455021	455702	0.448	+	1	transcript "dm_011_GS_dna_1"	
Adh	MAGPIEexon	CDS	455974	456225	0.032	+	0	transcript "dm_011_GS_dna_1"	
Adh	MAGPIEexon	CDS	457233	457488	0.035	+	2	transcript "dm_011_GS_dna_1"	
Adh	MAGPIEexon	CDS	457649	458206	0.983	+	1	transcript "dm_011_GS_dna_1"	
Adh	MAGPIEexon	CDS	458285	458600	0.957	+	1	transcript "dm_011_GS_dna_1"	
Adh	MAGPIEexon	CDS	458837	459146	0.989	-	0	transcript "dm_011_GS_dna_2"	
Adh	MAGPIEexon	CDS	459225	459761	0.998	-	0	transcript "dm_011_GS_dna_2"	
Adh	MAGPIEexon	CDS	460256	460674	0.998	-	2	transcript "dm_011_GS_dna_2"	
Adh	MAGPIEexon	CDS	461236	461787	0.443	-	2	transcript "dm_011_GS_dna_3"	
Adh	MAGPIEexon	CDS	462179	462584	0.451	-	0	transcript "dm_011_GS_dna_3"	
Adh	MAGPIEexon	CDS	462646	463209	0.666	-	2	transcript "dm_011_GS_dna_3"	
Adh	MAGPIEexon	CDS	463368	463657	0.666	-	1	transcript "dm_011_GS_dna_3"	
Adh	MAGPIEexon	CDS	464308	464615	0.816	+	0	transcript "dm_011_GS_dna_4"	
Adh	MAGPIEexon	CDS	464888	465434	0.441	+	1	transcript "dm_011_GS_dna_4"	
Adh	MAGPIEexon	CDS	465989	466333	0.555	-	1	transcript "dm_011_GS_dna_5"	
Adh	MAGPIEexon	CDS	467979	469610	0.902	-	0	transcript "dm_011_GS_dna_6"	
Adh	MAGPIEexon	CDS	471109	471296	0.997	+	0	transcript "dm_011_GS_dna_7"	
Adh	MAGPIEexon	CDS	471441	471687	0.814	+	2	transcript "dm_011_GS_dna_7"	
Adh	MAGPIEexon	CDS	471752	471856	0.971	+	1	transcript "dm_011_GS_dna_7"	
Adh	MAGPIEexon	CDS	471944	472490	0.985	+	1	transcript "dm_011_GS_dna_7"	
Adh	MAGPIEexon	CDS	472557	472823	0.514	+	2	transcript "dm_011_GS_dna_7"	
Adh	MAGPIEexon	CDS	472965	473087	0.130	+	2	transcript "dm_011_GS_dna_7"	
Adh	MAGPIEexon	CDS	473909	474023	0.136	+	1	transcript "dm_011_GS_dna_7"	
Adh	MAGPIEexon	CDS	474365	475283	0.951	+	1	transcript "dm_011_GS_dna_7"	
Adh	MAGPIEexon	CDS	475427	476389	0.822	+	1	transcript "dm_011_GS_dna_7"	
Adh	MAGPIEexon	CDS	477171	477490	0.998	-	1	transcript "dm_011_GS_dna_8"	
Adh	MAGPIEexon	CDS	477548	479329	0.947	-	1	transcript "dm_011_GS_dna_8"	
Adh	MAGPIEexon	CDS	479386	479783	0.603	-	0	transcript "dm_011_GS_dna_8"	
Adh	MAGPIEexon	CDS	479815	479958	0.820	-	2	transcript "dm_011_GS_dna_8"	
Adh	MAGPIEexon	CDS	480147	480287	0.998	-	0	transcript "dm_011_GS_dna_8"	
Adh	MAGPIEexon	CDS	480343	480480	0.911	-	2	transcript "dm_011_GS_dna_8"	
Adh	MAGPIEexon	CDS	481570	481638	0.418	-	2	transcript "dm_011_GS_dna_8"	
Adh	MAGPIEexon	CDS	483386	483457	0.417	-	1	transcript "dm_011_GS_dna_8"	
Adh	MAGPIEexon	CDS	484195	484338	0.728	-	2	transcript "dm_011_GS_dna_8"	
Adh	MAGPIEexon	CDS	484664	484807	0.988	-	1	transcript "dm_011_GS_dna_8"	
Adh	MAGPIEexon	CDS	486686	487236	0.993	-	2	transcript "dm_011_GS_dna_8"	
Adh	MAGPIEexon	CDS	493406	493606	0.348	+	1	transcript "dm_011_GS_dna_9"	
Adh	MAGPIEexon	CDS	494963	495133	0.646	+	1	transcript "dm_011_GS_dna_9"	
Adh	MAGPIEexon	CDS	495756	496007	0.698	+	2	transcript "dm_011_GS_dna_9"	
Adh	MAGPIEexon	CDS	495756	496007	0.819	+	2	transcript "dm_012_GS_dna_1"	
Adh	MAGPIEexon	CDS	498520	498979	0.831	+	0	transcript "dm_011_GS_dna_10"	
Adh	MAGPIEexon	CDS	498520	498979	0.870	+	0	transcript "dm_012_GS_dna_2"	
Adh	MAGPIEexon	CDS	499082	499159	0.703	+	1	transcript "dm_011_GS_dna_10"	
Adh	MAGPIEexon	CDS	499082	499159	0.767	+	1	transcript "dm_012_GS_dna_2"	
Adh	MAGPIEexon	CDS	499280	499563	0.029	+	1	transcript "dm_012_GS_dna_2"	
Adh	MAGPIEexon	CDS	499280	499563	0.084	+	1	transcript "dm_011_GS_dna_10"	
Adh	MAGPIEexon	CDS	507216	507581	0.987	+	2	transcript "dm_012_GS_dna_2"	
Adh	MAGPIEexon	CDS	509545	509783	0.997	+	0	transcript "dm_012_GS_dna_3"	
Adh	MAGPIEexon	CDS	509881	510226	0.999	+	0	transcript "dm_012_GS_dna_3"	
Adh	MAGPIEexon	CDS	510287	510775	0.883	+	1	transcript "dm_012_GS_dna_3"	
Adh	MAGPIEexon	CDS	511163	511359	0.855	+	1	transcript "dm_012_GS_dna_3"	
Adh	MAGPIEexon	CDS	511784	512375	0.983	+	1	transcript "dm_012_GS_dna_3"	
Adh	MAGPIEexon	CDS	512435	512758	0.999	+	1	transcript "dm_012_GS_dna_3"	
Adh	MAGPIEexon	CDS	513238	514050	0.878	-	2	transcript "dm_012_GS_dna_4"	
Adh	MAGPIEexon	CDS	520781	521850	0.998	+	1	transcript "dm_012_GS_dna_5"	
Adh	MAGPIEexon	CDS	522013	522988	0.999	+	0	transcript "dm_012_GS_dna_5"	
Adh	MAGPIEexon	CDS	523395	523601	0.539	-	0	transcript "dm_012_GS_dna_6"	
Adh	MAGPIEexon	CDS	523660	524253	0.486	-	2	transcript "dm_012_GS_dna_6"	
Adh	MAGPIEexon	CDS	524438	525283	0.998	-	1	transcript "dm_012_GS_dna_6"	
Adh	MAGPIEexon	CDS	531864	531942	0.758	+	2	transcript "dm_012_GS_dna_7"	
Adh	MAGPIEexon	CDS	532391	532713	0.751	+	1	transcript "dm_012_GS_dna_7"	
Adh	MAGPIEexon	CDS	533592	533994	0.677	-	2	transcript "dm_012_GS_dna_8"	
Adh	MAGPIEexon	CDS	534017	534188	0.636	-	0	transcript "dm_012_GS_dna_8"	
Adh	MAGPIEexon	CDS	534467	534571	0.752	-	1	transcript "dm_012_GS_dna_8"	
Adh	MAGPIEexon	CDS	536670	536913	0.780	-	2	transcript "dm_012_GS_dna_8"	
Adh	MAGPIEexon	CDS	539230	539739	0.880	-	2	transcript "dm_012_GS_dna_9"	
Adh	MAGPIEexon	CDS	541276	542513	0.890	+	0	transcript "dm_013_GS_dna_1"	
Adh	MAGPIEexon	CDS	541380	542513	0.945	+	2	transcript "dm_012_GS_dna_10"	
Adh	MAGPIEexon	CDS	543431	543581	0.915	-	0	transcript "dm_012_GS_dna_11"	
Adh	MAGPIEexon	CDS	544032	544171	0.342	-	1	transcript "dm_013_GS_dna_2"	
Adh	MAGPIEexon	CDS	544890	545045	0.719	-	0	transcript "dm_013_GS_dna_2"	
Adh	MAGPIEexon	CDS	545369	545712	0.072	-	2	transcript "dm_013_GS_dna_2"	
Adh	MAGPIEexon	CDS	551013	551277	0.015	-	2	transcript "dm_013_GS_dna_2"	
Adh	MAGPIEexon	CDS	552580	552670	0.168	-	1	transcript "dm_013_GS_dna_2"	
Adh	MAGPIEexon	CDS	555360	555824	0.988	+	2	transcript "dm_013_GS_dna_3"	
Adh	MAGPIEexon	CDS	555920	556630	0.997	+	1	transcript "dm_013_GS_dna_3"	
Adh	MAGPIEexon	CDS	559562	559636	0.029	-	1	transcript "dm_013_GS_dna_4"	
Adh	MAGPIEexon	CDS	561810	562023	0.175	-	2	transcript "dm_013_GS_dna_4"	
Adh	MAGPIEexon	CDS	564255	564453	0.876	-	2	transcript "dm_013_GS_dna_4"	
Adh	MAGPIEexon	CDS	564467	564611	0.879	-	0	transcript "dm_013_GS_dna_4"	
Adh	MAGPIEexon	CDS	565610	565773	0.897	-	2	transcript "dm_013_GS_dna_4"	
Adh	MAGPIEexon	CDS	565822	565897	0.736	-	1	transcript "dm_013_GS_dna_4"	
Adh	MAGPIEexon	CDS	568986	569222	0.005	+	2	transcript "dm_013_GS_dna_5"	
Adh	MAGPIEexon	CDS	570329	570621	0.531	+	1	transcript "dm_013_GS_dna_5"	
Adh	MAGPIEexon	CDS	570790	570947	0.562	+	0	transcript "dm_013_GS_dna_5"	
Adh	MAGPIEexon	CDS	574289	574483	0.997	+	1	transcript "dm_013_GS_dna_5"	
Adh	MAGPIEexon	CDS	575409	575495	0.839	+	2	transcript "dm_013_GS_dna_5"	
Adh	MAGPIEexon	CDS	579774	579941	0.056	+	2	transcript "dm_013_GS_dna_5"	
Adh	MAGPIEexon	CDS	581726	581865	0.128	+	1	transcript "dm_013_GS_dna_5"	
Adh	MAGPIEexon	CDS	582401	582535	0.012	-	1	transcript "dm_013_GS_dna_6"	
Adh	MAGPIEexon	CDS	584140	584372	0.603	-	0	transcript "dm_013_GS_dna_7"	
Adh	MAGPIEexon	CDS	584997	585142	0.840	-	1	transcript "dm_013_GS_dna_7"	
Adh	MAGPIEexon	CDS	589462	589731	0.976	+	0	transcript "dm_014_GS_dna_1"	
Adh	MAGPIEexon	CDS	589538	589792	0.374	-	1	transcript "dm_013_GS_dna_7"	
Adh	MAGPIEexon	CDS	589807	589934	0.815	-	0	transcript "dm_013_GS_dna_7"	
Adh	MAGPIEexon	CDS	593654	594150	0.998	-	2	transcript "dm_014_GS_dna_2"	
Adh	MAGPIEexon	CDS	594203	594239	0.652	-	0	transcript "dm_014_GS_dna_2"	
Adh	MAGPIEexon	CDS	594435	594638	0.612	-	0	transcript "dm_014_GS_dna_2"	
Adh	MAGPIEexon	CDS	598403	598796	0.999	+	1	transcript "dm_014_GS_dna_3"	
Adh	MAGPIEexon	CDS	598857	599119	0.999	+	2	transcript "dm_014_GS_dna_3"	
Adh	MAGPIEexon	CDS	599219	600433	0.998	+	1	transcript "dm_014_GS_dna_3"	
Adh	MAGPIEexon	CDS	601945	603000	0.926	-	2	transcript "dm_014_GS_dna_4"	
Adh	MAGPIEexon	CDS	603442	604311	0.606	-	2	transcript "dm_014_GS_dna_5"	
Adh	MAGPIEexon	CDS	605575	605733	0.649	+	0	transcript "dm_014_GS_dna_6"	
Adh	MAGPIEexon	CDS	606284	606390	0.666	+	1	transcript "dm_014_GS_dna_6"	
Adh	MAGPIEexon	CDS	607399	607831	0.263	+	0	transcript "dm_014_GS_dna_6"	
Adh	MAGPIEexon	CDS	609887	610112	0.923	+	1	transcript "dm_014_GS_dna_7"	
Adh	MAGPIEexon	CDS	610286	610466	0.978	+	1	transcript "dm_014_GS_dna_7"	
Adh	MAGPIEexon	CDS	611385	611481	0.969	+	2	transcript "dm_014_GS_dna_7"	
Adh	MAGPIEexon	CDS	612900	613381	0.992	-	1	transcript "dm_014_GS_dna_8"	
Adh	MAGPIEexon	CDS	615333	615618	0.974	-	2	transcript "dm_014_GS_dna_8"	
Adh	MAGPIEexon	CDS	616137	616184	0.757	-	0	transcript "dm_014_GS_dna_8"	
Adh	MAGPIEexon	CDS	619451	619606	0.807	-	1	transcript "dm_014_GS_dna_8"	
Adh	MAGPIEexon	CDS	619825	619971	0.473	-	2	transcript "dm_014_GS_dna_8"	
Adh	MAGPIEexon	CDS	620442	620599	0.796	-	1	transcript "dm_014_GS_dna_8"	
Adh	MAGPIEexon	CDS	620827	620960	0.760	-	0	transcript "dm_014_GS_dna_8"	
Adh	MAGPIEexon	CDS	622753	623026	0.953	-	1	transcript "dm_014_GS_dna_8"	
Adh	MAGPIEexon	CDS	623108	623174	0.671	-	0	transcript "dm_014_GS_dna_8"	
Adh	MAGPIEexon	CDS	626761	627134	0.617	+	0	transcript "dm_014_GS_dna_9"	
Adh	MAGPIEexon	CDS	627758	628123	0.431	+	1	transcript "dm_014_GS_dna_9"	
Adh	MAGPIEexon	CDS	628666	628884	0.337	+	0	transcript "dm_014_GS_dna_9"	
Adh	MAGPIEexon	CDS	629944	630415	0.230	+	0	transcript "dm_014_GS_dna_9"	
Adh	MAGPIEexon	CDS	631257	631455	0.096	-	2	transcript "dm_015_GS_dna_1"	
Adh	MAGPIEexon	CDS	631257	631455	0.332	-	2	transcript "dm_014_GS_dna_10"	
Adh	MAGPIEexon	CDS	632492	632556	0.082	-	2	transcript "dm_015_GS_dna_1"	
Adh	MAGPIEexon	CDS	632492	632556	0.494	-	2	transcript "dm_014_GS_dna_10"	
Adh	MAGPIEexon	CDS	634805	634925	0.517	-	0	transcript "dm_014_GS_dna_11"	
Adh	MAGPIEexon	CDS	639175	639414	0.059	+	0	transcript "dm_015_GS_dna_2"	
Adh	MAGPIEexon	CDS	650611	651153	0.667	+	0	transcript "dm_015_GS_dna_2"	
Adh	MAGPIEexon	CDS	651278	651478	0.999	+	1	transcript "dm_015_GS_dna_2"	
Adh	MAGPIEexon	CDS	651583	652282	0.766	+	0	transcript "dm_015_GS_dna_2"	
Adh	MAGPIEexon	CDS	652397	652824	0.999	+	1	transcript "dm_015_GS_dna_2"	
Adh	MAGPIEexon	CDS	654984	656741	0.753	-	0	transcript "dm_015_GS_dna_3"	
Adh	MAGPIEexon	CDS	656952	657179	0.863	-	0	transcript "dm_015_GS_dna_3"	
Adh	MAGPIEexon	CDS	657754	658001	0.435	-	0	transcript "dm_015_GS_dna_3"	
Adh	MAGPIEexon	CDS	658058	658265	0.932	-	0	transcript "dm_015_GS_dna_3"	
Adh	MAGPIEexon	CDS	658326	658463	0.999	-	0	transcript "dm_015_GS_dna_3"	
Adh	MAGPIEexon	CDS	658526	660852	0.801	-	2	transcript "dm_015_GS_dna_3"	
Adh	MAGPIEexon	CDS	660917	661331	0.731	-	0	transcript "dm_015_GS_dna_3"	
Adh	MAGPIEexon	CDS	662256	662303	0.628	-	0	transcript "dm_015_GS_dna_3"	
Adh	MAGPIEexon	CDS	669489	669698	0.211	-	0	transcript "dm_015_GS_dna_3"	
Adh	MAGPIEexon	CDS	672131	672241	0.792	+	1	transcript "dm_015_GS_dna_4"	
Adh	MAGPIEexon	CDS	676698	676982	0.419	+	2	transcript "dm_016_GS_dna_1"	
Adh	MAGPIEexon	CDS	679806	679984	0.016	+	2	transcript "dm_015_GS_dna_4"	
Adh	MAGPIEexon	CDS	679874	680889	0.975	-	2	transcript "dm_016_GS_dna_2"	
Adh	MAGPIEexon	CDS	682600	682771	0.790	-	1	transcript "dm_016_GS_dna_2"	
Adh	MAGPIEexon	CDS	682831	682969	0.977	-	1	transcript "dm_016_GS_dna_2"	
Adh	MAGPIEexon	CDS	683154	683228	0.078	-	0	transcript "dm_016_GS_dna_2"	
Adh	MAGPIEexon	CDS	687135	687323	0.104	-	0	transcript "dm_016_GS_dna_2"	
Adh	MAGPIEexon	CDS	687902	688024	0.301	-	1	transcript "dm_016_GS_dna_2"	
Adh	MAGPIEexon	CDS	689469	689746	0.897	-	1	transcript "dm_016_GS_dna_2"	
Adh	MAGPIEexon	CDS	689811	689983	0.999	-	1	transcript "dm_016_GS_dna_2"	
Adh	MAGPIEexon	CDS	690663	691097	0.998	-	0	transcript "dm_016_GS_dna_2"	
Adh	MAGPIEexon	CDS	691393	691603	0.116	-	1	transcript "dm_016_GS_dna_2"	
Adh	MAGPIEexon	CDS	694449	694667	0.085	-	0	transcript "dm_016_GS_dna_2"	
Adh	MAGPIEexon	CDS	696358	696502	0.719	+	0	transcript "dm_016_GS_dna_3"	
Adh	MAGPIEexon	CDS	703834	704312	0.178	+	0	transcript "dm_016_GS_dna_3"	
Adh	MAGPIEexon	CDS	708173	708388	0.694	-	1	transcript "dm_016_GS_dna_4"	
Adh	MAGPIEexon	CDS	711768	711933	0.002	-	2	transcript "dm_016_GS_dna_5"	
Adh	MAGPIEexon	CDS	719956	720148	0.001	-	1	transcript "dm_016_GS_dna_5"	
Adh	MAGPIEexon	CDS	720798	720919	0.392	+	2	transcript "dm_017_GS_dna_1"	
Adh	MAGPIEexon	CDS	721551	721627	0.184	-	1	transcript "dm_016_GS_dna_5"	
Adh	MAGPIEexon	CDS	723676	723760	0.325	+	0	transcript "dm_017_GS_dna_1"	
Adh	MAGPIEexon	CDS	727112	727283	0.722	+	1	transcript "dm_017_GS_dna_1"	
Adh	MAGPIEexon	CDS	727747	728036	0.751	+	0	transcript "dm_017_GS_dna_1"	
Adh	MAGPIEexon	CDS	729158	729227	0.841	+	1	transcript "dm_017_GS_dna_2"	
Adh	MAGPIEexon	CDS	730955	731126	0.825	+	1	transcript "dm_017_GS_dna_2"	
Adh	MAGPIEexon	CDS	736960	737185	0.156	+	0	transcript "dm_017_GS_dna_2"	
Adh	MAGPIEexon	CDS	739579	739678	0.113	-	1	transcript "dm_017_GS_dna_3"	
Adh	MAGPIEexon	CDS	745333	745517	0.409	-	0	transcript "dm_017_GS_dna_3"	
Adh	MAGPIEexon	CDS	746912	747144	0.650	-	2	transcript "dm_017_GS_dna_3"	
Adh	MAGPIEexon	CDS	747904	747997	0.840	-	1	transcript "dm_017_GS_dna_3"	
Adh	MAGPIEexon	CDS	749647	749690	0.716	+	0	transcript "dm_017_GS_dna_4"	
Adh	MAGPIEexon	CDS	750438	750559	0.525	+	2	transcript "dm_017_GS_dna_4"	
Adh	MAGPIEexon	CDS	754035	754129	0.305	+	2	transcript "dm_017_GS_dna_4"	
Adh	MAGPIEexon	CDS	754773	754879	0.065	+	2	transcript "dm_017_GS_dna_4"	
Adh	MAGPIEexon	CDS	755993	756089	0.428	+	1	transcript "dm_017_GS_dna_4"	
Adh	MAGPIEexon	CDS	756638	756775	0.873	+	1	transcript "dm_017_GS_dna_4"	
Adh	MAGPIEexon	CDS	757457	757838	.	+	1	transcript "dm_019_MP_dna_1"	
Adh	MAGPIEexon	CDS	757457	757859	0.861	+	1	transcript "dm_017_GS_dna_5"	
Adh	MAGPIEexon	CDS	758794	759002	0.782	+	0	transcript "dm_017_GS_dna_5"	
Adh	MAGPIEexon	CDS	763337	763772	0.940	-	0	transcript "dm_017_GS_dna_6"	
Adh	MAGPIEexon	CDS	767844	767989	0.703	-	1	transcript "dm_017_GS_dna_6"	
Adh	MAGPIEexon	CDS	771216	771615	0.998	+	2	transcript "dm_018_GS_dna_1"	
Adh	MAGPIEexon	CDS	771955	772295	.	+	0	transcript "dm_019_MP_dna_1"	
Adh	MAGPIEexon	CDS	771955	772295	0.999	+	0	transcript "dm_018_GS_dna_1"	
Adh	MAGPIEexon	CDS	779692	781583	.	+	0	transcript "dm_019_MP_dna_1"	
Adh	MAGPIEexon	CDS	779692	781583	0.592	+	0	transcript "dm_018_GS_dna_1"	
Adh	MAGPIEexon	CDS	781886	782694	.	+	1	transcript "dm_019_MP_dna_1"	
Adh	MAGPIEexon	CDS	781886	782694	0.935	+	1	transcript "dm_018_GS_dna_1"	
Adh	MAGPIEexon	CDS	784250	784398	0.747	+	1	transcript "dm_018_GS_dna_1"	
Adh	MAGPIEexon	CDS	785825	785896	0.460	-	1	transcript "dm_018_GS_dna_2"	
Adh	MAGPIEexon	CDS	786663	786788	0.322	-	0	transcript "dm_018_GS_dna_2"	
Adh	MAGPIEexon	CDS	787968	788261	0.976	-	0	transcript "dm_018_GS_dna_2"	
Adh	MAGPIEexon	CDS	788839	788940	0.856	+	0	transcript "dm_018_GS_dna_3"	
Adh	MAGPIEexon	CDS	789003	789176	0.839	+	2	transcript "dm_018_GS_dna_3"	
Adh	MAGPIEexon	CDS	794575	794793	0.744	+	0	transcript "dm_018_GS_dna_3"	
Adh	MAGPIEexon	CDS	796482	796994	0.866	+	2	transcript "dm_018_GS_dna_3"	
Adh	MAGPIEexon	CDS	801894	802914	0.681	+	2	transcript "dm_018_GS_dna_4"	
Adh	MAGPIEexon	CDS	803148	803203	0.949	+	2	transcript "dm_018_GS_dna_4"	
Adh	MAGPIEexon	CDS	804010	804157	0.560	+	0	transcript "dm_018_GS_dna_4"	
Adh	MAGPIEexon	CDS	813291	814650	.	+	2	transcript "dm_019_MP_dna_1"	
Adh	MAGPIEexon	CDS	813291	814650	0.882	+	2	transcript "dm_018_GS_dna_4"	
Adh	MAGPIEexon	CDS	814726	814981	.	+	0	transcript "dm_019_MP_dna_1"	
Adh	MAGPIEexon	CDS	814726	814981	0.995	+	0	transcript "dm_018_GS_dna_4"	
Adh	MAGPIEexon	CDS	815046	815442	.	+	2	transcript "dm_019_MP_dna_1"	
Adh	MAGPIEexon	CDS	815528	817215	.	+	1	transcript "dm_019_MP_dna_1"	
Adh	MAGPIEexon	CDS	817273	818025	.	+	0	transcript "dm_019_MP_dna_1"	
Adh	MAGPIEexon	CDS	818086	818367	.	+	0	transcript "dm_019_MP_dna_1"	
Adh	MAGPIEexon	CDS	818447	818574	.	+	1	transcript "dm_019_MP_dna_1"	
Adh	MAGPIEexon	CDS	818633	819290	.	+	1	transcript "dm_019_MP_dna_1"	
Adh	MAGPIEexon	CDS	820171	820789	.	+	0	transcript "dm_019_MP_dna_1"	
Adh	MAGPIEexon	CDS	820846	820979	.	+	0	transcript "dm_019_MP_dna_1"	
Adh	MAGPIEexon	CDS	821037	821265	.	+	2	transcript "dm_019_MP_dna_1"	
Adh	MAGPIEexon	CDS	821333	821487	.	+	1	transcript "dm_019_MP_dna_1"	
Adh	MAGPIEexon	CDS	822205	822454	0.999	+	0	transcript "dm_019_GS_dna_2"	
Adh	MAGPIEexon	CDS	822511	822848	0.997	+	0	transcript "dm_019_GS_dna_2"	
Adh	MAGPIEexon	CDS	822874	824011	0.864	+	0	transcript "dm_019_GS_dna_2"	
Adh	MAGPIEexon	CDS	824074	824822	0.997	+	0	transcript "dm_019_GS_dna_2"	
Adh	MAGPIEexon	CDS	824885	825688	0.942	+	1	transcript "dm_019_GS_dna_2"	
Adh	MAGPIEexon	CDS	825804	826423	0.996	+	2	transcript "dm_019_GS_dna_2"	
Adh	MAGPIEexon	CDS	826499	826653	0.811	+	1	transcript "dm_019_GS_dna_2"	
Adh	MAGPIEexon	CDS	826714	826921	0.814	+	0	transcript "dm_019_GS_dna_2"	
Adh	MAGPIEexon	CDS	826980	827087	0.994	+	2	transcript "dm_019_GS_dna_2"	
Adh	MAGPIEexon	CDS	827148	827511	0.999	+	2	transcript "dm_019_GS_dna_2"	
Adh	MAGPIEexon	CDS	828047	828306	0.854	+	1	transcript "dm_019_GS_dna_3"	
Adh	MAGPIEexon	CDS	832073	833668	0.335	+	1	transcript "dm_019_GS_dna_3"	
Adh	MAGPIEexon	CDS	835043	835312	0.987	+	1	transcript "dm_019_GS_dna_3"	
Adh	MAGPIEexon	CDS	836514	837106	0.799	+	2	transcript "dm_019_GS_dna_3"	
Adh	MAGPIEexon	CDS	837173	837428	0.952	+	1	transcript "dm_019_GS_dna_3"	
Adh	MAGPIEexon	CDS	837486	837859	0.943	+	2	transcript "dm_019_GS_dna_3"	
Adh	MAGPIEexon	CDS	837919	838152	0.999	+	0	transcript "dm_019_GS_dna_3"	
Adh	MAGPIEexon	CDS	838217	839076	0.932	+	1	transcript "dm_019_GS_dna_3"	
Adh	MAGPIEexon	CDS	839671	840390	0.985	-	2	transcript "dm_019_GS_dna_4"	
Adh	MAGPIEexon	CDS	841091	841333	0.984	-	1	transcript "dm_019_GS_dna_5"	
Adh	MAGPIEexon	CDS	841389	841969	0.998	-	1	transcript "dm_019_GS_dna_5"	
Adh	MAGPIEexon	CDS	842034	842442	0.933	-	2	transcript "dm_019_GS_dna_5"	
Adh	MAGPIEexon	CDS	842968	843375	0.941	-	2	transcript "dm_019_GS_dna_6"	
Adh	MAGPIEexon	CDS	843445	843518	0.696	-	0	transcript "dm_019_GS_dna_6"	
Adh	MAGPIEexon	CDS	846096	846292	0.687	-	1	transcript "dm_019_GS_dna_6"	
Adh	MAGPIEexon	CDS	846401	847372	0.670	-	1	transcript "dm_019_GS_dna_6"	
Adh	MAGPIEexon	CDS	847433	848154	0.989	-	2	transcript "dm_019_GS_dna_6"	
Adh	MAGPIEexon	CDS	848208	848609	0.999	-	0	transcript "dm_019_GS_dna_6"	
Adh	MAGPIEexon	CDS	848668	848733	0.467	-	2	transcript "dm_019_GS_dna_6"	
Adh	MAGPIEexon	CDS	851085	851190	.	+	2	transcript "dm_019_MP_dna_7"	
Adh	MAGPIEexon	CDS	851256	851436	.	+	2	transcript "dm_019_MP_dna_7"	
Adh	MAGPIEexon	CDS	851491	851673	.	+	0	transcript "dm_019_MP_dna_7"	
Adh	MAGPIEexon	CDS	851742	851919	.	+	2	transcript "dm_019_MP_dna_7"	
Adh	MAGPIEexon	CDS	853119	855014	0.519	+	2	transcript "dm_019_GS_dna_8"	
Adh	MAGPIEexon	CDS	855874	855922	.	+	0	transcript "dm_020_MP_dna_1"	
Adh	MAGPIEexon	CDS	855874	855922	0.938	+	0	transcript "dm_019_GS_dna_9"	
Adh	MAGPIEexon	CDS	855982	856031	.	+	0	transcript "dm_020_MP_dna_1"	
Adh	MAGPIEexon	CDS	855982	856031	0.664	+	0	transcript "dm_019_GS_dna_9"	
Adh	MAGPIEexon	CDS	856092	856876	.	+	2	transcript "dm_020_MP_dna_1"	
Adh	MAGPIEexon	CDS	856092	856876	0.670	+	2	transcript "dm_019_GS_dna_9"	
Adh	MAGPIEexon	CDS	856942	858029	.	+	0	transcript "dm_020_MP_dna_1"	
Adh	MAGPIEexon	CDS	856942	858029	0.999	+	0	transcript "dm_019_GS_dna_9"	
Adh	MAGPIEexon	CDS	858109	858341	.	+	0	transcript "dm_020_MP_dna_1"	
Adh	MAGPIEexon	CDS	858109	858341	0.999	+	0	transcript "dm_019_GS_dna_9"	
Adh	MAGPIEexon	CDS	858418	858966	.	+	0	transcript "dm_020_MP_dna_1"	
Adh	MAGPIEexon	CDS	858418	858966	0.997	+	0	transcript "dm_019_GS_dna_9"	
Adh	MAGPIEexon	CDS	859408	859527	0.497	-	2	transcript "dm_019_GS_dna_10"	
Adh	MAGPIEexon	CDS	862461	862656	0.885	-	2	transcript "dm_020_GS_dna_2"	
Adh	MAGPIEexon	CDS	864846	865018	0.445	-	1	transcript "dm_020_GS_dna_2"	
Adh	MAGPIEexon	CDS	865295	865345	0.355	-	1	transcript "dm_020_GS_dna_2"	
Adh	MAGPIEexon	CDS	870684	870860	0.501	-	0	transcript "dm_020_GS_dna_3"	
Adh	MAGPIEexon	CDS	872557	872818	.	-	1	transcript "dm_020_MP_dna_4"	
Adh	MAGPIEexon	CDS	872891	873131	.	-	0	transcript "dm_020_MP_dna_4"	
Adh	MAGPIEexon	CDS	873191	873321	.	-	2	transcript "dm_020_MP_dna_4"	
Adh	MAGPIEexon	CDS	873388	873527	.	-	0	transcript "dm_020_MP_dna_4"	
Adh	MAGPIEexon	CDS	873583	874093	.	-	1	transcript "dm_020_MP_dna_4"	
Adh	MAGPIEexon	CDS	874278	874541	.	-	0	transcript "dm_020_MP_dna_4"	
Adh	MAGPIEexon	CDS	874599	874870	.	-	1	transcript "dm_020_MP_dna_4"	
Adh	MAGPIEexon	CDS	875603	875970	0.313	+	1	transcript "dm_020_GS_dna_5"	
Adh	MAGPIEexon	CDS	879960	880326	0.752	+	2	transcript "dm_020_GS_dna_5"	
Adh	MAGPIEexon	CDS	880859	881091	0.402	-	2	transcript "dm_020_GS_dna_6"	
Adh	MAGPIEexon	CDS	883002	883191	0.209	-	2	transcript "dm_020_GS_dna_6"	
Adh	MAGPIEexon	CDS	884810	884937	0.453	-	2	transcript "dm_020_GS_dna_6"	
Adh	MAGPIEexon	CDS	885047	885736	0.928	-	1	transcript "dm_020_GS_dna_6"	
Adh	MAGPIEexon	CDS	885967	886798	0.724	-	1	transcript "dm_020_GS_dna_6"	
Adh	MAGPIEexon	CDS	888067	888286	0.074	-	1	transcript "dm_020_GS_dna_6"	
Adh	MAGPIEexon	CDS	901332	901495	0.200	-	1	transcript "dm_020_GS_dna_6"	
Adh	MAGPIEexon	CDS	903291	903472	0.846	-	1	transcript "dm_020_GS_dna_7"	
Adh	MAGPIEexon	CDS	903291	903472	0.904	-	1	transcript "dm_021_GS_dna_1"	
Adh	MAGPIEexon	CDS	904075	904120	0.904	-	1	transcript "dm_021_GS_dna_1"	
Adh	MAGPIEexon	CDS	904075	904120	0.920	-	1	transcript "dm_020_GS_dna_7"	
Adh	MAGPIEexon	CDS	910572	910742	0.859	-	0	transcript "dm_021_GS_dna_2"	
Adh	MAGPIEexon	CDS	910801	911055	0.909	-	2	transcript "dm_021_GS_dna_2"	
Adh	MAGPIEexon	CDS	914313	914373	0.768	+	2	transcript "dm_021_GS_dna_3"	
Adh	MAGPIEexon	CDS	915101	915384	0.631	+	1	transcript "dm_021_GS_dna_3"	
Adh	MAGPIEexon	CDS	918151	918795	0.970	-	2	transcript "dm_021_GS_dna_4"	
Adh	MAGPIEexon	CDS	918858	918869	0.980	-	0	transcript "dm_021_GS_dna_4"	
Adh	MAGPIEexon	CDS	920331	920644	0.986	-	1	transcript "dm_021_GS_dna_5"	
Adh	MAGPIEexon	CDS	921666	921726	0.639	-	2	transcript "dm_021_GS_dna_5"	
Adh	MAGPIEexon	CDS	925331	925384	0.526	+	1	transcript "dm_021_GS_dna_6"	
Adh	MAGPIEexon	CDS	925992	926161	0.770	+	2	transcript "dm_021_GS_dna_6"	
Adh	MAGPIEexon	CDS	926551	926656	0.462	+	0	transcript "dm_021_GS_dna_6"	
Adh	MAGPIEexon	CDS	930378	930473	0.637	-	0	transcript "dm_021_GS_dna_7"	
Adh	MAGPIEexon	CDS	930526	930618	0.406	-	2	transcript "dm_021_GS_dna_7"	
Adh	MAGPIEexon	CDS	930979	931038	0.835	+	0	transcript "dm_021_GS_dna_8"	
Adh	MAGPIEexon	CDS	934141	934218	0.795	+	0	transcript "dm_021_GS_dna_8"	
Adh	MAGPIEexon	CDS	937578	937656	0.868	+	2	transcript "dm_021_GS_dna_9"	
Adh	MAGPIEexon	CDS	937700	937847	0.255	+	1	transcript "dm_021_GS_dna_9"	
Adh	MAGPIEexon	CDS	940449	940647	0.690	+	2	transcript "dm_021_GS_dna_9"	
Adh	MAGPIEexon	CDS	941115	941176	0.325	-	1	transcript "dm_021_GS_dna_10"	
Adh	MAGPIEexon	CDS	941646	941731	0.141	-	1	transcript "dm_021_GS_dna_10"	
Adh	MAGPIEexon	CDS	942328	942612	0.242	-	2	transcript "dm_021_GS_dna_10"	
Adh	MAGPIEexon	CDS	943030	943151	0.284	-	0	transcript "dm_021_GS_dna_10"	
Adh	MAGPIEexon	CDS	944233	944598	0.259	-	2	transcript "dm_021_GS_dna_10"	
Adh	MAGPIEexon	CDS	945396	945542	0.112	-	0	transcript "dm_022_GS_dna_1"	
Adh	MAGPIEexon	CDS	945396	945542	0.935	-	0	transcript "dm_021_GS_dna_11"	
Adh	MAGPIEexon	CDS	947717	947791	0.281	-	1	transcript "dm_022_GS_dna_1"	
Adh	MAGPIEexon	CDS	947717	947791	0.641	-	1	transcript "dm_021_GS_dna_11"	
Adh	MAGPIEexon	CDS	959530	959754	.	-	2	transcript "dm_022_MP_dna_2"	
Adh	MAGPIEexon	CDS	959747	959788	.	-	1	transcript "dm_022_MP_dna_2"	
Adh	MAGPIEexon	CDS	961228	962781	.	-	2	transcript "dm_022_MP_dna_2"	
Adh	MAGPIEexon	CDS	971207	971303	0.301	+	1	transcript "dm_022_GS_dna_3"	
Adh	MAGPIEexon	CDS	974363	974512	0.018	+	1	transcript "dm_022_GS_dna_3"	
Adh	MAGPIEexon	CDS	976874	977072	0.003	+	1	transcript "dm_022_GS_dna_3"	
Adh	MAGPIEexon	CDS	979878	980124	0.674	+	2	transcript "dm_022_GS_dna_3"	
Adh	MAGPIEexon	CDS	980240	980419	0.571	-	1	transcript "dm_022_GS_dna_4"	
Adh	MAGPIEexon	CDS	984981	985070	.	+	2	transcript "dm_022_MP_dna_5"	
Adh	MAGPIEexon	CDS	985373	986896	.	+	1	transcript "dm_022_MP_dna_5"	
Adh	MAGPIEexon	CDS	989323	989629	0.446	+	0	transcript "dm_022_GS_dna_6"	
Adh	MAGPIEexon	CDS	991190	991278	0.277	+	1	transcript "dm_022_GS_dna_6"	
Adh	MAGPIEexon	CDS	992355	992562	0.594	+	2	transcript "dm_023_GS_dna_1"	
Adh	MAGPIEexon	CDS	993039	993131	0.655	-	0	transcript "dm_022_GS_dna_7"	
Adh	MAGPIEexon	CDS	993183	993498	0.507	-	2	transcript "dm_022_GS_dna_7"	
Adh	MAGPIEexon	CDS	996046	996180	0.192	+	0	transcript "dm_023_GS_dna_1"	
Adh	MAGPIEexon	CDS	997668	997824	0.960	+	2	transcript "dm_023_GS_dna_2"	
Adh	MAGPIEexon	CDS	999440	999546	0.972	+	1	transcript "dm_023_GS_dna_2"	
Adh	MAGPIEexon	CDS	1000753	1000833	0.816	-	2	transcript "dm_023_GS_dna_3"	
Adh	MAGPIEexon	CDS	1001673	1001809	0.864	-	1	transcript "dm_023_GS_dna_3"	
Adh	MAGPIEexon	CDS	1002590	1002767	0.909	-	0	transcript "dm_023_GS_dna_3"	
Adh	MAGPIEexon	CDS	1003354	1003371	0.867	-	2	transcript "dm_023_GS_dna_3"	
Adh	MAGPIEexon	CDS	1004686	1004817	0.878	+	0	transcript "dm_023_GS_dna_4"	
Adh	MAGPIEexon	CDS	1004898	1005045	0.520	+	2	transcript "dm_023_GS_dna_4"	
Adh	MAGPIEexon	CDS	1005107	1005297	0.205	+	1	transcript "dm_023_GS_dna_4"	
Adh	MAGPIEexon	CDS	1006442	1006590	0.078	+	1	transcript "dm_023_GS_dna_4"	
Adh	MAGPIEexon	CDS	1007627	1007813	0.199	+	1	transcript "dm_023_GS_dna_4"	
Adh	MAGPIEexon	CDS	1010672	1010788	0.471	+	1	transcript "dm_023_GS_dna_4"	
Adh	MAGPIEexon	CDS	1012123	1012246	0.875	+	0	transcript "dm_023_GS_dna_5"	
Adh	MAGPIEexon	CDS	1013541	1013718	0.014	+	2	transcript "dm_023_GS_dna_5"	
Adh	MAGPIEexon	CDS	1016252	1016384	0.009	+	1	transcript "dm_023_GS_dna_5"	
Adh	MAGPIEexon	CDS	1018661	1018717	0.072	+	1	transcript "dm_023_GS_dna_6"	
Adh	MAGPIEexon	CDS	1023733	1023986	0.003	+	0	transcript "dm_023_GS_dna_6"	
Adh	MAGPIEexon	CDS	1027636	1027728	0.142	+	0	transcript "dm_023_GS_dna_6"	
Adh	MAGPIEexon	CDS	1029258	1029575	0.104	+	2	transcript "dm_023_GS_dna_6"	
Adh	MAGPIEexon	CDS	1032318	1032417	0.447	+	2	transcript "dm_023_GS_dna_6"	
Adh	MAGPIEexon	CDS	1034159	1034527	0.628	+	1	transcript "dm_023_GS_dna_6"	
Adh	MAGPIEexon	CDS	1035573	1035884	0.715	-	0	transcript "dm_023_GS_dna_7"	
Adh	MAGPIEexon	CDS	1035624	1035884	0.141	-	0	transcript "dm_024_GS_dna_1"	
Adh	MAGPIEexon	CDS	1039544	1039700	0.663	-	0	transcript "dm_023_GS_dna_8"	
Adh	MAGPIEexon	CDS	1041376	1041530	0.997	-	0	transcript "dm_024_GS_dna_2"	
Adh	MAGPIEexon	CDS	1041602	1041989	0.963	-	0	transcript "dm_024_GS_dna_2"	
Adh	MAGPIEexon	CDS	1042386	1042688	0.998	-	0	transcript "dm_024_GS_dna_2"	
Adh	MAGPIEexon	CDS	1044304	1044690	0.932	+	0	transcript "dm_024_GS_dna_3"	
Adh	MAGPIEexon	CDS	1046547	1046945	0.908	-	0	transcript "dm_024_GS_dna_4"	
Adh	MAGPIEexon	CDS	1049062	1049603	0.618	-	0	transcript "dm_024_GS_dna_5"	
Adh	MAGPIEexon	CDS	1050773	1050821	0.812	-	0	transcript "dm_024_GS_dna_5"	
Adh	MAGPIEexon	CDS	1051748	1051953	0.679	-	2	transcript "dm_024_GS_dna_6"	
Adh	MAGPIEexon	CDS	1056915	1057314	0.661	-	2	transcript "dm_024_GS_dna_6"	
Adh	MAGPIEexon	CDS	1058247	1058433	0.836	+	2	transcript "dm_024_GS_dna_7"	
Adh	MAGPIEexon	CDS	1060088	1060332	0.747	+	1	transcript "dm_024_GS_dna_7"	
Adh	MAGPIEexon	CDS	1061245	1061553	0.784	+	0	transcript "dm_024_GS_dna_7"	
Adh	MAGPIEexon	CDS	1062866	1063004	0.501	-	0	transcript "dm_024_GS_dna_8"	
Adh	MAGPIEexon	CDS	1063308	1063476	0.242	-	2	transcript "dm_024_GS_dna_8"	
Adh	MAGPIEexon	CDS	1065198	1065299	0.119	-	0	transcript "dm_024_GS_dna_8"	
Adh	MAGPIEexon	CDS	1065409	1065697	0.189	-	1	transcript "dm_024_GS_dna_8"	
Adh	MAGPIEexon	CDS	1067215	1067418	0.018	-	2	transcript "dm_024_GS_dna_8"	
Adh	MAGPIEexon	CDS	1071033	1071182	0.440	+	2	transcript "dm_024_GS_dna_9"	
Adh	MAGPIEexon	CDS	1071569	1071758	0.599	+	1	transcript "dm_024_GS_dna_9"	
Adh	MAGPIEexon	CDS	1071760	1071884	0.643	+	0	transcript "dm_024_GS_dna_9"	
Adh	MAGPIEexon	CDS	1072985	1073182	0.126	-	1	transcript "dm_024_GS_dna_10"	
Adh	MAGPIEexon	CDS	1076146	1076281	0.041	-	1	transcript "dm_024_GS_dna_10"	
Adh	MAGPIEexon	CDS	1076902	1077102	0.717	-	2	transcript "dm_024_GS_dna_10"	
Adh	MAGPIEexon	CDS	1078465	1079099	0.945	-	0	transcript "dm_024_GS_dna_10"	
Adh	MAGPIEexon	CDS	1080191	1080391	0.008	+	1	transcript "dm_024_GS_dna_11"	
Adh	MAGPIEexon	CDS	1080191	1080550	0.982	+	1	transcript "dm_025_GS_dna_1"	
Adh	MAGPIEexon	CDS	1080824	1081111	0.010	+	1	transcript "dm_024_GS_dna_11"	
Adh	MAGPIEexon	CDS	1080893	1081134	0.345	+	1	transcript "dm_025_GS_dna_2"	
Adh	MAGPIEexon	CDS	1081774	1081920	0.301	+	0	transcript "dm_024_GS_dna_11"	
Adh	MAGPIEexon	CDS	1083400	1083793	0.660	-	1	transcript "dm_024_GS_dna_12"	
Adh	MAGPIEexon	CDS	1083628	1083965	0.008	+	0	transcript "dm_025_GS_dna_2"	
Adh	MAGPIEexon	CDS	1084268	1084890	0.698	-	2	transcript "dm_024_GS_dna_12"	
Adh	MAGPIEexon	CDS	1084758	1084913	0.010	+	2	transcript "dm_025_GS_dna_2"	
Adh	MAGPIEexon	CDS	1085487	1085647	0.009	+	2	transcript "dm_025_GS_dna_2"	
Adh	MAGPIEexon	CDS	1088648	1088855	0.587	+	1	transcript "dm_025_GS_dna_2"	
Adh	MAGPIEexon	CDS	1089066	1089373	0.401	+	2	transcript "dm_025_GS_dna_2"	
Adh	MAGPIEexon	CDS	1104531	1104965	.	-	0	transcript "dm_025_MP_dna_3"	
Adh	MAGPIEexon	CDS	1110074	1110172	.	+	1	transcript "dm_025_MP_dna_4a"	
Adh	MAGPIEexon	CDS	1110238	1110642	.	+	0	transcript "dm_025_MP_dna_4a"	
Adh	MAGPIEexon	CDS	1110713	1110979	.	+	1	transcript "dm_025_MP_dna_4a"	
Adh	MAGPIEexon	CDS	1111283	1111378	.	+	1	transcript "dm_025_MP_dna_4"	
Adh	MAGPIEexon	CDS	1111805	1112209	.	+	1	transcript "dm_025_MP_dna_4"	
Adh	MAGPIEexon	CDS	1112261	1112578	.	+	1	transcript "dm_025_MP_dna_4"	
Adh	MAGPIEexon	CDS	1115048	1115497	0.844	+	1	transcript "dm_025_GS_dna_5"	
Adh	MAGPIEexon	CDS	1116327	1116774	0.902	-	2	transcript "dm_025_GS_dna_6"	
Adh	MAGPIEexon	CDS	1117455	1117672	0.879	-	1	transcript "dm_025_GS_dna_6"	
Adh	MAGPIEexon	CDS	1118649	1118732	0.927	-	0	transcript "dm_025_GS_dna_6"	
Adh	MAGPIEexon	CDS	1123828	1123896	0.883	+	0	transcript "dm_025_GS_dna_7"	
Adh	MAGPIEexon	CDS	1125007	1125165	0.974	+	0	transcript "dm_025_GS_dna_7"	
Adh	MAGPIEexon	CDS	1125735	1125893	0.189	-	0	transcript "dm_025_GS_dna_8"	
Adh	MAGPIEexon	CDS	1126784	1126947	0.248	+	1	transcript "dm_026_GS_dna_1"	
Adh	MAGPIEexon	CDS	1128207	1128352	0.103	+	2	transcript "dm_026_GS_dna_1"	
Adh	MAGPIEexon	CDS	1128664	1128863	0.285	-	0	transcript "dm_026_GS_dna_2"	
Adh	MAGPIEexon	CDS	1128724	1128863	0.530	-	0	transcript "dm_025_GS_dna_8"	
Adh	MAGPIEexon	CDS	1129074	1129236	0.632	-	2	transcript "dm_026_GS_dna_2"	
Adh	MAGPIEexon	CDS	1129074	1129236	0.660	-	2	transcript "dm_025_GS_dna_8"	
Adh	MAGPIEexon	CDS	1130623	1130755	0.207	-	1	transcript "dm_026_GS_dna_3"	
Adh	MAGPIEexon	CDS	1133479	1133643	0.432	-	2	transcript "dm_026_GS_dna_3"	
Adh	MAGPIEexon	CDS	1135298	1135446	0.664	-	2	transcript "dm_026_GS_dna_3"	
Adh	MAGPIEexon	CDS	1141566	1143953	.	-	0	transcript "dm_026_MP_dna_4"	
Adh	MAGPIEexon	CDS	1145593	1145844	0.227	-	2	transcript "dm_026_GS_dna_5"	
Adh	MAGPIEexon	CDS	1146799	1147106	0.954	-	0	transcript "dm_026_GS_dna_6"	
Adh	MAGPIEexon	CDS	1147866	1148064	0.714	-	2	transcript "dm_026_GS_dna_6"	
Adh	MAGPIEexon	CDS	1148478	1148530	0.712	-	1	transcript "dm_026_GS_dna_6"	
Adh	MAGPIEexon	CDS	1148830	1149064	0.682	-	1	transcript "dm_026_GS_dna_6"	
Adh	MAGPIEexon	CDS	1155909	1156244	0.966	+	2	transcript "dm_026_GS_dna_7"	
Adh	MAGPIEexon	CDS	1157124	1157396	0.391	+	2	transcript "dm_026_GS_dna_8"	
Adh	MAGPIEexon	CDS	1159253	1159449	0.929	-	2	transcript "dm_026_GS_dna_9"	
Adh	MAGPIEexon	CDS	1159530	1159749	0.019	-	2	transcript "dm_026_GS_dna_9"	
Adh	MAGPIEexon	CDS	1163535	1163787	0.535	-	2	transcript "dm_026_GS_dna_9"	
Adh	MAGPIEexon	CDS	1169369	1169435	0.356	-	0	transcript "dm_026_GS_dna_9"	
Adh	MAGPIEexon	CDS	1171159	1171226	0.592	-	0	transcript "dm_026_GS_dna_9"	
Adh	MAGPIEexon	CDS	1171176	1171265	0.290	+	2	transcript "dm_027_GS_dna_1"	
Adh	MAGPIEexon	CDS	1173445	1173675	0.181	+	0	transcript "dm_027_GS_dna_1"	
Adh	MAGPIEexon	CDS	1175859	1176133	0.639	-	1	transcript "dm_027_GS_dna_2"	
Adh	MAGPIEexon	CDS	1178371	1178593	0.949	-	1	transcript "dm_027_GS_dna_2"	
Adh	MAGPIEexon	CDS	1182203	1182415	0.917	-	1	transcript "dm_027_GS_dna_2"	
Adh	MAGPIEexon	CDS	1185006	1185086	0.927	+	2	transcript "dm_027_GS_dna_3"	
Adh	MAGPIEexon	CDS	1187398	1187646	0.803	+	0	transcript "dm_027_GS_dna_3"	
Adh	MAGPIEexon	CDS	1191961	1192146	0.737	-	2	transcript "dm_027_GS_dna_4"	
Adh	MAGPIEexon	CDS	1195612	1195710	0.970	-	2	transcript "dm_027_GS_dna_4"	
Adh	MAGPIEexon	CDS	1196126	1196173	0.874	-	1	transcript "dm_027_GS_dna_4"	
Adh	MAGPIEexon	CDS	1198757	1198941	0.640	+	1	transcript "dm_027_GS_dna_5"	
Adh	MAGPIEexon	CDS	1202772	1202931	0.623	+	2	transcript "dm_027_GS_dna_5"	
Adh	MAGPIEexon	CDS	1205439	1205597	0.964	+	2	transcript "dm_027_GS_dna_6"	
Adh	MAGPIEexon	CDS	1206559	1206786	0.989	+	0	transcript "dm_027_GS_dna_6"	
Adh	MAGPIEexon	CDS	1207563	1207574	0.945	+	2	transcript "dm_027_GS_dna_7"	
Adh	MAGPIEexon	CDS	1207666	1207906	0.731	+	0	transcript "dm_027_GS_dna_7"	
Adh	MAGPIEexon	CDS	1209000	1209064	0.540	+	2	transcript "dm_027_GS_dna_7"	
Adh	MAGPIEexon	CDS	1211030	1211110	0.627	+	1	transcript "dm_027_GS_dna_7"	
Adh	MAGPIEexon	CDS	1213212	1213325	0.591	+	2	transcript "dm_027_GS_dna_7"	
Adh	MAGPIEexon	CDS	1216389	1216489	0.394	-	1	transcript "dm_028_GS_dna_1"	
Adh	MAGPIEexon	CDS	1218391	1219920	0.416	-	2	transcript "dm_027_GS_dna_8"	
Adh	MAGPIEexon	CDS	1218654	1220253	0.387	-	2	transcript "dm_028_GS_dna_1"	
Adh	MAGPIEexon	CDS	1220453	1221762	0.903	-	2	transcript "dm_028_GS_dna_1"	
Adh	MAGPIEexon	CDS	1222288	1222395	0.485	-	2	transcript "dm_028_GS_dna_1"	
Adh	MAGPIEexon	CDS	1222483	1223742	0.220	-	2	transcript "dm_028_GS_dna_1"	
Adh	MAGPIEexon	CDS	1225056	1225291	0.276	-	1	transcript "dm_028_GS_dna_1"	
Adh	MAGPIEexon	CDS	1225603	1225742	0.558	-	0	transcript "dm_028_GS_dna_1"	
Adh	MAGPIEexon	CDS	1229684	1230733	0.993	+	1	transcript "dm_028_GS_dna_2"	
Adh	MAGPIEexon	CDS	1231127	1231384	0.885	-	1	transcript "dm_028_GS_dna_3"	
Adh	MAGPIEexon	CDS	1231452	1231463	0.999	-	0	transcript "dm_028_GS_dna_3"	
Adh	MAGPIEexon	CDS	1233087	1233293	0.831	+	2	transcript "dm_028_GS_dna_4"	
Adh	MAGPIEexon	CDS	1234598	1234752	0.969	+	1	transcript "dm_028_GS_dna_5"	
Adh	MAGPIEexon	CDS	1235638	1235782	0.972	+	0	transcript "dm_028_GS_dna_5"	
Adh	MAGPIEexon	CDS	1237615	1237935	0.792	-	2	transcript "dm_028_GS_dna_6"	
Adh	MAGPIEexon	CDS	1242560	1242628	0.334	+	1	transcript "dm_028_GS_dna_7"	
Adh	MAGPIEexon	CDS	1243647	1243787	0.027	+	2	transcript "dm_028_GS_dna_7"	
Adh	MAGPIEexon	CDS	1245175	1245291	0.054	+	0	transcript "dm_028_GS_dna_7"	
Adh	MAGPIEexon	CDS	1247640	1247834	0.789	+	2	transcript "dm_028_GS_dna_7"	
Adh	MAGPIEexon	CDS	1250753	1251421	0.758	+	1	transcript "dm_028_GS_dna_7"	
Adh	MAGPIEexon	CDS	1252544	1253617	0.645	+	1	transcript "dm_028_GS_dna_8"	
Adh	MAGPIEexon	CDS	1255669	1256823	0.999	+	0	transcript "dm_028_GS_dna_9"	
Adh	MAGPIEexon	CDS	1260165	1260262	0.676	-	1	transcript "dm_028_GS_dna_10"	
Adh	MAGPIEexon	CDS	1260699	1260735	0.384	+	2	transcript "dm_029_GS_dna_1"	
Adh	MAGPIEexon	CDS	1262187	1262229	0.802	-	2	transcript "dm_028_GS_dna_10"	
Adh	MAGPIEexon	CDS	1262204	1262244	0.263	+	1	transcript "dm_029_GS_dna_1"	
Adh	MAGPIEexon	CDS	1263535	1264034	0.999	-	0	transcript "dm_028_GS_dna_11"	
Adh	MAGPIEexon	CDS	1263535	1264034	0.999	-	0	transcript "dm_029_GS_dna_2"	
Adh	MAGPIEexon	CDS	1264126	1264286	0.997	-	0	transcript "dm_028_GS_dna_11"	
Adh	MAGPIEexon	CDS	1264126	1264286	0.997	-	0	transcript "dm_029_GS_dna_2"	
Adh	MAGPIEexon	CDS	1264559	1264638	0.787	-	2	transcript "dm_028_GS_dna_11"	
Adh	MAGPIEexon	CDS	1264559	1264638	0.883	-	2	transcript "dm_029_GS_dna_2"	
Adh	MAGPIEexon	CDS	1271377	1272140	0.931	-	0	transcript "dm_029_GS_dna_3"	
Adh	MAGPIEexon	CDS	1272217	1272395	0.999	-	0	transcript "dm_029_GS_dna_3"	
Adh	MAGPIEexon	CDS	1273203	1273596	0.000	-	2	transcript "dm_029_GS_dna_3"	
Adh	MAGPIEexon	CDS	1273652	1273822	0.530	-	1	transcript "dm_029_GS_dna_3"	
Adh	MAGPIEexon	CDS	1274014	1274154	0.230	-	2	transcript "dm_029_GS_dna_3"	
Adh	MAGPIEexon	CDS	1276206	1276359	0.939	-	2	transcript "dm_029_GS_dna_3"	
Adh	MAGPIEexon	CDS	1278087	1278236	0.608	+	2	transcript "dm_029_GS_dna_4"	
Adh	MAGPIEexon	CDS	1278370	1278783	0.593	+	0	transcript "dm_029_GS_dna_4"	
Adh	MAGPIEexon	CDS	1279740	1279866	0.596	+	2	transcript "dm_029_GS_dna_5"	
Adh	MAGPIEexon	CDS	1280376	1280551	0.701	+	2	transcript "dm_029_GS_dna_5"	
Adh	MAGPIEexon	CDS	1285030	1285502	0.945	-	0	transcript "dm_029_GS_dna_6"	
Adh	MAGPIEexon	CDS	1285595	1285746	0.966	-	2	transcript "dm_029_GS_dna_6"	
Adh	MAGPIEexon	CDS	1285814	1285859	0.916	-	0	transcript "dm_029_GS_dna_6"	
Adh	MAGPIEexon	CDS	1285971	1286199	0.864	-	2	transcript "dm_029_GS_dna_6"	
Adh	MAGPIEexon	CDS	1287362	1287449	0.934	+	1	transcript "dm_029_GS_dna_7"	
Adh	MAGPIEexon	CDS	1288777	1288839	0.456	+	0	transcript "dm_029_GS_dna_7"	
Adh	MAGPIEexon	CDS	1289437	1289622	0.697	+	0	transcript "dm_029_GS_dna_7"	
Adh	MAGPIEexon	CDS	1290737	1290891	0.521	+	1	transcript "dm_029_GS_dna_7"	
Adh	MAGPIEexon	CDS	1291163	1291306	0.322	+	1	transcript "dm_029_GS_dna_7"	
Adh	MAGPIEexon	CDS	1291426	1291581	0.326	+	0	transcript "dm_029_GS_dna_7"	
Adh	MAGPIEexon	CDS	1292100	1292645	0.982	+	2	transcript "dm_029_GS_dna_8"	
Adh	MAGPIEexon	CDS	1294081	1298310	.	-	2	transcript "dm_029_MP_dna_9"	
Adh	MAGPIEexon	CDS	1300469	1300474	0.991	+	1	transcript "dm_029_GS_dna_10"	
Adh	MAGPIEexon	CDS	1300535	1302030	0.801	+	1	transcript "dm_029_GS_dna_10"	
Adh	MAGPIEexon	CDS	1303048	1303240	0.568	+	0	transcript "dm_029_GS_dna_10"	
Adh	MAGPIEexon	CDS	1306976	1307120	0.319	+	1	transcript "dm_029_GS_dna_10"	
Adh	MAGPIEexon	CDS	1306976	1307130	0.520	+	1	transcript "dm_030_GS_dna_1"	
Adh	MAGPIEexon	CDS	1308562	1308884	0.158	+	0	transcript "dm_029_GS_dna_10"	
Adh	MAGPIEexon	CDS	1312765	1312941	0.010	+	0	transcript "dm_030_GS_dna_1"	
Adh	MAGPIEexon	CDS	1315829	1315922	0.211	+	1	transcript "dm_030_GS_dna_1"	
Adh	MAGPIEexon	CDS	1316180	1316324	0.478	-	0	transcript "dm_030_GS_dna_2"	
Adh	MAGPIEexon	CDS	1318236	1318363	0.900	-	1	transcript "dm_030_GS_dna_2"	
Adh	MAGPIEexon	CDS	1325325	1325476	0.354	+	2	transcript "dm_030_GS_dna_3"	
Adh	MAGPIEexon	CDS	1331811	1331941	0.386	+	2	transcript "dm_030_GS_dna_3"	
Adh	MAGPIEexon	CDS	1332021	1332113	0.930	+	2	transcript "dm_030_GS_dna_3"	
Adh	MAGPIEexon	CDS	1332196	1332764	0.996	+	0	transcript "dm_030_GS_dna_3"	
Adh	MAGPIEexon	CDS	1333640	1333962	0.838	-	2	transcript "dm_030_GS_dna_4"	
Adh	MAGPIEexon	CDS	1334205	1334409	0.595	-	2	transcript "dm_030_GS_dna_4"	
Adh	MAGPIEexon	CDS	1334780	1335024	0.803	-	2	transcript "dm_030_GS_dna_5"	
Adh	MAGPIEexon	CDS	1335080	1335356	0.814	-	0	transcript "dm_030_GS_dna_5"	
Adh	MAGPIEexon	CDS	1335416	1336157	0.991	-	0	transcript "dm_030_GS_dna_5"	
Adh	MAGPIEexon	CDS	1336453	1336680	0.690	-	2	transcript "dm_030_GS_dna_5"	
Adh	MAGPIEexon	CDS	1337668	1338007	0.692	-	1	transcript "dm_030_GS_dna_5"	
Adh	MAGPIEexon	CDS	1338337	1338640	0.998	-	1	transcript "dm_030_GS_dna_5"	
Adh	MAGPIEexon	CDS	1338702	1338785	0.999	-	0	transcript "dm_030_GS_dna_5"	
Adh	MAGPIEexon	CDS	1341273	1341405	0.053	-	2	transcript "dm_030_GS_dna_6"	
Adh	MAGPIEexon	CDS	1343297	1343428	0.038	-	1	transcript "dm_030_GS_dna_6"	
Adh	MAGPIEexon	CDS	1345610	1345895	0.061	-	0	transcript "dm_030_GS_dna_6"	
Adh	MAGPIEexon	CDS	1348649	1348820	0.083	-	0	transcript "dm_030_GS_dna_6"	
Adh	MAGPIEexon	CDS	1351755	1351841	0.319	-	0	transcript "dm_030_GS_dna_6"	
Adh	MAGPIEexon	CDS	1353453	1353513	0.691	+	2	transcript "dm_031_GS_dna_1"	
Adh	MAGPIEexon	CDS	1356244	1356389	0.541	+	0	transcript "dm_031_GS_dna_1"	
Adh	MAGPIEexon	CDS	1361682	1361956	0.077	+	2	transcript "dm_031_GS_dna_1"	
Adh	MAGPIEexon	CDS	1363483	1363603	0.088	+	0	transcript "dm_031_GS_dna_1"	
Adh	MAGPIEexon	CDS	1365367	1365566	0.868	+	0	transcript "dm_031_GS_dna_2"	
Adh	MAGPIEexon	CDS	1366196	1366289	0.987	+	1	transcript "dm_031_GS_dna_2"	
Adh	MAGPIEexon	CDS	1366469	1366636	0.973	+	1	transcript "dm_031_GS_dna_2"	
Adh	MAGPIEexon	CDS	1368951	1369282	.	-	1	transcript "dm_031_MP_dna_3"	
Adh	MAGPIEexon	CDS	1372020	1372351	.	-	1	transcript "dm_031_MP_dna_4"	
Adh	MAGPIEexon	CDS	1387013	1387294	0.590	+	1	transcript "dm_031_GS_dna_5"	
Adh	MAGPIEexon	CDS	1398183	1398833	0.088	-	0	transcript "dm_032_GS_dna_1"	
Adh	MAGPIEexon	CDS	1398183	1398833	0.355	-	0	transcript "dm_031_GS_dna_6"	
Adh	MAGPIEexon	CDS	1401633	1401874	0.470	-	1	transcript "dm_032_GS_dna_1"	
Adh	MAGPIEexon	CDS	1402535	1402643	0.962	-	0	transcript "dm_032_GS_dna_1"	
Adh	MAGPIEexon	CDS	1402808	1402995	0.822	-	2	transcript "dm_032_GS_dna_1"	
Adh	MAGPIEexon	CDS	1403930	1404111	0.828	-	2	transcript "dm_032_GS_dna_1"	
Adh	MAGPIEexon	CDS	1405762	1405903	0.999	-	1	transcript "dm_032_GS_dna_1"	
Adh	MAGPIEexon	CDS	1406801	1406882	0.986	-	0	transcript "dm_032_GS_dna_1"	
Adh	MAGPIEexon	CDS	1407035	1407146	0.889	-	0	transcript "dm_032_GS_dna_1"	
Adh	MAGPIEexon	CDS	1408830	1408932	0.986	-	2	transcript "dm_032_GS_dna_1"	
Adh	MAGPIEexon	CDS	1411600	1411759	0.773	-	1	transcript "dm_032_GS_dna_1"	
Adh	MAGPIEexon	CDS	1412611	1412741	0.737	-	0	transcript "dm_032_GS_dna_1"	
Adh	MAGPIEexon	CDS	1413022	1413067	0.542	-	1	transcript "dm_032_GS_dna_1"	
Adh	MAGPIEexon	CDS	1414397	1418081	0.999	+	1	transcript "dm_032_GS_dna_2"	
Adh	MAGPIEexon	CDS	1418142	1419321	0.999	+	2	transcript "dm_032_GS_dna_2"	
Adh	MAGPIEexon	CDS	1419378	1419918	0.999	+	2	transcript "dm_032_GS_dna_2"	
Adh	MAGPIEexon	CDS	1421921	1422143	0.942	-	0	transcript "dm_032_GS_dna_3"	
Adh	MAGPIEexon	CDS	1422176	1422320	0.944	-	0	transcript "dm_032_GS_dna_3"	
Adh	MAGPIEexon	CDS	1424531	1424676	0.240	-	2	transcript "dm_032_GS_dna_3"	
Adh	MAGPIEexon	CDS	1424926	1425041	0.006	-	0	transcript "dm_032_GS_dna_3"	
Adh	MAGPIEexon	CDS	1425646	1425752	0.004	-	0	transcript "dm_032_GS_dna_3"	
Adh	MAGPIEexon	CDS	1426168	1426281	0.998	-	2	transcript "dm_032_GS_dna_3"	
Adh	MAGPIEexon	CDS	1426393	1426486	0.706	-	1	transcript "dm_032_GS_dna_3"	
Adh	MAGPIEexon	CDS	1428573	1428690	0.186	-	2	transcript "dm_032_GS_dna_3"	
Adh	MAGPIEexon	CDS	1431180	1431306	0.145	-	2	transcript "dm_032_GS_dna_3"	
Adh	MAGPIEexon	CDS	1432142	1432223	0.078	-	0	transcript "dm_032_GS_dna_3"	
Adh	MAGPIEexon	CDS	1433247	1433480	0.939	+	2	transcript "dm_032_GS_dna_4"	
Adh	MAGPIEexon	CDS	1435469	1435552	0.886	+	1	transcript "dm_032_GS_dna_4"	
Adh	MAGPIEexon	CDS	1438345	1438432	0.760	+	0	transcript "dm_032_GS_dna_4"	
Adh	MAGPIEexon	CDS	1439326	1439513	0.138	+	0	transcript "dm_032_GS_dna_4"	
Adh	MAGPIEexon	CDS	1443348	1443405	0.516	+	2	transcript "dm_033_GS_dna_1"	
Adh	MAGPIEexon	CDS	1445532	1445710	0.907	+	2	transcript "dm_033_GS_dna_1"	
Adh	MAGPIEexon	CDS	1446481	1446622	0.417	+	0	transcript "dm_033_GS_dna_1"	
Adh	MAGPIEexon	CDS	1450916	1451046	0.711	+	1	transcript "dm_033_GS_dna_1"	
Adh	MAGPIEexon	CDS	1452315	1452770	0.222	-	0	transcript "dm_033_GS_dna_2"	
Adh	MAGPIEexon	CDS	1454896	1455060	0.249	+	0	transcript "dm_033_GS_dna_3"	
Adh	MAGPIEexon	CDS	1458338	1458694	0.248	+	1	transcript "dm_033_GS_dna_3"	
Adh	MAGPIEexon	CDS	1461904	1462087	0.133	-	1	transcript "dm_033_GS_dna_4"	
Adh	MAGPIEexon	CDS	1466153	1466744	0.092	-	0	transcript "dm_033_GS_dna_4"	
Adh	MAGPIEexon	CDS	1466876	1467095	0.023	-	0	transcript "dm_033_GS_dna_4"	
Adh	MAGPIEexon	CDS	1472586	1472723	0.796	-	0	transcript "dm_033_GS_dna_5"	
Adh	MAGPIEexon	CDS	1473468	1473791	0.805	-	0	transcript "dm_033_GS_dna_5"	
Adh	MAGPIEexon	CDS	1475691	1476936	0.810	+	2	transcript "dm_033_GS_dna_6"	
Adh	MAGPIEexon	CDS	1476945	1480096	0.916	+	2	transcript "dm_033_GS_dna_6"	
Adh	MAGPIEexon	CDS	1480661	1481086	0.978	+	1	transcript "dm_033_GS_dna_7"	
Adh	MAGPIEexon	CDS	1481557	1481576	0.809	+	0	transcript "dm_033_GS_dna_8"	
Adh	MAGPIEexon	CDS	1484424	1484782	0.485	+	2	transcript "dm_033_GS_dna_8"	
Adh	MAGPIEexon	CDS	1487158	1487326	0.459	+	0	transcript "dm_034_GS_dna_1"	
Adh	MAGPIEexon	CDS	1487158	1487326	0.626	+	0	transcript "dm_033_GS_dna_8"	
Adh	MAGPIEexon	CDS	1488069	1488120	0.644	+	2	transcript "dm_033_GS_dna_8"	
Adh	MAGPIEexon	CDS	1488069	1488120	0.685	+	2	transcript "dm_034_GS_dna_1"	
Adh	MAGPIEexon	CDS	1489262	1489834	0.699	+	1	transcript "dm_033_GS_dna_8"	
Adh	MAGPIEexon	CDS	1489262	1489834	0.701	+	1	transcript "dm_034_GS_dna_1"	
Adh	MAGPIEexon	CDS	1493680	1493718	0.533	+	0	transcript "dm_034_GS_dna_2"	
Adh	MAGPIEexon	CDS	1495620	1496198	0.719	+	2	transcript "dm_034_GS_dna_2"	
Adh	MAGPIEexon	CDS	1496304	1496815	0.999	-	1	transcript "dm_034_GS_dna_3"	
Adh	MAGPIEexon	CDS	1496865	1497000	0.999	-	2	transcript "dm_034_GS_dna_3"	
Adh	MAGPIEexon	CDS	1497576	1498121	0.999	+	2	transcript "dm_034_GS_dna_4"	
Adh	MAGPIEexon	CDS	1498334	1499046	0.999	-	2	transcript "dm_034_GS_dna_5"	
Adh	MAGPIEexon	CDS	1499102	1499249	0.995	-	0	transcript "dm_034_GS_dna_5"	
Adh	MAGPIEexon	CDS	1499670	1500870	.	+	2	transcript "dm_034_MP_dna_6"	
Adh	MAGPIEexon	CDS	1500928	1501010	.	+	0	transcript "dm_034_MP_dna_6"	
Adh	MAGPIEexon	CDS	1527523	1527636	0.916	-	2	transcript "dm_034_GS_dna_7"	
Adh	MAGPIEexon	CDS	1527705	1528201	0.624	-	1	transcript "dm_034_GS_dna_7"	
Adh	MAGPIEexon	CDS	1528291	1528426	0.889	-	1	transcript "dm_034_GS_dna_7"	
Adh	MAGPIEexon	CDS	1529588	1529971	.	+	1	transcript "dm_034_MP_dna_8"	
Adh	MAGPIEexon	CDS	1530746	1531626	.	+	1	transcript "dm_034_MP_dna_8"	
Adh	MAGPIEexon	CDS	1530746	1531626	0.798	+	1	transcript "dm_035_GS_dna_1"	
Adh	MAGPIEexon	CDS	1531685	1531892	.	+	1	transcript "dm_034_MP_dna_8"	
Adh	MAGPIEexon	CDS	1531685	1531892	0.999	+	1	transcript "dm_035_GS_dna_1"	
Adh	MAGPIEexon	CDS	1531958	1532269	.	+	1	transcript "dm_034_MP_dna_8"	
Adh	MAGPIEexon	CDS	1531958	1532269	0.847	+	1	transcript "dm_035_GS_dna_1"	
Adh	MAGPIEexon	CDS	1533935	1533994	0.458	-	1	transcript "dm_035_GS_dna_2"	
Adh	MAGPIEexon	CDS	1535341	1535461	0.359	-	1	transcript "dm_035_GS_dna_2"	
Adh	MAGPIEexon	CDS	1535530	1535676	0.369	-	2	transcript "dm_035_GS_dna_2"	
Adh	MAGPIEexon	CDS	1535739	1536304	0.683	-	1	transcript "dm_035_GS_dna_2"	
Adh	MAGPIEexon	CDS	1536364	1537150	0.999	-	1	transcript "dm_035_GS_dna_2"	
Adh	MAGPIEexon	CDS	1537212	1538662	0.999	-	1	transcript "dm_035_GS_dna_2"	
Adh	MAGPIEexon	CDS	1538719	1541113	0.962	-	1	transcript "dm_035_GS_dna_2"	
Adh	MAGPIEexon	CDS	1541178	1541378	0.992	-	0	transcript "dm_035_GS_dna_2"	
Adh	MAGPIEexon	CDS	1541445	1541794	0.952	-	1	transcript "dm_035_GS_dna_2"	
Adh	MAGPIEexon	CDS	1542125	1542385	0.997	-	1	transcript "dm_035_GS_dna_2"	
Adh	MAGPIEexon	CDS	1543065	1543082	0.687	-	0	transcript "dm_035_GS_dna_2"	
Adh	MAGPIEexon	CDS	1546679	1546741	0.097	+	1	transcript "dm_035_GS_dna_3"	
Adh	MAGPIEexon	CDS	1547173	1547386	0.835	+	0	transcript "dm_035_GS_dna_3"	
Adh	MAGPIEexon	CDS	1547883	1548319	0.869	+	2	transcript "dm_035_GS_dna_3"	
Adh	MAGPIEexon	CDS	1548383	1548538	0.851	+	1	transcript "dm_035_GS_dna_3"	
Adh	MAGPIEexon	CDS	1549142	1550017	.	-	1	transcript "dm_035_MP_dna_4"	
Adh	MAGPIEexon	CDS	1550084	1550149	.	-	1	transcript "dm_035_MP_dna_4"	
Adh	MAGPIEexon	CDS	1554085	1554599	0.918	-	0	transcript "dm_035_GS_dna_5"	
Adh	MAGPIEexon	CDS	1554841	1555107	0.999	-	2	transcript "dm_035_GS_dna_5"	
Adh	MAGPIEexon	CDS	1556588	1557278	0.992	-	0	transcript "dm_035_GS_dna_5"	
Adh	MAGPIEexon	CDS	1558057	1558080	.	+	0	transcript "dm_035_MP_dna_6"	
Adh	MAGPIEexon	CDS	1558134	1558521	.	+	2	transcript "dm_035_MP_dna_6"	
Adh	MAGPIEexon	CDS	1561989	1562278	.	+	2	transcript "dm_035_MP_dna_6"	
Adh	MAGPIEexon	CDS	1562338	1563081	.	+	0	transcript "dm_035_MP_dna_6"	
Adh	MAGPIEexon	CDS	1563140	1563353	.	+	1	transcript "dm_035_MP_dna_6"	
Adh	MAGPIEexon	CDS	1563418	1563689	.	+	0	transcript "dm_035_MP_dna_6"	
Adh	MAGPIEexon	CDS	1563761	1563814	.	+	1	transcript "dm_035_MP_dna_6"	
Adh	MAGPIEexon	CDS	1565296	1565530	0.626	+	0	transcript "dm_035_GS_dna_7"	
Adh	MAGPIEexon	CDS	1575016	1575163	0.674	+	0	transcript "dm_036_GS_dna_1"	
Adh	MAGPIEexon	CDS	1576691	1576943	0.996	+	1	transcript "dm_035_GS_dna_7"	
Adh	MAGPIEexon	CDS	1576691	1576943	0.998	+	1	transcript "dm_036_GS_dna_1"	
Adh	MAGPIEexon	CDS	1577036	1577406	0.993	+	1	transcript "dm_035_GS_dna_7"	
Adh	MAGPIEexon	CDS	1577036	1577406	0.993	+	1	transcript "dm_036_GS_dna_1"	
Adh	MAGPIEexon	CDS	1577568	1577860	0.603	+	2	transcript "dm_035_GS_dna_7"	
Adh	MAGPIEexon	CDS	1577568	1577860	0.611	+	2	transcript "dm_036_GS_dna_1"	
Adh	MAGPIEexon	CDS	1577926	1578081	0.418	+	0	transcript "dm_035_GS_dna_7"	
Adh	MAGPIEexon	CDS	1577926	1578081	0.847	+	0	transcript "dm_036_GS_dna_1"	
Adh	MAGPIEexon	CDS	1580550	1580685	0.840	+	2	transcript "dm_036_GS_dna_1"	
Adh	MAGPIEexon	CDS	1580750	1580880	0.957	+	1	transcript "dm_036_GS_dna_1"	
Adh	MAGPIEexon	CDS	1580946	1581227	0.944	+	2	transcript "dm_036_GS_dna_1"	
Adh	MAGPIEexon	CDS	1581294	1581623	0.978	+	2	transcript "dm_036_GS_dna_1"	
Adh	MAGPIEexon	CDS	1581774	1582136	0.968	+	2	transcript "dm_036_GS_dna_1"	
Adh	MAGPIEexon	CDS	1582201	1582292	0.998	+	0	transcript "dm_036_GS_dna_1"	
Adh	MAGPIEexon	CDS	1582550	1582687	0.997	+	1	transcript "dm_036_GS_dna_1"	
Adh	MAGPIEexon	CDS	1583070	1583334	0.999	+	2	transcript "dm_036_GS_dna_1"	
Adh	MAGPIEexon	CDS	1583785	1583883	0.906	+	0	transcript "dm_036_GS_dna_1"	
Adh	MAGPIEexon	CDS	1584330	1584828	0.999	+	2	transcript "dm_036_GS_dna_1"	
Adh	MAGPIEexon	CDS	1584949	1585094	0.999	+	0	transcript "dm_036_GS_dna_1"	
Adh	MAGPIEexon	CDS	1585153	1585380	0.996	+	0	transcript "dm_036_GS_dna_1"	
Adh	MAGPIEexon	CDS	1586105	1586211	0.445	-	2	transcript "dm_036_GS_dna_2"	
Adh	MAGPIEexon	CDS	1587316	1587428	0.167	-	0	transcript "dm_036_GS_dna_2"	
Adh	MAGPIEexon	CDS	1588473	1588744	0.189	-	1	transcript "dm_036_GS_dna_2"	
Adh	MAGPIEexon	CDS	1588816	1588872	0.384	-	2	transcript "dm_036_GS_dna_2"	
Adh	MAGPIEexon	CDS	1591829	1592257	0.975	-	1	transcript "dm_036_GS_dna_3"	
Adh	MAGPIEexon	CDS	1596595	1596727	0.227	-	1	transcript "dm_036_GS_dna_3"	
Adh	MAGPIEexon	CDS	1597096	1597214	0.730	-	0	transcript "dm_036_GS_dna_3"	
Adh	MAGPIEexon	CDS	1597932	1597970	0.671	-	0	transcript "dm_036_GS_dna_3"	
Adh	MAGPIEexon	CDS	1603541	1603885	.	+	1	transcript "dm_036_MP_dna_4"	
Adh	MAGPIEexon	CDS	1603951	1605404	.	+	0	transcript "dm_036_MP_dna_4"	
Adh	MAGPIEexon	CDS	1605651	1606718	.	+	2	transcript "dm_036_MP_dna_4"	
Adh	MAGPIEexon	CDS	1606791	1607142	.	+	2	transcript "dm_036_MP_dna_4"	
Adh	MAGPIEexon	CDS	1607205	1607306	.	+	2	transcript "dm_036_MP_dna_4"	
Adh	MAGPIEexon	CDS	1620163	1620290	0.486	-	0	transcript "dm_036_GS_dna_5"	
Adh	MAGPIEexon	CDS	1622406	1622601	0.733	+	2	transcript "dm_037_GS_dna_1"	
Adh	MAGPIEexon	CDS	1624402	1624528	0.757	+	0	transcript "dm_037_GS_dna_2"	
Adh	MAGPIEexon	CDS	1627325	1627455	0.281	+	1	transcript "dm_037_GS_dna_2"	
Adh	MAGPIEexon	CDS	1628213	1628396	0.643	-	0	transcript "dm_037_GS_dna_3"	
Adh	MAGPIEexon	CDS	1630351	1630487	0.868	-	0	transcript "dm_037_GS_dna_3"	
Adh	MAGPIEexon	CDS	1634224	1634643	0.396	-	2	transcript "dm_037_GS_dna_4"	
Adh	MAGPIEexon	CDS	1635742	1635899	0.351	-	0	transcript "dm_037_GS_dna_4"	
Adh	MAGPIEexon	CDS	1638689	1638825	0.241	-	2	transcript "dm_037_GS_dna_4"	
Adh	MAGPIEexon	CDS	1639010	1639282	0.192	-	1	transcript "dm_037_GS_dna_4"	
Adh	MAGPIEexon	CDS	1641051	1641379	0.309	-	1	transcript "dm_037_GS_dna_4"	
Adh	MAGPIEexon	CDS	1642383	1642635	0.473	-	2	transcript "dm_037_GS_dna_5"	
Adh	MAGPIEexon	CDS	1644342	1644503	0.373	-	0	transcript "dm_037_GS_dna_5"	
Adh	MAGPIEexon	CDS	1646229	1646560	0.054	-	1	transcript "dm_037_GS_dna_5"	
Adh	MAGPIEexon	CDS	1649449	1649601	0.069	-	2	transcript "dm_037_GS_dna_5"	
Adh	MAGPIEexon	CDS	1650318	1650373	0.090	+	2	transcript "dm_037_GS_dna_6"	
Adh	MAGPIEexon	CDS	1650496	1650751	0.870	+	0	transcript "dm_037_GS_dna_6"	
Adh	MAGPIEexon	CDS	1653146	1653412	0.940	-	1	transcript "dm_037_GS_dna_7"	
Adh	MAGPIEexon	CDS	1653857	1657133	0.987	-	0	transcript "dm_037_GS_dna_7"	
Adh	MAGPIEexon	CDS	1657232	1657342	0.966	-	1	transcript "dm_037_GS_dna_7"	
Adh	MAGPIEexon	CDS	1661045	1661189	0.978	-	0	transcript "dm_037_GS_dna_7"	
Adh	MAGPIEexon	CDS	1661787	1661932	0.908	-	1	transcript "dm_037_GS_dna_7"	
Adh	MAGPIEexon	CDS	1665755	1665947	0.700	-	0	transcript "dm_037_GS_dna_7"	
Adh	MAGPIEexon	CDS	1667548	1667970	0.810	-	2	transcript "dm_038_GS_dna_1"	
Adh	MAGPIEexon	CDS	1667694	1667970	0.873	-	2	transcript "dm_037_GS_dna_7"	
Adh	MAGPIEexon	CDS	1671018	1671220	0.025	-	1	transcript "dm_038_GS_dna_2"	
Adh	MAGPIEexon	CDS	1677473	1677640	0.292	-	1	transcript "dm_038_GS_dna_2"	
Adh	MAGPIEexon	CDS	1678182	1678266	0.253	-	2	transcript "dm_038_GS_dna_2"	
Adh	MAGPIEexon	CDS	1684235	1684323	0.104	+	1	transcript "dm_038_GS_dna_3"	
Adh	MAGPIEexon	CDS	1690012	1690270	0.001	+	0	transcript "dm_038_GS_dna_3"	
Adh	MAGPIEexon	CDS	1694369	1694569	0.020	+	1	transcript "dm_038_GS_dna_3"	
Adh	MAGPIEexon	CDS	1696599	1696755	0.013	+	2	transcript "dm_038_GS_dna_3"	
Adh	MAGPIEexon	CDS	1697703	1697852	0.162	+	2	transcript "dm_038_GS_dna_3"	
Adh	MAGPIEexon	CDS	1697883	1698259	0.162	+	2	transcript "dm_038_GS_dna_3"	
Adh	MAGPIEexon	CDS	1700956	1701285	0.771	+	0	transcript "dm_038_GS_dna_4"	
Adh	MAGPIEexon	CDS	1703608	1703858	0.821	-	0	transcript "dm_038_GS_dna_5"	
Adh	MAGPIEexon	CDS	1705335	1705446	0.447	-	2	transcript "dm_038_GS_dna_5"	
Adh	MAGPIEexon	CDS	1712203	1712349	0.371	+	0	transcript "dm_038_GS_dna_6"	
Adh	MAGPIEexon	CDS	1712203	1712349	0.512	+	0	transcript "dm_039_GS_dna_1"	
Adh	MAGPIEexon	CDS	1714442	1714585	0.179	+	1	transcript "dm_038_GS_dna_6"	
Adh	MAGPIEexon	CDS	1715792	1715848	0.420	+	1	transcript "dm_039_GS_dna_1"	
Adh	MAGPIEexon	CDS	1718580	1718725	0.997	-	1	transcript "dm_039_GS_dna_2"	
Adh	MAGPIEexon	CDS	1719195	1719342	0.999	-	2	transcript "dm_039_GS_dna_2"	
Adh	MAGPIEexon	CDS	1719504	1720004	0.966	-	0	transcript "dm_039_GS_dna_2"	
Adh	MAGPIEexon	CDS	1722555	1722656	0.573	+	2	transcript "dm_039_GS_dna_3"	
Adh	MAGPIEexon	CDS	1724226	1724372	0.608	+	2	transcript "dm_039_GS_dna_3"	
Adh	MAGPIEexon	CDS	1724802	1725017	0.965	+	2	transcript "dm_039_GS_dna_3"	
Adh	MAGPIEexon	CDS	1726091	1726220	0.584	-	0	transcript "dm_039_GS_dna_4"	
Adh	MAGPIEexon	CDS	1726256	1726435	0.902	-	1	transcript "dm_039_GS_dna_4"	
Adh	MAGPIEexon	CDS	1728387	1728686	0.980	-	0	transcript "dm_039_GS_dna_4"	
Adh	MAGPIEexon	CDS	1730116	1730236	0.999	-	1	transcript "dm_039_GS_dna_4"	
Adh	MAGPIEexon	CDS	1731062	1731172	0.999	-	1	transcript "dm_039_GS_dna_4"	
Adh	MAGPIEexon	CDS	1732784	1732957	0.449	-	1	transcript "dm_039_GS_dna_4"	
Adh	MAGPIEexon	CDS	1735826	1736004	0.458	-	2	transcript "dm_039_GS_dna_4"	
Adh	MAGPIEexon	CDS	1737215	1737246	0.490	-	2	transcript "dm_039_GS_dna_4"	
Adh	MAGPIEexon	CDS	1738791	1739218	0.960	+	2	transcript "dm_039_GS_dna_5"	
Adh	MAGPIEexon	CDS	1740300	1740540	0.997	+	2	transcript "dm_039_GS_dna_5"	
Adh	MAGPIEexon	CDS	1740659	1740939	0.999	+	1	transcript "dm_039_GS_dna_5"	
Adh	MAGPIEexon	CDS	1740995	1742042	0.951	+	1	transcript "dm_039_GS_dna_5"	
Adh	MAGPIEexon	CDS	1742104	1742446	0.998	+	0	transcript "dm_039_GS_dna_5"	
Adh	MAGPIEexon	CDS	1742886	1743193	0.996	+	2	transcript "dm_039_GS_dna_5"	
Adh	MAGPIEexon	CDS	1744620	1745915	0.997	-	0	transcript "dm_039_GS_dna_6"	
Adh	MAGPIEexon	CDS	1746303	1746349	0.999	+	2	transcript "dm_039_GS_dna_7"	
Adh	MAGPIEexon	CDS	1746401	1746842	0.999	+	1	transcript "dm_039_GS_dna_7"	
Adh	MAGPIEexon	CDS	1747065	1747238	0.908	-	0	transcript "dm_039_GS_dna_8"	
Adh	MAGPIEexon	CDS	1747451	1747757	0.978	-	0	transcript "dm_039_GS_dna_8"	
Adh	MAGPIEexon	CDS	1747825	1748093	0.790	-	0	transcript "dm_039_GS_dna_8"	
Adh	MAGPIEexon	CDS	1748156	1748361	0.686	-	2	transcript "dm_039_GS_dna_8"	
Adh	MAGPIEexon	CDS	1748434	1748590	0.999	-	1	transcript "dm_039_GS_dna_8"	
Adh	MAGPIEexon	CDS	1748671	1748943	0.845	-	2	transcript "dm_039_GS_dna_8"	
Adh	MAGPIEexon	CDS	1751370	1751492	0.617	-	0	transcript "dm_039_GS_dna_8"	
Adh	MAGPIEexon	CDS	1751564	1751664	0.968	-	2	transcript "dm_039_GS_dna_8"	
Adh	MAGPIEexon	CDS	1751722	1751956	0.998	-	1	transcript "dm_039_GS_dna_8"	
Adh	MAGPIEexon	CDS	1752027	1752278	0.998	-	0	transcript "dm_039_GS_dna_8"	
Adh	MAGPIEexon	CDS	1752622	1752780	0.983	-	2	transcript "dm_039_GS_dna_8"	
Adh	MAGPIEexon	CDS	1752984	1753316	0.877	-	0	transcript "dm_039_GS_dna_8"	
Adh	MAGPIEexon	CDS	1753422	1753778	0.965	-	0	transcript "dm_039_GS_dna_8"	
Adh	MAGPIEexon	CDS	1756026	1756178	0.996	-	0	transcript "dm_039_GS_dna_9"	
Adh	MAGPIEexon	CDS	1756026	1756178	0.997	-	0	transcript "dm_040_GS_dna_1"	
Adh	MAGPIEexon	CDS	1756248	1756386	0.876	-	2	transcript "dm_039_GS_dna_9"	
Adh	MAGPIEexon	CDS	1756248	1756386	0.934	-	2	transcript "dm_040_GS_dna_1"	
Adh	MAGPIEexon	CDS	1756448	1756671	0.876	-	2	transcript "dm_039_GS_dna_9"	
Adh	MAGPIEexon	CDS	1756448	1756671	0.932	-	2	transcript "dm_040_GS_dna_1"	
Adh	MAGPIEexon	CDS	1756797	1756939	0.684	-	1	transcript "dm_039_GS_dna_9"	
Adh	MAGPIEexon	CDS	1756797	1756973	0.738	-	0	transcript "dm_040_GS_dna_1"	
Adh	MAGPIEexon	CDS	1757005	1757119	0.538	-	1	transcript "dm_039_GS_dna_9"	
Adh	MAGPIEexon	CDS	1757182	1757352	0.663	-	2	transcript "dm_039_GS_dna_9"	
Adh	MAGPIEexon	CDS	1757182	1757352	0.960	-	2	transcript "dm_040_GS_dna_1"	
Adh	MAGPIEexon	CDS	1757415	1757585	0.999	-	0	transcript "dm_039_GS_dna_9"	
Adh	MAGPIEexon	CDS	1757415	1757585	0.999	-	0	transcript "dm_040_GS_dna_1"	
Adh	MAGPIEexon	CDS	1757648	1758409	0.916	-	1	transcript "dm_039_GS_dna_9"	
Adh	MAGPIEexon	CDS	1757648	1758856	0.665	-	1	transcript "dm_040_GS_dna_1"	
Adh	MAGPIEexon	CDS	1758473	1758856	0.528	-	1	transcript "dm_039_GS_dna_9"	
Adh	MAGPIEexon	CDS	1759026	1759629	0.756	-	2	transcript "dm_039_GS_dna_9"	
Adh	MAGPIEexon	CDS	1759026	1759629	0.789	-	2	transcript "dm_040_GS_dna_1"	
Adh	MAGPIEexon	CDS	1759760	1759938	0.193	-	2	transcript "dm_039_GS_dna_9"	
Adh	MAGPIEexon	CDS	1759760	1759938	0.850	-	2	transcript "dm_040_GS_dna_1"	
Adh	MAGPIEexon	CDS	1760557	1760726	0.609	-	0	transcript "dm_040_GS_dna_1"	
Adh	MAGPIEexon	CDS	1762735	1762861	0.568	-	1	transcript "dm_040_GS_dna_1"	
Adh	MAGPIEexon	CDS	1763921	1764042	0.992	-	2	transcript "dm_040_GS_dna_2"	
Adh	MAGPIEexon	CDS	1764272	1764437	0.777	-	0	transcript "dm_040_GS_dna_2"	
Adh	MAGPIEexon	CDS	1765474	1765626	0.276	+	0	transcript "dm_040_GS_dna_3"	
Adh	MAGPIEexon	CDS	1768563	1768793	0.570	+	2	transcript "dm_040_GS_dna_3"	
Adh	MAGPIEexon	CDS	1770133	1770552	0.361	+	0	transcript "dm_040_GS_dna_3"	
Adh	MAGPIEexon	CDS	1774679	1775557	0.920	+	1	transcript "dm_040_GS_dna_4"	
Adh	MAGPIEexon	CDS	1778386	1778793	0.964	+	0	transcript "dm_040_GS_dna_5"	
Adh	MAGPIEexon	CDS	1779575	1779943	0.997	-	1	transcript "dm_040_GS_dna_6"	
Adh	MAGPIEexon	CDS	1780341	1780496	0.998	-	0	transcript "dm_040_GS_dna_7"	
Adh	MAGPIEexon	CDS	1781148	1781825	0.901	-	0	transcript "dm_040_GS_dna_7"	
Adh	MAGPIEexon	CDS	1782412	1782827	0.516	-	0	transcript "dm_040_GS_dna_8"	
Adh	MAGPIEexon	CDS	1783140	1783286	0.966	-	0	transcript "dm_040_GS_dna_8"	
Adh	MAGPIEexon	CDS	1783610	1783696	0.943	-	1	transcript "dm_040_GS_dna_8"	
Adh	MAGPIEexon	CDS	1784926	1785036	0.397	-	2	transcript "dm_040_GS_dna_8"	
Adh	MAGPIEexon	CDS	1785511	1785654	0.675	-	2	transcript "dm_040_GS_dna_8"	
Adh	MAGPIEexon	CDS	1786132	1786291	0.695	-	1	transcript "dm_040_GS_dna_8"	
Adh	MAGPIEexon	CDS	1786326	1786409	0.974	-	0	transcript "dm_040_GS_dna_8"	
Adh	MAGPIEexon	CDS	1787599	1788915	0.998	+	0	transcript "dm_040_GS_dna_9"	
Adh	MAGPIEexon	CDS	1790556	1790699	0.676	+	2	transcript "dm_040_GS_dna_10"	
Adh	MAGPIEexon	CDS	1791967	1792111	0.720	+	0	transcript "dm_040_GS_dna_10"	
Adh	MAGPIEexon	CDS	1792168	1792338	0.799	+	0	transcript "dm_040_GS_dna_10"	
Adh	MAGPIEexon	CDS	1794322	1794595	0.945	+	0	transcript "dm_040_GS_dna_10"	
Adh	MAGPIEexon	CDS	1794998	1795279	0.557	+	1	transcript "dm_040_GS_dna_10"	
Adh	MAGPIEexon	CDS	1796220	1796322	0.407	+	2	transcript "dm_040_GS_dna_10"	
Adh	MAGPIEexon	CDS	1796589	1796882	0.779	-	0	transcript "dm_040_GS_dna_11"	
Adh	MAGPIEexon	CDS	1798384	1799028	0.988	-	2	transcript "dm_040_GS_dna_12"	
Adh	MAGPIEexon	CDS	1800829	1800958	0.689	+	0	transcript "dm_041_GS_dna_1"	
Adh	MAGPIEexon	CDS	1801277	1801497	0.856	+	1	transcript "dm_041_GS_dna_1"	
Adh	MAGPIEexon	CDS	1802095	1802389	0.530	-	1	transcript "dm_041_GS_dna_2"	
Adh	MAGPIEexon	CDS	1802527	1802636	0.470	-	0	transcript "dm_041_GS_dna_2"	
Adh	MAGPIEexon	CDS	1804220	1804279	0.891	-	1	transcript "dm_041_GS_dna_2"	
Adh	MAGPIEexon	CDS	1804220	1804279	0.989	-	1	transcript "dm_040_GS_dna_12"	
Adh	MAGPIEexon	CDS	1807761	1808476	0.959	-	1	transcript "dm_041_GS_dna_3"	
Adh	MAGPIEexon	CDS	1809495	1809558	0.964	-	2	transcript "dm_041_GS_dna_3"	
Adh	MAGPIEexon	CDS	1810719	1811121	0.982	-	2	transcript "dm_041_GS_dna_4"	
Adh	MAGPIEexon	CDS	1811467	1811600	0.989	-	0	transcript "dm_041_GS_dna_4"	
Adh	MAGPIEexon	CDS	1811839	1811969	0.366	+	0	transcript "dm_041_GS_dna_5"	
Adh	MAGPIEexon	CDS	1814887	1815052	0.382	+	0	transcript "dm_041_GS_dna_5"	
Adh	MAGPIEexon	CDS	1816589	1816807	0.346	+	1	transcript "dm_041_GS_dna_5"	
Adh	MAGPIEexon	CDS	1823746	1825158	.	+	0	transcript "dm_041_MP_dna_6"	
Adh	MAGPIEexon	CDS	1827961	1828003	0.788	+	0	transcript "dm_041_GS_dna_7"	
Adh	MAGPIEexon	CDS	1829293	1829586	0.345	+	0	transcript "dm_041_GS_dna_7"	
Adh	MAGPIEexon	CDS	1830834	1831003	0.696	+	2	transcript "dm_041_GS_dna_7"	
Adh	MAGPIEexon	CDS	1832135	1832374	0.480	+	1	transcript "dm_041_GS_dna_7"	
Adh	MAGPIEexon	CDS	1833450	1833848	0.580	-	0	transcript "dm_041_GS_dna_8"	
Adh	MAGPIEexon	CDS	1836751	1837287	0.832	-	2	transcript "dm_041_GS_dna_9"	
Adh	MAGPIEexon	CDS	1838815	1838891	0.089	-	0	transcript "dm_041_GS_dna_10"	
Adh	MAGPIEexon	CDS	1843368	1843484	0.017	-	0	transcript "dm_041_GS_dna_10"	
Adh	MAGPIEexon	CDS	1845841	1846037	0.244	+	0	transcript "dm_042_GS_dna_1"	
Adh	MAGPIEexon	CDS	1846504	1846798	0.244	+	0	transcript "dm_042_GS_dna_1"	
Adh	MAGPIEexon	CDS	1847276	1847427	0.179	-	2	transcript "dm_041_GS_dna_10"	
Adh	MAGPIEexon	CDS	1848616	1848683	0.221	-	0	transcript "dm_041_GS_dna_10"	
Adh	MAGPIEexon	CDS	1849362	1849544	0.743	-	0	transcript "dm_041_GS_dna_11"	
Adh	MAGPIEexon	CDS	1849362	1849544	0.793	-	0	transcript "dm_042_GS_dna_2"	
Adh	MAGPIEexon	CDS	1850650	1851231	0.085	-	2	transcript "dm_042_GS_dna_3"	
Adh	MAGPIEexon	CDS	1853016	1853142	0.071	-	2	transcript "dm_042_GS_dna_3"	
Adh	MAGPIEexon	CDS	1856461	1856642	0.108	-	0	transcript "dm_042_GS_dna_3"	
Adh	MAGPIEexon	CDS	1859931	1860443	0.953	-	0	transcript "dm_042_GS_dna_4"	
Adh	MAGPIEexon	CDS	1862723	1862866	0.758	-	1	transcript "dm_042_GS_dna_4"	
Adh	MAGPIEexon	CDS	1864125	1864184	0.900	-	0	transcript "dm_042_GS_dna_4"	
Adh	MAGPIEexon	CDS	1866720	1867217	0.897	+	2	transcript "dm_042_GS_dna_5"	
Adh	MAGPIEexon	CDS	1869237	1869411	0.612	+	2	transcript "dm_042_GS_dna_6"	
Adh	MAGPIEexon	CDS	1870003	1870144	0.545	+	0	transcript "dm_042_GS_dna_6"	
Adh	MAGPIEexon	CDS	1870178	1870251	0.544	+	1	transcript "dm_042_GS_dna_6"	
Adh	MAGPIEexon	CDS	1870375	1870560	0.891	+	0	transcript "dm_042_GS_dna_6"	
Adh	MAGPIEexon	CDS	1871336	1871557	0.623	+	1	transcript "dm_042_GS_dna_6"	
Adh	MAGPIEexon	CDS	1871587	1871681	0.989	+	0	transcript "dm_042_GS_dna_6"	
Adh	MAGPIEexon	CDS	1872374	1872481	0.975	+	1	transcript "dm_042_GS_dna_6"	
Adh	MAGPIEexon	CDS	1875987	1876447	0.574	-	1	transcript "dm_042_GS_dna_7"	
Adh	MAGPIEexon	CDS	1878988	1879161	0.366	-	2	transcript "dm_042_GS_dna_7"	
Adh	MAGPIEexon	CDS	1881548	1881779	0.354	-	0	transcript "dm_042_GS_dna_7"	
Adh	MAGPIEexon	CDS	1883261	1883385	0.878	-	2	transcript "dm_042_GS_dna_7"	
Adh	MAGPIEexon	CDS	1883560	1883683	0.937	-	1	transcript "dm_042_GS_dna_7"	
Adh	MAGPIEexon	CDS	1884195	1884559	0.801	-	1	transcript "dm_042_GS_dna_7"	
Adh	MAGPIEexon	CDS	1885049	1885269	0.340	-	2	transcript "dm_042_GS_dna_7"	
Adh	MAGPIEexon	CDS	1885421	1885599	0.195	-	2	transcript "dm_042_GS_dna_7"	
Adh	MAGPIEexon	CDS	1886301	1886582	0.490	-	0	transcript "dm_042_GS_dna_7"	
Adh	MAGPIEexon	CDS	1889969	1890043	0.498	-	1	transcript "dm_042_GS_dna_7"	
Adh	MAGPIEexon	CDS	1891293	1891508	0.293	-	0	transcript "dm_043_GS_dna_1"	
Adh	MAGPIEexon	CDS	1891514	1891654	0.312	-	1	transcript "dm_043_GS_dna_1"	
Adh	MAGPIEexon	CDS	1891514	1891654	0.945	-	1	transcript "dm_042_GS_dna_7"	
Adh	MAGPIEexon	CDS	1891981	1892047	0.314	-	1	transcript "dm_043_GS_dna_1"	
Adh	MAGPIEexon	CDS	1891981	1892047	0.944	-	1	transcript "dm_042_GS_dna_7"	
Adh	MAGPIEexon	CDS	1893271	1893751	0.200	-	1	transcript "dm_043_GS_dna_1"	
Adh	MAGPIEexon	CDS	1893271	1893815	0.611	-	0	transcript "dm_042_GS_dna_7"	
Adh	MAGPIEexon	CDS	1895585	1895879	0.491	-	0	transcript "dm_043_GS_dna_1"	
Adh	MAGPIEexon	CDS	1897648	1897741	0.087	+	0	transcript "dm_043_GS_dna_2"	
Adh	MAGPIEexon	CDS	1898098	1898199	0.850	+	0	transcript "dm_043_GS_dna_2"	
Adh	MAGPIEexon	CDS	1899607	1899902	0.980	+	0	transcript "dm_043_GS_dna_2"	
Adh	MAGPIEexon	CDS	1902002	1902268	0.594	+	1	transcript "dm_043_GS_dna_3"	
Adh	MAGPIEexon	CDS	1903197	1903412	0.909	+	2	transcript "dm_043_GS_dna_3"	
Adh	MAGPIEexon	CDS	1909801	1910036	0.051	+	0	transcript "dm_043_GS_dna_4"	
Adh	MAGPIEexon	CDS	1910129	1910271	0.092	+	1	transcript "dm_043_GS_dna_4"	
Adh	MAGPIEexon	CDS	1912067	1912189	0.076	+	1	transcript "dm_043_GS_dna_4"	
Adh	MAGPIEexon	CDS	1912526	1912650	0.103	+	1	transcript "dm_043_GS_dna_4"	
Adh	MAGPIEexon	CDS	1913374	1914932	0.949	-	0	transcript "dm_043_GS_dna_5"	
Adh	MAGPIEexon	CDS	1914995	1915082	0.982	-	0	transcript "dm_043_GS_dna_5"	
Adh	MAGPIEexon	CDS	1916305	1916372	0.063	+	0	transcript "dm_043_GS_dna_6"	
Adh	MAGPIEexon	CDS	1916440	1916680	0.057	+	0	transcript "dm_043_GS_dna_6"	
Adh	MAGPIEexon	CDS	1917420	1917537	0.985	+	2	transcript "dm_043_GS_dna_7"	
Adh	MAGPIEexon	CDS	1917587	1917792	0.540	+	1	transcript "dm_043_GS_dna_7"	
Adh	MAGPIEexon	CDS	1919204	1919551	0.695	-	1	transcript "dm_043_GS_dna_8"	
Adh	MAGPIEexon	CDS	1920382	1920612	0.642	-	2	transcript "dm_043_GS_dna_9"	
Adh	MAGPIEexon	CDS	1923109	1924563	0.568	+	0	transcript "dm_043_GS_dna_10"	
Adh	MAGPIEexon	CDS	1925729	1925859	0.974	+	1	transcript "dm_043_GS_dna_11"	
Adh	MAGPIEexon	CDS	1926614	1926827	0.006	+	1	transcript "dm_043_GS_dna_11"	
Adh	MAGPIEexon	CDS	1929495	1929652	0.043	+	2	transcript "dm_043_GS_dna_11"	
Adh	MAGPIEexon	CDS	1931240	1931487	0.746	+	1	transcript "dm_043_GS_dna_11"	
Adh	MAGPIEexon	CDS	1931493	1931775	0.539	+	2	transcript "dm_043_GS_dna_11"	
Adh	MAGPIEexon	CDS	1933713	1934013	0.471	+	2	transcript "dm_043_GS_dna_11"	
Adh	MAGPIEexon	CDS	1935160	1935308	0.756	+	0	transcript "dm_044_GS_dna_1"	
Adh	MAGPIEexon	CDS	1936723	1937027	0.018	+	0	transcript "dm_043_GS_dna_11"	
Adh	MAGPIEexon	CDS	1936726	1937027	0.118	+	0	transcript "dm_044_GS_dna_2"	
Adh	MAGPIEexon	CDS	1937664	1938775	0.065	+	2	transcript "dm_043_GS_dna_11"	
Adh	MAGPIEexon	CDS	1937664	1938775	0.073	+	2	transcript "dm_044_GS_dna_2"	
Adh	MAGPIEexon	CDS	1939045	1939772	0.562	+	0	transcript "dm_043_GS_dna_11"	
Adh	MAGPIEexon	CDS	1939045	1941879	0.667	+	0	transcript "dm_044_GS_dna_2"	
Adh	MAGPIEexon	CDS	1947254	1947663	0.451	+	1	transcript "dm_044_GS_dna_2"	
Adh	MAGPIEexon	CDS	1948793	1949045	0.965	-	0	transcript "dm_044_GS_dna_3"	
Adh	MAGPIEexon	CDS	1950020	1950200	0.290	-	0	transcript "dm_044_GS_dna_3"	
Adh	MAGPIEexon	CDS	1950829	1951201	0.412	-	1	transcript "dm_044_GS_dna_3"	
Adh	MAGPIEexon	CDS	1952711	1952818	0.270	-	1	transcript "dm_044_GS_dna_3"	
Adh	MAGPIEexon	CDS	1953776	1953872	0.196	-	0	transcript "dm_044_GS_dna_3"	
Adh	MAGPIEexon	CDS	1955898	1956010	0.298	-	1	transcript "dm_044_GS_dna_3"	
Adh	MAGPIEexon	CDS	1957828	1957936	0.417	-	1	transcript "dm_044_GS_dna_3"	
Adh	MAGPIEexon	CDS	1958206	1958462	0.047	-	0	transcript "dm_044_GS_dna_3"	
Adh	MAGPIEexon	CDS	1959464	1959538	0.064	-	1	transcript "dm_044_GS_dna_3"	
Adh	MAGPIEexon	CDS	1962736	1962865	0.216	+	0	transcript "dm_044_GS_dna_4"	
Adh	MAGPIEexon	CDS	1963353	1963651	0.012	+	2	transcript "dm_044_GS_dna_4"	
Adh	MAGPIEexon	CDS	1966586	1967758	.	-	1	transcript "dm_044_MP_dna_5"	
Adh	MAGPIEexon	CDS	1970460	1970641	0.742	+	2	transcript "dm_044_GS_dna_6"	
Adh	MAGPIEexon	CDS	1971063	1971186	0.455	+	2	transcript "dm_044_GS_dna_6"	
Adh	MAGPIEexon	CDS	1974488	1974989	0.148	+	1	transcript "dm_044_GS_dna_7"	
Adh	MAGPIEexon	CDS	1975334	1975484	0.108	+	1	transcript "dm_044_GS_dna_7"	
Adh	MAGPIEexon	CDS	1975874	1976154	0.081	+	1	transcript "dm_044_GS_dna_7"	
Adh	MAGPIEexon	CDS	1977628	1977740	0.902	+	0	transcript "dm_044_GS_dna_7"	
Adh	MAGPIEexon	CDS	1980081	1980310	0.739	+	2	transcript "dm_045_GS_dna_1"	
Adh	MAGPIEexon	CDS	1980249	1980381	0.247	-	2	transcript "dm_044_GS_dna_8"	
Adh	MAGPIEexon	CDS	1980457	1980517	0.459	+	0	transcript "dm_045_GS_dna_1"	
Adh	MAGPIEexon	CDS	1981929	1982084	0.116	-	0	transcript "dm_044_GS_dna_8"	
Adh	MAGPIEexon	CDS	1983033	1983207	0.219	-	2	transcript "dm_044_GS_dna_8"	
Adh	MAGPIEexon	CDS	1983142	1983399	0.418	+	0	transcript "dm_045_GS_dna_1"	
Adh	MAGPIEexon	CDS	1983628	1983855	0.572	+	0	transcript "dm_045_GS_dna_1"	
Adh	MAGPIEexon	CDS	1983782	1983907	0.549	-	1	transcript "dm_044_GS_dna_8"	
Adh	MAGPIEexon	CDS	1985108	1985452	0.993	+	1	transcript "dm_045_GS_dna_2"	
Adh	MAGPIEexon	CDS	1987051	1987153	0.795	+	0	transcript "dm_045_GS_dna_3"	
Adh	MAGPIEexon	CDS	1987691	1987986	0.682	+	1	transcript "dm_045_GS_dna_3"	
Adh	MAGPIEexon	CDS	1988872	1989075	0.731	+	0	transcript "dm_045_GS_dna_4"	
Adh	MAGPIEexon	CDS	1991768	1992877	0.970	+	1	transcript "dm_045_GS_dna_4"	
Adh	MAGPIEexon	CDS	1992942	1993204	0.830	+	2	transcript "dm_045_GS_dna_4"	
Adh	MAGPIEexon	CDS	1993350	1993566	0.986	+	2	transcript "dm_045_GS_dna_4"	
Adh	MAGPIEexon	CDS	1995750	1996122	0.986	+	2	transcript "dm_045_GS_dna_5"	
Adh	MAGPIEexon	CDS	2000098	2000438	0.609	+	0	transcript "dm_045_GS_dna_5"	
Adh	MAGPIEexon	CDS	2001387	2001686	0.033	-	0	transcript "dm_045_GS_dna_6"	
Adh	MAGPIEexon	CDS	2002501	2002806	0.034	-	2	transcript "dm_045_GS_dna_6"	
Adh	MAGPIEexon	CDS	2007824	2008036	0.741	-	1	transcript "dm_045_GS_dna_6"	
Adh	MAGPIEexon	CDS	2008083	2008175	0.625	-	0	transcript "dm_045_GS_dna_6"	
Adh	MAGPIEexon	CDS	2010810	2010834	0.475	+	2	transcript "dm_045_GS_dna_7"	
Adh	MAGPIEexon	CDS	2011611	2011726	0.077	+	2	transcript "dm_045_GS_dna_7"	
Adh	MAGPIEexon	CDS	2015244	2015444	0.041	+	2	transcript "dm_045_GS_dna_7"	
Adh	MAGPIEexon	CDS	2016806	2016940	0.011	+	1	transcript "dm_045_GS_dna_7"	
Adh	MAGPIEexon	CDS	2019576	2019731	0.000	+	2	transcript "dm_045_GS_dna_7"	
Adh	MAGPIEexon	CDS	2022700	2022936	0.000	+	0	transcript "dm_045_GS_dna_7"	
Adh	MAGPIEexon	CDS	2024273	2024336	0.002	+	1	transcript "dm_045_GS_dna_7"	
Adh	MAGPIEexon	CDS	2025937	2026182	0.124	+	0	transcript "dm_045_GS_dna_7"	
Adh	MAGPIEexon	CDS	2025937	2026182	0.791	+	0	transcript "dm_046_GS_dna_1"	
Adh	MAGPIEexon	CDS	2027143	2027277	0.060	+	0	transcript "dm_045_GS_dna_7"	
Adh	MAGPIEexon	CDS	2027143	2027277	0.361	+	0	transcript "dm_046_GS_dna_1"	
Adh	MAGPIEexon	CDS	2028707	2028807	0.095	+	1	transcript "dm_045_GS_dna_7"	
Adh	MAGPIEexon	CDS	2031388	2031577	0.186	+	0	transcript "dm_046_GS_dna_1"	
Adh	MAGPIEexon	CDS	2031644	2031725	0.322	+	1	transcript "dm_046_GS_dna_1"	
Adh	MAGPIEexon	CDS	2031902	2032078	0.409	+	1	transcript "dm_046_GS_dna_1"	
Adh	MAGPIEexon	CDS	2035641	2035825	0.787	+	2	transcript "dm_046_GS_dna_2"	
Adh	MAGPIEexon	CDS	2037369	2037672	0.922	+	2	transcript "dm_046_GS_dna_2"	
Adh	MAGPIEexon	CDS	2039153	2039293	0.547	+	1	transcript "dm_046_GS_dna_3"	
Adh	MAGPIEexon	CDS	2040123	2040280	0.993	+	2	transcript "dm_046_GS_dna_4"	
Adh	MAGPIEexon	CDS	2040432	2040689	0.985	+	2	transcript "dm_046_GS_dna_4"	
Adh	MAGPIEexon	CDS	2041374	2041494	0.703	+	2	transcript "dm_046_GS_dna_4"	
Adh	MAGPIEexon	CDS	2044388	2044681	0.603	+	1	transcript "dm_046_GS_dna_4"	
Adh	MAGPIEexon	CDS	2049236	2049415	0.671	+	1	transcript "dm_046_GS_dna_4"	
Adh	MAGPIEexon	CDS	2050204	2050341	0.867	+	0	transcript "dm_046_GS_dna_4"	
Adh	MAGPIEexon	CDS	2052716	2052901	0.571	+	1	transcript "dm_046_GS_dna_4"	
Adh	MAGPIEexon	CDS	2055713	2055775	0.151	+	1	transcript "dm_046_GS_dna_5"	
Adh	MAGPIEexon	CDS	2055855	2055959	0.112	+	2	transcript "dm_046_GS_dna_5"	
Adh	MAGPIEexon	CDS	2058541	2058766	0.088	+	0	transcript "dm_046_GS_dna_5"	
Adh	MAGPIEexon	CDS	2059326	2059444	0.544	+	2	transcript "dm_046_GS_dna_5"	
Adh	MAGPIEexon	CDS	2062307	2062735	0.539	-	1	transcript "dm_046_GS_dna_6"	
Adh	MAGPIEexon	CDS	2068604	2070501	0.735	+	1	transcript "dm_046_GS_dna_7"	
Adh	MAGPIEexon	CDS	2070077	2070501	0.999	+	1	transcript "dm_047_GS_dna_1"	
Adh	MAGPIEexon	CDS	2070692	2070988	0.794	+	1	transcript "dm_046_GS_dna_7"	
Adh	MAGPIEexon	CDS	2070692	2070988	0.795	+	1	transcript "dm_047_GS_dna_1"	
Adh	MAGPIEexon	CDS	2071510	2072677	0.839	+	0	transcript "dm_046_GS_dna_7"	
Adh	MAGPIEexon	CDS	2071510	2072677	0.840	+	0	transcript "dm_047_GS_dna_1"	
Adh	MAGPIEexon	CDS	2074709	2074983	0.845	+	1	transcript "dm_047_GS_dna_2"	
Adh	MAGPIEexon	CDS	2074709	2074983	0.938	+	1	transcript "dm_046_GS_dna_8"	
Adh	MAGPIEexon	CDS	2075435	2075690	0.813	+	1	transcript "dm_047_GS_dna_2"	
Adh	MAGPIEexon	CDS	2078114	2081293	.	+	1	transcript "dm_047_MP_dna_3"	
Adh	MAGPIEexon	CDS	2093540	2093709	0.555	-	2	transcript "dm_047_GS_dna_4"	
Adh	MAGPIEexon	CDS	2094086	2094189	0.610	-	2	transcript "dm_047_GS_dna_4"	
Adh	MAGPIEexon	CDS	2096121	2096206	0.899	-	1	transcript "dm_047_GS_dna_4"	
Adh	MAGPIEexon	CDS	2100551	2101336	0.998	-	1	transcript "dm_047_GS_dna_5"	
Adh	MAGPIEexon	CDS	2102169	2102752	0.986	-	1	transcript "dm_047_GS_dna_6"	
Adh	MAGPIEexon	CDS	2102776	2102965	0.901	-	1	transcript "dm_047_GS_dna_6"	
Adh	MAGPIEexon	CDS	2103628	2104169	0.968	-	0	transcript "dm_047_GS_dna_6"	
Adh	MAGPIEexon	CDS	2104226	2104442	0.857	-	0	transcript "dm_047_GS_dna_6"	
Adh	MAGPIEexon	CDS	2105170	2105720	0.996	-	0	transcript "dm_047_GS_dna_7"	
Adh	MAGPIEexon	CDS	2105774	2105984	0.973	-	0	transcript "dm_047_GS_dna_7"	
Adh	MAGPIEexon	CDS	2106653	2106860	0.998	+	1	transcript "dm_047_GS_dna_8"	
Adh	MAGPIEexon	CDS	2106931	2107445	0.975	+	0	transcript "dm_047_GS_dna_8"	
Adh	MAGPIEexon	CDS	2109315	2109407	0.366	-	0	transcript "dm_047_GS_dna_9"	
Adh	MAGPIEexon	CDS	2111897	2112079	0.875	-	1	transcript "dm_047_GS_dna_9"	
Adh	MAGPIEexon	CDS	2112328	2113209	0.991	-	2	transcript "dm_047_GS_dna_9"	
Adh	MAGPIEexon	CDS	2114455	2114669	0.594	+	0	transcript "dm_047_GS_dna_10"	
Adh	MAGPIEexon	CDS	2115066	2115211	0.416	+	2	transcript "dm_047_GS_dna_10"	
Adh	MAGPIEexon	CDS	2115477	2115648	0.447	+	2	transcript "dm_047_GS_dna_10"	
Adh	MAGPIEexon	CDS	2115477	2115648	0.473	+	2	transcript "dm_048_GS_dna_1"	
Adh	MAGPIEexon	CDS	2117129	2117276	0.122	+	1	transcript "dm_047_GS_dna_10"	
Adh	MAGPIEexon	CDS	2117129	2117276	0.146	+	1	transcript "dm_048_GS_dna_1"	
Adh	MAGPIEexon	CDS	2118356	2118551	0.146	+	1	transcript "dm_047_GS_dna_10"	
Adh	MAGPIEexon	CDS	2118356	2118551	0.180	+	1	transcript "dm_048_GS_dna_1"	
Adh	MAGPIEexon	CDS	2118614	2119161	0.965	+	1	transcript "dm_048_GS_dna_1"	
Adh	MAGPIEexon	CDS	2118614	2119161	0.974	+	1	transcript "dm_047_GS_dna_10"	
Adh	MAGPIEexon	CDS	2119703	2119938	0.998	-	2	transcript "dm_047_GS_dna_11"	
Adh	MAGPIEexon	CDS	2119874	2120025	0.936	+	1	transcript "dm_048_GS_dna_2"	
Adh	MAGPIEexon	CDS	2120092	2120194	0.993	+	0	transcript "dm_048_GS_dna_2"	
Adh	MAGPIEexon	CDS	2120312	2121269	0.997	+	1	transcript "dm_048_GS_dna_2"	
Adh	MAGPIEexon	CDS	2121336	2121745	0.997	+	2	transcript "dm_048_GS_dna_2"	
Adh	MAGPIEexon	CDS	2125843	2125928	0.488	+	0	transcript "dm_048_GS_dna_3"	
Adh	MAGPIEexon	CDS	2127418	2127538	0.994	+	0	transcript "dm_048_GS_dna_3"	
Adh	MAGPIEexon	CDS	2128068	2128196	0.997	+	2	transcript "dm_048_GS_dna_3"	
Adh	MAGPIEexon	CDS	2128698	2128886	0.876	+	2	transcript "dm_048_GS_dna_3"	
Adh	MAGPIEexon	CDS	2130327	2130434	0.574	-	0	transcript "dm_048_GS_dna_4"	
Adh	MAGPIEexon	CDS	2131207	2131281	0.760	-	2	transcript "dm_048_GS_dna_4"	
Adh	MAGPIEexon	CDS	2137486	2137679	0.998	-	0	transcript "dm_048_GS_dna_5"	
Adh	MAGPIEexon	CDS	2137746	2137902	0.958	-	2	transcript "dm_048_GS_dna_5"	
Adh	MAGPIEexon	CDS	2137961	2138116	0.996	-	1	transcript "dm_048_GS_dna_5"	
Adh	MAGPIEexon	CDS	2138186	2138671	0.997	-	1	transcript "dm_048_GS_dna_5"	
Adh	MAGPIEexon	CDS	2138733	2138994	0.994	-	2	transcript "dm_048_GS_dna_5"	
Adh	MAGPIEexon	CDS	2139065	2139169	0.998	-	1	transcript "dm_048_GS_dna_5"	
Adh	MAGPIEexon	CDS	2139824	2140056	0.987	-	2	transcript "dm_048_GS_dna_5"	
Adh	MAGPIEexon	CDS	2140199	2140353	0.619	-	2	transcript "dm_048_GS_dna_5"	
Adh	MAGPIEexon	CDS	2140417	2140630	0.982	-	1	transcript "dm_048_GS_dna_5"	
Adh	MAGPIEexon	CDS	2140705	2141412	0.965	-	2	transcript "dm_048_GS_dna_5"	
Adh	MAGPIEexon	CDS	2141468	2141749	0.990	-	1	transcript "dm_048_GS_dna_5"	
Adh	MAGPIEexon	CDS	2141998	2142471	0.659	-	2	transcript "dm_048_GS_dna_5"	
Adh	MAGPIEexon	CDS	2146632	2146973	0.910	-	0	transcript "dm_048_GS_dna_5"	
Adh	MAGPIEexon	CDS	2149283	2149510	0.474	+	1	transcript "dm_048_GS_dna_6"	
Adh	MAGPIEexon	CDS	2149741	2150907	0.917	+	0	transcript "dm_048_GS_dna_6"	
Adh	MAGPIEexon	CDS	2151008	2151505	0.557	-	1	transcript "dm_048_GS_dna_7"	
Adh	MAGPIEexon	CDS	2151821	2151931	0.556	-	1	transcript "dm_048_GS_dna_7"	
Adh	MAGPIEexon	CDS	2152628	2152645	0.671	-	1	transcript "dm_048_GS_dna_7"	
Adh	MAGPIEexon	CDS	2154039	2154363	0.448	+	2	transcript "dm_048_GS_dna_8"	
Adh	MAGPIEexon	CDS	2155824	2155921	0.782	+	2	transcript "dm_048_GS_dna_8"	
Adh	MAGPIEexon	CDS	2158476	2158559	0.454	+	2	transcript "dm_048_GS_dna_9"	
Adh	MAGPIEexon	CDS	2158660	2159460	0.406	+	0	transcript "dm_048_GS_dna_9"	
Adh	MAGPIEexon	CDS	2160686	2160794	0.678	+	1	transcript "dm_049_GS_dna_1"	
Adh	MAGPIEexon	CDS	2163892	2164224	0.821	-	2	transcript "dm_048_GS_dna_10"	
Adh	MAGPIEexon	CDS	2163892	2164224	0.897	-	2	transcript "dm_049_GS_dna_2"	
Adh	MAGPIEexon	CDS	2165286	2165451	0.168	+	2	transcript "dm_049_GS_dna_3"	
Adh	MAGPIEexon	CDS	2168497	2168693	0.076	+	0	transcript "dm_049_GS_dna_3"	
Adh	MAGPIEexon	CDS	2168764	2168898	0.368	+	0	transcript "dm_049_GS_dna_3"	
Adh	MAGPIEexon	CDS	2168982	2169076	0.211	+	2	transcript "dm_049_GS_dna_3"	
Adh	MAGPIEexon	CDS	2171041	2171227	0.491	+	0	transcript "dm_049_GS_dna_3"	
Adh	MAGPIEexon	CDS	2172305	2172463	0.617	+	1	transcript "dm_049_GS_dna_3"	
Adh	MAGPIEexon	CDS	2173083	2173905	0.702	+	2	transcript "dm_049_GS_dna_4"	
Adh	MAGPIEexon	CDS	2174301	2177240	0.356	+	2	transcript "dm_049_GS_dna_4"	
Adh	MAGPIEexon	CDS	2177608	2177853	0.275	+	0	transcript "dm_049_GS_dna_4"	
Adh	MAGPIEexon	CDS	2179000	2179181	0.455	+	0	transcript "dm_049_GS_dna_4"	
Adh	MAGPIEexon	CDS	2180707	2180982	.	-	2	transcript "dm_049_MP_dna_5"	
Adh	MAGPIEexon	CDS	2181100	2181325	.	-	1	transcript "dm_049_MP_dna_5"	
Adh	MAGPIEexon	CDS	2181392	2182662	.	-	2	transcript "dm_049_MP_dna_5"	
Adh	MAGPIEexon	CDS	2182496	2182662	.	-	2	transcript "dm_049_MP_dna_8a"	
Adh	MAGPIEexon	CDS	2182828	2182863	.	-	2	transcript "dm_049_MP_dna_5"	
Adh	MAGPIEexon	CDS	2183542	2183946	0.807	-	2	transcript "dm_049_GS_dna_6"	
Adh	MAGPIEexon	CDS	2185415	2185492	0.898	+	1	transcript "dm_049_GS_dna_7"	
Adh	MAGPIEexon	CDS	2185631	2186020	0.251	+	1	transcript "dm_049_GS_dna_7"	
Adh	MAGPIEexon	CDS	2188469	2188849	0.184	+	1	transcript "dm_049_GS_dna_7"	
Adh	MAGPIEexon	CDS	2189454	2189790	.	-	2	transcript "dm_049_MP_dna_8a"	
Adh	MAGPIEexon	CDS	2189643	2189802	0.504	+	2	transcript "dm_049_GS_dna_8"	
Adh	MAGPIEexon	CDS	2190117	2190290	0.026	+	2	transcript "dm_049_GS_dna_8"	
Adh	MAGPIEexon	CDS	2192598	2192617	.	-	1	transcript "dm_049_MP_dna_8a"	
Adh	MAGPIEexon	CDS	2197287	2197386	0.791	+	2	transcript "dm_049_GS_dna_8"	
Adh	MAGPIEexon	CDS	2198345	2198735	0.841	+	1	transcript "dm_049_GS_dna_8"	
Adh	MAGPIEexon	CDS	2199247	2199422	0.769	-	0	transcript "dm_049_GS_dna_9"	
Adh	MAGPIEexon	CDS	2199618	2199651	0.725	-	2	transcript "dm_049_GS_dna_9"	
Adh	MAGPIEexon	CDS	2201531	2201677	0.984	-	1	transcript "dm_049_GS_dna_10"	
Adh	MAGPIEexon	CDS	2202376	2202477	0.877	-	2	transcript "dm_049_GS_dna_10"	
Adh	MAGPIEexon	CDS	2202548	2202802	0.852	-	1	transcript "dm_049_GS_dna_10"	
Adh	MAGPIEexon	CDS	2204183	2205278	0.999	+	1	transcript "dm_049_GS_dna_11"	
Adh	MAGPIEexon	CDS	2205170	2205278	0.725	+	1	transcript "dm_050_GS_dna_1"	
Adh	MAGPIEexon	CDS	2205332	2207403	0.998	+	1	transcript "dm_049_GS_dna_11"	
Adh	MAGPIEexon	CDS	2205332	2207403	0.998	+	1	transcript "dm_050_GS_dna_1"	
Adh	MAGPIEexon	CDS	2208922	2209531	.	-	1	transcript "dm_050_MP_dna_2"	
Adh	MAGPIEexon	CDS	2208922	2209531	0.995	-	1	transcript "dm_049_GS_dna_12"	
Adh	MAGPIEexon	CDS	2209593	2209876	0.938	-	1	transcript "dm_049_GS_dna_12"	
Adh	MAGPIEexon	CDS	2209593	2209904	.	-	0	transcript "dm_050_MP_dna_2"	
Adh	MAGPIEexon	CDS	2209967	2211186	.	-	2	transcript "dm_050_MP_dna_2"	
Adh	MAGPIEexon	CDS	2211243	2211671	.	-	0	transcript "dm_050_MP_dna_2"	
Adh	MAGPIEexon	CDS	2212036	2212168	.	-	1	transcript "dm_050_MP_dna_2"	
Adh	MAGPIEexon	CDS	2212228	2212394	.	-	0	transcript "dm_050_MP_dna_2"	
Adh	MAGPIEexon	CDS	2214270	2214423	0.396	+	2	transcript "dm_050_GS_dna_3"	
Adh	MAGPIEexon	CDS	2215392	2215516	0.476	+	2	transcript "dm_050_GS_dna_3"	
Adh	MAGPIEexon	CDS	2216202	2216447	0.960	+	2	transcript "dm_050_GS_dna_4"	
Adh	MAGPIEexon	CDS	2216609	2217034	0.999	+	1	transcript "dm_050_GS_dna_4"	
Adh	MAGPIEexon	CDS	2217099	2217419	0.837	+	2	transcript "dm_050_GS_dna_4"	
Adh	MAGPIEexon	CDS	2218555	2218905	0.989	-	2	transcript "dm_050_GS_dna_5"	
Adh	MAGPIEexon	CDS	2218966	2220057	0.989	-	2	transcript "dm_050_GS_dna_5"	
Adh	MAGPIEexon	CDS	2220565	2222197	0.999	-	1	transcript "dm_050_GS_dna_6"	
Adh	MAGPIEexon	CDS	2222257	2222379	0.999	-	2	transcript "dm_050_GS_dna_6"	
Adh	MAGPIEexon	CDS	2222435	2222667	0.998	-	2	transcript "dm_050_GS_dna_6"	
Adh	MAGPIEexon	CDS	2222723	2222818	0.400	-	1	transcript "dm_050_GS_dna_6"	
Adh	MAGPIEexon	CDS	2223403	2223577	0.936	-	1	transcript "dm_050_GS_dna_6"	
Adh	MAGPIEexon	CDS	2223854	2224248	0.539	-	2	transcript "dm_050_GS_dna_6"	
Adh	MAGPIEexon	CDS	2226895	2227046	0.092	-	0	transcript "dm_050_GS_dna_6"	
Adh	MAGPIEexon	CDS	2231935	2232091	0.062	-	1	transcript "dm_050_GS_dna_6"	
Adh	MAGPIEexon	CDS	2236081	2241876	0.964	+	0	transcript "dm_050_GS_dna_7"	
Adh	MAGPIEexon	CDS	2242582	2242790	0.326	-	0	transcript "dm_050_GS_dna_8"	
Adh	MAGPIEexon	CDS	2242955	2243099	0.546	-	0	transcript "dm_050_GS_dna_8"	
Adh	MAGPIEexon	CDS	2243851	2243957	0.788	-	0	transcript "dm_050_GS_dna_8"	
Adh	MAGPIEexon	CDS	2246761	2246878	0.875	-	1	transcript "dm_050_GS_dna_8"	
Adh	MAGPIEexon	CDS	2248133	2248224	0.939	-	2	transcript "dm_050_GS_dna_9"	
Adh	MAGPIEexon	CDS	2252604	2252769	0.062	-	2	transcript "dm_050_GS_dna_9"	
Adh	MAGPIEexon	CDS	2254301	2254361	0.891	+	1	transcript "dm_051_GS_dna_1"	
Adh	MAGPIEexon	CDS	2255069	2255172	0.603	+	1	transcript "dm_051_GS_dna_1"	
Adh	MAGPIEexon	CDS	2255810	2255944	0.703	+	1	transcript "dm_051_GS_dna_1"	
Adh	MAGPIEexon	CDS	2256861	2257041	0.840	+	2	transcript "dm_051_GS_dna_1"	
Adh	MAGPIEexon	CDS	2257795	2257955	0.932	+	0	transcript "dm_051_GS_dna_1"	
Adh	MAGPIEexon	CDS	2259512	2259735	0.877	-	2	transcript "dm_051_GS_dna_2"	
Adh	MAGPIEexon	CDS	2260159	2260306	0.902	-	1	transcript "dm_051_GS_dna_2"	
Adh	MAGPIEexon	CDS	2263166	2263696	0.888	-	1	transcript "dm_051_GS_dna_3"	
Adh	MAGPIEexon	CDS	2263755	2263955	0.420	-	0	transcript "dm_051_GS_dna_3"	
Adh	MAGPIEexon	CDS	2266649	2266718	0.877	+	1	transcript "dm_051_GS_dna_4"	
Adh	MAGPIEexon	CDS	2267137	2267283	0.745	+	0	transcript "dm_051_GS_dna_4"	
Adh	MAGPIEexon	CDS	2267749	2267922	0.774	+	0	transcript "dm_051_GS_dna_4"	
Adh	MAGPIEexon	CDS	2270150	2270319	0.567	+	1	transcript "dm_051_GS_dna_4"	
Adh	MAGPIEexon	CDS	2277254	2277546	0.564	+	1	transcript "dm_051_GS_dna_5"	
Adh	MAGPIEexon	CDS	2278064	2278212	0.851	+	1	transcript "dm_051_GS_dna_5"	
Adh	MAGPIEexon	CDS	2279357	2279653	0.792	+	1	transcript "dm_051_GS_dna_5"	
Adh	MAGPIEexon	CDS	2280362	2281032	0.684	+	1	transcript "dm_051_GS_dna_5"	
Adh	MAGPIEexon	CDS	2282647	2282710	0.997	+	0	transcript "dm_051_GS_dna_6"	
Adh	MAGPIEexon	CDS	2283319	2283638	0.470	+	0	transcript "dm_051_GS_dna_6"	
Adh	MAGPIEexon	CDS	2286435	2287433	0.986	-	0	transcript "dm_051_GS_dna_7"	
Adh	MAGPIEexon	CDS	2294198	2294255	0.948	+	1	transcript "dm_051_GS_dna_8"	
Adh	MAGPIEexon	CDS	2295140	2295360	0.698	+	1	transcript "dm_052_GS_dna_1"	
Adh	MAGPIEexon	CDS	2295140	2295360	0.901	+	1	transcript "dm_051_GS_dna_8"	
Adh	MAGPIEexon	CDS	2297756	2297935	0.331	-	1	transcript "dm_052_GS_dna_2"	
Adh	MAGPIEexon	CDS	2297756	2297981	0.735	-	0	transcript "dm_051_GS_dna_9"	
Adh	MAGPIEexon	CDS	2301474	2301560	0.382	-	0	transcript "dm_052_GS_dna_2"	
Adh	MAGPIEexon	CDS	2302519	2303025	0.966	+	0	transcript "dm_052_GS_dna_3"	
Adh	MAGPIEexon	CDS	2303448	2304641	0.464	+	2	transcript "dm_052_GS_dna_4"	
Adh	MAGPIEexon	CDS	2305038	2305397	0.998	+	2	transcript "dm_052_GS_dna_5"	
Adh	MAGPIEexon	CDS	2305489	2305763	0.896	+	0	transcript "dm_052_GS_dna_5"	
Adh	MAGPIEexon	CDS	2305829	2306951	0.958	+	1	transcript "dm_052_GS_dna_5"	
Adh	MAGPIEexon	CDS	2309520	2309676	0.832	+	2	transcript "dm_052_GS_dna_6"	
Adh	MAGPIEexon	CDS	2310116	2310229	0.459	+	1	transcript "dm_052_GS_dna_6"	
Adh	MAGPIEexon	CDS	2310335	2310516	0.393	+	1	transcript "dm_052_GS_dna_6"	
Adh	MAGPIEexon	CDS	2311125	2311544	0.775	+	2	transcript "dm_052_GS_dna_6"	
Adh	MAGPIEexon	CDS	2313937	2314044	0.813	+	0	transcript "dm_052_GS_dna_7"	
Adh	MAGPIEexon	CDS	2314099	2314204	0.763	+	0	transcript "dm_052_GS_dna_7"	
Adh	MAGPIEexon	CDS	2315279	2315487	0.272	+	1	transcript "dm_052_GS_dna_7"	
Adh	MAGPIEexon	CDS	2315767	2315925	0.328	-	2	transcript "dm_052_GS_dna_8"	
Adh	MAGPIEexon	CDS	2315991	2316098	0.857	-	0	transcript "dm_052_GS_dna_8"	
Adh	MAGPIEexon	CDS	2318127	2318178	0.341	+	2	transcript "dm_052_GS_dna_9"	
Adh	MAGPIEexon	CDS	2325779	2325915	0.171	+	1	transcript "dm_052_GS_dna_9"	
Adh	MAGPIEexon	CDS	2328290	2328403	0.998	-	1	transcript "dm_052_GS_dna_10"	
Adh	MAGPIEexon	CDS	2328611	2329967	0.881	-	0	transcript "dm_052_GS_dna_10"	
Adh	MAGPIEexon	CDS	2330026	2330181	0.527	-	2	transcript "dm_052_GS_dna_10"	
Adh	MAGPIEexon	CDS	2330600	2330652	0.521	-	2	transcript "dm_052_GS_dna_10"	
Adh	MAGPIEexon	CDS	2331101	2331310	0.938	-	1	transcript "dm_052_GS_dna_10"	
Adh	MAGPIEexon	CDS	2335716	2335977	0.906	+	2	transcript "dm_052_GS_dna_11"	
Adh	MAGPIEexon	CDS	2337332	2337479	0.388	+	1	transcript "dm_052_GS_dna_11"	
Adh	MAGPIEexon	CDS	2338580	2339258	0.352	+	1	transcript "dm_052_GS_dna_11"	
Adh	MAGPIEexon	CDS	2339377	2340420	0.999	-	2	transcript "dm_052_GS_dna_12"	
Adh	MAGPIEexon	CDS	2340041	2340420	0.763	-	2	transcript "dm_053_GS_dna_1"	
Adh	MAGPIEexon	CDS	2340535	2341630	0.980	-	1	transcript "dm_052_GS_dna_12"	
Adh	MAGPIEexon	CDS	2340535	2341630	0.980	-	1	transcript "dm_053_GS_dna_1"	
Adh	MAGPIEexon	CDS	2341725	2341808	0.774	-	0	transcript "dm_052_GS_dna_12"	
Adh	MAGPIEexon	CDS	2341725	2341808	0.774	-	0	transcript "dm_053_GS_dna_1"	
Adh	MAGPIEexon	CDS	2342156	2342274	0.939	-	2	transcript "dm_052_GS_dna_12"	
Adh	MAGPIEexon	CDS	2342156	2342274	0.939	-	2	transcript "dm_053_GS_dna_1"	
Adh	MAGPIEexon	CDS	2342341	2342602	0.804	-	1	transcript "dm_052_GS_dna_12"	
Adh	MAGPIEexon	CDS	2342341	2342602	0.805	-	1	transcript "dm_053_GS_dna_1"	
Adh	MAGPIEexon	CDS	2342664	2343851	0.439	-	0	transcript "dm_053_GS_dna_1"	
Adh	MAGPIEexon	CDS	2342664	2343851	0.596	-	0	transcript "dm_052_GS_dna_12"	
Adh	MAGPIEexon	CDS	2343893	2343909	0.421	-	2	transcript "dm_053_GS_dna_1"	
Adh	MAGPIEexon	CDS	2346572	2346942	0.181	+	1	transcript "dm_053_GS_dna_2"	
Adh	MAGPIEexon	CDS	2347013	2347323	0.970	+	1	transcript "dm_053_GS_dna_2"	
Adh	MAGPIEexon	CDS	2347420	2347676	0.773	+	0	transcript "dm_053_GS_dna_2"	
Adh	MAGPIEexon	CDS	2348982	2349115	0.691	-	1	transcript "dm_053_GS_dna_3"	
Adh	MAGPIEexon	CDS	2349968	2350879	0.770	-	1	transcript "dm_053_GS_dna_3"	
Adh	MAGPIEexon	CDS	2352080	2353052	0.862	-	0	transcript "dm_053_GS_dna_3"	
Adh	MAGPIEexon	CDS	2354284	2354606	0.498	+	0	transcript "dm_053_GS_dna_4"	
Adh	MAGPIEexon	CDS	2354627	2354857	0.809	+	1	transcript "dm_053_GS_dna_4"	
Adh	MAGPIEexon	CDS	2355299	2355506	0.598	+	1	transcript "dm_053_GS_dna_4"	
Adh	MAGPIEexon	CDS	2356272	2356710	0.938	-	2	transcript "dm_053_GS_dna_5"	
Adh	MAGPIEexon	CDS	2356872	2357164	0.953	-	1	transcript "dm_053_GS_dna_5"	
Adh	MAGPIEexon	CDS	2357224	2357495	0.788	-	0	transcript "dm_053_GS_dna_5"	
Adh	MAGPIEexon	CDS	2357539	2357674	0.999	-	1	transcript "dm_053_GS_dna_5"	
Adh	MAGPIEexon	CDS	2358742	2358953	0.983	-	0	transcript "dm_053_GS_dna_5"	
Adh	MAGPIEexon	CDS	2362252	2362426	0.441	-	1	transcript "dm_053_GS_dna_5"	
Adh	MAGPIEexon	CDS	2363206	2363370	0.823	-	2	transcript "dm_053_GS_dna_5"	
Adh	MAGPIEexon	CDS	2363486	2363521	0.933	-	1	transcript "dm_053_GS_dna_5"	
Adh	MAGPIEexon	CDS	2365166	2365471	0.998	+	1	transcript "dm_053_GS_dna_6"	
Adh	MAGPIEexon	CDS	2365688	2365814	0.272	-	0	transcript "dm_053_GS_dna_7"	
Adh	MAGPIEexon	CDS	2366015	2366304	0.271	-	2	transcript "dm_053_GS_dna_7"	
Adh	MAGPIEexon	CDS	2367880	2368018	0.225	-	1	transcript "dm_053_GS_dna_8"	
Adh	MAGPIEexon	CDS	2368647	2368753	0.198	-	1	transcript "dm_053_GS_dna_8"	
Adh	MAGPIEexon	CDS	2370974	2371207	0.644	-	1	transcript "dm_053_GS_dna_8"	
Adh	MAGPIEexon	CDS	2372572	2372919	0.765	+	0	transcript "dm_053_GS_dna_9"	
Adh	MAGPIEexon	CDS	2374085	2374294	0.674	+	1	transcript "dm_053_GS_dna_10"	
Adh	MAGPIEexon	CDS	2374356	2376860	0.986	+	2	transcript "dm_053_GS_dna_10"	
Adh	MAGPIEexon	CDS	2377665	2377875	0.930	+	2	transcript "dm_053_GS_dna_10"	
Adh	MAGPIEexon	CDS	2379582	2379724	0.942	+	2	transcript "dm_053_GS_dna_10"	
Adh	MAGPIEexon	CDS	2385180	2385273	0.596	+	2	transcript "dm_054_GS_dna_1"	
Adh	MAGPIEexon	CDS	2392116	2392737	0.001	+	2	transcript "dm_054_GS_dna_1"	
Adh	MAGPIEexon	CDS	2392800	2393095	0.992	+	2	transcript "dm_054_GS_dna_1"	
Adh	MAGPIEexon	CDS	2393155	2393333	0.991	+	0	transcript "dm_054_GS_dna_1"	
Adh	MAGPIEexon	CDS	2395174	2395323	0.973	+	0	transcript "dm_054_GS_dna_1"	
Adh	MAGPIEexon	CDS	2398367	2398380	0.252	+	1	transcript "dm_054_GS_dna_2"	
Adh	MAGPIEexon	CDS	2398534	2398815	0.198	+	0	transcript "dm_054_GS_dna_2"	
Adh	MAGPIEexon	CDS	2400367	2400843	0.135	+	0	transcript "dm_054_GS_dna_2"	
Adh	MAGPIEexon	CDS	2406425	2406634	0.507	+	1	transcript "dm_054_GS_dna_2"	
Adh	MAGPIEexon	CDS	2407447	2407845	0.656	+	0	transcript "dm_054_GS_dna_2"	
Adh	MAGPIEexon	CDS	2407960	2408288	0.911	+	0	transcript "dm_054_GS_dna_2"	
Adh	MAGPIEexon	CDS	2410246	2410394	0.593	+	0	transcript "dm_054_GS_dna_2"	
Adh	MAGPIEexon	CDS	2414304	2414626	0.380	-	1	transcript "dm_054_GS_dna_3"	
Adh	MAGPIEexon	CDS	2414976	2415135	0.528	-	2	transcript "dm_054_GS_dna_3"	
Adh	MAGPIEexon	CDS	2415472	2415600	0.960	-	2	transcript "dm_054_GS_dna_3"	
Adh	MAGPIEexon	CDS	2415779	2415817	0.531	+	1	transcript "dm_054_GS_dna_4"	
Adh	MAGPIEexon	CDS	2416355	2416527	0.276	+	1	transcript "dm_054_GS_dna_4"	
Adh	MAGPIEexon	CDS	2416779	2416879	0.538	+	2	transcript "dm_054_GS_dna_4"	
Adh	MAGPIEexon	CDS	2417682	2417932	0.401	+	2	transcript "dm_054_GS_dna_4"	
Adh	MAGPIEexon	CDS	2420182	2420319	0.457	+	0	transcript "dm_054_GS_dna_4"	
Adh	MAGPIEexon	CDS	2421403	2421733	0.072	-	1	transcript "dm_054_GS_dna_5"	
Adh	MAGPIEexon	CDS	2422862	2423079	0.044	-	2	transcript "dm_054_GS_dna_5"	
Adh	MAGPIEexon	CDS	2423115	2423234	0.166	-	0	transcript "dm_054_GS_dna_5"	
Adh	MAGPIEexon	CDS	2428833	2429381	0.998	+	2	transcript "dm_054_GS_dna_6"	
Adh	MAGPIEexon	CDS	2431658	2431860	0.958	-	2	transcript "dm_054_GS_dna_7"	
Adh	MAGPIEexon	CDS	2439978	2440179	0.789	+	2	transcript "dm_055_GS_dna_1"	
Adh	MAGPIEexon	CDS	2441079	2441209	0.882	+	2	transcript "dm_055_GS_dna_1"	
Adh	MAGPIEexon	CDS	2443537	2443726	0.125	+	0	transcript "dm_055_GS_dna_2"	
Adh	MAGPIEexon	CDS	2444164	2444213	0.086	+	0	transcript "dm_055_GS_dna_2"	
Adh	MAGPIEexon	CDS	2445262	2445365	0.081	+	0	transcript "dm_055_GS_dna_2"	
Adh	MAGPIEexon	CDS	2445792	2445848	0.090	+	2	transcript "dm_055_GS_dna_2"	
Adh	MAGPIEexon	CDS	2449650	2449838	0.086	+	2	transcript "dm_055_GS_dna_2"	
Adh	MAGPIEexon	CDS	2451225	2451400	0.496	+	2	transcript "dm_055_GS_dna_2"	
Adh	MAGPIEexon	CDS	2452356	2452477	0.503	+	2	transcript "dm_055_GS_dna_2"	
Adh	MAGPIEexon	CDS	2452560	2452721	0.769	+	2	transcript "dm_055_GS_dna_2"	
Adh	MAGPIEexon	CDS	2454209	2454275	0.135	+	1	transcript "dm_055_GS_dna_3"	
Adh	MAGPIEexon	CDS	2458368	2458406	0.148	+	2	transcript "dm_055_GS_dna_3"	
Adh	MAGPIEexon	CDS	2460751	2461259	0.541	+	0	transcript "dm_055_GS_dna_3"	
Adh	MAGPIEexon	CDS	2465772	2465965	0.803	+	2	transcript "dm_055_GS_dna_4"	
Adh	MAGPIEexon	CDS	2466655	2466738	0.074	+	0	transcript "dm_055_GS_dna_4"	
Adh	MAGPIEexon	CDS	2473984	2474088	0.006	+	0	transcript "dm_055_GS_dna_4"	
Adh	MAGPIEexon	CDS	2475362	2475560	0.631	+	1	transcript "dm_056_GS_dna_1"	
Adh	MAGPIEexon	CDS	2475406	2475560	0.026	+	0	transcript "dm_055_GS_dna_4"	
Adh	MAGPIEexon	CDS	2476194	2476460	0.749	+	2	transcript "dm_055_GS_dna_4"	
Adh	MAGPIEexon	CDS	2476194	2476460	0.751	+	2	transcript "dm_056_GS_dna_1"	
Adh	MAGPIEexon	CDS	2477298	2477356	0.479	+	2	transcript "dm_055_GS_dna_4"	
Adh	MAGPIEexon	CDS	2477298	2477356	0.480	+	2	transcript "dm_056_GS_dna_1"	
Adh	MAGPIEexon	CDS	2479122	2479487	0.213	-	0	transcript "dm_055_GS_dna_5"	
Adh	MAGPIEexon	CDS	2479122	2479487	0.269	-	0	transcript "dm_056_GS_dna_2"	
Adh	MAGPIEexon	CDS	2480542	2480671	0.614	+	0	transcript "dm_056_GS_dna_3"	
Adh	MAGPIEexon	CDS	2481137	2481328	0.461	+	1	transcript "dm_056_GS_dna_3"	
Adh	MAGPIEexon	CDS	2481639	2481850	0.997	+	2	transcript "dm_056_GS_dna_3"	
Adh	MAGPIEexon	CDS	2483447	2483582	0.990	+	1	transcript "dm_056_GS_dna_3"	
Adh	MAGPIEexon	CDS	2483839	2483972	0.993	+	0	transcript "dm_056_GS_dna_3"	
Adh	MAGPIEexon	CDS	2484693	2484860	0.635	+	2	transcript "dm_056_GS_dna_3"	
Adh	MAGPIEexon	CDS	2486400	2486522	0.814	+	2	transcript "dm_056_GS_dna_3"	
Adh	MAGPIEexon	CDS	2486596	2486785	0.938	+	0	transcript "dm_056_GS_dna_3"	
Adh	MAGPIEexon	CDS	2488134	2488789	0.979	+	2	transcript "dm_056_GS_dna_3"	
Adh	MAGPIEexon	CDS	2492047	2492253	0.976	-	2	transcript "dm_056_GS_dna_4"	
Adh	MAGPIEexon	CDS	2493314	2493620	.	+	1	transcript "dm_056_MP_dna_5"	
Adh	MAGPIEexon	CDS	2493682	2493731	.	+	0	transcript "dm_056_MP_dna_5"	
Adh	MAGPIEexon	CDS	2494047	2494116	.	+	2	transcript "dm_056_MP_dna_5"	
Adh	MAGPIEexon	CDS	2494180	2494259	.	+	0	transcript "dm_056_MP_dna_5"	
Adh	MAGPIEexon	CDS	2494325	2494651	.	+	1	transcript "dm_056_MP_dna_5"	
Adh	MAGPIEexon	CDS	2495100	2495225	.	+	2	transcript "dm_056_MP_dna_5"	
Adh	MAGPIEexon	CDS	2495286	2495667	.	+	2	transcript "dm_056_MP_dna_5"	
Adh	MAGPIEexon	CDS	2495861	2496988	.	+	1	transcript "dm_056_MP_dna_5"	
Adh	MAGPIEexon	CDS	2497217	2497464	.	+	1	transcript "dm_056_MP_dna_5"	
Adh	MAGPIEexon	CDS	2501760	2501859	0.762	+	2	transcript "dm_056_GS_dna_6"	
Adh	MAGPIEexon	CDS	2505534	2505597	.	+	2	transcript "dm_057_MP_dna_2"	
Adh	MAGPIEexon	CDS	2505511	2505597	0.943	+	0	transcript "dm_056_GS_dna_6"	
Adh	MAGPIEexon	CDS	2506745	2506866	0.836	+	1	transcript "dm_056_GS_dna_6"	
Adh	MAGPIEexon	CDS	2509644	2509922	0.830	-	0	transcript "dm_056_GS_dna_7"	
Adh	MAGPIEexon	CDS	2513313	2513411	0.649	-	0	transcript "dm_056_GS_dna_7"	
Adh	MAGPIEexon	CDS	2520582	2520797	0.471	-	0	transcript "dm_057_GS_dna_1"	
Adh	MAGPIEexon	CDS	2520852	2521087	0.385	-	1	transcript "dm_056_GS_dna_8"	
Adh	MAGPIEexon	CDS	2522607	2522738	0.248	-	0	transcript "dm_057_GS_dna_1"	
Adh	MAGPIEexon	CDS	2522638	2522802	0.068	-	2	transcript "dm_056_GS_dna_8"	
Adh	MAGPIEexon	CDS	2524357	2524565	.	+	0	transcript "dm_057_MP_dna_2"	
Adh	MAGPIEexon	CDS	2525929	2526064	.	+	0	transcript "dm_057_MP_dna_2"	
Adh	MAGPIEexon	CDS	2527415	2527548	.	+	1	transcript "dm_057_MP_dna_2"	
Adh	MAGPIEexon	CDS	2529073	2529195	.	+	0	transcript "dm_057_MP_dna_2"	
Adh	MAGPIEexon	CDS	2529260	2529455	.	+	1	transcript "dm_057_MP_dna_2"	
Adh	MAGPIEexon	CDS	2529735	2530156	.	+	2	transcript "dm_057_MP_dna_2"	
Adh	MAGPIEexon	CDS	2533991	2534034	0.451	-	2	transcript "dm_057_GS_dna_3"	
Adh	MAGPIEexon	CDS	2536216	2536431	0.546	-	2	transcript "dm_057_GS_dna_3"	
Adh	MAGPIEexon	CDS	2537972	2538092	0.154	-	0	transcript "dm_057_GS_dna_3"	
Adh	MAGPIEexon	CDS	2540736	2541061	0.060	-	1	transcript "dm_057_GS_dna_3"	
Adh	MAGPIEexon	CDS	2541408	2541510	0.884	-	2	transcript "dm_057_GS_dna_3"	
Adh	MAGPIEexon	CDS	2544295	2545096	0.563	+	0	transcript "dm_057_GS_dna_4"	
Adh	MAGPIEexon	CDS	2545698	2545846	0.530	+	2	transcript "dm_057_GS_dna_4"	
Adh	MAGPIEexon	CDS	2549369	2549688	0.929	+	1	transcript "dm_057_GS_dna_5"	
Adh	MAGPIEexon	CDS	2555100	2555176	0.286	+	2	transcript "dm_057_GS_dna_5"	
Adh	MAGPIEexon	CDS	2566013	2566312	0.821	+	1	transcript "dm_058_GS_dna_1"	
Adh	MAGPIEexon	CDS	2566020	2566312	0.010	+	2	transcript "dm_057_GS_dna_5"	
Adh	MAGPIEexon	CDS	2568461	2568924	0.654	-	2	transcript "dm_057_GS_dna_6"	
Adh	MAGPIEexon	CDS	2571515	2571691	0.883	+	1	transcript "dm_058_GS_dna_2"	
Adh	MAGPIEexon	CDS	2572971	2573222	0.953	+	2	transcript "dm_058_GS_dna_2"	
Adh	MAGPIEexon	CDS	2575792	2576072	0.716	+	0	transcript "dm_058_GS_dna_2"	
Adh	MAGPIEexon	CDS	2578239	2578407	0.535	+	2	transcript "dm_058_GS_dna_2"	
Adh	MAGPIEexon	CDS	2580455	2580779	0.722	-	0	transcript "dm_058_GS_dna_3"	
Adh	MAGPIEexon	CDS	2580838	2580999	0.473	-	2	transcript "dm_058_GS_dna_3"	
Adh	MAGPIEexon	CDS	2581149	2581234	0.655	-	1	transcript "dm_058_GS_dna_3"	
Adh	MAGPIEexon	CDS	2582975	2583547	0.981	+	1	transcript "dm_058_GS_dna_4"	
Adh	MAGPIEexon	CDS	2584077	2584353	0.976	-	2	transcript "dm_058_GS_dna_5"	
Adh	MAGPIEexon	CDS	2584421	2584527	0.267	-	2	transcript "dm_058_GS_dna_5"	
Adh	MAGPIEexon	CDS	2585705	2585917	0.191	-	1	transcript "dm_058_GS_dna_5"	
Adh	MAGPIEexon	CDS	2586623	2586772	0.624	-	1	transcript "dm_058_GS_dna_5"	
Adh	MAGPIEexon	CDS	2590910	2595141	.	+	1	transcript "dm_058_MP_dna_6"	
Adh	MAGPIEexon	CDS	2595904	2596179	0.815	-	2	transcript "dm_058_GS_dna_7"	
Adh	MAGPIEexon	CDS	2601123	2601215	0.262	+	2	transcript "dm_058_GS_dna_8"	
Adh	MAGPIEexon	CDS	2602563	2602700	0.261	+	2	transcript "dm_058_GS_dna_8"	
Adh	MAGPIEexon	CDS	2604868	2608047	.	-	2	transcript "dm_058_MP_dna_9"	
Adh	MAGPIEexon	CDS	2619967	2620307	.	+	0	transcript "dm_059_MP_dna_1"	
Adh	MAGPIEexon	CDS	2621231	2622507	.	+	1	transcript "dm_059_MP_dna_1"	
Adh	MAGPIEexon	CDS	2622578	2622803	.	+	1	transcript "dm_059_MP_dna_1"	
Adh	MAGPIEexon	CDS	2622977	2623082	.	+	1	transcript "dm_059_MP_dna_1"	
Adh	MAGPIEexon	CDS	2623316	2623455	.	+	1	transcript "dm_059_MP_dna_1"	
Adh	MAGPIEexon	CDS	2623675	2623781	.	+	0	transcript "dm_059_MP_dna_1"	
Adh	MAGPIEexon	CDS	2624114	2624266	.	+	1	transcript "dm_059_MP_dna_1"	
Adh	MAGPIEexon	CDS	2624694	2624875	.	+	2	transcript "dm_059_MP_dna_1"	
Adh	MAGPIEexon	CDS	2624976	2625495	.	+	2	transcript "dm_059_MP_dna_1"	
Adh	MAGPIEexon	CDS	2625559	2625784	.	+	0	transcript "dm_059_MP_dna_1"	
Adh	MAGPIEexon	CDS	2625851	2626061	.	+	1	transcript "dm_059_MP_dna_1"	
Adh	MAGPIEexon	CDS	2626124	2626333	.	+	1	transcript "dm_059_MP_dna_1"	
Adh	MAGPIEexon	CDS	2626392	2626510	.	+	2	transcript "dm_059_MP_dna_1"	
Adh	MAGPIEexon	CDS	2626595	2626653	.	+	1	transcript "dm_059_MP_dna_1"	
Adh	MAGPIEexon	CDS	2627634	2627751	.	+	2	transcript "dm_059_MP_dna_1"	
Adh	MAGPIEexon	CDS	2628166	2628295	.	+	0	transcript "dm_059_MP_dna_1"	
Adh	MAGPIEexon	CDS	2628460	2628626	.	+	0	transcript "dm_059_MP_dna_1"	
Adh	MAGPIEexon	CDS	2628718	2628805	.	+	0	transcript "dm_059_MP_dna_1"	
Adh	MAGPIEexon	CDS	2629398	2629505	.	+	2	transcript "dm_059_MP_dna_1"	
Adh	MAGPIEexon	CDS	2632038	2632090	.	+	2	transcript "dm_059_MP_dna_1"	
Adh	MAGPIEexon	CDS	2632152	2632298	.	+	2	transcript "dm_059_MP_dna_1"	
Adh	MAGPIEexon	CDS	2632363	2632834	.	+	0	transcript "dm_059_MP_dna_1"	
Adh	MAGPIEexon	CDS	2632889	2632972	.	+	1	transcript "dm_059_MP_dna_1"	
Adh	MAGPIEexon	CDS	2633028	2633093	.	+	2	transcript "dm_059_MP_dna_1"	
Adh	MAGPIEexon	CDS	2633149	2633337	.	+	0	transcript "dm_059_MP_dna_1"	
Adh	MAGPIEexon	CDS	2633397	2633645	.	+	2	transcript "dm_059_MP_dna_1"	
Adh	MAGPIEexon	CDS	2633706	2634365	.	+	2	transcript "dm_059_MP_dna_1"	
Adh	MAGPIEexon	CDS	2634452	2634885	.	+	1	transcript "dm_059_MP_dna_1"	
Adh	MAGPIEexon	CDS	2635370	2635410	.	+	1	transcript "dm_059_MP_dna_1"	
Adh	MAGPIEexon	CDS	2638284	2638414	.	+	2	transcript "dm_059_MP_dna_1"	
Adh	MAGPIEexon	CDS	2638322	2638414	0.968	+	1	transcript "dm_059_GS_dna_2"	
Adh	MAGPIEexon	CDS	2638470	2639006	.	+	2	transcript "dm_059_MP_dna_1"	
Adh	MAGPIEexon	CDS	2638470	2639006	0.979	+	2	transcript "dm_059_GS_dna_2"	
Adh	MAGPIEexon	CDS	2640219	2640644	0.998	-	0	transcript "dm_059_GS_dna_3"	
Adh	MAGPIEexon	CDS	2649834	2650229	0.987	-	0	transcript "dm_059_GS_dna_4"	
Adh	MAGPIEexon	CDS	2651612	2651711	0.564	-	0	transcript "dm_059_GS_dna_4"	
Adh	MAGPIEexon	CDS	2651787	2651890	0.406	-	1	transcript "dm_059_GS_dna_4"	
Adh	MAGPIEexon	CDS	2654137	2654334	0.183	-	2	transcript "dm_059_GS_dna_4"	
Adh	MAGPIEexon	CDS	2655328	2655462	0.940	-	2	transcript "dm_059_GS_dna_4"	
Adh	MAGPIEexon	CDS	2656120	2656278	0.875	+	0	transcript "dm_060_GS_dna_1"	
Adh	MAGPIEexon	CDS	2659219	2659500	0.885	-	2	transcript "dm_059_GS_dna_4"	
Adh	MAGPIEexon	CDS	2660848	2661318	0.911	+	0	transcript "dm_060_GS_dna_2"	
Adh	MAGPIEexon	CDS	2661378	2662292	0.976	+	2	transcript "dm_060_GS_dna_2"	
Adh	MAGPIEexon	CDS	2664895	2664990	0.818	+	0	transcript "dm_060_GS_dna_2"	
Adh	MAGPIEexon	CDS	2665660	2665896	0.663	+	0	transcript "dm_060_GS_dna_2"	
Adh	MAGPIEexon	CDS	2671791	2672087	0.723	-	0	transcript "dm_060_GS_dna_3"	
Adh	MAGPIEexon	CDS	2674498	2674665	0.777	-	2	transcript "dm_060_GS_dna_4"	
Adh	MAGPIEexon	CDS	2676107	2676274	0.218	-	1	transcript "dm_060_GS_dna_5"	
Adh	MAGPIEexon	CDS	2680716	2680808	0.885	-	0	transcript "dm_060_GS_dna_5"	
Adh	MAGPIEexon	CDS	2683427	2683473	0.695	+	1	transcript "dm_060_GS_dna_6"	
Adh	MAGPIEexon	CDS	2684880	2686209	0.999	+	2	transcript "dm_060_GS_dna_6"	
Adh	MAGPIEexon	CDS	2686394	2686570	0.988	+	1	transcript "dm_060_GS_dna_6"	
Adh	MAGPIEexon	CDS	2686628	2686705	0.534	+	1	transcript "dm_060_GS_dna_6"	
Adh	MAGPIEexon	CDS	2686770	2687146	0.987	+	2	transcript "dm_060_GS_dna_6"	
Adh	MAGPIEexon	CDS	2687211	2687359	0.999	+	2	transcript "dm_060_GS_dna_6"	
Adh	MAGPIEexon	CDS	2687415	2687794	0.853	+	2	transcript "dm_060_GS_dna_6"	
Adh	MAGPIEexon	CDS	2687988	2688204	0.526	+	2	transcript "dm_060_GS_dna_6"	
Adh	MAGPIEexon	CDS	2688462	2688883	0.980	+	2	transcript "dm_060_GS_dna_6"	
Adh	MAGPIEexon	CDS	2691203	2694219	0.499	+	1	transcript "dm_060_GS_dna_6"	
Adh	MAGPIEexon	CDS	2694277	2694414	0.792	+	0	transcript "dm_060_GS_dna_6"	
Adh	MAGPIEexon	CDS	2694479	2694719	0.737	+	1	transcript "dm_060_GS_dna_6"	
Adh	MAGPIEexon	CDS	2696335	2696446	.	-	1	transcript "dm_060_MP_dna_7"	
Adh	MAGPIEexon	CDS	2696513	2696664	.	-	2	transcript "dm_060_MP_dna_7"	
Adh	MAGPIEexon	CDS	2697876	2698028	.	-	0	transcript "dm_060_MP_dna_7"	
Adh	MAGPIEexon	CDS	2698091	2698210	.	-	1	transcript "dm_060_MP_dna_7"	
Adh	MAGPIEexon	CDS	2701003	2701093	0.729	+	0	transcript "dm_060_GS_dna_8"	
Adh	MAGPIEexon	CDS	2701003	2701093	0.911	+	0	transcript "dm_061_GS_dna_1"	
Adh	MAGPIEexon	CDS	2702379	2702447	0.213	+	2	transcript "dm_060_GS_dna_8"	
Adh	MAGPIEexon	CDS	2702379	2702447	0.570	+	2	transcript "dm_061_GS_dna_1"	
Adh	MAGPIEexon	CDS	2703179	2703294	0.286	+	1	transcript "dm_060_GS_dna_8"	
Adh	MAGPIEexon	CDS	2707297	2707439	0.983	+	0	transcript "dm_061_GS_dna_1"	
Adh	MAGPIEexon	CDS	2707509	2708522	0.997	+	2	transcript "dm_061_GS_dna_1"	
Adh	MAGPIEexon	CDS	2709485	2710765	.	-	1	transcript "dm_061_MP_dna_2"	
Adh	MAGPIEexon	CDS	2711460	2711538	0.737	+	2	transcript "dm_061_GS_dna_3"	
Adh	MAGPIEexon	CDS	2711599	2711717	0.920	+	0	transcript "dm_061_GS_dna_3"	
Adh	MAGPIEexon	CDS	2711781	2711853	0.923	+	2	transcript "dm_061_GS_dna_3"	
Adh	MAGPIEexon	CDS	2711910	2712472	0.460	+	2	transcript "dm_061_GS_dna_3"	
Adh	MAGPIEexon	CDS	2712884	2713168	0.213	-	1	transcript "dm_061_GS_dna_4"	
Adh	MAGPIEexon	CDS	2714814	2716277	0.238	-	0	transcript "dm_061_GS_dna_4"	
Adh	MAGPIEexon	CDS	2717360	2717687	0.059	-	0	transcript "dm_061_GS_dna_4"	
Adh	MAGPIEexon	CDS	2720157	2720211	0.003	-	2	transcript "dm_061_GS_dna_4"	
Adh	MAGPIEexon	CDS	2724534	2724951	0.028	-	2	transcript "dm_061_GS_dna_4"	
Adh	MAGPIEexon	CDS	2728123	2728429	0.993	-	1	transcript "dm_061_GS_dna_4"	
Adh	MAGPIEexon	CDS	2730499	2730656	0.016	-	0	transcript "dm_061_GS_dna_4"	
Adh	MAGPIEexon	CDS	2731305	2731640	0.984	+	2	transcript "dm_061_GS_dna_5"	
Adh	MAGPIEexon	CDS	2734869	2734987	0.963	+	2	transcript "dm_061_GS_dna_6"	
Adh	MAGPIEexon	CDS	2735831	2736108	0.957	+	1	transcript "dm_061_GS_dna_6"	
Adh	MAGPIEexon	CDS	2736795	2737021	0.470	+	2	transcript "dm_061_GS_dna_6"	
Adh	MAGPIEexon	CDS	2737320	2737427	0.629	+	2	transcript "dm_061_GS_dna_7"	
Adh	MAGPIEexon	CDS	2737640	2737731	0.811	+	1	transcript "dm_061_GS_dna_7"	
Adh	MAGPIEexon	CDS	2737873	2738237	0.468	+	0	transcript "dm_061_GS_dna_7"	
Adh	MAGPIEexon	CDS	2738403	2739461	0.996	+	2	transcript "dm_061_GS_dna_7"	
Adh	MAGPIEexon	CDS	2739531	2740039	0.999	+	2	transcript "dm_061_GS_dna_7"	
Adh	MAGPIEexon	CDS	2740542	2741090	0.889	+	2	transcript "dm_061_GS_dna_8"	
Adh	MAGPIEexon	CDS	2741387	2741956	0.860	-	1	transcript "dm_061_GS_dna_9"	
Adh	MAGPIEexon	CDS	2743611	2745122	0.999	+	2	transcript "dm_061_GS_dna_11"	
Adh	MAGPIEexon	CDS	2746815	2747453	0.964	-	0	transcript "dm_061_GS_dna_12"	
Adh	MAGPIEexon	CDS	2746815	2747453	0.964	-	0	transcript "dm_062_GS_dna_1"	
Adh	MAGPIEexon	CDS	2748132	2748572	0.963	-	0	transcript "dm_061_GS_dna_12"	
Adh	MAGPIEexon	CDS	2748132	2748572	0.964	-	0	transcript "dm_062_GS_dna_1"	
Adh	MAGPIEexon	CDS	2749658	2749696	0.282	+	1	transcript "dm_062_GS_dna_2"	
Adh	MAGPIEexon	CDS	2749753	2750868	0.885	+	0	transcript "dm_062_GS_dna_2"	
Adh	MAGPIEexon	CDS	2751337	2751465	0.976	-	2	transcript "dm_062_GS_dna_3"	
Adh	MAGPIEexon	CDS	2751521	2751736	0.450	-	1	transcript "dm_062_GS_dna_3"	
Adh	MAGPIEexon	CDS	2752612	2752742	0.999	+	0	transcript "dm_062_GS_dna_4"	
Adh	MAGPIEexon	CDS	2752822	2752985	0.999	+	0	transcript "dm_062_GS_dna_4"	
Adh	MAGPIEexon	CDS	2753042	2753322	0.768	+	1	transcript "dm_062_GS_dna_4"	
Adh	MAGPIEexon	CDS	2753382	2753565	0.989	+	2	transcript "dm_062_GS_dna_4"	
Adh	MAGPIEexon	CDS	2753620	2754004	0.994	+	0	transcript "dm_062_GS_dna_4"	
Adh	MAGPIEexon	CDS	2754057	2754364	0.721	+	2	transcript "dm_062_GS_dna_4"	
Adh	MAGPIEexon	CDS	2754423	2754595	0.697	+	2	transcript "dm_062_GS_dna_4"	
Adh	MAGPIEexon	CDS	2755219	2755580	0.997	-	0	transcript "dm_062_GS_dna_5"	
Adh	MAGPIEexon	CDS	2755775	2755883	0.940	-	0	transcript "dm_062_GS_dna_5"	
Adh	MAGPIEexon	CDS	2755954	2756022	0.867	-	2	transcript "dm_062_GS_dna_5"	
Adh	MAGPIEexon	CDS	2757391	2757589	.	+	0	transcript "dm_062_MP_dna_6"	
Adh	MAGPIEexon	CDS	2757658	2758391	.	+	0	transcript "dm_062_MP_dna_6"	
Adh	MAGPIEexon	CDS	2759163	2759190	.	-	2	transcript "dm_062_MP_dna_7a"	
Adh	MAGPIEexon	CDS	2759260	2759403	.	-	2	transcript "dm_062_MP_dna_7a"	
Adh	MAGPIEexon	CDS	2759527	2759639	.	-	0	transcript "dm_062_MP_dna_7a"	
Adh	MAGPIEexon	CDS	2759701	2759850	.	-	2	transcript "dm_062_MP_dna_7a"	
Adh	MAGPIEexon	CDS	2760361	2760672	.	+	0	transcript "dm_062_MP_dna_7"	
Adh	MAGPIEexon	CDS	2760766	2761087	.	+	0	transcript "dm_062_MP_dna_7"	
Adh	MAGPIEexon	CDS	2761141	2762087	.	+	0	transcript "dm_062_MP_dna_7"	
Adh	MAGPIEexon	CDS	2763693	2763968	.	-	0	transcript "dm_062_MP_dna_8"	
Adh	MAGPIEexon	CDS	2764030	2764118	.	-	0	transcript "dm_062_MP_dna_8"	
Adh	MAGPIEexon	CDS	2772220	2772430	.	-	1	transcript "dm_062_MP_dna_8"	
Adh	MAGPIEexon	CDS	2772600	2772777	.	-	2	transcript "dm_062_MP_dna_8"	
Adh	MAGPIEexon	CDS	2773593	2774287	.	-	1	transcript "dm_062_MP_dna_8"	
Adh	MAGPIEexon	CDS	2776429	2777295	0.919	+	0	transcript "dm_062_GS_dna_9"	
Adh	MAGPIEexon	CDS	2777390	2777609	0.989	-	0	transcript "dm_062_GS_dna_10"	
Adh	MAGPIEexon	CDS	2777672	2778342	0.998	-	2	transcript "dm_062_GS_dna_10"	
Adh	MAGPIEexon	CDS	2779883	2785491	0.976	-	2	transcript "dm_062_GS_dna_12"	
Adh	MAGPIEexon	CDS	2785552	2786724	0.999	-	2	transcript "dm_062_GS_dna_12"	
Adh	MAGPIEexon	CDS	2786788	2787069	0.001	-	2	transcript "dm_062_GS_dna_12"	
Adh	MAGPIEexon	CDS	2787432	2787885	0.061	-	2	transcript "dm_062_GS_dna_12"	
Adh	MAGPIEexon	CDS	2787948	2788341	0.995	-	2	transcript "dm_062_GS_dna_12"	
Adh	MAGPIEexon	CDS	2788407	2788474	0.013	-	1	transcript "dm_062_GS_dna_12"	
Adh	MAGPIEexon	CDS	2788569	2788684	0.007	-	1	transcript "dm_062_GS_dna_12"	
Adh	MAGPIEexon	CDS	2788808	2789082	0.449	-	2	transcript "dm_062_GS_dna_12"	
Adh	MAGPIEexon	CDS	2789143	2789471	0.347	-	0	transcript "dm_062_GS_dna_12"	
Adh	MAGPIEexon	CDS	2789812	2791516	0.017	-	1	transcript "dm_062_GS_dna_12"	
Adh	MAGPIEexon	CDS	2790007	2791516	0.116	-	1	transcript "dm_063_GS_dna_1"	
Adh	MAGPIEexon	CDS	2791870	2792011	0.027	-	1	transcript "dm_062_GS_dna_12"	
Adh	MAGPIEexon	CDS	2791870	2792011	0.116	-	1	transcript "dm_063_GS_dna_1"	
Adh	MAGPIEexon	CDS	2792082	2792601	0.999	-	2	transcript "dm_062_GS_dna_12"	
Adh	MAGPIEexon	CDS	2792082	2792601	0.999	-	2	transcript "dm_063_GS_dna_1"	
Adh	MAGPIEexon	CDS	2793626	2794950	0.530	-	2	transcript "dm_062_GS_dna_13"	
Adh	MAGPIEexon	CDS	2793626	2798713	0.998	-	1	transcript "dm_063_GS_dna_2"	
Adh	MAGPIEexon	CDS	2800793	2800913	0.911	+	1	transcript "dm_063_GS_dna_3"	
Adh	MAGPIEexon	CDS	2802395	2802813	0.966	+	1	transcript "dm_063_GS_dna_3"	
Adh	MAGPIEexon	CDS	2804442	2805730	0.918	-	1	transcript "dm_063_GS_dna_4"	
Adh	MAGPIEexon	CDS	2805800	2805812	0.816	-	0	transcript "dm_063_GS_dna_4"	
Adh	MAGPIEexon	CDS	2815178	2815829	0.991	+	1	transcript "dm_063_GS_dna_5"	
Adh	MAGPIEexon	CDS	2815894	2816001	0.277	+	0	transcript "dm_063_GS_dna_5"	
Adh	MAGPIEexon	CDS	2820072	2820194	0.602	+	2	transcript "dm_063_GS_dna_5"	
Adh	MAGPIEexon	CDS	2820862	2820926	0.337	+	0	transcript "dm_063_GS_dna_5"	
Adh	MAGPIEexon	CDS	2824416	2824622	0.723	-	0	transcript "dm_063_GS_dna_6"	
Adh	MAGPIEexon	CDS	2827707	2827908	0.949	-	2	transcript "dm_063_GS_dna_7"	
Adh	MAGPIEexon	CDS	2829637	2829731	0.991	-	0	transcript "dm_063_GS_dna_7"	
Adh	MAGPIEexon	CDS	2829951	2830165	0.024	-	1	transcript "dm_063_GS_dna_7"	
Adh	MAGPIEexon	CDS	2831482	2831676	0.020	-	2	transcript "dm_063_GS_dna_7"	
Adh	MAGPIEexon	CDS	2831700	2831950	0.028	-	1	transcript "dm_063_GS_dna_7"	
Adh	MAGPIEexon	CDS	2833489	2833753	0.030	-	1	transcript "dm_063_GS_dna_7"	
Adh	MAGPIEexon	CDS	2836812	2836843	0.020	-	1	transcript "dm_063_GS_dna_7"	
Adh	MAGPIEexon	CDS	2837445	2837627	0.425	+	2	transcript "dm_064_GS_dna_1"	
Adh	MAGPIEexon	CDS	2837417	2837676	0.059	-	2	transcript "dm_063_GS_dna_7"	
Adh	MAGPIEexon	CDS	2837705	2837761	0.206	-	1	transcript "dm_063_GS_dna_7"	
Adh	MAGPIEexon	CDS	2838064	2838226	0.428	-	1	transcript "dm_063_GS_dna_7"	
Adh	MAGPIEexon	CDS	2838730	2838822	0.517	-	2	transcript "dm_063_GS_dna_7"	
Adh	MAGPIEexon	CDS	2840422	2840655	0.246	+	0	transcript "dm_064_GS_dna_1"	
Adh	MAGPIEexon	CDS	2841156	2841390	0.462	+	2	transcript "dm_064_GS_dna_1"	
Adh	MAGPIEexon	CDS	2842430	2842744	0.239	+	1	transcript "dm_064_GS_dna_1"	
Adh	MAGPIEexon	CDS	2843232	2843386	0.401	+	2	transcript "dm_064_GS_dna_1"	
Adh	MAGPIEexon	CDS	2844829	2845138	0.393	-	1	transcript "dm_064_GS_dna_2"	
Adh	MAGPIEexon	CDS	2846003	2846091	0.891	-	2	transcript "dm_064_GS_dna_2"	
Adh	MAGPIEexon	CDS	2848166	2848283	0.707	+	1	transcript "dm_064_GS_dna_3"	
Adh	MAGPIEexon	CDS	2851811	2851936	0.786	+	1	transcript "dm_064_GS_dna_3"	
Adh	MAGPIEexon	CDS	2852313	2852590	0.967	+	2	transcript "dm_064_GS_dna_3"	
Adh	MAGPIEexon	CDS	2853736	2854099	0.990	-	1	transcript "dm_064_GS_dna_4"	
Adh	MAGPIEexon	CDS	2854197	2855213	0.494	-	0	transcript "dm_064_GS_dna_4"	
Adh	MAGPIEexon	CDS	2855254	2855387	0.365	-	0	transcript "dm_064_GS_dna_4"	
Adh	MAGPIEexon	CDS	2856104	2856535	0.444	-	1	transcript "dm_064_GS_dna_4"	
Adh	MAGPIEexon	CDS	2860250	2860489	0.951	-	1	transcript "dm_064_GS_dna_5"	
Adh	MAGPIEexon	CDS	2862924	2863295	0.054	+	2	transcript "dm_064_GS_dna_6"	
Adh	MAGPIEexon	CDS	2868689	2868910	0.029	+	1	transcript "dm_064_GS_dna_6"	
Adh	MAGPIEexon	CDS	2870618	2870720	0.447	+	1	transcript "dm_064_GS_dna_7"	
Adh	MAGPIEexon	CDS	2871302	2871404	0.610	+	1	transcript "dm_064_GS_dna_7"	
Adh	MAGPIEexon	CDS	2877379	2877553	0.334	+	0	transcript "dm_064_GS_dna_7"	
Adh	MAGPIEexon	CDS	2881476	2881811	0.975	+	2	transcript "dm_065_GS_dna_1"	
Adh	MAGPIEexon	CDS	2881476	2881811	0.985	+	2	transcript "dm_064_GS_dna_8"	
Adh	MAGPIEexon	CDS	2882072	2882405	0.760	+	1	transcript "dm_064_GS_dna_9"	
Adh	MAGPIEexon	CDS	2882072	2882405	0.761	+	1	transcript "dm_065_GS_dna_2"	
Adh	MAGPIEexon	CDS	2883602	2883864	0.882	+	1	transcript "dm_064_GS_dna_9"	
Adh	MAGPIEexon	CDS	2883602	2883864	0.883	+	1	transcript "dm_065_GS_dna_2"	
Adh	MAGPIEexon	CDS	2886321	2886429	0.897	-	2	transcript "dm_065_GS_dna_3"	
Adh	MAGPIEexon	CDS	2886895	2887013	0.908	-	0	transcript "dm_065_GS_dna_3"	
Adh	MAGPIEexon	CDS	2892477	2892704	0.549	-	0	transcript "dm_065_GS_dna_4"	
Adh	MAGPIEexon	CDS	2893582	2893668	0.794	-	2	transcript "dm_065_GS_dna_4"	
Adh	MAGPIEexon	CDS	2894587	2895247	.	+	0	transcript "dm_065_MP_dna_5"	
Adh	MAGPIEexon	CDS	2895319	2895977	.	+	0	transcript "dm_065_MP_dna_5"	
Adh	MAGPIEexon	CDS	2896655	2896763	.	+	1	transcript "dm_065_MP_dna_6"	
Adh	MAGPIEexon	CDS	2898444	2899001	.	+	2	transcript "dm_065_MP_dna_6"	
Adh	MAGPIEexon	CDS	2899061	2899716	.	+	1	transcript "dm_065_MP_dna_6"	
Adh	MAGPIEexon	CDS	2900448	2900565	.	+	2	transcript "dm_065_MP_dna_7"	
Adh	MAGPIEexon	CDS	2900634	2901185	.	+	2	transcript "dm_065_MP_dna_7"	
Adh	MAGPIEexon	CDS	2901452	2902107	.	+	1	transcript "dm_065_MP_dna_7"	
Adh	MAGPIEexon	CDS	2908693	2909016	0.848	+	0	transcript "dm_065_GS_dna_8"	
Adh	MAGPIEexon	CDS	2911056	2911181	0.838	+	2	transcript "dm_065_GS_dna_9"	
Adh	MAGPIEexon	CDS	2912991	2913284	0.821	+	2	transcript "dm_065_GS_dna_9"	
Adh	MAGPIEexon	CDS	2913888	2914123	0.508	-	1	transcript "dm_065_GS_dna_10"	
Adh	MAGPIEexon	CDS	2914738	2914949	0.312	-	0	transcript "dm_065_GS_dna_10"	
Adh	MAGPIEexon	CDS	2914999	2915129	0.173	-	0	transcript "dm_065_GS_dna_10"	
Adh	MAGPIEexon	CDS	2916879	2917012	.	-	1	transcript "dm_065_MP_dna_11"	
Adh	MAGPIEexon	CDS	2917311	2917504	.	-	1	transcript "dm_065_MP_dna_11"	
Adh	MAGPIEexon	CDS	2917751	2917988	.	-	0	transcript "dm_065_MP_dna_11"	
Adh	MAGPIEexon	CDS	2918253	2918513	.	-	0	transcript "dm_065_MP_dna_11"	
#
# compfly: 1. Took only CDS feature entries Jul 6 (MR)
#
#
#
Adh	MAGPIE	CDS	1	441	.	-	2	transcript "dm_001_MP_dna_1"	
Adh	MAGPIE	CDS	2379	2862	.	-	2	transcript "dm_001_MP_dna_1"	
Adh	MAGPIE	CDS	3225	3550	.	-	1	transcript "dm_001_MP_dna_1"	
Adh	MAGPIE	CDS	6718	7018	.	-	1	transcript "dm_001_MP_dna_1"	
Adh	MAGPIE	start_codon	7016	7018	.	-	1	transcript "dm_001_MP_dna_1"	
Adh	MAGPIE	start_codon	45358	45360	.	+	0	transcript "dm_003_MP_dna_8"	
Adh	MAGPIE	CDS	45358	45421	.	+	0	transcript "dm_003_MP_dna_8"	
Adh	MAGPIE	CDS	52555	52587	.	+	0	transcript "dm_003_MP_dna_8"	
Adh	MAGPIE	CDS	56136	58711	.	+	2	transcript "dm_002_MP_dna_2"	
Adh	MAGPIE	CDS	103543	103739	.	+	0	transcript "dm_003_MP_dna_8"	
Adh	MAGPIE	CDS	103808	104330	.	+	1	transcript "dm_003_MP_dna_8"	
Adh	MAGPIE	CDS	124458	124936	.	+	2	transcript "dm_003_MP_dna_8"	
Adh	MAGPIE	CDS	127146	127292	.	+	2	transcript "dm_003_MP_dna_8"	
Adh	MAGPIE	CDS	127771	127931	.	+	0	transcript "dm_003_MP_dna_8"	
Adh	MAGPIE	CDS	127991	128225	.	+	1	transcript "dm_003_MP_dna_8"	
Adh	MAGPIE	CDS	128296	129342	.	+	0	transcript "dm_003_MP_dna_8"	
Adh	MAGPIE	CDS	129401	129965	.	+	1	transcript "dm_003_MP_dna_8"	
Adh	MAGPIE	CDS	130136	130401	.	+	1	transcript "dm_003_MP_dna_8"	
Adh	MAGPIE	start_codon	274751	274753	.	+	1	transcript "dm_007_MP_dna_2"	
Adh	MAGPIE	CDS	274751	275848	.	+	1	transcript "dm_007_MP_dna_2"	
Adh	MAGPIE	start_codon	307965	307967	.	+	2	transcript "dm_007_MP_dna_10"	
Adh	MAGPIE	CDS	307965	309056	.	+	2	transcript "dm_007_MP_dna_10"	
Adh	MAGPIE	CDS	309110	309467	.	+	1	transcript "dm_007_MP_dna_10"	
Adh	MAGPIE	CDS	309530	310452	.	+	1	transcript "dm_007_MP_dna_10"	
Adh	MAGPIE	CDS	310517	311365	.	+	1	transcript "dm_007_MP_dna_10"	
Adh	MAGPIE	CDS	311428	312318	.	+	0	transcript "dm_007_MP_dna_10"	
Adh	MAGPIE	CDS	312387	313020	.	+	2	transcript "dm_007_MP_dna_10"	
Adh	MAGPIE	CDS	313086	313129	.	+	2	transcript "dm_007_MP_dna_10"	
Adh	MAGPIE	start_codon	315138	315140	.	+	2	transcript "dm_008_MP_dna_1"	
Adh	MAGPIE	CDS	315138	315899	.	+	2	transcript "dm_008_MP_dna_1"	
Adh	MAGPIE	CDS	316433	316800	.	+	1	transcript "dm_008_MP_dna_1"	
Adh	MAGPIE	CDS	316865	317462	.	+	1	transcript "dm_008_MP_dna_1"	
Adh	MAGPIE	stop_codon	317460	317462	.	+	2	transcript "dm_008_MP_dna_1"	
Adh	MAGPIE	stop_codon	317891	317893	.	-	1	transcript "dm_008_MP_dna_2"	
Adh	MAGPIE	CDS	317891	318548	.	-	0	transcript "dm_008_MP_dna_2"	
Adh	MAGPIE	CDS	318608	319430	.	-	0	transcript "dm_008_MP_dna_2"	
Adh	MAGPIE	CDS	319486	321442	.	-	1	transcript "dm_008_MP_dna_2"	
Adh	MAGPIE	start_codon	321440	321442	.	-	1	transcript "dm_008_MP_dna_2"	
Adh	MAGPIE	stop_codon	321967	321969	.	-	2	transcript "dm_008_MP_dna_3"	
Adh	MAGPIE	CDS	321967	323027	.	-	0	transcript "dm_008_MP_dna_3"	
Adh	MAGPIE	CDS	323097	323169	.	-	2	transcript "dm_008_MP_dna_3"	
Adh	MAGPIE	start_codon	323167	323169	.	-	2	transcript "dm_008_MP_dna_3"	
Adh	MAGPIE	start_codon	323788	323790	.	+	0	transcript "dm_008_MP_dna_4"	
Adh	MAGPIE	CDS	323788	324885	.	+	0	transcript "dm_008_MP_dna_4"	
Adh	MAGPIE	CDS	324939	325223	.	+	2	transcript "dm_008_MP_dna_4"	
Adh	MAGPIE	stop_codon	325221	325223	.	+	2	transcript "dm_008_MP_dna_4"	
Adh	MAGPIE	CDS	325240	325634	.	-	0	transcript "dm_008_MP_dna_5"	
Adh	MAGPIE	CDS	325689	326379	.	-	2	transcript "dm_008_MP_dna_5"	
Adh	MAGPIE	start_codon	326377	326379	.	-	2	transcript "dm_008_MP_dna_5"	
Adh	MAGPIE	start_codon	327175	327177	.	+	0	transcript "dm_008_MP_dna_6"	
Adh	MAGPIE	CDS	327175	328002	.	+	0	transcript "dm_008_MP_dna_6"	
Adh	MAGPIE	CDS	352084	354471	.	-	2	transcript "dm_008_MP_dna_14"	
Adh	MAGPIE	start_codon	400338	400340	.	+	2	transcript "dm_009_MP_dna_6"	
Adh	MAGPIE	CDS	400338	400923	.	+	2	transcript "dm_009_MP_dna_6"	
Adh	MAGPIE	CDS	401350	401713	.	+	0	transcript "dm_009_MP_dna_6"	
Adh	MAGPIE	CDS	401775	402341	.	+	2	transcript "dm_009_MP_dna_6"	
Adh	MAGPIE	CDS	402399	402539	.	+	2	transcript "dm_009_MP_dna_6"	
Adh	MAGPIE	CDS	402607	402780	.	+	0	transcript "dm_009_MP_dna_6"	
Adh	MAGPIE	start_codon	405952	405954	.	+	0	transcript "dm_010_MP_dna_1"	
Adh	MAGPIE	CDS	405952	406314	.	+	0	transcript "dm_010_MP_dna_1"	
Adh	MAGPIE	CDS	757457	757838	.	+	1	transcript "dm_019_MP_dna_1"	
Adh	MAGPIE	CDS	771955	772295	.	+	0	transcript "dm_019_MP_dna_1"	
Adh	MAGPIE	CDS	779692	781583	.	+	0	transcript "dm_019_MP_dna_1"	
Adh	MAGPIE	CDS	781886	782694	.	+	1	transcript "dm_019_MP_dna_1"	
Adh	MAGPIE	CDS	813291	814650	.	+	2	transcript "dm_019_MP_dna_1"	
Adh	MAGPIE	CDS	814726	814981	.	+	0	transcript "dm_019_MP_dna_1"	
Adh	MAGPIE	CDS	815046	815442	.	+	2	transcript "dm_019_MP_dna_1"	
Adh	MAGPIE	CDS	815528	817215	.	+	1	transcript "dm_019_MP_dna_1"	
Adh	MAGPIE	CDS	817273	818025	.	+	0	transcript "dm_019_MP_dna_1"	
Adh	MAGPIE	CDS	818086	818367	.	+	0	transcript "dm_019_MP_dna_1"	
Adh	MAGPIE	CDS	818447	818574	.	+	1	transcript "dm_019_MP_dna_1"	
Adh	MAGPIE	CDS	818633	819290	.	+	1	transcript "dm_019_MP_dna_1"	
Adh	MAGPIE	CDS	820171	820789	.	+	0	transcript "dm_019_MP_dna_1"	
Adh	MAGPIE	CDS	820846	820979	.	+	0	transcript "dm_019_MP_dna_1"	
Adh	MAGPIE	CDS	821037	821265	.	+	2	transcript "dm_019_MP_dna_1"	
Adh	MAGPIE	CDS	821333	821487	.	+	1	transcript "dm_019_MP_dna_1"	
Adh	MAGPIE	stop_codon	821485	821487	.	+	0	transcript "dm_019_MP_dna_1"	
Adh	MAGPIE	start_codon	851085	851087	.	+	2	transcript "dm_019_MP_dna_7"	
Adh	MAGPIE	CDS	851085	851190	.	+	2	transcript "dm_019_MP_dna_7"	
Adh	MAGPIE	CDS	851256	851436	.	+	2	transcript "dm_019_MP_dna_7"	
Adh	MAGPIE	CDS	851491	851673	.	+	0	transcript "dm_019_MP_dna_7"	
Adh	MAGPIE	CDS	851742	851919	.	+	2	transcript "dm_019_MP_dna_7"	
Adh	MAGPIE	CDS	855874	855922	.	+	0	transcript "dm_020_MP_dna_1"	
Adh	MAGPIE	CDS	855982	856031	.	+	0	transcript "dm_020_MP_dna_1"	
Adh	MAGPIE	CDS	856092	856876	.	+	2	transcript "dm_020_MP_dna_1"	
Adh	MAGPIE	CDS	856942	858029	.	+	0	transcript "dm_020_MP_dna_1"	
Adh	MAGPIE	CDS	858109	858341	.	+	0	transcript "dm_020_MP_dna_1"	
Adh	MAGPIE	CDS	858418	858966	.	+	0	transcript "dm_020_MP_dna_1"	
Adh	MAGPIE	CDS	872557	872818	.	-	1	transcript "dm_020_MP_dna_4"	
Adh	MAGPIE	CDS	872891	873131	.	-	0	transcript "dm_020_MP_dna_4"	
Adh	MAGPIE	CDS	873191	873321	.	-	2	transcript "dm_020_MP_dna_4"	
Adh	MAGPIE	CDS	873388	873527	.	-	0	transcript "dm_020_MP_dna_4"	
Adh	MAGPIE	CDS	873583	874093	.	-	1	transcript "dm_020_MP_dna_4"	
Adh	MAGPIE	CDS	874278	874541	.	-	0	transcript "dm_020_MP_dna_4"	
Adh	MAGPIE	CDS	874599	874870	.	-	1	transcript "dm_020_MP_dna_4"	
Adh	MAGPIE	start_codon	874868	874870	.	-	1	transcript "dm_020_MP_dna_4"	
Adh	MAGPIE	CDS	959530	959754	.	-	2	transcript "dm_022_MP_dna_2"	
Adh	MAGPIE	CDS	959747	959788	.	-	1	transcript "dm_022_MP_dna_2"	
Adh	MAGPIE	CDS	961228	962781	.	-	2	transcript "dm_022_MP_dna_2"	
Adh	MAGPIE	start_codon	984981	984983	.	+	2	transcript "dm_022_MP_dna_5"	
Adh	MAGPIE	CDS	984981	985070	.	+	2	transcript "dm_022_MP_dna_5"	
Adh	MAGPIE	CDS	985373	986896	.	+	1	transcript "dm_022_MP_dna_5"	
Adh	MAGPIE	CDS	1104531	1104965	.	-	0	transcript "dm_025_MP_dna_3"	
Adh	MAGPIE	start_codon	1104963	1104965	.	-	0	transcript "dm_025_MP_dna_3"	
Adh	MAGPIE	start_codon	1110074	1110077	.	+	1	transcript "dm_025_MP_dna_4a"	
Adh	MAGPIE	CDS	1110074	1110172	.	+	1	transcript "dm_025_MP_dna_4a"	
Adh	MAGPIE	CDS	1110238	1110642	.	+	0	transcript "dm_025_MP_dna_4a"	
Adh	MAGPIE	CDS	1110713	1110979	.	+	1	transcript "dm_025_MP_dna_4a"	
Adh	MAGPIE	stop_codon	1110973	1110979	.	+	0	transcript "dm_025_MP_dna_4a"	
Adh	MAGPIE	start_codon	1111283	1111285	.	+	1	transcript "dm_025_MP_dna_4"	
Adh	MAGPIE	CDS	1111283	1111378	.	+	1	transcript "dm_025_MP_dna_4"	
Adh	MAGPIE	CDS	1111805	1112209	.	+	1	transcript "dm_025_MP_dna_4"	
Adh	MAGPIE	CDS	1112261	1112578	.	+	1	transcript "dm_025_MP_dna_4"	
Adh	MAGPIE	CDS	1141566	1143953	.	-	0	transcript "dm_026_MP_dna_4"	
Adh	MAGPIE	CDS	1294081	1298310	.	-	2	transcript "dm_029_MP_dna_9"	
Adh	MAGPIE	start_codon	1298308	1298310	.	-	2	transcript "dm_029_MP_dna_9"	
Adh	MAGPIE	CDS	1368951	1369282	.	-	1	transcript "dm_031_MP_dna_3"	
Adh	MAGPIE	start_codon	1369280	1369282	.	-	1	transcript "dm_031_MP_dna_3"	
Adh	MAGPIE	CDS	1372020	1372351	.	-	1	transcript "dm_031_MP_dna_4"	
Adh	MAGPIE	start_codon	1372349	1372351	.	-	1	transcript "dm_031_MP_dna_4"	
Adh	MAGPIE	start_codon	1499670	1499672	.	+	2	transcript "dm_034_MP_dna_6"	
Adh	MAGPIE	CDS	1499670	1500870	.	+	2	transcript "dm_034_MP_dna_6"	
Adh	MAGPIE	CDS	1500928	1501010	.	+	0	transcript "dm_034_MP_dna_6"	
Adh	MAGPIE	start_codon	1529588	1529590	.	+	1	transcript "dm_034_MP_dna_8"	
Adh	MAGPIE	CDS	1529588	1529971	.	+	1	transcript "dm_034_MP_dna_8"	
Adh	MAGPIE	CDS	1530746	1531626	.	+	1	transcript "dm_034_MP_dna_8"	
Adh	MAGPIE	CDS	1531685	1531892	.	+	1	transcript "dm_034_MP_dna_8"	
Adh	MAGPIE	CDS	1531958	1532269	.	+	1	transcript "dm_034_MP_dna_8"	
Adh	MAGPIE	stop_codon	1549142	1549144	.	-	1	transcript "dm_035_MP_dna_4"	
Adh	MAGPIE	CDS	1549142	1550017	.	-	1	transcript "dm_035_MP_dna_4"	
Adh	MAGPIE	CDS	1550084	1550149	.	-	1	transcript "dm_035_MP_dna_4"	
Adh	MAGPIE	start_codon	1550147	1550149	.	-	1	transcript "dm_035_MP_dna_4"	
Adh	MAGPIE	start_codon	1558057	1558059	.	+	0	transcript "dm_035_MP_dna_6"	
Adh	MAGPIE	CDS	1558057	1558080	.	+	0	transcript "dm_035_MP_dna_6"	
Adh	MAGPIE	CDS	1558134	1558521	.	+	2	transcript "dm_035_MP_dna_6"	
Adh	MAGPIE	CDS	1561989	1562278	.	+	2	transcript "dm_035_MP_dna_6"	
Adh	MAGPIE	CDS	1562338	1563081	.	+	0	transcript "dm_035_MP_dna_6"	
Adh	MAGPIE	CDS	1563140	1563353	.	+	1	transcript "dm_035_MP_dna_6"	
Adh	MAGPIE	CDS	1563418	1563689	.	+	0	transcript "dm_035_MP_dna_6"	
Adh	MAGPIE	CDS	1563761	1563814	.	+	1	transcript "dm_035_MP_dna_6"	
Adh	MAGPIE	stop_codon	1563812	1563814	.	+	1	transcript "dm_035_MP_dna_6"	
Adh	MAGPIE	start_codon	1603541	1603543	.	+	1	transcript "dm_036_MP_dna_4"	
Adh	MAGPIE	CDS	1603541	1603885	.	+	1	transcript "dm_036_MP_dna_4"	
Adh	MAGPIE	CDS	1603951	1605404	.	+	0	transcript "dm_036_MP_dna_4"	
Adh	MAGPIE	CDS	1605651	1606718	.	+	2	transcript "dm_036_MP_dna_4"	
Adh	MAGPIE	CDS	1606791	1607142	.	+	2	transcript "dm_036_MP_dna_4"	
Adh	MAGPIE	CDS	1607205	1607306	.	+	2	transcript "dm_036_MP_dna_4"	
Adh	MAGPIE	start_codon	1823746	1823748	.	+	0	transcript "dm_041_MP_dna_6"	
Adh	MAGPIE	CDS	1823746	1825158	.	+	0	transcript "dm_041_MP_dna_6"	
Adh	MAGPIE	CDS	1966586	1967758	.	-	1	transcript "dm_044_MP_dna_5"	
Adh	MAGPIE	start_codon	1967756	1967758	.	-	1	transcript "dm_044_MP_dna_5"	
Adh	MAGPIE	CDS	2078114	2081293	.	+	1	transcript "dm_047_MP_dna_3"	
Adh	MAGPIE	CDS	2180707	2180982	.	-	2	transcript "dm_049_MP_dna_5"	
Adh	MAGPIE	CDS	2181100	2181325	.	-	1	transcript "dm_049_MP_dna_5"	
Adh	MAGPIE	stop_codon	2182496	2182498	.	-	1	transcript "dm_049_MP_dna_8a"	
Adh	MAGPIE	CDS	2181392	2182662	.	-	2	transcript "dm_049_MP_dna_5"	
Adh	MAGPIE	CDS	2182496	2182662	.	-	2	transcript "dm_049_MP_dna_8a"	
Adh	MAGPIE	CDS	2182828	2182863	.	-	2	transcript "dm_049_MP_dna_5"	
Adh	MAGPIE	start_codon	2182861	2182863	.	-	2	transcript "dm_049_MP_dna_5"	
Adh	MAGPIE	CDS	2189454	2189790	.	-	2	transcript "dm_049_MP_dna_8a"	
Adh	MAGPIE	CDS	2192598	2192617	.	-	1	transcript "dm_049_MP_dna_8a"	
Adh	MAGPIE	start_codon	2192615	2192617	.	-	1	transcript "dm_049_MP_dna_8a"	
Adh	MAGPIE	stop_codon	2208922	2208924	.	-	2	transcript "dm_050_MP_dna_2"	
Adh	MAGPIE	CDS	2208922	2209531	.	-	1	transcript "dm_050_MP_dna_2"	
Adh	MAGPIE	CDS	2209593	2209904	.	-	0	transcript "dm_050_MP_dna_2"	
Adh	MAGPIE	CDS	2209967	2211186	.	-	2	transcript "dm_050_MP_dna_2"	
Adh	MAGPIE	CDS	2211243	2211671	.	-	0	transcript "dm_050_MP_dna_2"	
Adh	MAGPIE	CDS	2212036	2212168	.	-	1	transcript "dm_050_MP_dna_2"	
Adh	MAGPIE	CDS	2212228	2212394	.	-	0	transcript "dm_050_MP_dna_2"	
Adh	MAGPIE	start_codon	2212392	2212394	.	-	0	transcript "dm_050_MP_dna_2"	
Adh	MAGPIE	start_codon	2493314	2493316	.	+	1	transcript "dm_056_MP_dna_5"	
Adh	MAGPIE	CDS	2493314	2493620	.	+	1	transcript "dm_056_MP_dna_5"	
Adh	MAGPIE	CDS	2493682	2493731	.	+	0	transcript "dm_056_MP_dna_5"	
Adh	MAGPIE	CDS	2494047	2494116	.	+	2	transcript "dm_056_MP_dna_5"	
Adh	MAGPIE	CDS	2494180	2494259	.	+	0	transcript "dm_056_MP_dna_5"	
Adh	MAGPIE	CDS	2494325	2494651	.	+	1	transcript "dm_056_MP_dna_5"	
Adh	MAGPIE	CDS	2495100	2495225	.	+	2	transcript "dm_056_MP_dna_5"	
Adh	MAGPIE	CDS	2495286	2495667	.	+	2	transcript "dm_056_MP_dna_5"	
Adh	MAGPIE	CDS	2495861	2496988	.	+	1	transcript "dm_056_MP_dna_5"	
Adh	MAGPIE	CDS	2497217	2497464	.	+	1	transcript "dm_056_MP_dna_5"	
Adh	MAGPIE	CDS	2505534	2505597	.	+	2	transcript "dm_057_MP_dna_2"	
Adh	MAGPIE	CDS	2524357	2524565	.	+	0	transcript "dm_057_MP_dna_2"	
Adh	MAGPIE	CDS	2525929	2526064	.	+	0	transcript "dm_057_MP_dna_2"	
Adh	MAGPIE	CDS	2527415	2527548	.	+	1	transcript "dm_057_MP_dna_2"	
Adh	MAGPIE	CDS	2529073	2529195	.	+	0	transcript "dm_057_MP_dna_2"	
Adh	MAGPIE	CDS	2529260	2529455	.	+	1	transcript "dm_057_MP_dna_2"	
Adh	MAGPIE	CDS	2529735	2530156	.	+	2	transcript "dm_057_MP_dna_2"	
Adh	MAGPIE	start_codon	2590910	2590912	.	+	1	transcript "dm_058_MP_dna_6"	
Adh	MAGPIE	CDS	2590910	2595141	.	+	1	transcript "dm_058_MP_dna_6"	
Adh	MAGPIE	CDS	2604868	2608047	.	-	2	transcript "dm_058_MP_dna_9"	
Adh	MAGPIE	start_codon	2619967	2619969	.	+	0	transcript "dm_059_MP_dna_1"	
Adh	MAGPIE	CDS	2619967	2620307	.	+	0	transcript "dm_059_MP_dna_1"	
Adh	MAGPIE	CDS	2621231	2622507	.	+	1	transcript "dm_059_MP_dna_1"	
Adh	MAGPIE	CDS	2622578	2622803	.	+	1	transcript "dm_059_MP_dna_1"	
Adh	MAGPIE	CDS	2622977	2623082	.	+	1	transcript "dm_059_MP_dna_1"	
Adh	MAGPIE	CDS	2623316	2623455	.	+	1	transcript "dm_059_MP_dna_1"	
Adh	MAGPIE	CDS	2623675	2623781	.	+	0	transcript "dm_059_MP_dna_1"	
Adh	MAGPIE	CDS	2624114	2624266	.	+	1	transcript "dm_059_MP_dna_1"	
Adh	MAGPIE	CDS	2624694	2624875	.	+	2	transcript "dm_059_MP_dna_1"	
Adh	MAGPIE	CDS	2624976	2625495	.	+	2	transcript "dm_059_MP_dna_1"	
Adh	MAGPIE	CDS	2625559	2625784	.	+	0	transcript "dm_059_MP_dna_1"	
Adh	MAGPIE	CDS	2625851	2626061	.	+	1	transcript "dm_059_MP_dna_1"	
Adh	MAGPIE	CDS	2626124	2626333	.	+	1	transcript "dm_059_MP_dna_1"	
Adh	MAGPIE	CDS	2626392	2626510	.	+	2	transcript "dm_059_MP_dna_1"	
Adh	MAGPIE	CDS	2626595	2626653	.	+	1	transcript "dm_059_MP_dna_1"	
Adh	MAGPIE	CDS	2627634	2627751	.	+	2	transcript "dm_059_MP_dna_1"	
Adh	MAGPIE	CDS	2628166	2628295	.	+	0	transcript "dm_059_MP_dna_1"	
Adh	MAGPIE	CDS	2628460	2628626	.	+	0	transcript "dm_059_MP_dna_1"	
Adh	MAGPIE	CDS	2628718	2628805	.	+	0	transcript "dm_059_MP_dna_1"	
Adh	MAGPIE	CDS	2629398	2629505	.	+	2	transcript "dm_059_MP_dna_1"	
Adh	MAGPIE	CDS	2632038	2632090	.	+	2	transcript "dm_059_MP_dna_1"	
Adh	MAGPIE	CDS	2632152	2632298	.	+	2	transcript "dm_059_MP_dna_1"	
Adh	MAGPIE	CDS	2632363	2632834	.	+	0	transcript "dm_059_MP_dna_1"	
Adh	MAGPIE	CDS	2632889	2632972	.	+	1	transcript "dm_059_MP_dna_1"	
Adh	MAGPIE	CDS	2633028	2633093	.	+	2	transcript "dm_059_MP_dna_1"	
Adh	MAGPIE	CDS	2633149	2633337	.	+	0	transcript "dm_059_MP_dna_1"	
Adh	MAGPIE	CDS	2633397	2633645	.	+	2	transcript "dm_059_MP_dna_1"	
Adh	MAGPIE	CDS	2633706	2634365	.	+	2	transcript "dm_059_MP_dna_1"	
Adh	MAGPIE	CDS	2634452	2634885	.	+	1	transcript "dm_059_MP_dna_1"	
Adh	MAGPIE	CDS	2635370	2635410	.	+	1	transcript "dm_059_MP_dna_1"	
Adh	MAGPIE	CDS	2638284	2638414	.	+	2	transcript "dm_059_MP_dna_1"	
Adh	MAGPIE	CDS	2638470	2639006	.	+	2	transcript "dm_059_MP_dna_1"	
Adh	MAGPIE	CDS	2696335	2696446	.	-	1	transcript "dm_060_MP_dna_7"	
Adh	MAGPIE	CDS	2696513	2696664	.	-	2	transcript "dm_060_MP_dna_7"	
Adh	MAGPIE	CDS	2697876	2698028	.	-	0	transcript "dm_060_MP_dna_7"	
Adh	MAGPIE	CDS	2698091	2698210	.	-	1	transcript "dm_060_MP_dna_7"	
Adh	MAGPIE	start_codon	2698208	2698210	.	-	1	transcript "dm_060_MP_dna_7"	
Adh	MAGPIE	CDS	2709485	2710765	.	-	1	transcript "dm_061_MP_dna_2"	
Adh	MAGPIE	start_codon	2710763	2710765	.	-	1	transcript "dm_061_MP_dna_2"	
Adh	MAGPIE	start_codon	2757391	2757393	.	+	0	transcript "dm_062_MP_dna_6"	
Adh	MAGPIE	CDS	2757391	2757589	.	+	0	transcript "dm_062_MP_dna_6"	
Adh	MAGPIE	CDS	2757658	2758391	.	+	0	transcript "dm_062_MP_dna_6"	
Adh	MAGPIE	stop_codon	2759163	2759165	.	-	0	transcript "dm_062_MP_dna_7a"	
Adh	MAGPIE	CDS	2759163	2759190	.	-	2	transcript "dm_062_MP_dna_7a"	
Adh	MAGPIE	CDS	2759260	2759403	.	-	2	transcript "dm_062_MP_dna_7a"	
Adh	MAGPIE	CDS	2759527	2759639	.	-	0	transcript "dm_062_MP_dna_7a"	
Adh	MAGPIE	CDS	2759701	2759850	.	-	2	transcript "dm_062_MP_dna_7a"	
Adh	MAGPIE	start_codon	2759848	2759850	.	-	2	transcript "dm_062_MP_dna_7a"	
Adh	MAGPIE	start_codon	2760361	2760363	.	+	0	transcript "dm_062_MP_dna_7"	
Adh	MAGPIE	CDS	2760361	2760672	.	+	0	transcript "dm_062_MP_dna_7"	
Adh	MAGPIE	CDS	2760766	2761087	.	+	0	transcript "dm_062_MP_dna_7"	
Adh	MAGPIE	CDS	2761141	2762087	.	+	0	transcript "dm_062_MP_dna_7"	
Adh	MAGPIE	CDS	2763693	2763968	.	-	0	transcript "dm_062_MP_dna_8"	
Adh	MAGPIE	CDS	2764030	2764118	.	-	0	transcript "dm_062_MP_dna_8"	
Adh	MAGPIE	CDS	2772220	2772430	.	-	1	transcript "dm_062_MP_dna_8"	
Adh	MAGPIE	CDS	2772600	2772777	.	-	2	transcript "dm_062_MP_dna_8"	
Adh	MAGPIE	CDS	2773593	2774287	.	-	1	transcript "dm_062_MP_dna_8"	
Adh	MAGPIE	start_codon	2774285	2774287	.	-	1	transcript "dm_062_MP_dna_8"	
Adh	MAGPIE	start_codon	2894587	2894589	.	+	0	transcript "dm_065_MP_dna_5"	
Adh	MAGPIE	CDS	2894587	2895247	.	+	0	transcript "dm_065_MP_dna_5"	
Adh	MAGPIE	CDS	2895319	2895977	.	+	0	transcript "dm_065_MP_dna_5"	
Adh	MAGPIE	start_codon	2896655	2896657	.	+	1	transcript "dm_065_MP_dna_6"	
Adh	MAGPIE	CDS	2896655	2896763	.	+	1	transcript "dm_065_MP_dna_6"	
Adh	MAGPIE	CDS	2898444	2899001	.	+	2	transcript "dm_065_MP_dna_6"	
Adh	MAGPIE	CDS	2899061	2899716	.	+	1	transcript "dm_065_MP_dna_6"	
Adh	MAGPIE	start_codon	2900448	2900450	.	+	2	transcript "dm_065_MP_dna_7"	
Adh	MAGPIE	CDS	2900448	2900565	.	+	2	transcript "dm_065_MP_dna_7"	
Adh	MAGPIE	CDS	2900634	2901185	.	+	2	transcript "dm_065_MP_dna_7"	
Adh	MAGPIE	CDS	2901452	2902107	.	+	1	transcript "dm_065_MP_dna_7"	
Adh	MAGPIE	stop_codon	2902105	2902107	.	+	0	transcript "dm_065_MP_dna_7"	
Adh	MAGPIE	CDS	2916879	2917012	.	-	1	transcript "dm_065_MP_dna_11"	
Adh	MAGPIE	CDS	2917311	2917504	.	-	1	transcript "dm_065_MP_dna_11"	
Adh	MAGPIE	CDS	2917751	2917988	.	-	0	transcript "dm_065_MP_dna_11"	
Adh	MAGPIE	CDS	2918253	2918513	.	-	0	transcript "dm_065_MP_dna_11"	
##gff-version 1
##Genie  pure statistics Submission 1
##date 99-7-23
#
# compfly: 1. Removed all TSS entries
#
#
Adh	Genie	CDS	12	58	-8.893800	-	0	transcript "1"
Adh	Genie	stop_codon	12	14	0	-	0	transcript "1"
Adh	Genie	CDS	124	441	25.605000	-	0	transcript "1"
Adh	Genie	CDS	2379	2862	73.384000	-	0	transcript "1"
Adh	Genie	CDS	3225	3452	44.678000	-	0	transcript "1"
Adh	Genie	start_codon	3450	3452	0	-	0	transcript "1"
Adh	Genie	CDS	6353	6378	-10.856000	-	0	transcript "2"
Adh	Genie	stop_codon	6353	6355	0	-	0	transcript "2"
Adh	Genie	CDS	6718	7051	60.438000	-	0	transcript "2"
Adh	Genie	start_codon	7049	7051	0	-	0	transcript "2"
Adh	Genie	CDS	21599	21988	9.333500	+	0	transcript "3"
Adh	Genie	start_codon	21599	21601	0	+	0	transcript "3"
Adh	Genie	stop_codon	21986	21988	0	+	0	transcript "3"
Adh	Genie	CDS	29156	29479	52.366000	-	0	transcript "4"
Adh	Genie	stop_codon	29156	29158	0	-	0	transcript "4"
Adh	Genie	start_codon	29477	29479	0	-	0	transcript "4"
Adh	Genie	CDS	34783	34822	-1.418400	+	0	transcript "5"
Adh	Genie	start_codon	34783	34785	0	+	0	transcript "5"
Adh	Genie	CDS	34884	35332	38.456000	+	1	transcript "5"
Adh	Genie	stop_codon	35330	35332	0	+	0	transcript "5"
Adh	Genie	CDS	35433	35749	14.862000	-	0	transcript "6"
Adh	Genie	stop_codon	35433	35435	0	-	0	transcript "6"
Adh	Genie	CDS	35938	36226	23.090000	-	0	transcript "6"
Adh	Genie	start_codon	36224	36226	0	-	0	transcript "6"
Adh	Genie	CDS	36488	37315	72.179000	+	0	transcript "7"
Adh	Genie	start_codon	36488	36490	0	+	0	transcript "7"
Adh	Genie	stop_codon	37313	37315	0	+	0	transcript "7"
Adh	Genie	CDS	89305	90750	81.106000	-	0	transcript "8"
Adh	Genie	stop_codon	89305	89307	0	-	0	transcript "8"
Adh	Genie	start_codon	90748	90750	0	-	0	transcript "8"
Adh	Genie	CDS	93123	93698	15.417000	-	0	transcript "9"
Adh	Genie	stop_codon	93123	93125	0	-	0	transcript "9"
Adh	Genie	start_codon	93696	93698	0	-	0	transcript "9"
Adh	Genie	CDS	103793	104344	20.593000	+	0	transcript "56"
Adh	Genie	start_codon	103793	103795	0	+	0	transcript "56"
Adh	Genie	stop_codon	104342	104344	0	+	0	transcript "56"
Adh	Genie	CDS	117056	117107	7.713200	+	0	transcript "10"
Adh	Genie	start_codon	117056	117058	0	+	0	transcript "10"
Adh	Genie	CDS	117406	117527	10.511000	+	1	transcript "10"
Adh	Genie	stop_codon	117525	117527	0	+	0	transcript "10"
Adh	Genie	CDS	124325	124954	68.934000	+	0	transcript "11"
Adh	Genie	start_codon	124325	124327	0	+	0	transcript "11"
Adh	Genie	stop_codon	124952	124954	0	+	0	transcript "11"
Adh	Genie	CDS	126817	126858	0.155620	+	0	transcript "12"
Adh	Genie	start_codon	126817	126819	0	+	0	transcript "12"
Adh	Genie	CDS	127146	127292	9.950700	+	0	transcript "12"
Adh	Genie	CDS	127771	127931	2.274300	+	0	transcript "12"
Adh	Genie	CDS	127991	128225	30.076000	+	0	transcript "12"
Adh	Genie	CDS	128296	129342	131.900000	+	0	transcript "12"
Adh	Genie	CDS	129401	129965	88.903000	+	0	transcript "12"
Adh	Genie	CDS	130136	130401	31.158000	+	1	transcript "12"
Adh	Genie	stop_codon	130399	130401	0	+	0	transcript "12"
Adh	Genie	CDS	131015	131248	41.281000	+	0	transcript "13"
Adh	Genie	start_codon	131015	131017	0	+	0	transcript "13"
Adh	Genie	stop_codon	131246	131248	0	+	0	transcript "13"
Adh	Genie	CDS	133458	133548	4.549900	-	0	transcript "14"
Adh	Genie	stop_codon	133458	133460	0	-	0	transcript "14"
Adh	Genie	CDS	133612	134233	71.023000	-	1	transcript "14"
Adh	Genie	CDS	134862	134967	11.918000	-	0	transcript "14"
Adh	Genie	start_codon	134965	134967	0	-	0	transcript "14"
Adh	Genie	CDS	159578	159874	37.047000	+	0	transcript "15"
Adh	Genie	start_codon	159578	159580	0	+	0	transcript "15"
Adh	Genie	CDS	161727	162105	31.487000	+	0	transcript "15"
Adh	Genie	CDS	162442	162557	10.899000	+	1	transcript "15"
Adh	Genie	CDS	162616	163137	79.679000	+	0	transcript "15"
Adh	Genie	CDS	163297	163527	38.365000	+	0	transcript "15"
Adh	Genie	stop_codon	163525	163527	0	+	0	transcript "15"
Adh	Genie	CDS	163992	164417	27.239000	+	0	transcript "16"
Adh	Genie	start_codon	163992	163994	0	+	0	transcript "16"
Adh	Genie	stop_codon	164415	164417	0	+	0	transcript "16"
Adh	Genie	CDS	181255	181409	4.814000	-	0	transcript "17"
Adh	Genie	stop_codon	181255	181257	0	-	0	transcript "17"
Adh	Genie	CDS	183107	183551	44.401000	-	0	transcript "17"
Adh	Genie	CDS	183600	183635	-2.067600	-	0	transcript "17"
Adh	Genie	CDS	183699	183764	-0.591140	-	0	transcript "17"
Adh	Genie	CDS	183835	184040	21.644000	-	0	transcript "17"
Adh	Genie	CDS	184241	184282	-0.391800	-	0	transcript "17"
Adh	Genie	CDS	184388	184409	-1.916300	-	0	transcript "17"
Adh	Genie	start_codon	184407	184409	0	-	0	transcript "17"
Adh	Genie	CDS	202128	202646	35.713000	+	0	transcript "57"
Adh	Genie	start_codon	202128	202130	0	+	0	transcript "57"
Adh	Genie	CDS	202700	204199	134.440000	+	0	transcript "57"
Adh	Genie	stop_codon	204197	204199	0	+	0	transcript "57"
Adh	Genie	CDS	216144	216761	72.615000	-	0	transcript "18"
Adh	Genie	stop_codon	216144	216146	0	-	0	transcript "18"
Adh	Genie	CDS	216820	217188	38.888000	-	0	transcript "18"
Adh	Genie	start_codon	217186	217188	0	-	0	transcript "18"
Adh	Genie	CDS	229944	230462	96.650000	+	0	transcript "19"
Adh	Genie	start_codon	229944	229946	0	+	0	transcript "19"
Adh	Genie	stop_codon	230460	230462	0	+	0	transcript "19"
Adh	Genie	CDS	265048	265063	-3.109800	+	0	transcript "20"
Adh	Genie	start_codon	265048	265050	0	+	0	transcript "20"
Adh	Genie	CDS	265122	266322	102.600000	+	1	transcript "20"
Adh	Genie	CDS	266392	266619	9.524000	+	0	transcript "20"
Adh	Genie	CDS	266684	266867	0.802840	+	0	transcript "20"
Adh	Genie	CDS	266935	267073	3.253500	+	0	transcript "20"
Adh	Genie	CDS	267134	267234	1.168400	+	1	transcript "20"
Adh	Genie	stop_codon	267232	267234	0	+	0	transcript "20"
Adh	Genie	CDS	267633	267656	2.325000	+	0	transcript "21"
Adh	Genie	start_codon	267633	267635	0	+	0	transcript "21"
Adh	Genie	CDS	267912	268061	1.426700	+	0	transcript "21"
Adh	Genie	stop_codon	268059	268061	0	+	0	transcript "21"
Adh	Genie	CDS	268751	268798	1.940200	-	0	transcript "22"
Adh	Genie	stop_codon	268751	268753	0	-	0	transcript "22"
Adh	Genie	CDS	269006	269157	16.212000	-	0	transcript "22"
Adh	Genie	CDS	269222	269559	45.070000	-	0	transcript "22"
Adh	Genie	CDS	269629	269907	9.801500	-	1	transcript "22"
Adh	Genie	CDS	270235	270314	6.550500	-	1	transcript "22"
Adh	Genie	start_codon	270312	270314	0	-	0	transcript "22"
Adh	Genie	CDS	274751	275848	167.190000	+	0	transcript "23"
Adh	Genie	start_codon	274751	274753	0	+	0	transcript "23"
Adh	Genie	stop_codon	275846	275848	0	+	0	transcript "23"
Adh	Genie	CDS	276361	276696	29.297000	-	0	transcript "24"
Adh	Genie	stop_codon	276361	276363	0	-	0	transcript "24"
Adh	Genie	CDS	276748	277188	38.485000	-	0	transcript "24"
Adh	Genie	start_codon	277186	277188	0	-	0	transcript "24"
Adh	Genie	CDS	277921	278103	6.440000	+	0	transcript "25"
Adh	Genie	start_codon	277921	277923	0	+	0	transcript "25"
Adh	Genie	CDS	278222	278345	-4.638900	+	0	transcript "25"
Adh	Genie	CDS	278537	278737	10.413000	+	1	transcript "25"
Adh	Genie	CDS	278802	279272	20.087000	+	1	transcript "25"
Adh	Genie	CDS	279548	279726	-3.015900	+	1	transcript "25"
Adh	Genie	CDS	280031	280247	11.078000	+	0	transcript "25"
Adh	Genie	CDS	280310	280610	19.682000	+	1	transcript "25"
Adh	Genie	CDS	280674	280986	16.831000	+	0	transcript "25"
Adh	Genie	CDS	281051	281202	-3.583300	+	0	transcript "25"
Adh	Genie	CDS	281264	281447	-9.390000	+	0	transcript "25"
Adh	Genie	CDS	281550	281787	16.961000	+	0	transcript "25"
Adh	Genie	CDS	281848	282471	26.817000	+	1	transcript "25"
Adh	Genie	CDS	282539	283541	67.621000	+	1	transcript "25"
Adh	Genie	CDS	283608	284052	28.347000	+	0	transcript "25"
Adh	Genie	stop_codon	284050	284052	0	+	0	transcript "25"
Adh	Genie	CDS	284770	284915	10.180000	+	0	transcript "26"
Adh	Genie	start_codon	284770	284772	0	+	0	transcript "26"
Adh	Genie	CDS	284969	285346	45.932000	+	0	transcript "26"
Adh	Genie	CDS	285416	286886	123.730000	+	0	transcript "26"
Adh	Genie	stop_codon	286884	286886	0	+	0	transcript "26"
Adh	Genie	CDS	287599	288379	102.040000	+	0	transcript "27"
Adh	Genie	start_codon	287599	287601	0	+	0	transcript "27"
Adh	Genie	CDS	288647	292689	446.560000	+	1	transcript "27"
Adh	Genie	CDS	292759	292896	4.791100	+	0	transcript "27"
Adh	Genie	stop_codon	292894	292896	0	+	0	transcript "27"
Adh	Genie	CDS	302508	302718	14.770000	+	0	transcript "58"
Adh	Genie	start_codon	302508	302510	0	+	0	transcript "58"
Adh	Genie	CDS	302786	303405	88.331000	+	1	transcript "58"
Adh	Genie	stop_codon	303403	303405	0	+	0	transcript "58"
Adh	Genie	CDS	303960	304272	1.287300	-	0	transcript "59"
Adh	Genie	stop_codon	303960	303962	0	-	0	transcript "59"
Adh	Genie	CDS	304330	305201	27.368000	-	1	transcript "59"
Adh	Genie	start_codon	305199	305201	0	-	0	transcript "59"
Adh	Genie	CDS	305396	305516	12.439000	+	0	transcript "60"
Adh	Genie	start_codon	305396	305398	0	+	0	transcript "60"
Adh	Genie	CDS	305577	305737	7.320600	+	1	transcript "60"
Adh	Genie	CDS	305803	306108	27.083000	+	0	transcript "60"
Adh	Genie	CDS	306230	306385	12.276000	+	0	transcript "60"
Adh	Genie	stop_codon	306383	306385	0	+	0	transcript "60"
Adh	Genie	CDS	306476	306985	21.445000	-	0	transcript "61"
Adh	Genie	stop_codon	306476	306478	0	-	0	transcript "61"
Adh	Genie	start_codon	306983	306985	0	-	0	transcript "61"
Adh	Genie	CDS	307965	309056	167.220000	+	0	transcript "62"
Adh	Genie	start_codon	307965	307967	0	+	0	transcript "62"
Adh	Genie	CDS	309110	309467	32.548000	+	0	transcript "62"
Adh	Genie	CDS	309530	310452	105.900000	+	1	transcript "62"
Adh	Genie	CDS	310517	311365	59.345000	+	0	transcript "62"
Adh	Genie	CDS	311428	312318	63.743000	+	0	transcript "62"
Adh	Genie	CDS	312387	313020	65.999000	+	0	transcript "62"
Adh	Genie	CDS	313086	313129	-10.673000	+	1	transcript "62"
Adh	Genie	stop_codon	313127	313129	0	+	0	transcript "62"
Adh	Genie	CDS	315138	315899	111.860000	+	0	transcript "28"
Adh	Genie	start_codon	315138	315140	0	+	0	transcript "28"
Adh	Genie	CDS	316433	316800	62.965000	+	0	transcript "28"
Adh	Genie	CDS	316865	317462	91.715000	+	0	transcript "28"
Adh	Genie	stop_codon	317460	317462	0	+	0	transcript "28"
Adh	Genie	CDS	317891	318548	73.170000	-	0	transcript "29"
Adh	Genie	stop_codon	317891	317893	0	-	0	transcript "29"
Adh	Genie	CDS	318608	319430	75.699000	-	1	transcript "29"
Adh	Genie	CDS	319486	321442	211.910000	-	0	transcript "29"
Adh	Genie	start_codon	321440	321442	0	-	0	transcript "29"
Adh	Genie	CDS	321967	323027	154.480000	-	0	transcript "30"
Adh	Genie	stop_codon	321967	321969	0	-	0	transcript "30"
Adh	Genie	CDS	323097	323169	7.790100	-	0	transcript "30"
Adh	Genie	start_codon	323167	323169	0	-	0	transcript "30"
Adh	Genie	CDS	323788	324885	126.260000	+	0	transcript "31"
Adh	Genie	start_codon	323788	323790	0	+	0	transcript "31"
Adh	Genie	CDS	324939	325223	20.843000	+	0	transcript "31"
Adh	Genie	stop_codon	325221	325223	0	+	0	transcript "31"
Adh	Genie	CDS	325240	325634	-8.033300	-	0	transcript "32"
Adh	Genie	stop_codon	325240	325242	0	-	0	transcript "32"
Adh	Genie	CDS	325689	326352	25.314000	-	0	transcript "32"
Adh	Genie	CDS	326412	326822	53.101000	-	0	transcript "32"
Adh	Genie	start_codon	326820	326822	0	-	0	transcript "32"
Adh	Genie	CDS	327175	328002	129.850000	+	0	transcript "33"
Adh	Genie	start_codon	327175	327177	0	+	0	transcript "33"
Adh	Genie	stop_codon	328000	328002	0	+	0	transcript "33"
Adh	Genie	CDS	328048	328357	34.136000	-	0	transcript "34"
Adh	Genie	stop_codon	328048	328050	0	-	0	transcript "34"
Adh	Genie	CDS	328473	328634	8.911700	-	1	transcript "34"
Adh	Genie	CDS	328690	328733	-3.199800	-	1	transcript "34"
Adh	Genie	start_codon	328731	328733	0	-	0	transcript "34"
Adh	Genie	CDS	329808	330183	47.338000	+	0	transcript "35"
Adh	Genie	start_codon	329808	329810	0	+	0	transcript "35"
Adh	Genie	CDS	331090	331184	-4.749500	+	1	transcript "35"
Adh	Genie	stop_codon	331182	331184	0	+	0	transcript "35"
Adh	Genie	CDS	334589	334786	12.218000	-	0	transcript "36"
Adh	Genie	stop_codon	334589	334591	0	-	0	transcript "36"
Adh	Genie	CDS	334847	335125	21.128000	-	0	transcript "36"
Adh	Genie	CDS	335195	335230	-3.998600	-	0	transcript "36"
Adh	Genie	start_codon	335228	335230	0	-	0	transcript "36"
Adh	Genie	CDS	336668	337323	52.024000	-	0	transcript "37"
Adh	Genie	stop_codon	336668	336670	0	-	0	transcript "37"
Adh	Genie	CDS	337379	337413	-5.745400	-	0	transcript "37"
Adh	Genie	CDS	338171	338879	101.290000	-	1	transcript "37"
Adh	Genie	CDS	338944	339013	7.482500	-	0	transcript "37"
Adh	Genie	start_codon	339011	339013	0	-	0	transcript "37"
Adh	Genie	CDS	340529	340634	11.726000	+	0	transcript "38"
Adh	Genie	start_codon	340529	340531	0	+	0	transcript "38"
Adh	Genie	CDS	340705	340870	12.403000	+	1	transcript "38"
Adh	Genie	CDS	340926	341517	89.596000	+	0	transcript "38"
Adh	Genie	stop_codon	341515	341517	0	+	0	transcript "38"
Adh	Genie	CDS	341713	341857	22.650000	+	0	transcript "39"
Adh	Genie	start_codon	341713	341715	0	+	0	transcript "39"
Adh	Genie	CDS	342003	342689	106.980000	+	1	transcript "39"
Adh	Genie	CDS	343143	343368	12.786000	+	1	transcript "39"
Adh	Genie	CDS	343432	343984	43.658000	+	0	transcript "39"
Adh	Genie	stop_codon	343982	343984	0	+	0	transcript "39"
Adh	Genie	CDS	373286	373501	11.227000	+	0	transcript "40"
Adh	Genie	start_codon	373286	373288	0	+	0	transcript "40"
Adh	Genie	stop_codon	373499	373501	0	+	0	transcript "40"
Adh	Genie	CDS	384853	384925	-3.988200	+	0	transcript "41"
Adh	Genie	start_codon	384853	384855	0	+	0	transcript "41"
Adh	Genie	CDS	385051	385283	24.931000	+	1	transcript "41"
Adh	Genie	CDS	385717	385788	3.241100	+	0	transcript "41"
Adh	Genie	stop_codon	385786	385788	0	+	0	transcript "41"
Adh	Genie	CDS	388523	388657	3.871400	+	0	transcript "42"
Adh	Genie	start_codon	388523	388525	0	+	0	transcript "42"
Adh	Genie	CDS	388780	388921	4.675900	+	0	transcript "42"
Adh	Genie	CDS	389006	389140	14.841000	+	1	transcript "42"
Adh	Genie	CDS	389208	390491	191.370000	+	1	transcript "42"
Adh	Genie	CDS	390556	390673	0.323100	+	1	transcript "42"
Adh	Genie	CDS	390737	391112	44.058000	+	0	transcript "42"
Adh	Genie	CDS	391177	391500	38.133000	+	0	transcript "42"
Adh	Genie	stop_codon	391498	391500	0	+	0	transcript "42"
Adh	Genie	CDS	393573	393814	18.450000	-	0	transcript "43"
Adh	Genie	stop_codon	393573	393575	0	-	0	transcript "43"
Adh	Genie	CDS	393894	394052	12.181000	-	0	transcript "43"
Adh	Genie	CDS	394383	395732	168.090000	-	0	transcript "43"
Adh	Genie	CDS	395826	397468	207.330000	-	0	transcript "43"
Adh	Genie	CDS	397532	397671	16.185000	-	1	transcript "43"
Adh	Genie	start_codon	397669	397671	0	-	0	transcript "43"
Adh	Genie	CDS	400338	400923	101.100000	+	0	transcript "63"
Adh	Genie	start_codon	400338	400340	0	+	0	transcript "63"
Adh	Genie	CDS	401350	401713	43.593000	+	1	transcript "63"
Adh	Genie	CDS	401775	402341	73.155000	+	0	transcript "63"
Adh	Genie	CDS	402399	402539	12.686000	+	0	transcript "63"
Adh	Genie	CDS	402607	402779	22.132000	+	0	transcript "63"
Adh	Genie	CDS	403182	403312	-1.283200	+	1	transcript "63"
Adh	Genie	CDS	403468	404414	52.020000	+	0	transcript "63"
Adh	Genie	CDS	404467	405027	22.727000	+	0	transcript "63"
Adh	Genie	CDS	405085	405391	15.486000	+	0	transcript "63"
Adh	Genie	stop_codon	405389	405391	0	+	0	transcript "63"
Adh	Genie	CDS	405952	406314	37.941000	+	0	transcript "64"
Adh	Genie	start_codon	405952	405954	0	+	0	transcript "64"
Adh	Genie	stop_codon	406312	406314	0	+	0	transcript "64"
Adh	Genie	CDS	408759	409001	26.832000	+	0	transcript "65"
Adh	Genie	start_codon	408759	408761	0	+	0	transcript "65"
Adh	Genie	CDS	409150	409656	59.432000	+	0	transcript "65"
Adh	Genie	CDS	410157	410315	14.059000	+	0	transcript "65"
Adh	Genie	CDS	410372	410612	25.504000	+	0	transcript "65"
Adh	Genie	CDS	410677	411401	52.507000	+	1	transcript "65"
Adh	Genie	CDS	411728	411831	-12.030000	+	0	transcript "65"
Adh	Genie	CDS	411898	412000	-5.267300	+	0	transcript "65"
Adh	Genie	stop_codon	411998	412000	0	+	0	transcript "65"
Adh	Genie	CDS	415576	416211	75.256000	-	0	transcript "44"
Adh	Genie	stop_codon	415576	415578	0	-	0	transcript "44"
Adh	Genie	CDS	416276	416749	86.237000	-	0	transcript "44"
Adh	Genie	CDS	417100	417111	-1.109900	-	0	transcript "44"
Adh	Genie	start_codon	417109	417111	0	-	0	transcript "44"
Adh	Genie	CDS	426746	427525	146.500000	-	0	transcript "45"
Adh	Genie	stop_codon	426746	426748	0	-	0	transcript "45"
Adh	Genie	start_codon	427523	427525	0	-	0	transcript "45"
Adh	Genie	CDS	438979	439800	140.060000	-	0	transcript "46"
Adh	Genie	stop_codon	438979	438981	0	-	0	transcript "46"
Adh	Genie	CDS	440839	440850	-2.874600	-	0	transcript "46"
Adh	Genie	start_codon	440848	440850	0	-	0	transcript "46"
Adh	Genie	CDS	448271	448290	-0.847070	+	0	transcript "47"
Adh	Genie	start_codon	448271	448273	0	+	0	transcript "47"
Adh	Genie	CDS	448467	448607	9.262700	+	0	transcript "47"
Adh	Genie	CDS	449015	449330	20.178000	+	0	transcript "47"
Adh	Genie	stop_codon	449328	449330	0	+	0	transcript "47"
Adh	Genie	CDS	451645	451914	26.155000	+	0	transcript "48"
Adh	Genie	start_codon	451645	451647	0	+	0	transcript "48"
Adh	Genie	stop_codon	451912	451914	0	+	0	transcript "48"
Adh	Genie	CDS	454701	454755	-0.308080	+	0	transcript "49"
Adh	Genie	start_codon	454701	454703	0	+	0	transcript "49"
Adh	Genie	CDS	454814	454931	1.564400	+	1	transcript "49"
Adh	Genie	CDS	454999	455702	69.604000	+	0	transcript "49"
Adh	Genie	CDS	455870	456263	31.935000	+	1	transcript "49"
Adh	Genie	CDS	457279	457488	5.405000	+	0	transcript "49"
Adh	Genie	CDS	457649	458206	25.663000	+	0	transcript "49"
Adh	Genie	CDS	458285	458488	12.755000	+	0	transcript "49"
Adh	Genie	CDS	458544	458802	7.398700	+	0	transcript "49"
Adh	Genie	stop_codon	458800	458802	0	+	0	transcript "49"
Adh	Genie	CDS	458837	459146	33.197000	-	0	transcript "50"
Adh	Genie	stop_codon	458837	458839	0	-	0	transcript "50"
Adh	Genie	CDS	459225	459761	66.611000	-	1	transcript "50"
Adh	Genie	CDS	460256	460653	46.632000	-	1	transcript "50"
Adh	Genie	CDS	460730	460959	-8.603400	-	0	transcript "50"
Adh	Genie	CDS	461268	461443	16.057000	-	0	transcript "50"
Adh	Genie	CDS	461500	461675	6.836200	-	1	transcript "50"
Adh	Genie	CDS	461823	461883	-10.814000	-	0	transcript "50"
Adh	Genie	CDS	462096	462584	43.863000	-	1	transcript "50"
Adh	Genie	CDS	462646	463209	69.520000	-	1	transcript "50"
Adh	Genie	CDS	463368	463657	40.621000	-	1	transcript "50"
Adh	Genie	start_codon	463655	463657	0	-	0	transcript "50"
Adh	Genie	CDS	464353	464549	6.740100	+	0	transcript "51"
Adh	Genie	start_codon	464353	464355	0	+	0	transcript "51"
Adh	Genie	CDS	464888	465434	69.426000	+	0	transcript "51"
Adh	Genie	stop_codon	465432	465434	0	+	0	transcript "51"
Adh	Genie	CDS	467979	469610	60.431000	-	0	transcript "52"
Adh	Genie	stop_codon	467979	467981	0	-	0	transcript "52"
Adh	Genie	start_codon	469608	469610	0	-	0	transcript "52"
Adh	Genie	CDS	471109	471296	2.447600	+	0	transcript "53"
Adh	Genie	start_codon	471109	471111	0	+	0	transcript "53"
Adh	Genie	CDS	471441	471687	15.840000	+	0	transcript "53"
Adh	Genie	CDS	471752	471856	5.237500	+	0	transcript "53"
Adh	Genie	CDS	471944	472490	52.378000	+	0	transcript "53"
Adh	Genie	CDS	472557	472823	21.299000	+	1	transcript "53"
Adh	Genie	CDS	472965	473093	-1.081500	+	1	transcript "53"
Adh	Genie	CDS	473909	474023	-10.696000	+	1	transcript "53"
Adh	Genie	CDS	474087	474189	-6.057700	+	0	transcript "53"
Adh	Genie	CDS	474251	474306	-5.381900	+	0	transcript "53"
Adh	Genie	CDS	474365	475283	73.043000	+	0	transcript "53"
Adh	Genie	CDS	475427	476389	57.618000	+	0	transcript "53"
Adh	Genie	stop_codon	476387	476389	0	+	0	transcript "53"
Adh	Genie	CDS	477171	477490	25.992000	-	0	transcript "54"
Adh	Genie	stop_codon	477171	477173	0	-	0	transcript "54"
Adh	Genie	CDS	477548	479329	157.600000	-	0	transcript "54"
Adh	Genie	CDS	479386	479753	19.508000	-	0	transcript "54"
Adh	Genie	CDS	479815	479958	6.614600	-	1	transcript "54"
Adh	Genie	CDS	480147	480287	5.059100	-	1	transcript "54"
Adh	Genie	CDS	480343	480480	9.766900	-	1	transcript "54"
Adh	Genie	CDS	480586	480617	2.328000	-	1	transcript "54"
Adh	Genie	start_codon	480615	480617	0	-	0	transcript "54"
Adh	Genie	CDS	486682	487236	64.142000	-	0	transcript "55"
Adh	Genie	stop_codon	486682	486684	0	-	0	transcript "55"
Adh	Genie	start_codon	487234	487236	0	-	0	transcript "55"
Adh	Genie	CDS	508684	508704	-1.904100	+	0	transcript "66"
Adh	Genie	start_codon	508684	508686	0	+	0	transcript "66"
Adh	Genie	CDS	509536	509783	30.707000	+	0	transcript "66"
Adh	Genie	CDS	509881	510226	60.789000	+	0	transcript "66"
Adh	Genie	CDS	510287	510786	87.527000	+	0	transcript "66"
Adh	Genie	CDS	511784	512375	94.084000	+	0	transcript "66"
Adh	Genie	CDS	512435	512758	48.437000	+	0	transcript "66"
Adh	Genie	stop_codon	512756	512758	0	+	0	transcript "66"
Adh	Genie	CDS	513238	513912	102.390000	-	0	transcript "67"
Adh	Genie	stop_codon	513238	513240	0	-	0	transcript "67"
Adh	Genie	start_codon	513910	513912	0	-	0	transcript "67"
Adh	Genie	CDS	520781	521850	122.850000	+	0	transcript "68"
Adh	Genie	start_codon	520781	520783	0	+	0	transcript "68"
Adh	Genie	CDS	522013	522988	88.994000	+	0	transcript "68"
Adh	Genie	stop_codon	522986	522988	0	+	0	transcript "68"
Adh	Genie	CDS	541380	542513	122.200000	+	0	transcript "69"
Adh	Genie	start_codon	541380	541382	0	+	0	transcript "69"
Adh	Genie	stop_codon	542511	542513	0	+	0	transcript "69"
Adh	Genie	CDS	555360	555824	40.790000	+	0	transcript "70"
Adh	Genie	start_codon	555360	555362	0	+	0	transcript "70"
Adh	Genie	CDS	555920	556370	30.003000	+	0	transcript "70"
Adh	Genie	CDS	556436	556503	1.463100	+	1	transcript "70"
Adh	Genie	stop_codon	556501	556503	0	+	0	transcript "70"
Adh	Genie	CDS	570386	570745	30.570000	+	0	transcript "71"
Adh	Genie	start_codon	570386	570388	0	+	0	transcript "71"
Adh	Genie	stop_codon	570743	570745	0	+	0	transcript "71"
Adh	Genie	CDS	581768	581877	11.944000	+	0	transcript "72"
Adh	Genie	start_codon	581768	581770	0	+	0	transcript "72"
Adh	Genie	CDS	582235	582361	6.377200	+	0	transcript "72"
Adh	Genie	stop_codon	582359	582361	0	+	0	transcript "72"
Adh	Genie	CDS	598403	598796	56.574000	+	0	transcript "97"
Adh	Genie	start_codon	598403	598405	0	+	0	transcript "97"
Adh	Genie	CDS	598857	599119	24.534000	+	1	transcript "97"
Adh	Genie	CDS	599219	600433	106.310000	+	0	transcript "97"
Adh	Genie	stop_codon	600431	600433	0	+	0	transcript "97"
Adh	Genie	CDS	601945	602889	12.322000	-	0	transcript "98"
Adh	Genie	stop_codon	601945	601947	0	-	0	transcript "98"
Adh	Genie	CDS	602944	603000	1.701900	-	0	transcript "98"
Adh	Genie	start_codon	602998	603000	0	-	0	transcript "98"
Adh	Genie	CDS	650075	650110	-2.646100	+	0	transcript "73"
Adh	Genie	start_codon	650075	650077	0	+	0	transcript "73"
Adh	Genie	CDS	650611	651153	102.410000	+	0	transcript "73"
Adh	Genie	CDS	651278	651478	15.920000	+	0	transcript "73"
Adh	Genie	CDS	651583	652282	112.260000	+	0	transcript "73"
Adh	Genie	CDS	652397	652824	102.860000	+	1	transcript "73"
Adh	Genie	stop_codon	652822	652824	0	+	0	transcript "73"
Adh	Genie	CDS	657691	658001	15.595000	-	0	transcript "74"
Adh	Genie	stop_codon	657691	657693	0	-	0	transcript "74"
Adh	Genie	CDS	658058	658265	18.579000	-	0	transcript "74"
Adh	Genie	CDS	658326	658463	10.081000	-	0	transcript "74"
Adh	Genie	CDS	658526	660852	290.200000	-	0	transcript "74"
Adh	Genie	CDS	660917	661331	79.630000	-	0	transcript "74"
Adh	Genie	CDS	661834	661866	-0.860640	-	0	transcript "74"
Adh	Genie	start_codon	661864	661866	0	-	0	transcript "74"
Adh	Genie	CDS	679874	680889	126.190000	-	0	transcript "75"
Adh	Genie	stop_codon	679874	679876	0	-	0	transcript "75"
Adh	Genie	CDS	681018	681033	-1.737900	-	0	transcript "75"
Adh	Genie	start_codon	681031	681033	0	-	0	transcript "75"
Adh	Genie	CDS	689465	689746	15.657000	-	0	transcript "76"
Adh	Genie	stop_codon	689465	689467	0	-	0	transcript "76"
Adh	Genie	CDS	689811	689983	20.609000	-	0	transcript "76"
Adh	Genie	CDS	690663	691035	50.209000	-	0	transcript "76"
Adh	Genie	start_codon	691033	691035	0	-	0	transcript "76"
Adh	Genie	CDS	754773	754919	12.975000	+	0	transcript "77"
Adh	Genie	start_codon	754773	754775	0	+	0	transcript "77"
Adh	Genie	stop_codon	754917	754919	0	+	0	transcript "77"
Adh	Genie	CDS	757457	757873	47.792000	+	0	transcript "78"
Adh	Genie	start_codon	757457	757459	0	+	0	transcript "78"
Adh	Genie	stop_codon	757871	757873	0	+	0	transcript "78"
Adh	Genie	CDS	771216	771615	21.669000	+	0	transcript "79"
Adh	Genie	start_codon	771216	771218	0	+	0	transcript "79"
Adh	Genie	CDS	771955	772460	37.971000	+	1	transcript "79"
Adh	Genie	stop_codon	772458	772460	0	+	0	transcript "79"
Adh	Genie	CDS	779378	779413	-2.468700	+	0	transcript "80"
Adh	Genie	start_codon	779378	779380	0	+	0	transcript "80"
Adh	Genie	CDS	779692	781583	159.360000	+	0	transcript "80"
Adh	Genie	CDS	781886	782726	79.380000	+	0	transcript "80"
Adh	Genie	stop_codon	782724	782726	0	+	0	transcript "80"
Adh	Genie	CDS	801996	802961	116.510000	+	0	transcript "99"
Adh	Genie	start_codon	801996	801998	0	+	0	transcript "99"
Adh	Genie	stop_codon	802959	802961	0	+	0	transcript "99"
Adh	Genie	CDS	812924	812990	0.713830	+	0	transcript "81"
Adh	Genie	start_codon	812924	812926	0	+	0	transcript "81"
Adh	Genie	CDS	813291	814650	109.200000	+	1	transcript "81"
Adh	Genie	CDS	814726	814981	1.824500	+	0	transcript "81"
Adh	Genie	CDS	815046	815235	2.299600	+	0	transcript "81"
Adh	Genie	CDS	815317	815442	0.630260	+	1	transcript "81"
Adh	Genie	CDS	815528	817215	174.530000	+	1	transcript "81"
Adh	Genie	CDS	817273	818025	64.672000	+	0	transcript "81"
Adh	Genie	CDS	818086	818367	12.906000	+	0	transcript "81"
Adh	Genie	CDS	818447	818574	6.149600	+	0	transcript "81"
Adh	Genie	CDS	818633	819290	71.964000	+	0	transcript "81"
Adh	Genie	CDS	820171	820789	68.645000	+	0	transcript "81"
Adh	Genie	CDS	820846	820979	5.429300	+	1	transcript "81"
Adh	Genie	CDS	821037	821265	10.632000	+	0	transcript "81"
Adh	Genie	CDS	821333	821487	16.597000	+	1	transcript "81"
Adh	Genie	stop_codon	821485	821487	0	+	0	transcript "81"
Adh	Genie	CDS	822205	822454	10.460000	+	0	transcript "82"
Adh	Genie	start_codon	822205	822207	0	+	0	transcript "82"
Adh	Genie	CDS	822511	822848	20.375000	+	1	transcript "82"
Adh	Genie	CDS	822907	824011	69.757000	+	0	transcript "82"
Adh	Genie	CDS	824074	824822	39.780000	+	1	transcript "82"
Adh	Genie	CDS	824885	825688	59.063000	+	0	transcript "82"
Adh	Genie	CDS	825804	826423	15.824000	+	0	transcript "82"
Adh	Genie	CDS	826980	827087	-0.491250	+	0	transcript "82"
Adh	Genie	CDS	827148	827476	31.570000	+	0	transcript "82"
Adh	Genie	CDS	828063	828343	32.078000	+	1	transcript "82"
Adh	Genie	stop_codon	828341	828343	0	+	0	transcript "82"
Adh	Genie	CDS	832137	833672	151.590000	+	0	transcript "83"
Adh	Genie	start_codon	832137	832139	0	+	0	transcript "83"
Adh	Genie	stop_codon	833670	833672	0	+	0	transcript "83"
Adh	Genie	CDS	835092	835312	31.621000	+	0	transcript "84"
Adh	Genie	start_codon	835092	835094	0	+	0	transcript "84"
Adh	Genie	CDS	836514	837106	65.237000	+	0	transcript "84"
Adh	Genie	CDS	837173	837428	18.300000	+	1	transcript "84"
Adh	Genie	CDS	837486	837859	34.479000	+	0	transcript "84"
Adh	Genie	CDS	837919	838152	24.878000	+	1	transcript "84"
Adh	Genie	CDS	838217	839076	109.480000	+	1	transcript "84"
Adh	Genie	stop_codon	839074	839076	0	+	0	transcript "84"
Adh	Genie	CDS	839712	839872	-8.832400	-	0	transcript "85"
Adh	Genie	stop_codon	839712	839714	0	-	0	transcript "85"
Adh	Genie	CDS	840060	840448	18.918000	-	0	transcript "85"
Adh	Genie	CDS	841158	841333	-1.827000	-	1	transcript "85"
Adh	Genie	CDS	841389	841969	48.777000	-	0	transcript "85"
Adh	Genie	CDS	842034	842419	31.992000	-	0	transcript "85"
Adh	Genie	CDS	842969	843375	73.977000	-	1	transcript "85"
Adh	Genie	CDS	843445	843518	2.785500	-	0	transcript "85"
Adh	Genie	CDS	843799	843808	-1.136300	-	0	transcript "85"
Adh	Genie	start_codon	843806	843808	0	-	0	transcript "85"
Adh	Genie	CDS	846397	847372	135.720000	-	0	transcript "86"
Adh	Genie	stop_codon	846397	846399	0	-	0	transcript "86"
Adh	Genie	CDS	847433	848154	64.432000	-	1	transcript "86"
Adh	Genie	CDS	848208	848609	48.366000	-	0	transcript "86"
Adh	Genie	CDS	848668	848733	7.073700	-	0	transcript "86"
Adh	Genie	start_codon	848731	848733	0	-	0	transcript "86"
Adh	Genie	CDS	850944	851007	3.803500	+	0	transcript "87"
Adh	Genie	start_codon	850944	850946	0	+	0	transcript "87"
Adh	Genie	CDS	851077	851190	10.665000	+	1	transcript "87"
Adh	Genie	CDS	851256	851436	16.138000	+	1	transcript "87"
Adh	Genie	CDS	851491	851673	17.969000	+	0	transcript "87"
Adh	Genie	CDS	851742	851919	21.041000	+	0	transcript "87"
Adh	Genie	stop_codon	851917	851919	0	+	0	transcript "87"
Adh	Genie	CDS	853116	855014	304.840000	+	0	transcript "88"
Adh	Genie	start_codon	853116	853118	0	+	0	transcript "88"
Adh	Genie	stop_codon	855012	855014	0	+	0	transcript "88"
Adh	Genie	CDS	855874	855922	1.880600	+	0	transcript "89"
Adh	Genie	start_codon	855874	855876	0	+	0	transcript "89"
Adh	Genie	CDS	855982	856031	-4.428900	+	1	transcript "89"
Adh	Genie	CDS	856092	856876	114.970000	+	0	transcript "89"
Adh	Genie	CDS	856942	858029	89.593000	+	0	transcript "89"
Adh	Genie	CDS	858109	858341	3.931200	+	1	transcript "89"
Adh	Genie	CDS	858418	858966	50.237000	+	0	transcript "89"
Adh	Genie	stop_codon	858964	858966	0	+	0	transcript "89"
Adh	Genie	CDS	870684	870866	13.644000	-	0	transcript "90"
Adh	Genie	stop_codon	870684	870686	0	-	0	transcript "90"
Adh	Genie	start_codon	870864	870866	0	-	0	transcript "90"
Adh	Genie	CDS	872557	872818	10.799000	-	0	transcript "91"
Adh	Genie	stop_codon	872557	872559	0	-	0	transcript "91"
Adh	Genie	CDS	872891	873131	17.889000	-	1	transcript "91"
Adh	Genie	CDS	873191	873321	0.446900	-	0	transcript "91"
Adh	Genie	CDS	873388	873527	2.295400	-	1	transcript "91"
Adh	Genie	CDS	873583	874124	41.511000	-	0	transcript "91"
Adh	Genie	CDS	874273	874541	7.269300	-	0	transcript "91"
Adh	Genie	CDS	874599	874870	19.296000	-	1	transcript "91"
Adh	Genie	start_codon	874868	874870	0	-	0	transcript "91"
Adh	Genie	CDS	884916	885676	113.080000	-	0	transcript "92"
Adh	Genie	stop_codon	884916	884918	0	-	0	transcript "92"
Adh	Genie	CDS	885967	886798	150.730000	-	0	transcript "92"
Adh	Genie	CDS	887891	887908	-2.451600	-	0	transcript "92"
Adh	Genie	start_codon	887906	887908	0	-	0	transcript "92"
Adh	Genie	CDS	910572	910742	6.497100	-	0	transcript "93"
Adh	Genie	stop_codon	910572	910574	0	-	0	transcript "93"
Adh	Genie	CDS	910801	911055	31.243000	-	0	transcript "93"
Adh	Genie	start_codon	911053	911055	0	-	0	transcript "93"
Adh	Genie	CDS	918151	918795	75.491000	-	0	transcript "94"
Adh	Genie	stop_codon	918151	918153	0	-	0	transcript "94"
Adh	Genie	CDS	918858	918869	-1.928000	-	0	transcript "94"
Adh	Genie	start_codon	918867	918869	0	-	0	transcript "94"
Adh	Genie	CDS	944218	944493	21.855000	-	0	transcript "95"
Adh	Genie	stop_codon	944218	944220	0	-	0	transcript "95"
Adh	Genie	start_codon	944491	944493	0	-	0	transcript "95"
Adh	Genie	CDS	984981	985070	6.638600	+	0	transcript "96"
Adh	Genie	start_codon	984981	984983	0	+	0	transcript "96"
Adh	Genie	CDS	985373	986896	277.490000	+	0	transcript "96"
Adh	Genie	stop_codon	986894	986896	0	+	0	transcript "96"
Adh	Genie	CDS	1041376	1041530	7.550600	-	0	transcript "100"
Adh	Genie	stop_codon	1041376	1041378	0	-	0	transcript "100"
Adh	Genie	CDS	1041602	1041989	21.581000	-	0	transcript "100"
Adh	Genie	CDS	1042386	1042688	28.998000	-	0	transcript "100"
Adh	Genie	start_codon	1042686	1042688	0	-	0	transcript "100"
Adh	Genie	CDS	1094414	1094610	6.346800	-	0	transcript "101"
Adh	Genie	stop_codon	1094414	1094416	0	-	0	transcript "101"
Adh	Genie	CDS	1094867	1095215	10.626000	-	0	transcript "101"
Adh	Genie	CDS	1095422	1095533	-2.338700	-	0	transcript "101"
Adh	Genie	CDS	1095586	1095735	9.619500	-	1	transcript "101"
Adh	Genie	CDS	1095848	1095987	5.042400	-	1	transcript "101"
Adh	Genie	CDS	1096062	1096196	9.104500	-	0	transcript "101"
Adh	Genie	CDS	1096326	1098979	304.150000	-	0	transcript "101"
Adh	Genie	CDS	1099099	1099111	-1.379500	-	0	transcript "101"
Adh	Genie	start_codon	1099109	1099111	0	-	0	transcript "101"
Adh	Genie	CDS	1104411	1104965	86.735000	-	0	transcript "125"
Adh	Genie	stop_codon	1104411	1104413	0	-	0	transcript "125"
Adh	Genie	start_codon	1104963	1104965	0	-	0	transcript "125"
Adh	Genie	CDS	1110074	1110172	16.149000	+	0	transcript "102"
Adh	Genie	start_codon	1110074	1110076	0	+	0	transcript "102"
Adh	Genie	CDS	1110238	1110642	91.938000	+	0	transcript "102"
Adh	Genie	CDS	1110713	1110979	44.173000	+	0	transcript "102"
Adh	Genie	stop_codon	1110977	1110979	0	+	0	transcript "102"
Adh	Genie	CDS	1111283	1111378	9.383100	+	0	transcript "103"
Adh	Genie	start_codon	1111283	1111285	0	+	0	transcript "103"
Adh	Genie	CDS	1111805	1112209	19.743000	+	0	transcript "103"
Adh	Genie	CDS	1112261	1112578	13.427000	+	0	transcript "103"
Adh	Genie	stop_codon	1112576	1112578	0	+	0	transcript "103"
Adh	Genie	CDS	1115807	1115987	7.158300	+	0	transcript "104"
Adh	Genie	start_codon	1115807	1115809	0	+	0	transcript "104"
Adh	Genie	CDS	1116315	1116493	16.016000	+	1	transcript "104"
Adh	Genie	stop_codon	1116491	1116493	0	+	0	transcript "104"
Adh	Genie	CDS	1117474	1117608	24.390000	+	0	transcript "105"
Adh	Genie	start_codon	1117474	1117476	0	+	0	transcript "105"
Adh	Genie	stop_codon	1117606	1117608	0	+	0	transcript "105"
Adh	Genie	CDS	1206614	1206790	40.716000	+	0	transcript "126"
Adh	Genie	start_codon	1206614	1206616	0	+	0	transcript "126"
Adh	Genie	CDS	1207666	1207953	59.930000	+	0	transcript "126"
Adh	Genie	stop_codon	1207951	1207953	0	+	0	transcript "126"
Adh	Genie	CDS	1218630	1218652	-6.454600	-	0	transcript "106"
Adh	Genie	stop_codon	1218630	1218632	0	-	0	transcript "106"
Adh	Genie	CDS	1218756	1220253	31.350000	-	0	transcript "106"
Adh	Genie	CDS	1220453	1221762	10.474000	-	0	transcript "106"
Adh	Genie	CDS	1222288	1222395	1.781000	-	0	transcript "106"
Adh	Genie	CDS	1222483	1222579	-6.141500	-	0	transcript "106"
Adh	Genie	start_codon	1222577	1222579	0	-	0	transcript "106"
Adh	Genie	CDS	1229684	1230733	85.374000	+	0	transcript "107"
Adh	Genie	start_codon	1229684	1229686	0	+	0	transcript "107"
Adh	Genie	stop_codon	1230731	1230733	0	+	0	transcript "107"
Adh	Genie	CDS	1231127	1231384	65.899000	-	0	transcript "108"
Adh	Genie	stop_codon	1231127	1231129	0	-	0	transcript "108"
Adh	Genie	CDS	1231452	1231463	-2.119700	-	0	transcript "108"
Adh	Genie	start_codon	1231461	1231463	0	-	0	transcript "108"
Adh	Genie	CDS	1233087	1233293	38.174000	+	0	transcript "109"
Adh	Genie	start_codon	1233087	1233089	0	+	0	transcript "109"
Adh	Genie	stop_codon	1233291	1233293	0	+	0	transcript "109"
Adh	Genie	CDS	1250633	1251421	93.812000	+	0	transcript "110"
Adh	Genie	start_codon	1250633	1250635	0	+	0	transcript "110"
Adh	Genie	stop_codon	1251419	1251421	0	+	0	transcript "110"
Adh	Genie	CDS	1252523	1253617	68.034000	+	0	transcript "111"
Adh	Genie	start_codon	1252523	1252525	0	+	0	transcript "111"
Adh	Genie	stop_codon	1253615	1253617	0	+	0	transcript "111"
Adh	Genie	CDS	1255669	1256823	119.160000	+	0	transcript "112"
Adh	Genie	start_codon	1255669	1255671	0	+	0	transcript "112"
Adh	Genie	stop_codon	1256821	1256823	0	+	0	transcript "112"
Adh	Genie	CDS	1271377	1272140	13.632000	-	0	transcript "113"
Adh	Genie	stop_codon	1271377	1271379	0	-	0	transcript "113"
Adh	Genie	CDS	1272217	1272271	0.605850	-	0	transcript "113"
Adh	Genie	start_codon	1272269	1272271	0	-	0	transcript "113"
Adh	Genie	CDS	1334780	1335024	12.306000	-	0	transcript "114"
Adh	Genie	stop_codon	1334780	1334782	0	-	0	transcript "114"
Adh	Genie	CDS	1335080	1335356	11.423000	-	0	transcript "114"
Adh	Genie	CDS	1335416	1336157	45.509000	-	0	transcript "114"
Adh	Genie	CDS	1336453	1336720	2.078200	-	1	transcript "114"
Adh	Genie	CDS	1337562	1337587	-7.159000	-	0	transcript "114"
Adh	Genie	CDS	1337668	1338007	15.902000	-	1	transcript "114"
Adh	Genie	CDS	1338337	1338640	33.416000	-	0	transcript "114"
Adh	Genie	CDS	1338702	1338785	9.234600	-	0	transcript "114"
Adh	Genie	start_codon	1338783	1338785	0	-	0	transcript "114"
Adh	Genie	CDS	1365077	1365100	-7.689600	-	0	transcript "115"
Adh	Genie	stop_codon	1365077	1365079	0	-	0	transcript "115"
Adh	Genie	CDS	1365170	1365361	12.666000	-	0	transcript "115"
Adh	Genie	CDS	1365421	1365611	0.834990	-	0	transcript "115"
Adh	Genie	CDS	1365666	1365732	5.211000	-	0	transcript "115"
Adh	Genie	start_codon	1365730	1365732	0	-	0	transcript "115"
Adh	Genie	CDS	1398183	1398833	89.997000	-	0	transcript "127"
Adh	Genie	stop_codon	1398183	1398185	0	-	0	transcript "127"
Adh	Genie	CDS	1399403	1399429	-1.532700	-	0	transcript "127"
Adh	Genie	start_codon	1399427	1399429	0	-	0	transcript "127"
Adh	Genie	CDS	1401419	1401445	-6.795300	-	0	transcript "128"
Adh	Genie	stop_codon	1401419	1401421	0	-	0	transcript "128"
Adh	Genie	CDS	1401633	1401874	42.690000	-	0	transcript "128"
Adh	Genie	CDS	1402535	1402643	2.930000	-	0	transcript "128"
Adh	Genie	CDS	1402808	1402995	15.412000	-	0	transcript "128"
Adh	Genie	CDS	1403930	1404047	8.017300	-	0	transcript "128"
Adh	Genie	start_codon	1404045	1404047	0	-	0	transcript "128"
Adh	Genie	CDS	1415492	1415566	-1.380300	+	0	transcript "116"
Adh	Genie	start_codon	1415492	1415494	0	+	0	transcript "116"
Adh	Genie	CDS	1415885	1416055	-8.786900	+	0	transcript "116"
Adh	Genie	CDS	1416197	1418081	144.810000	+	0	transcript "116"
Adh	Genie	CDS	1418142	1419321	94.855000	+	1	transcript "116"
Adh	Genie	CDS	1419378	1419918	18.692000	+	0	transcript "116"
Adh	Genie	stop_codon	1419916	1419918	0	+	0	transcript "116"
Adh	Genie	CDS	1425535	1425752	4.637200	-	0	transcript "117"
Adh	Genie	stop_codon	1425535	1425537	0	-	0	transcript "117"
Adh	Genie	CDS	1426168	1426258	7.701700	-	0	transcript "117"
Adh	Genie	start_codon	1426256	1426258	0	-	0	transcript "117"
Adh	Genie	CDS	1465977	1466019	-2.836900	-	0	transcript "118"
Adh	Genie	stop_codon	1465977	1465979	0	-	0	transcript "118"
Adh	Genie	CDS	1466153	1466744	85.975000	-	1	transcript "118"
Adh	Genie	CDS	1466876	1467307	33.471000	-	0	transcript "118"
Adh	Genie	CDS	1467523	1467556	-2.813000	-	0	transcript "118"
Adh	Genie	start_codon	1467554	1467556	0	-	0	transcript "118"
Adh	Genie	CDS	1475691	1476189	0.948570	+	0	transcript "119"
Adh	Genie	start_codon	1475691	1475693	0	+	0	transcript "119"
Adh	Genie	CDS	1476547	1476944	-2.672100	+	1	transcript "119"
Adh	Genie	stop_codon	1476942	1476944	0	+	0	transcript "119"
Adh	Genie	CDS	1480661	1481086	23.307000	+	0	transcript "120"
Adh	Genie	start_codon	1480661	1480663	0	+	0	transcript "120"
Adh	Genie	stop_codon	1481084	1481086	0	+	0	transcript "120"
Adh	Genie	CDS	1495484	1495522	1.469100	+	0	transcript "121"
Adh	Genie	start_codon	1495484	1495486	0	+	0	transcript "121"
Adh	Genie	CDS	1495620	1495919	25.497000	+	0	transcript "121"
Adh	Genie	CDS	1495977	1496198	18.637000	+	0	transcript "121"
Adh	Genie	stop_codon	1496196	1496198	0	+	0	transcript "121"
Adh	Genie	CDS	1496304	1496815	76.325000	-	0	transcript "122"
Adh	Genie	stop_codon	1496304	1496306	0	-	0	transcript "122"
Adh	Genie	CDS	1496865	1497000	25.236000	-	0	transcript "122"
Adh	Genie	start_codon	1496998	1497000	0	-	0	transcript "122"
Adh	Genie	CDS	1497576	1498121	124.250000	+	0	transcript "123"
Adh	Genie	start_codon	1497576	1497578	0	+	0	transcript "123"
Adh	Genie	stop_codon	1498119	1498121	0	+	0	transcript "123"
Adh	Genie	CDS	1498334	1499046	65.715000	-	0	transcript "124"
Adh	Genie	stop_codon	1498334	1498336	0	-	0	transcript "124"
Adh	Genie	CDS	1499102	1499249	10.056000	-	0	transcript "124"
Adh	Genie	start_codon	1499247	1499249	0	-	0	transcript "124"
Adh	Genie	CDS	1500039	1500797	82.096000	+	0	transcript "129"
Adh	Genie	start_codon	1500039	1500041	0	+	0	transcript "129"
Adh	Genie	CDS	1500954	1501010	-2.097600	+	0	transcript "129"
Adh	Genie	stop_codon	1501008	1501010	0	+	0	transcript "129"
Adh	Genie	CDS	1515068	1515175	5.871800	+	0	transcript "130"
Adh	Genie	start_codon	1515068	1515070	0	+	0	transcript "130"
Adh	Genie	CDS	1515266	1515436	20.435000	+	0	transcript "130"
Adh	Genie	CDS	1515498	1515714	11.218000	+	0	transcript "130"
Adh	Genie	CDS	1515807	1515972	6.709800	+	1	transcript "130"
Adh	Genie	CDS	1516036	1516279	18.450000	+	0	transcript "130"
Adh	Genie	CDS	1516339	1516527	-2.014100	+	0	transcript "130"
Adh	Genie	stop_codon	1516525	1516527	0	+	0	transcript "130"
Adh	Genie	CDS	1519306	1519382	-2.829400	+	0	transcript "131"
Adh	Genie	start_codon	1519306	1519308	0	+	0	transcript "131"
Adh	Genie	CDS	1519441	1519564	-3.660600	+	0	transcript "131"
Adh	Genie	CDS	1519897	1520023	-7.102600	+	0	transcript "131"
Adh	Genie	CDS	1520081	1520337	11.739000	+	1	transcript "131"
Adh	Genie	CDS	1520398	1520535	-2.078900	+	0	transcript "131"
Adh	Genie	CDS	1521654	1521834	18.846000	+	0	transcript "131"
Adh	Genie	CDS	1522286	1522308	-8.716800	+	1	transcript "131"
Adh	Genie	stop_codon	1522306	1522308	0	+	0	transcript "131"
Adh	Genie	CDS	1525248	1525447	36.152000	+	0	transcript "132"
Adh	Genie	start_codon	1525248	1525250	0	+	0	transcript "132"
Adh	Genie	CDS	1526237	1526642	49.907000	+	0	transcript "132"
Adh	Genie	CDS	1526702	1527379	63.185000	+	0	transcript "132"
Adh	Genie	stop_codon	1527377	1527379	0	+	0	transcript "132"
Adh	Genie	CDS	1527523	1527636	8.675300	-	0	transcript "133"
Adh	Genie	stop_codon	1527523	1527525	0	-	0	transcript "133"
Adh	Genie	CDS	1527705	1528201	69.856000	-	0	transcript "133"
Adh	Genie	CDS	1528291	1528426	17.615000	-	0	transcript "133"
Adh	Genie	start_codon	1528424	1528426	0	-	0	transcript "133"
Adh	Genie	CDS	1529588	1529971	80.971000	+	0	transcript "134"
Adh	Genie	start_codon	1529588	1529590	0	+	0	transcript "134"
Adh	Genie	CDS	1530746	1531626	104.260000	+	0	transcript "134"
Adh	Genie	CDS	1531685	1531892	18.041000	+	0	transcript "134"
Adh	Genie	CDS	1531958	1532269	35.008000	+	0	transcript "134"
Adh	Genie	stop_codon	1532267	1532269	0	+	0	transcript "134"
Adh	Genie	CDS	1535065	1535271	-2.504300	-	0	transcript "135"
Adh	Genie	stop_codon	1535065	1535067	0	-	0	transcript "135"
Adh	Genie	CDS	1535341	1535461	-1.928100	-	0	transcript "135"
Adh	Genie	CDS	1535530	1535676	-3.039100	-	1	transcript "135"
Adh	Genie	CDS	1535739	1536304	53.865000	-	1	transcript "135"
Adh	Genie	CDS	1536364	1537150	67.782000	-	0	transcript "135"
Adh	Genie	CDS	1537212	1538662	122.580000	-	1	transcript "135"
Adh	Genie	CDS	1538719	1541113	170.440000	-	0	transcript "135"
Adh	Genie	CDS	1541178	1541378	6.934800	-	1	transcript "135"
Adh	Genie	CDS	1541445	1541794	14.039000	-	1	transcript "135"
Adh	Genie	CDS	1542125	1542385	42.652000	-	0	transcript "135"
Adh	Genie	CDS	1542465	1542503	2.503500	-	0	transcript "135"
Adh	Genie	start_codon	1542501	1542503	0	-	0	transcript "135"
Adh	Genie	CDS	1549142	1550017	162.070000	-	0	transcript "136"
Adh	Genie	stop_codon	1549142	1549144	0	-	0	transcript "136"
Adh	Genie	CDS	1550084	1550149	8.933300	-	0	transcript "136"
Adh	Genie	start_codon	1550147	1550149	0	-	0	transcript "136"
Adh	Genie	CDS	1554085	1554599	69.360000	-	0	transcript "137"
Adh	Genie	stop_codon	1554085	1554087	0	-	0	transcript "137"
Adh	Genie	CDS	1554841	1555107	40.725000	-	0	transcript "137"
Adh	Genie	CDS	1556588	1557278	107.790000	-	0	transcript "137"
Adh	Genie	start_codon	1557276	1557278	0	-	0	transcript "137"
Adh	Genie	CDS	1558057	1558080	-0.775290	+	0	transcript "138"
Adh	Genie	start_codon	1558057	1558059	0	+	0	transcript "138"
Adh	Genie	CDS	1558134	1558521	54.139000	+	0	transcript "138"
Adh	Genie	CDS	1558685	1558960	7.562300	+	1	transcript "138"
Adh	Genie	CDS	1559053	1559117	-3.361000	+	1	transcript "138"
Adh	Genie	stop_codon	1559115	1559117	0	+	0	transcript "138"
Adh	Genie	CDS	1562491	1563081	16.131000	+	0	transcript "139"
Adh	Genie	start_codon	1562491	1562493	0	+	0	transcript "139"
Adh	Genie	CDS	1563140	1563353	11.370000	+	0	transcript "139"
Adh	Genie	CDS	1563418	1563689	14.601000	+	1	transcript "139"
Adh	Genie	CDS	1563761	1563814	-0.682990	+	0	transcript "139"
Adh	Genie	stop_codon	1563812	1563814	0	+	0	transcript "139"
Adh	Genie	CDS	1565296	1565530	33.303000	+	0	transcript "140"
Adh	Genie	start_codon	1565296	1565298	0	+	0	transcript "140"
Adh	Genie	CDS	1566007	1566032	-5.226500	+	1	transcript "140"
Adh	Genie	stop_codon	1566030	1566032	0	+	0	transcript "140"
Adh	Genie	CDS	1576485	1576515	-3.331200	+	0	transcript "141"
Adh	Genie	start_codon	1576485	1576487	0	+	0	transcript "141"
Adh	Genie	CDS	1576691	1576943	8.151900	+	1	transcript "141"
Adh	Genie	CDS	1577036	1577406	49.371000	+	0	transcript "141"
Adh	Genie	CDS	1577568	1577860	11.645000	+	1	transcript "141"
Adh	Genie	CDS	1577926	1578108	10.510000	+	0	transcript "141"
Adh	Genie	stop_codon	1578106	1578108	0	+	0	transcript "141"
Adh	Genie	CDS	1580640	1580685	3.562700	+	0	transcript "142"
Adh	Genie	start_codon	1580640	1580642	0	+	0	transcript "142"
Adh	Genie	CDS	1580750	1580880	-3.640600	+	1	transcript "142"
Adh	Genie	CDS	1580946	1581227	15.101000	+	0	transcript "142"
Adh	Genie	CDS	1581294	1581623	13.812000	+	0	transcript "142"
Adh	Genie	CDS	1581774	1582136	39.592000	+	0	transcript "142"
Adh	Genie	CDS	1582201	1582292	0.821060	+	0	transcript "142"
Adh	Genie	CDS	1583070	1583334	18.473000	+	0	transcript "142"
Adh	Genie	CDS	1584330	1584828	60.419000	+	0	transcript "142"
Adh	Genie	CDS	1584949	1585094	20.028000	+	1	transcript "142"
Adh	Genie	CDS	1585153	1585380	15.833000	+	0	transcript "142"
Adh	Genie	stop_codon	1585378	1585380	0	+	0	transcript "142"
Adh	Genie	CDS	1599218	1600177	99.690000	+	0	transcript "168"
Adh	Genie	start_codon	1599218	1599220	0	+	0	transcript "168"
Adh	Genie	CDS	1601744	1602527	44.462000	+	0	transcript "168"
Adh	Genie	CDS	1603452	1603864	46.031000	+	1	transcript "168"
Adh	Genie	CDS	1603963	1605404	87.479000	+	0	transcript "168"
Adh	Genie	CDS	1605651	1606718	58.620000	+	0	transcript "168"
Adh	Genie	CDS	1606791	1607142	13.218000	+	0	transcript "168"
Adh	Genie	CDS	1607205	1607306	1.218200	+	0	transcript "168"
Adh	Genie	stop_codon	1607304	1607306	0	+	0	transcript "168"
Adh	Genie	CDS	1653232	1653414	18.635000	-	0	transcript "143"
Adh	Genie	stop_codon	1653232	1653234	0	-	0	transcript "143"
Adh	Genie	CDS	1653857	1657133	248.900000	-	0	transcript "143"
Adh	Genie	CDS	1657232	1657338	9.682700	-	1	transcript "143"
Adh	Genie	start_codon	1657336	1657338	0	-	0	transcript "143"
Adh	Genie	CDS	1667412	1667446	-5.767700	-	0	transcript "144"
Adh	Genie	stop_codon	1667412	1667414	0	-	0	transcript "144"
Adh	Genie	CDS	1667694	1667970	40.648000	-	0	transcript "144"
Adh	Genie	start_codon	1667968	1667970	0	-	0	transcript "144"
Adh	Genie	CDS	1718580	1718725	17.066000	-	0	transcript "145"
Adh	Genie	stop_codon	1718580	1718582	0	-	0	transcript "145"
Adh	Genie	CDS	1719195	1719342	8.610400	-	0	transcript "145"
Adh	Genie	CDS	1719504	1720004	59.547000	-	0	transcript "145"
Adh	Genie	start_codon	1720002	1720004	0	-	0	transcript "145"
Adh	Genie	CDS	1726252	1726434	20.932000	-	0	transcript "146"
Adh	Genie	stop_codon	1726252	1726254	0	-	0	transcript "146"
Adh	Genie	start_codon	1726432	1726434	0	-	0	transcript "146"
Adh	Genie	CDS	1728631	1728750	18.559000	+	0	transcript "147"
Adh	Genie	start_codon	1728631	1728633	0	+	0	transcript "147"
Adh	Genie	stop_codon	1728748	1728750	0	+	0	transcript "147"
Adh	Genie	CDS	1738791	1739218	79.569000	+	0	transcript "148"
Adh	Genie	start_codon	1738791	1738793	0	+	0	transcript "148"
Adh	Genie	CDS	1740300	1740540	24.083000	+	0	transcript "148"
Adh	Genie	CDS	1740659	1740939	36.239000	+	0	transcript "148"
Adh	Genie	CDS	1740995	1742042	128.040000	+	0	transcript "148"
Adh	Genie	CDS	1742104	1742446	41.061000	+	0	transcript "148"
Adh	Genie	CDS	1742886	1743193	32.811000	+	1	transcript "148"
Adh	Genie	stop_codon	1743191	1743193	0	+	0	transcript "148"
Adh	Genie	CDS	1744620	1745915	173.240000	-	0	transcript "149"
Adh	Genie	stop_codon	1744620	1744622	0	-	0	transcript "149"
Adh	Genie	start_codon	1745913	1745915	0	-	0	transcript "149"
Adh	Genie	CDS	1746292	1746308	-0.898620	+	0	transcript "150"
Adh	Genie	start_codon	1746292	1746294	0	+	0	transcript "150"
Adh	Genie	CDS	1746401	1746842	44.773000	+	0	transcript "150"
Adh	Genie	stop_codon	1746840	1746842	0	+	0	transcript "150"
Adh	Genie	CDS	1747065	1747238	4.316400	-	0	transcript "151"
Adh	Genie	stop_codon	1747065	1747067	0	-	0	transcript "151"
Adh	Genie	CDS	1747451	1747757	30.192000	-	0	transcript "151"
Adh	Genie	CDS	1747825	1748093	23.447000	-	1	transcript "151"
Adh	Genie	CDS	1748156	1748310	21.005000	-	0	transcript "151"
Adh	Genie	CDS	1748434	1748590	8.617300	-	0	transcript "151"
Adh	Genie	CDS	1748671	1748943	43.556000	-	0	transcript "151"
Adh	Genie	CDS	1749089	1749100	-1.099900	-	0	transcript "151"
Adh	Genie	start_codon	1749098	1749100	0	-	0	transcript "151"
Adh	Genie	CDS	1751358	1751492	2.015700	-	0	transcript "152"
Adh	Genie	stop_codon	1751358	1751360	0	-	0	transcript "152"
Adh	Genie	CDS	1751564	1751652	-0.897740	-	0	transcript "152"
Adh	Genie	CDS	1751722	1751956	9.798200	-	0	transcript "152"
Adh	Genie	CDS	1752027	1752278	20.062000	-	0	transcript "152"
Adh	Genie	CDS	1752622	1752780	10.515000	-	0	transcript "152"
Adh	Genie	CDS	1752984	1753316	29.151000	-	0	transcript "152"
Adh	Genie	CDS	1753422	1753778	35.429000	-	0	transcript "152"
Adh	Genie	start_codon	1753776	1753778	0	-	0	transcript "152"
Adh	Genie	CDS	1756026	1756178	6.599000	-	0	transcript "153"
Adh	Genie	stop_codon	1756026	1756028	0	-	0	transcript "153"
Adh	Genie	CDS	1756248	1756386	11.448000	-	0	transcript "153"
Adh	Genie	CDS	1756448	1756671	7.635000	-	1	transcript "153"
Adh	Genie	CDS	1756797	1756939	6.568000	-	0	transcript "153"
Adh	Genie	CDS	1757005	1757119	-3.131000	-	0	transcript "153"
Adh	Genie	CDS	1757182	1757352	-2.755300	-	0	transcript "153"
Adh	Genie	CDS	1757415	1757585	-0.968630	-	0	transcript "153"
Adh	Genie	CDS	1757648	1758409	75.512000	-	0	transcript "153"
Adh	Genie	CDS	1758473	1758856	21.947000	-	0	transcript "153"
Adh	Genie	CDS	1759026	1759568	35.378000	-	0	transcript "153"
Adh	Genie	start_codon	1759566	1759568	0	-	0	transcript "153"
Adh	Genie	CDS	1763921	1764042	13.792000	-	0	transcript "154"
Adh	Genie	stop_codon	1763921	1763923	0	-	0	transcript "154"
Adh	Genie	CDS	1764272	1764501	26.108000	-	0	transcript "154"
Adh	Genie	CDS	1764574	1764638	4.108800	-	1	transcript "154"
Adh	Genie	start_codon	1764636	1764638	0	-	0	transcript "154"
Adh	Genie	CDS	1774781	1775557	60.106000	+	0	transcript "155"
Adh	Genie	start_codon	1774781	1774783	0	+	0	transcript "155"
Adh	Genie	stop_codon	1775555	1775557	0	+	0	transcript "155"
Adh	Genie	CDS	1781133	1781825	40.865000	-	0	transcript "156"
Adh	Genie	stop_codon	1781133	1781135	0	-	0	transcript "156"
Adh	Genie	start_codon	1781823	1781825	0	-	0	transcript "156"
Adh	Genie	CDS	1787599	1788915	89.121000	+	0	transcript "157"
Adh	Genie	start_codon	1787599	1787601	0	+	0	transcript "157"
Adh	Genie	stop_codon	1788913	1788915	0	+	0	transcript "157"
Adh	Genie	CDS	1807761	1808498	45.439000	-	0	transcript "169"
Adh	Genie	stop_codon	1807761	1807763	0	-	0	transcript "169"
Adh	Genie	start_codon	1808496	1808498	0	-	0	transcript "169"
Adh	Genie	CDS	1823746	1825158	195.170000	+	0	transcript "158"
Adh	Genie	start_codon	1823746	1823748	0	+	0	transcript "158"
Adh	Genie	stop_codon	1825156	1825158	0	+	0	transcript "158"
Adh	Genie	CDS	1850650	1851240	27.146000	-	0	transcript "159"
Adh	Genie	stop_codon	1850650	1850652	0	-	0	transcript "159"
Adh	Genie	start_codon	1851238	1851240	0	-	0	transcript "159"
Adh	Genie	CDS	1880956	1881043	10.579000	+	0	transcript "160"
Adh	Genie	start_codon	1880956	1880958	0	+	0	transcript "160"
Adh	Genie	CDS	1881643	1881824	19.202000	+	1	transcript "160"
Adh	Genie	stop_codon	1881822	1881824	0	+	0	transcript "160"
Adh	Genie	CDS	1913374	1914932	160.550000	-	0	transcript "161"
Adh	Genie	stop_codon	1913374	1913376	0	-	0	transcript "161"
Adh	Genie	CDS	1914995	1915082	7.886500	-	0	transcript "161"
Adh	Genie	start_codon	1915080	1915082	0	-	0	transcript "161"
Adh	Genie	CDS	1923109	1924563	79.103000	+	0	transcript "162"
Adh	Genie	start_codon	1923109	1923111	0	+	0	transcript "162"
Adh	Genie	stop_codon	1924561	1924563	0	+	0	transcript "162"
Adh	Genie	CDS	1936726	1937031	9.894400	+	0	transcript "163"
Adh	Genie	start_codon	1936726	1936728	0	+	0	transcript "163"
Adh	Genie	stop_codon	1937029	1937031	0	+	0	transcript "163"
Adh	Genie	CDS	1966586	1967758	181.240000	-	0	transcript "164"
Adh	Genie	stop_codon	1966586	1966588	0	-	0	transcript "164"
Adh	Genie	start_codon	1967756	1967758	0	-	0	transcript "164"
Adh	Genie	CDS	1974488	1975018	47.539000	+	0	transcript "165"
Adh	Genie	start_codon	1974488	1974490	0	+	0	transcript "165"
Adh	Genie	stop_codon	1975016	1975018	0	+	0	transcript "165"
Adh	Genie	CDS	1988872	1989153	20.611000	+	0	transcript "166"
Adh	Genie	start_codon	1988872	1988874	0	+	0	transcript "166"
Adh	Genie	stop_codon	1989151	1989153	0	+	0	transcript "166"
Adh	Genie	CDS	1991338	1991355	-0.998340	+	0	transcript "167"
Adh	Genie	start_codon	1991338	1991340	0	+	0	transcript "167"
Adh	Genie	CDS	1991768	1992877	102.860000	+	0	transcript "167"
Adh	Genie	CDS	1992942	1993204	22.211000	+	0	transcript "167"
Adh	Genie	CDS	1993350	1993566	23.985000	+	0	transcript "167"
Adh	Genie	stop_codon	1993564	1993566	0	+	0	transcript "167"
Adh	Genie	CDS	2040123	2040280	14.809000	+	0	transcript "170"
Adh	Genie	start_codon	2040123	2040125	0	+	0	transcript "170"
Adh	Genie	CDS	2040432	2040689	4.368000	+	0	transcript "170"
Adh	Genie	CDS	2040748	2040772	-9.333900	+	0	transcript "170"
Adh	Genie	stop_codon	2040770	2040772	0	+	0	transcript "170"
Adh	Genie	CDS	2068604	2070505	218.550000	+	0	transcript "171"
Adh	Genie	start_codon	2068604	2068606	0	+	0	transcript "171"
Adh	Genie	stop_codon	2070503	2070505	0	+	0	transcript "171"
Adh	Genie	CDS	2071157	2071173	0.290290	+	0	transcript "172"
Adh	Genie	start_codon	2071157	2071159	0	+	0	transcript "172"
Adh	Genie	CDS	2071510	2072677	134.250000	+	0	transcript "172"
Adh	Genie	stop_codon	2072675	2072677	0	+	0	transcript "172"
Adh	Genie	CDS	2100551	2101336	68.671000	-	0	transcript "188"
Adh	Genie	stop_codon	2100551	2100553	0	-	0	transcript "188"
Adh	Genie	start_codon	2101334	2101336	0	-	0	transcript "188"
Adh	Genie	CDS	2103622	2104169	37.875000	-	0	transcript "189"
Adh	Genie	stop_codon	2103622	2103624	0	-	0	transcript "189"
Adh	Genie	CDS	2104226	2104442	12.426000	-	0	transcript "189"
Adh	Genie	start_codon	2104440	2104442	0	-	0	transcript "189"
Adh	Genie	CDS	2105170	2105720	28.868000	-	0	transcript "190"
Adh	Genie	stop_codon	2105170	2105172	0	-	0	transcript "190"
Adh	Genie	CDS	2105774	2105970	-0.992050	-	0	transcript "190"
Adh	Genie	CDS	2106662	2106717	-3.319800	-	1	transcript "190"
Adh	Genie	start_codon	2106715	2106717	0	-	0	transcript "190"
Adh	Genie	CDS	2118335	2118551	12.315000	+	0	transcript "173"
Adh	Genie	start_codon	2118335	2118337	0	+	0	transcript "173"
Adh	Genie	CDS	2118614	2119161	33.902000	+	1	transcript "173"
Adh	Genie	stop_codon	2119159	2119161	0	+	0	transcript "173"
Adh	Genie	CDS	2119874	2120025	4.335600	+	0	transcript "174"
Adh	Genie	start_codon	2119874	2119876	0	+	0	transcript "174"
Adh	Genie	CDS	2120092	2120194	-0.705710	+	0	transcript "174"
Adh	Genie	CDS	2120312	2121269	84.484000	+	0	transcript "174"
Adh	Genie	CDS	2121336	2121745	24.388000	+	1	transcript "174"
Adh	Genie	stop_codon	2121743	2121745	0	+	0	transcript "174"
Adh	Genie	CDS	2137486	2137679	17.966000	-	0	transcript "175"
Adh	Genie	stop_codon	2137486	2137488	0	-	0	transcript "175"
Adh	Genie	CDS	2137746	2137902	9.717800	-	0	transcript "175"
Adh	Genie	CDS	2137961	2138116	-3.238100	-	0	transcript "175"
Adh	Genie	CDS	2138186	2138671	37.446000	-	0	transcript "175"
Adh	Genie	CDS	2138733	2138994	8.043700	-	0	transcript "175"
Adh	Genie	CDS	2139065	2139169	-3.226600	-	1	transcript "175"
Adh	Genie	CDS	2139824	2140056	26.368000	-	1	transcript "175"
Adh	Genie	CDS	2140148	2140353	11.527000	-	0	transcript "175"
Adh	Genie	CDS	2140417	2140630	6.515100	-	0	transcript "175"
Adh	Genie	CDS	2140705	2141412	64.568000	-	0	transcript "175"
Adh	Genie	CDS	2141468	2141749	25.699000	-	0	transcript "175"
Adh	Genie	CDS	2141998	2142465	84.197000	-	0	transcript "175"
Adh	Genie	start_codon	2142463	2142465	0	-	0	transcript "175"
Adh	Genie	CDS	2149418	2149510	-1.696100	+	0	transcript "176"
Adh	Genie	start_codon	2149418	2149420	0	+	0	transcript "176"
Adh	Genie	CDS	2149741	2150734	41.145000	+	0	transcript "176"
Adh	Genie	CDS	2151057	2151169	6.071600	+	1	transcript "176"
Adh	Genie	stop_codon	2151167	2151169	0	+	0	transcript "176"
Adh	Genie	CDS	2180707	2180982	44.465000	-	0	transcript "177"
Adh	Genie	stop_codon	2180707	2180709	0	-	0	transcript "177"
Adh	Genie	CDS	2181100	2181325	12.830000	-	0	transcript "177"
Adh	Genie	CDS	2181392	2182662	201.900000	-	1	transcript "177"
Adh	Genie	CDS	2182828	2182863	0.138180	-	0	transcript "177"
Adh	Genie	start_codon	2182861	2182863	0	-	0	transcript "177"
Adh	Genie	CDS	2201531	2201677	13.465000	-	0	transcript "191"
Adh	Genie	stop_codon	2201531	2201533	0	-	0	transcript "191"
Adh	Genie	CDS	2202376	2202477	6.738700	-	0	transcript "191"
Adh	Genie	CDS	2202548	2202802	47.091000	-	0	transcript "191"
Adh	Genie	start_codon	2202800	2202802	0	-	0	transcript "191"
Adh	Genie	CDS	2204183	2205278	146.040000	+	0	transcript "192"
Adh	Genie	start_codon	2204183	2204185	0	+	0	transcript "192"
Adh	Genie	CDS	2205332	2207403	253.720000	+	1	transcript "192"
Adh	Genie	stop_codon	2207401	2207403	0	+	0	transcript "192"
Adh	Genie	CDS	2208922	2209531	78.228000	-	0	transcript "193"
Adh	Genie	stop_codon	2208922	2208924	0	-	0	transcript "193"
Adh	Genie	CDS	2209593	2209904	29.968000	-	1	transcript "193"
Adh	Genie	CDS	2209967	2211186	121.070000	-	1	transcript "193"
Adh	Genie	CDS	2211243	2211671	57.165000	-	0	transcript "193"
Adh	Genie	CDS	2212036	2212128	0.131650	-	0	transcript "193"
Adh	Genie	CDS	2212212	2212220	-1.849300	-	0	transcript "193"
Adh	Genie	start_codon	2212218	2212220	0	-	0	transcript "193"
Adh	Genie	CDS	2216202	2216561	56.603000	+	0	transcript "194"
Adh	Genie	start_codon	2216202	2216204	0	+	0	transcript "194"
Adh	Genie	CDS	2216630	2217034	58.787000	+	0	transcript "194"
Adh	Genie	CDS	2217099	2217403	46.663000	+	0	transcript "194"
Adh	Genie	CDS	2217501	2217537	-4.513600	+	0	transcript "194"
Adh	Genie	stop_codon	2217535	2217537	0	+	0	transcript "194"
Adh	Genie	CDS	2218461	2218494	-0.148450	-	0	transcript "195"
Adh	Genie	stop_codon	2218461	2218463	0	-	0	transcript "195"
Adh	Genie	CDS	2218559	2218905	23.243000	-	1	transcript "195"
Adh	Genie	CDS	2218966	2219871	62.717000	-	0	transcript "195"
Adh	Genie	CDS	2219932	2220057	8.331900	-	0	transcript "195"
Adh	Genie	start_codon	2220055	2220057	0	-	0	transcript "195"
Adh	Genie	CDS	2220565	2222197	146.420000	-	0	transcript "196"
Adh	Genie	stop_codon	2220565	2220567	0	-	0	transcript "196"
Adh	Genie	CDS	2222257	2222379	3.756600	-	1	transcript "196"
Adh	Genie	CDS	2222435	2222667	10.700000	-	1	transcript "196"
Adh	Genie	CDS	2222723	2222818	0.153020	-	0	transcript "196"
Adh	Genie	CDS	2222876	2222890	-2.957800	-	0	transcript "196"
Adh	Genie	start_codon	2222888	2222890	0	-	0	transcript "196"
Adh	Genie	CDS	2223170	2223346	11.322000	-	0	transcript "197"
Adh	Genie	stop_codon	2223170	2223172	0	-	0	transcript "197"
Adh	Genie	CDS	2223403	2223556	3.468300	-	0	transcript "197"
Adh	Genie	CDS	2223854	2224229	47.521000	-	1	transcript "197"
Adh	Genie	CDS	2224289	2224367	4.631900	-	0	transcript "197"
Adh	Genie	start_codon	2224365	2224367	0	-	0	transcript "197"
Adh	Genie	CDS	2303448	2304641	130.210000	+	0	transcript "198"
Adh	Genie	start_codon	2303448	2303450	0	+	0	transcript "198"
Adh	Genie	stop_codon	2304639	2304641	0	+	0	transcript "198"
Adh	Genie	CDS	2305038	2305397	28.689000	+	0	transcript "199"
Adh	Genie	start_codon	2305038	2305040	0	+	0	transcript "199"
Adh	Genie	CDS	2305489	2305763	12.856000	+	0	transcript "199"
Adh	Genie	CDS	2305829	2306951	102.410000	+	0	transcript "199"
Adh	Genie	stop_codon	2306949	2306951	0	+	0	transcript "199"
Adh	Genie	CDS	2328290	2328403	-3.779300	-	0	transcript "178"
Adh	Genie	stop_codon	2328290	2328292	0	-	0	transcript "178"
Adh	Genie	CDS	2328611	2329967	56.281000	-	0	transcript "178"
Adh	Genie	CDS	2330026	2330181	1.204700	-	1	transcript "178"
Adh	Genie	CDS	2330235	2330344	0.108220	-	1	transcript "178"
Adh	Genie	start_codon	2330342	2330344	0	-	0	transcript "178"
Adh	Genie	CDS	2339377	2340420	45.738000	-	0	transcript "179"
Adh	Genie	stop_codon	2339377	2339379	0	-	0	transcript "179"
Adh	Genie	CDS	2340535	2341630	3.693900	-	0	transcript "179"
Adh	Genie	CDS	2341682	2341790	-8.486900	-	1	transcript "179"
Adh	Genie	CDS	2341973	2341993	-9.380700	-	0	transcript "179"
Adh	Genie	CDS	2342049	2342274	-3.916900	-	0	transcript "179"
Adh	Genie	CDS	2342341	2342492	-3.319400	-	0	transcript "179"
Adh	Genie	CDS	2342842	2343700	42.190000	-	0	transcript "179"
Adh	Genie	start_codon	2343698	2343700	0	-	0	transcript "179"
Adh	Genie	CDS	2349595	2349890	11.860000	-	0	transcript "180"
Adh	Genie	stop_codon	2349595	2349597	0	-	0	transcript "180"
Adh	Genie	CDS	2349968	2350893	53.532000	-	0	transcript "180"
Adh	Genie	CDS	2351765	2352026	5.369500	-	1	transcript "180"
Adh	Genie	CDS	2352080	2353052	69.399000	-	0	transcript "180"
Adh	Genie	start_codon	2353050	2353052	0	-	0	transcript "180"
Adh	Genie	CDS	2357064	2357090	-4.679200	-	0	transcript "181"
Adh	Genie	stop_codon	2357064	2357066	0	-	0	transcript "181"
Adh	Genie	CDS	2357224	2357480	12.321000	-	0	transcript "181"
Adh	Genie	CDS	2357539	2357674	11.472000	-	0	transcript "181"
Adh	Genie	CDS	2358742	2358953	7.540000	-	0	transcript "181"
Adh	Genie	CDS	2359091	2359130	-5.855600	-	0	transcript "181"
Adh	Genie	start_codon	2359128	2359130	0	-	0	transcript "181"
Adh	Genie	CDS	2374482	2375075	26.276000	+	0	transcript "182"
Adh	Genie	start_codon	2374482	2374484	0	+	0	transcript "182"
Adh	Genie	CDS	2375254	2375405	5.444300	+	0	transcript "182"
Adh	Genie	CDS	2377144	2377201	-4.832100	+	0	transcript "182"
Adh	Genie	stop_codon	2377199	2377201	0	+	0	transcript "182"
Adh	Genie	CDS	2392235	2392737	14.263000	+	0	transcript "183"
Adh	Genie	start_codon	2392235	2392237	0	+	0	transcript "183"
Adh	Genie	CDS	2392800	2393115	-6.510800	+	0	transcript "183"
Adh	Genie	stop_codon	2393113	2393115	0	+	0	transcript "183"
Adh	Genie	CDS	2428833	2429381	58.160000	+	0	transcript "184"
Adh	Genie	start_codon	2428833	2428835	0	+	0	transcript "184"
Adh	Genie	stop_codon	2429379	2429381	0	+	0	transcript "184"
Adh	Genie	CDS	2481671	2481850	8.111400	+	0	transcript "185"
Adh	Genie	start_codon	2481671	2481673	0	+	0	transcript "185"
Adh	Genie	CDS	2483447	2483582	11.326000	+	0	transcript "185"
Adh	Genie	CDS	2483839	2483972	-5.040400	+	1	transcript "185"
Adh	Genie	CDS	2484693	2484866	11.913000	+	0	transcript "185"
Adh	Genie	stop_codon	2484864	2484866	0	+	0	transcript "185"
Adh	Genie	CDS	2485924	2485932	-3.141100	+	0	transcript "186"
Adh	Genie	start_codon	2485924	2485926	0	+	0	transcript "186"
Adh	Genie	CDS	2486400	2486522	10.288000	+	0	transcript "186"
Adh	Genie	CDS	2486596	2486808	18.933000	+	0	transcript "186"
Adh	Genie	stop_codon	2486806	2486808	0	+	0	transcript "186"
Adh	Genie	CDS	2493344	2493620	33.917000	+	0	transcript "187"
Adh	Genie	start_codon	2493344	2493346	0	+	0	transcript "187"
Adh	Genie	CDS	2493682	2493731	-5.435500	+	1	transcript "187"
Adh	Genie	CDS	2494047	2494116	-5.286800	+	0	transcript "187"
Adh	Genie	CDS	2494180	2494259	2.885600	+	1	transcript "187"
Adh	Genie	CDS	2494325	2494651	43.869000	+	0	transcript "187"
Adh	Genie	CDS	2495100	2495225	9.476900	+	0	transcript "187"
Adh	Genie	CDS	2495286	2495667	55.740000	+	0	transcript "187"
Adh	Genie	CDS	2495861	2496988	183.770000	+	1	transcript "187"
Adh	Genie	CDS	2497217	2497464	46.977000	+	1	transcript "187"
Adh	Genie	stop_codon	2497462	2497464	0	+	0	transcript "187"
Adh	Genie	CDS	2528864	2528881	-1.526000	+	0	transcript "200"
Adh	Genie	start_codon	2528864	2528866	0	+	0	transcript "200"
Adh	Genie	CDS	2529073	2529195	-0.309760	+	0	transcript "200"
Adh	Genie	CDS	2529260	2529455	8.160900	+	0	transcript "200"
Adh	Genie	CDS	2529735	2530156	33.281000	+	1	transcript "200"
Adh	Genie	stop_codon	2530154	2530156	0	+	0	transcript "200"
Adh	Genie	CDS	2544295	2545124	57.144000	+	0	transcript "201"
Adh	Genie	start_codon	2544295	2544297	0	+	0	transcript "201"
Adh	Genie	CDS	2545309	2545387	-10.209000	+	0	transcript "201"
Adh	Genie	stop_codon	2545385	2545387	0	+	0	transcript "201"
Adh	Genie	CDS	2580916	2581059	11.316000	+	0	transcript "202"
Adh	Genie	start_codon	2580916	2580918	0	+	0	transcript "202"
Adh	Genie	stop_codon	2581057	2581059	0	+	0	transcript "202"
Adh	Genie	CDS	2583113	2583547	43.746000	+	0	transcript "203"
Adh	Genie	start_codon	2583113	2583115	0	+	0	transcript "203"
Adh	Genie	stop_codon	2583545	2583547	0	+	0	transcript "203"
Adh	Genie	CDS	2619156	2619165	-2.863300	+	0	transcript "204"
Adh	Genie	start_codon	2619156	2619158	0	+	0	transcript "204"
Adh	Genie	CDS	2619518	2620403	93.274000	+	1	transcript "204"
Adh	Genie	CDS	2621231	2622507	220.180000	+	0	transcript "204"
Adh	Genie	CDS	2622578	2622803	20.540000	+	1	transcript "204"
Adh	Genie	CDS	2623675	2623781	-5.712100	+	0	transcript "204"
Adh	Genie	CDS	2624114	2624266	-0.627910	+	1	transcript "204"
Adh	Genie	CDS	2624694	2624875	24.931000	+	1	transcript "204"
Adh	Genie	CDS	2624976	2625495	63.111000	+	0	transcript "204"
Adh	Genie	CDS	2625559	2625752	13.220000	+	1	transcript "204"
Adh	Genie	CDS	2626124	2626333	14.590000	+	0	transcript "204"
Adh	Genie	CDS	2626392	2626547	1.768800	+	0	transcript "204"
Adh	Genie	stop_codon	2626545	2626547	0	+	0	transcript "204"
Adh	Genie	CDS	2632071	2632090	-2.826100	+	0	transcript "205"
Adh	Genie	start_codon	2632071	2632073	0	+	0	transcript "205"
Adh	Genie	CDS	2632152	2632298	11.833000	+	0	transcript "205"
Adh	Genie	CDS	2632363	2632834	-7.683800	+	0	transcript "205"
Adh	Genie	CDS	2633272	2633337	-5.463000	+	0	transcript "205"
Adh	Genie	CDS	2633397	2633645	10.199000	+	0	transcript "205"
Adh	Genie	CDS	2633706	2634365	84.189000	+	0	transcript "205"
Adh	Genie	CDS	2634452	2634889	67.398000	+	0	transcript "205"
Adh	Genie	stop_codon	2634887	2634889	0	+	0	transcript "205"
Adh	Genie	CDS	2638322	2638414	2.386200	+	0	transcript "206"
Adh	Genie	start_codon	2638322	2638324	0	+	0	transcript "206"
Adh	Genie	CDS	2638470	2639006	60.615000	+	0	transcript "206"
Adh	Genie	stop_codon	2639004	2639006	0	+	0	transcript "206"
Adh	Genie	CDS	2660848	2661318	9.935500	+	0	transcript "207"
Adh	Genie	start_codon	2660848	2660850	0	+	0	transcript "207"
Adh	Genie	CDS	2661378	2662292	3.398200	+	0	transcript "207"
Adh	Genie	CDS	2662428	2662463	-7.439200	+	0	transcript "207"
Adh	Genie	stop_codon	2662461	2662463	0	+	0	transcript "207"
Adh	Genie	CDS	2683427	2683452	4.763900	+	0	transcript "208"
Adh	Genie	start_codon	2683427	2683429	0	+	0	transcript "208"
Adh	Genie	CDS	2684880	2686209	177.890000	+	0	transcript "208"
Adh	Genie	CDS	2686394	2686570	10.052000	+	0	transcript "208"
Adh	Genie	CDS	2686628	2686705	-0.550860	+	0	transcript "208"
Adh	Genie	CDS	2686770	2687146	44.148000	+	0	transcript "208"
Adh	Genie	CDS	2687211	2687359	10.852000	+	0	transcript "208"
Adh	Genie	CDS	2687415	2687920	79.657000	+	1	transcript "208"
Adh	Genie	CDS	2687988	2688230	20.025000	+	0	transcript "208"
Adh	Genie	CDS	2688302	2688395	-8.850700	+	0	transcript "208"
Adh	Genie	CDS	2688462	2688883	33.320000	+	1	transcript "208"
Adh	Genie	CDS	2689073	2689183	1.409900	+	0	transcript "208"
Adh	Genie	stop_codon	2689181	2689183	0	+	0	transcript "208"
Adh	Genie	CDS	2697858	2698028	13.509000	-	0	transcript "209"
Adh	Genie	stop_codon	2697858	2697860	0	-	0	transcript "209"
Adh	Genie	CDS	2698091	2698210	8.052300	-	0	transcript "209"
Adh	Genie	start_codon	2698208	2698210	0	-	0	transcript "209"
Adh	Genie	CDS	2707374	2707439	8.375600	+	0	transcript "234"
Adh	Genie	start_codon	2707374	2707376	0	+	0	transcript "234"
Adh	Genie	CDS	2707509	2708522	128.330000	+	0	transcript "234"
Adh	Genie	stop_codon	2708520	2708522	0	+	0	transcript "234"
Adh	Genie	CDS	2709485	2710765	113.480000	-	0	transcript "235"
Adh	Genie	stop_codon	2709485	2709487	0	-	0	transcript "235"
Adh	Genie	start_codon	2710763	2710765	0	-	0	transcript "235"
Adh	Genie	CDS	2711460	2711538	2.305900	+	0	transcript "236"
Adh	Genie	start_codon	2711460	2711462	0	+	0	transcript "236"
Adh	Genie	CDS	2711599	2711717	-0.836810	+	1	transcript "236"
Adh	Genie	CDS	2711781	2711853	-5.981400	+	0	transcript "236"
Adh	Genie	CDS	2711910	2712440	55.398000	+	1	transcript "236"
Adh	Genie	CDS	2712522	2712646	2.618800	+	1	transcript "236"
Adh	Genie	stop_codon	2712644	2712646	0	+	0	transcript "236"
Adh	Genie	CDS	2714781	2716277	272.530000	-	0	transcript "210"
Adh	Genie	stop_codon	2714781	2714783	0	-	0	transcript "210"
Adh	Genie	CDS	2716683	2716697	-1.801700	-	0	transcript "210"
Adh	Genie	start_codon	2716695	2716697	0	-	0	transcript "210"
Adh	Genie	CDS	2727707	2727754	-4.392600	-	0	transcript "211"
Adh	Genie	stop_codon	2727707	2727709	0	-	0	transcript "211"
Adh	Genie	CDS	2728123	2728429	28.086000	-	0	transcript "211"
Adh	Genie	CDS	2728798	2728847	0.039271	-	1	transcript "211"
Adh	Genie	start_codon	2728845	2728847	0	-	0	transcript "211"
Adh	Genie	CDS	2737704	2737731	-2.598300	+	0	transcript "212"
Adh	Genie	start_codon	2737704	2737706	0	+	0	transcript "212"
Adh	Genie	CDS	2737860	2738132	50.538000	+	1	transcript "212"
Adh	Genie	CDS	2738403	2739461	115.810000	+	1	transcript "212"
Adh	Genie	CDS	2739531	2740039	48.481000	+	1	transcript "212"
Adh	Genie	stop_codon	2740037	2740039	0	+	0	transcript "212"
Adh	Genie	CDS	2740542	2741090	57.903000	+	0	transcript "213"
Adh	Genie	start_codon	2740542	2740544	0	+	0	transcript "213"
Adh	Genie	stop_codon	2741088	2741090	0	+	0	transcript "213"
Adh	Genie	CDS	2741387	2741990	53.930000	-	0	transcript "214"
Adh	Genie	stop_codon	2741387	2741389	0	-	0	transcript "214"
Adh	Genie	CDS	2742220	2742230	-2.233500	-	1	transcript "214"
Adh	Genie	start_codon	2742228	2742230	0	-	0	transcript "214"
Adh	Genie	CDS	2743611	2745122	140.020000	+	0	transcript "215"
Adh	Genie	start_codon	2743611	2743613	0	+	0	transcript "215"
Adh	Genie	stop_codon	2745120	2745122	0	+	0	transcript "215"
Adh	Genie	CDS	2746815	2747453	59.714000	-	0	transcript "216"
Adh	Genie	stop_codon	2746815	2746817	0	-	0	transcript "216"
Adh	Genie	CDS	2748132	2748572	54.989000	-	0	transcript "216"
Adh	Genie	start_codon	2748570	2748572	0	-	0	transcript "216"
Adh	Genie	CDS	2749655	2749696	-3.998500	+	0	transcript "217"
Adh	Genie	start_codon	2749655	2749657	0	+	0	transcript "217"
Adh	Genie	CDS	2749753	2750868	78.489000	+	0	transcript "217"
Adh	Genie	stop_codon	2750866	2750868	0	+	0	transcript "217"
Adh	Genie	CDS	2751337	2751465	8.605300	-	0	transcript "218"
Adh	Genie	stop_codon	2751337	2751339	0	-	0	transcript "218"
Adh	Genie	CDS	2751521	2751736	15.372000	-	0	transcript "218"
Adh	Genie	start_codon	2751734	2751736	0	-	0	transcript "218"
Adh	Genie	CDS	2755219	2755580	37.251000	-	0	transcript "219"
Adh	Genie	stop_codon	2755219	2755221	0	-	0	transcript "219"
Adh	Genie	CDS	2755775	2755883	3.547500	-	0	transcript "219"
Adh	Genie	CDS	2755954	2756092	12.949000	-	0	transcript "219"
Adh	Genie	CDS	2756201	2756274	3.157900	-	1	transcript "219"
Adh	Genie	start_codon	2756272	2756274	0	-	0	transcript "219"
Adh	Genie	CDS	2756920	2757589	74.489000	+	0	transcript "220"
Adh	Genie	start_codon	2756920	2756922	0	+	0	transcript "220"
Adh	Genie	CDS	2757658	2758391	71.632000	+	1	transcript "220"
Adh	Genie	stop_codon	2758389	2758391	0	+	0	transcript "220"
Adh	Genie	CDS	2759163	2759190	-7.485200	-	0	transcript "221"
Adh	Genie	stop_codon	2759163	2759165	0	-	0	transcript "221"
Adh	Genie	CDS	2759260	2759403	2.355400	-	1	transcript "221"
Adh	Genie	CDS	2759527	2759639	-3.355800	-	1	transcript "221"
Adh	Genie	CDS	2759701	2759850	4.709800	-	0	transcript "221"
Adh	Genie	start_codon	2759848	2759850	0	-	0	transcript "221"
Adh	Genie	CDS	2760361	2760672	39.630000	+	0	transcript "222"
Adh	Genie	start_codon	2760361	2760363	0	+	0	transcript "222"
Adh	Genie	CDS	2760766	2761087	36.943000	+	0	transcript "222"
Adh	Genie	CDS	2761141	2762087	99.804000	+	1	transcript "222"
Adh	Genie	stop_codon	2762085	2762087	0	+	0	transcript "222"
Adh	Genie	CDS	2763693	2763992	44.181000	-	0	transcript "223"
Adh	Genie	stop_codon	2763693	2763695	0	-	0	transcript "223"
Adh	Genie	start_codon	2763990	2763992	0	-	0	transcript "223"
Adh	Genie	CDS	2772212	2772430	20.916000	-	0	transcript "224"
Adh	Genie	stop_codon	2772212	2772214	0	-	0	transcript "224"
Adh	Genie	CDS	2772600	2772777	19.593000	-	0	transcript "224"
Adh	Genie	CDS	2773593	2774287	88.394000	-	1	transcript "224"
Adh	Genie	start_codon	2774285	2774287	0	-	0	transcript "224"
Adh	Genie	CDS	2776429	2777295	55.672000	+	0	transcript "225"
Adh	Genie	start_codon	2776429	2776431	0	+	0	transcript "225"
Adh	Genie	stop_codon	2777293	2777295	0	+	0	transcript "225"
Adh	Genie	CDS	2777390	2777609	18.848000	-	0	transcript "226"
Adh	Genie	stop_codon	2777390	2777392	0	-	0	transcript "226"
Adh	Genie	CDS	2777672	2778342	63.593000	-	1	transcript "226"
Adh	Genie	start_codon	2778340	2778342	0	-	0	transcript "226"
Adh	Genie	CDS	2779268	2779279	-2.413600	+	0	transcript "227"
Adh	Genie	start_codon	2779268	2779270	0	+	0	transcript "227"
Adh	Genie	CDS	2779339	2779566	30.076000	+	0	transcript "227"
Adh	Genie	stop_codon	2779564	2779566	0	+	0	transcript "227"
Adh	Genie	CDS	2786019	2786051	-6.603400	-	0	transcript "228"
Adh	Genie	stop_codon	2786019	2786021	0	-	0	transcript "228"
Adh	Genie	CDS	2786105	2786724	-13.048000	-	0	transcript "228"
Adh	Genie	CDS	2786839	2787069	2.061600	-	0	transcript "228"
Adh	Genie	CDS	2787444	2787885	18.708000	-	0	transcript "228"
Adh	Genie	CDS	2787948	2788341	5.315800	-	0	transcript "228"
Adh	Genie	CDS	2788808	2789086	-2.006600	-	1	transcript "228"
Adh	Genie	CDS	2789143	2789555	10.375000	-	1	transcript "228"
Adh	Genie	CDS	2790007	2791015	-0.827880	-	0	transcript "228"
Adh	Genie	CDS	2791870	2792011	4.232500	-	1	transcript "228"
Adh	Genie	CDS	2792082	2792601	44.397000	-	0	transcript "228"
Adh	Genie	start_codon	2792599	2792601	0	-	0	transcript "228"
Adh	Genie	CDS	2793626	2798713	210.370000	-	0	transcript "229"
Adh	Genie	stop_codon	2793626	2793628	0	-	0	transcript "229"
Adh	Genie	start_codon	2798711	2798713	0	-	0	transcript "229"
Adh	Genie	CDS	2802355	2802394	-3.954200	+	0	transcript "237"
Adh	Genie	start_codon	2802355	2802357	0	+	0	transcript "237"
Adh	Genie	CDS	2802473	2802813	27.264000	+	1	transcript "237"
Adh	Genie	stop_codon	2802811	2802813	0	+	0	transcript "237"
Adh	Genie	CDS	2804442	2805730	227.740000	-	0	transcript "238"
Adh	Genie	stop_codon	2804442	2804444	0	-	0	transcript "238"
Adh	Genie	CDS	2805800	2805812	-2.477800	-	0	transcript "238"
Adh	Genie	start_codon	2805810	2805812	0	-	0	transcript "238"
Adh	Genie	CDS	2815178	2815829	55.309000	+	0	transcript "230"
Adh	Genie	start_codon	2815178	2815180	0	+	0	transcript "230"
Adh	Genie	CDS	2815894	2816135	-1.339700	+	1	transcript "230"
Adh	Genie	stop_codon	2816133	2816135	0	+	0	transcript "230"
Adh	Genie	CDS	2843324	2843386	5.943900	+	0	transcript "231"
Adh	Genie	start_codon	2843324	2843326	0	+	0	transcript "231"
Adh	Genie	stop_codon	2843384	2843386	0	+	0	transcript "231"
Adh	Genie	CDS	2853736	2854099	39.273000	-	0	transcript "232"
Adh	Genie	stop_codon	2853736	2853738	0	-	0	transcript "232"
Adh	Genie	CDS	2854197	2855182	70.274000	-	1	transcript "232"
Adh	Genie	start_codon	2855180	2855182	0	-	0	transcript "232"
Adh	Genie	CDS	2894707	2895247	43.958000	+	0	transcript "239"
Adh	Genie	start_codon	2894707	2894709	0	+	0	transcript "239"
Adh	Genie	CDS	2895319	2895977	33.530000	+	1	transcript "239"
Adh	Genie	stop_codon	2895975	2895977	0	+	0	transcript "239"
Adh	Genie	CDS	2898199	2898229	2.342300	+	0	transcript "240"
Adh	Genie	start_codon	2898199	2898201	0	+	0	transcript "240"
Adh	Genie	CDS	2898444	2899001	40.503000	+	1	transcript "240"
Adh	Genie	CDS	2899061	2899716	57.697000	+	1	transcript "240"
Adh	Genie	stop_codon	2899714	2899716	0	+	0	transcript "240"
Adh	Genie	CDS	2900448	2900565	-0.580870	+	0	transcript "241"
Adh	Genie	start_codon	2900448	2900450	0	+	0	transcript "241"
Adh	Genie	CDS	2900634	2901185	37.401000	+	1	transcript "241"
Adh	Genie	CDS	2901452	2902107	61.781000	+	1	transcript "241"
Adh	Genie	stop_codon	2902105	2902107	0	+	0	transcript "241"
Adh	Genie	CDS	2916879	2917012	24.868000	-	0	transcript "233"
Adh	Genie	stop_codon	2916879	2916881	0	-	0	transcript "233"
Adh	Genie	CDS	2917311	2917504	41.327000	-	0	transcript "233"
Adh	Genie	CDS	2917751	2917988	33.398000	-	1	transcript "233"
Adh	Genie	CDS	2918253	2918513	50.022000	-	0	transcript "233"
Adh	Genie	CDS	2918684	2918711	1.011700	-	0	transcript "233"
Adh	Genie	start_codon	2918709	2918711	0	-	0	transcript "233"
##gff-version 1
##GenieEST  EST integrated Submission 2
##date 99-7-23
#
# compfly: 1. Removed all TSS entries
#
#
#
Adh	GenieEST	CDS	12	58	-8.893800	-	0	transcript "1"
Adh	GenieEST	stop_codon	12	14	0	-	0	transcript "1"
Adh	GenieEST	CDS	124	441	25.605000	-	0	transcript "1"
Adh	GenieEST	CDS	2379	2862	73.384000	-	0	transcript "1"
Adh	GenieEST	CDS	3225	3452	44.678000	-	0	transcript "1"
Adh	GenieEST	start_codon	3450	3452	0	-	0	transcript "1"
Adh	GenieEST	CDS	6353	6378	-10.856000	-	0	transcript "2"
Adh	GenieEST	stop_codon	6353	6355	0	-	0	transcript "2"
Adh	GenieEST	CDS	6718	7012	52.546000	-	0	transcript "2"
Adh	GenieEST	CDS	7179	7231	4.253100	-	0	transcript "2"
Adh	GenieEST	CDS	28665	28744	-3.475400	-	0	transcript "2"
Adh	GenieEST	CDS	29160	29479	51.721000	-	1	transcript "2"
Adh	GenieEST	start_codon	29477	29479	0	-	0	transcript "2"
Adh	GenieEST	CDS	34783	34822	-1.418400	+	0	transcript "3"
Adh	GenieEST	start_codon	34783	34785	0	+	0	transcript "3"
Adh	GenieEST	CDS	34884	35332	38.456000	+	1	transcript "3"
Adh	GenieEST	stop_codon	35330	35332	0	+	0	transcript "3"
Adh	GenieEST	CDS	35433	35749	14.862000	-	0	transcript "4"
Adh	GenieEST	stop_codon	35433	35435	0	-	0	transcript "4"
Adh	GenieEST	CDS	35938	36226	23.090000	-	0	transcript "4"
Adh	GenieEST	start_codon	36224	36226	0	-	0	transcript "4"
Adh	GenieEST	CDS	36488	37315	72.179000	+	0	transcript "5"
Adh	GenieEST	start_codon	36488	36490	0	+	0	transcript "5"
Adh	GenieEST	stop_codon	37313	37315	0	+	0	transcript "5"
Adh	GenieEST	CDS	40843	40919	-2.635100	-	0	transcript "6"
Adh	GenieEST	stop_codon	40843	40845	0	-	0	transcript "6"
Adh	GenieEST	CDS	42887	43076	-4.201100	-	0	transcript "6"
Adh	GenieEST	start_codon	43074	43076	0	-	0	transcript "6"
Adh	GenieEST	CDS	89305	90750	81.106000	-	0	transcript "7"
Adh	GenieEST	stop_codon	89305	89307	0	-	0	transcript "7"
Adh	GenieEST	start_codon	90748	90750	0	-	0	transcript "7"
Adh	GenieEST	CDS	93123	93698	15.417000	-	0	transcript "8"
Adh	GenieEST	stop_codon	93123	93125	0	-	0	transcript "8"
Adh	GenieEST	start_codon	93696	93698	0	-	0	transcript "8"
Adh	GenieEST	CDS	103793	104344	20.593000	+	0	transcript "55"
Adh	GenieEST	start_codon	103793	103795	0	+	0	transcript "55"
Adh	GenieEST	stop_codon	104342	104344	0	+	0	transcript "55"
Adh	GenieEST	CDS	117056	117107	7.713200	+	0	transcript "9"
Adh	GenieEST	start_codon	117056	117058	0	+	0	transcript "9"
Adh	GenieEST	CDS	117406	117527	10.511000	+	1	transcript "9"
Adh	GenieEST	stop_codon	117525	117527	0	+	0	transcript "9"
Adh	GenieEST	CDS	124325	124954	68.934000	+	0	transcript "10"
Adh	GenieEST	start_codon	124325	124327	0	+	0	transcript "10"
Adh	GenieEST	stop_codon	124952	124954	0	+	0	transcript "10"
Adh	GenieEST	CDS	126817	126858	0.155620	+	0	transcript "11"
Adh	GenieEST	start_codon	126817	126819	0	+	0	transcript "11"
Adh	GenieEST	CDS	127146	127292	9.950700	+	0	transcript "11"
Adh	GenieEST	CDS	127771	127931	2.274300	+	0	transcript "11"
Adh	GenieEST	CDS	127991	128225	30.076000	+	0	transcript "11"
Adh	GenieEST	CDS	128296	129342	131.900000	+	0	transcript "11"
Adh	GenieEST	CDS	129401	129965	88.903000	+	0	transcript "11"
Adh	GenieEST	CDS	130136	130401	31.158000	+	1	transcript "11"
Adh	GenieEST	stop_codon	130399	130401	0	+	0	transcript "11"
Adh	GenieEST	CDS	131015	131248	41.281000	+	0	transcript "12"
Adh	GenieEST	start_codon	131015	131017	0	+	0	transcript "12"
Adh	GenieEST	stop_codon	131246	131248	0	+	0	transcript "12"
Adh	GenieEST	CDS	133458	133548	4.549900	-	0	transcript "13"
Adh	GenieEST	stop_codon	133458	133460	0	-	0	transcript "13"
Adh	GenieEST	CDS	133612	134233	71.023000	-	1	transcript "13"
Adh	GenieEST	CDS	134862	134967	11.918000	-	0	transcript "13"
Adh	GenieEST	start_codon	134965	134967	0	-	0	transcript "13"
Adh	GenieEST	CDS	159578	159874	37.047000	+	0	transcript "14"
Adh	GenieEST	start_codon	159578	159580	0	+	0	transcript "14"
Adh	GenieEST	CDS	161727	162105	31.487000	+	0	transcript "14"
Adh	GenieEST	CDS	162442	162557	10.899000	+	1	transcript "14"
Adh	GenieEST	CDS	162616	163137	79.679000	+	0	transcript "14"
Adh	GenieEST	CDS	164190	164417	21.761000	+	0	transcript "14"
Adh	GenieEST	stop_codon	164415	164417	0	+	0	transcript "14"
Adh	GenieEST	CDS	181255	181409	4.814000	-	0	transcript "15"
Adh	GenieEST	stop_codon	181255	181257	0	-	0	transcript "15"
Adh	GenieEST	CDS	183107	183551	44.401000	-	0	transcript "15"
Adh	GenieEST	CDS	183600	183635	-2.067600	-	0	transcript "15"
Adh	GenieEST	CDS	183699	183764	-0.591140	-	0	transcript "15"
Adh	GenieEST	CDS	183835	184040	21.644000	-	0	transcript "15"
Adh	GenieEST	CDS	184241	184282	-0.391800	-	0	transcript "15"
Adh	GenieEST	CDS	184388	184409	-1.916300	-	0	transcript "15"
Adh	GenieEST	start_codon	184407	184409	0	-	0	transcript "15"
Adh	GenieEST	CDS	202128	202646	35.713000	+	0	transcript "56"
Adh	GenieEST	start_codon	202128	202130	0	+	0	transcript "56"
Adh	GenieEST	CDS	202700	204199	134.440000	+	0	transcript "56"
Adh	GenieEST	stop_codon	204197	204199	0	+	0	transcript "56"
Adh	GenieEST	CDS	216144	216761	72.615000	-	0	transcript "16"
Adh	GenieEST	stop_codon	216144	216146	0	-	0	transcript "16"
Adh	GenieEST	CDS	216820	217121	29.538000	-	0	transcript "16"
Adh	GenieEST	CDS	217192	217226	-9.733700	-	0	transcript "16"
Adh	GenieEST	CDS	217600	217616	-2.043700	-	1	transcript "16"
Adh	GenieEST	start_codon	217614	217616	0	-	0	transcript "16"
Adh	GenieEST	CDS	229944	230462	96.650000	+	0	transcript "17"
Adh	GenieEST	start_codon	229944	229946	0	+	0	transcript "17"
Adh	GenieEST	stop_codon	230460	230462	0	+	0	transcript "17"
Adh	GenieEST	CDS	263721	263735	-0.738090	+	0	transcript "18"
Adh	GenieEST	start_codon	263721	263723	0	+	0	transcript "18"
Adh	GenieEST	CDS	265088	266322	101.610000	+	0	transcript "18"
Adh	GenieEST	CDS	266392	266619	9.524000	+	0	transcript "18"
Adh	GenieEST	CDS	266684	266867	0.802840	+	0	transcript "18"
Adh	GenieEST	CDS	266935	267073	3.253500	+	0	transcript "18"
Adh	GenieEST	CDS	267134	267234	1.168400	+	1	transcript "18"
Adh	GenieEST	stop_codon	267232	267234	0	+	0	transcript "18"
Adh	GenieEST	CDS	267633	267656	2.325000	+	0	transcript "19"
Adh	GenieEST	start_codon	267633	267635	0	+	0	transcript "19"
Adh	GenieEST	CDS	267912	268061	1.426700	+	0	transcript "19"
Adh	GenieEST	stop_codon	268059	268061	0	+	0	transcript "19"
Adh	GenieEST	CDS	268751	268798	1.940200	-	0	transcript "20"
Adh	GenieEST	stop_codon	268751	268753	0	-	0	transcript "20"
Adh	GenieEST	CDS	269006	269157	16.212000	-	0	transcript "20"
Adh	GenieEST	CDS	269222	269559	45.070000	-	0	transcript "20"
Adh	GenieEST	CDS	269629	269785	1.070900	-	1	transcript "20"
Adh	GenieEST	CDS	269849	269907	-1.524200	-	0	transcript "20"
Adh	GenieEST	CDS	270235	270314	6.550500	-	1	transcript "20"
Adh	GenieEST	start_codon	270312	270314	0	-	0	transcript "20"
Adh	GenieEST	CDS	274751	275848	167.190000	+	0	transcript "21"
Adh	GenieEST	start_codon	274751	274753	0	+	0	transcript "21"
Adh	GenieEST	stop_codon	275846	275848	0	+	0	transcript "21"
Adh	GenieEST	CDS	276361	276696	29.297000	-	0	transcript "22"
Adh	GenieEST	stop_codon	276361	276363	0	-	0	transcript "22"
Adh	GenieEST	CDS	276748	277188	38.485000	-	0	transcript "22"
Adh	GenieEST	start_codon	277186	277188	0	-	0	transcript "22"
Adh	GenieEST	CDS	277921	278103	6.440000	+	0	transcript "23"
Adh	GenieEST	start_codon	277921	277923	0	+	0	transcript "23"
Adh	GenieEST	CDS	278222	278345	-4.638900	+	0	transcript "23"
Adh	GenieEST	CDS	278537	278737	10.413000	+	1	transcript "23"
Adh	GenieEST	CDS	278802	279272	20.087000	+	1	transcript "23"
Adh	GenieEST	CDS	279548	279726	-3.015900	+	1	transcript "23"
Adh	GenieEST	CDS	280031	280247	11.078000	+	0	transcript "23"
Adh	GenieEST	CDS	280310	280610	19.682000	+	1	transcript "23"
Adh	GenieEST	CDS	280674	280986	16.831000	+	0	transcript "23"
Adh	GenieEST	CDS	281051	281202	-3.583300	+	0	transcript "23"
Adh	GenieEST	CDS	281264	281447	-9.390000	+	0	transcript "23"
Adh	GenieEST	CDS	281550	281787	16.961000	+	0	transcript "23"
Adh	GenieEST	CDS	281848	282471	26.817000	+	1	transcript "23"
Adh	GenieEST	CDS	282539	283541	67.621000	+	1	transcript "23"
Adh	GenieEST	CDS	283608	284052	28.347000	+	0	transcript "23"
Adh	GenieEST	stop_codon	284050	284052	0	+	0	transcript "23"
Adh	GenieEST	CDS	284770	284915	10.180000	+	0	transcript "24"
Adh	GenieEST	start_codon	284770	284772	0	+	0	transcript "24"
Adh	GenieEST	CDS	284969	285346	45.932000	+	0	transcript "24"
Adh	GenieEST	CDS	285416	286886	123.730000	+	0	transcript "24"
Adh	GenieEST	stop_codon	286884	286886	0	+	0	transcript "24"
Adh	GenieEST	CDS	287599	288379	102.040000	+	0	transcript "25"
Adh	GenieEST	start_codon	287599	287601	0	+	0	transcript "25"
Adh	GenieEST	CDS	288647	292689	446.560000	+	1	transcript "25"
Adh	GenieEST	CDS	292759	292896	4.791100	+	0	transcript "25"
Adh	GenieEST	stop_codon	292894	292896	0	+	0	transcript "25"
Adh	GenieEST	CDS	297680	297713	0.359620	+	0	transcript "57"
Adh	GenieEST	start_codon	297680	297682	0	+	0	transcript "57"
Adh	GenieEST	CDS	302560	302718	14.812000	+	1	transcript "57"
Adh	GenieEST	CDS	302786	303405	92.880000	+	1	transcript "57"
Adh	GenieEST	stop_codon	303403	303405	0	+	0	transcript "57"
Adh	GenieEST	CDS	303960	304272	0.105630	-	0	transcript "58"
Adh	GenieEST	stop_codon	303960	303962	0	-	0	transcript "58"
Adh	GenieEST	CDS	304330	305201	27.951000	-	1	transcript "58"
Adh	GenieEST	start_codon	305199	305201	0	-	0	transcript "58"
Adh	GenieEST	CDS	305396	305516	12.570000	+	0	transcript "59"
Adh	GenieEST	start_codon	305396	305398	0	+	0	transcript "59"
Adh	GenieEST	CDS	305577	305737	8.046600	+	1	transcript "59"
Adh	GenieEST	CDS	305803	306108	28.500000	+	0	transcript "59"
Adh	GenieEST	CDS	306230	306385	13.195000	+	0	transcript "59"
Adh	GenieEST	stop_codon	306383	306385	0	+	0	transcript "59"
Adh	GenieEST	CDS	306476	306985	22.905000	-	0	transcript "60"
Adh	GenieEST	stop_codon	306476	306478	0	-	0	transcript "60"
Adh	GenieEST	start_codon	306983	306985	0	-	0	transcript "60"
Adh	GenieEST	CDS	307965	309056	174.550000	+	0	transcript "61"
Adh	GenieEST	start_codon	307965	307967	0	+	0	transcript "61"
Adh	GenieEST	CDS	309110	309467	33.900000	+	0	transcript "61"
Adh	GenieEST	CDS	309530	310452	109.920000	+	1	transcript "61"
Adh	GenieEST	CDS	310517	311365	60.805000	+	0	transcript "61"
Adh	GenieEST	CDS	311428	312318	69.460000	+	0	transcript "61"
Adh	GenieEST	CDS	312387	313020	69.573000	+	0	transcript "61"
Adh	GenieEST	CDS	313086	313129	-10.839000	+	1	transcript "61"
Adh	GenieEST	stop_codon	313127	313129	0	+	0	transcript "61"
Adh	GenieEST	CDS	315138	315899	111.860000	+	0	transcript "26"
Adh	GenieEST	start_codon	315138	315140	0	+	0	transcript "26"
Adh	GenieEST	CDS	316433	316800	62.965000	+	0	transcript "26"
Adh	GenieEST	CDS	316865	317462	91.715000	+	0	transcript "26"
Adh	GenieEST	stop_codon	317460	317462	0	+	0	transcript "26"
Adh	GenieEST	CDS	317891	318548	73.170000	-	0	transcript "27"
Adh	GenieEST	stop_codon	317891	317893	0	-	0	transcript "27"
Adh	GenieEST	CDS	318608	319430	75.699000	-	1	transcript "27"
Adh	GenieEST	CDS	319486	321442	211.910000	-	0	transcript "27"
Adh	GenieEST	start_codon	321440	321442	0	-	0	transcript "27"
Adh	GenieEST	CDS	321967	323027	154.480000	-	0	transcript "28"
Adh	GenieEST	stop_codon	321967	321969	0	-	0	transcript "28"
Adh	GenieEST	CDS	323097	323169	7.790100	-	0	transcript "28"
Adh	GenieEST	start_codon	323167	323169	0	-	0	transcript "28"
Adh	GenieEST	CDS	323788	324885	126.260000	+	0	transcript "29"
Adh	GenieEST	start_codon	323788	323790	0	+	0	transcript "29"
Adh	GenieEST	CDS	324939	325223	20.843000	+	0	transcript "29"
Adh	GenieEST	stop_codon	325221	325223	0	+	0	transcript "29"
Adh	GenieEST	CDS	325240	325634	-8.033300	-	0	transcript "30"
Adh	GenieEST	stop_codon	325240	325242	0	-	0	transcript "30"
Adh	GenieEST	CDS	325689	326352	25.314000	-	0	transcript "30"
Adh	GenieEST	CDS	326412	326822	53.101000	-	0	transcript "30"
Adh	GenieEST	start_codon	326820	326822	0	-	0	transcript "30"
Adh	GenieEST	CDS	327175	328002	129.850000	+	0	transcript "31"
Adh	GenieEST	start_codon	327175	327177	0	+	0	transcript "31"
Adh	GenieEST	stop_codon	328000	328002	0	+	0	transcript "31"
Adh	GenieEST	CDS	328048	328357	34.136000	-	0	transcript "32"
Adh	GenieEST	stop_codon	328048	328050	0	-	0	transcript "32"
Adh	GenieEST	CDS	328473	328634	8.911700	-	1	transcript "32"
Adh	GenieEST	CDS	328690	328733	-3.199800	-	1	transcript "32"
Adh	GenieEST	start_codon	328731	328733	0	-	0	transcript "32"
Adh	GenieEST	CDS	329808	330183	47.338000	+	0	transcript "33"
Adh	GenieEST	start_codon	329808	329810	0	+	0	transcript "33"
Adh	GenieEST	CDS	331090	331184	-4.749500	+	1	transcript "33"
Adh	GenieEST	stop_codon	331182	331184	0	+	0	transcript "33"
Adh	GenieEST	CDS	334589	334786	12.218000	-	0	transcript "34"
Adh	GenieEST	stop_codon	334589	334591	0	-	0	transcript "34"
Adh	GenieEST	CDS	334847	335125	21.128000	-	0	transcript "34"
Adh	GenieEST	CDS	335195	335230	-3.998600	-	0	transcript "34"
Adh	GenieEST	start_codon	335228	335230	0	-	0	transcript "34"
Adh	GenieEST	CDS	336668	337323	52.024000	-	0	transcript "35"
Adh	GenieEST	stop_codon	336668	336670	0	-	0	transcript "35"
Adh	GenieEST	CDS	337379	337413	-5.745400	-	0	transcript "35"
Adh	GenieEST	CDS	338171	338879	101.290000	-	1	transcript "35"
Adh	GenieEST	CDS	338944	339013	7.482500	-	0	transcript "35"
Adh	GenieEST	start_codon	339011	339013	0	-	0	transcript "35"
Adh	GenieEST	CDS	340529	340634	11.726000	+	0	transcript "36"
Adh	GenieEST	start_codon	340529	340531	0	+	0	transcript "36"
Adh	GenieEST	CDS	340705	340870	12.403000	+	1	transcript "36"
Adh	GenieEST	CDS	340926	341517	89.596000	+	0	transcript "36"
Adh	GenieEST	stop_codon	341515	341517	0	+	0	transcript "36"
Adh	GenieEST	CDS	341713	341857	22.650000	+	0	transcript "37"
Adh	GenieEST	start_codon	341713	341715	0	+	0	transcript "37"
Adh	GenieEST	CDS	342003	342689	106.980000	+	1	transcript "37"
Adh	GenieEST	CDS	343143	343368	12.786000	+	1	transcript "37"
Adh	GenieEST	CDS	343432	343984	43.658000	+	0	transcript "37"
Adh	GenieEST	stop_codon	343982	343984	0	+	0	transcript "37"
Adh	GenieEST	CDS	346994	347038	-12.460000	-	0	transcript "38"
Adh	GenieEST	stop_codon	346994	346996	0	-	0	transcript "38"
Adh	GenieEST	CDS	356285	356311	-0.207320	-	0	transcript "38"
Adh	GenieEST	start_codon	356309	356311	0	-	0	transcript "38"
Adh	GenieEST	CDS	373286	373501	11.227000	+	0	transcript "39"
Adh	GenieEST	start_codon	373286	373288	0	+	0	transcript "39"
Adh	GenieEST	stop_codon	373499	373501	0	+	0	transcript "39"
Adh	GenieEST	CDS	384853	384925	-3.988200	+	0	transcript "40"
Adh	GenieEST	start_codon	384853	384855	0	+	0	transcript "40"
Adh	GenieEST	CDS	385051	385283	24.931000	+	1	transcript "40"
Adh	GenieEST	CDS	385717	385788	3.241100	+	0	transcript "40"
Adh	GenieEST	stop_codon	385786	385788	0	+	0	transcript "40"
Adh	GenieEST	CDS	388523	388657	3.871400	+	0	transcript "41"
Adh	GenieEST	start_codon	388523	388525	0	+	0	transcript "41"
Adh	GenieEST	CDS	388780	388921	4.675900	+	0	transcript "41"
Adh	GenieEST	CDS	389006	389140	14.841000	+	1	transcript "41"
Adh	GenieEST	CDS	389208	390491	191.370000	+	1	transcript "41"
Adh	GenieEST	CDS	390556	390673	0.323100	+	1	transcript "41"
Adh	GenieEST	CDS	390737	391112	44.058000	+	0	transcript "41"
Adh	GenieEST	CDS	391177	391500	38.133000	+	0	transcript "41"
Adh	GenieEST	stop_codon	391498	391500	0	+	0	transcript "41"
Adh	GenieEST	CDS	393573	393814	18.450000	-	0	transcript "42"
Adh	GenieEST	stop_codon	393573	393575	0	-	0	transcript "42"
Adh	GenieEST	CDS	393894	394052	12.181000	-	0	transcript "42"
Adh	GenieEST	CDS	394383	395732	168.090000	-	0	transcript "42"
Adh	GenieEST	CDS	395826	397468	207.330000	-	0	transcript "42"
Adh	GenieEST	CDS	397532	397682	11.068000	-	1	transcript "42"
Adh	GenieEST	CDS	398773	398794	-4.142000	-	0	transcript "42"
Adh	GenieEST	start_codon	398792	398794	0	-	0	transcript "42"
Adh	GenieEST	CDS	399301	399469	-11.319000	+	0	transcript "62"
Adh	GenieEST	start_codon	399301	399303	0	+	0	transcript "62"
Adh	GenieEST	CDS	400317	400345	-9.001700	+	1	transcript "62"
Adh	GenieEST	CDS	400398	400923	91.479000	+	0	transcript "62"
Adh	GenieEST	CDS	401350	401713	43.593000	+	1	transcript "62"
Adh	GenieEST	CDS	401775	402341	73.155000	+	0	transcript "62"
Adh	GenieEST	CDS	402399	402539	12.686000	+	0	transcript "62"
Adh	GenieEST	CDS	402607	402718	14.251000	+	0	transcript "62"
Adh	GenieEST	CDS	402844	402876	-9.848800	+	0	transcript "62"
Adh	GenieEST	CDS	403468	404414	52.020000	+	0	transcript "62"
Adh	GenieEST	CDS	404467	405027	22.727000	+	0	transcript "62"
Adh	GenieEST	CDS	405085	405391	15.486000	+	0	transcript "62"
Adh	GenieEST	stop_codon	405389	405391	0	+	0	transcript "62"
Adh	GenieEST	CDS	405952	406314	37.941000	+	0	transcript "63"
Adh	GenieEST	start_codon	405952	405954	0	+	0	transcript "63"
Adh	GenieEST	stop_codon	406312	406314	0	+	0	transcript "63"
Adh	GenieEST	CDS	408759	409001	26.832000	+	0	transcript "64"
Adh	GenieEST	start_codon	408759	408761	0	+	0	transcript "64"
Adh	GenieEST	CDS	409150	409656	59.432000	+	0	transcript "64"
Adh	GenieEST	CDS	410157	410315	14.059000	+	0	transcript "64"
Adh	GenieEST	CDS	410372	410612	25.504000	+	0	transcript "64"
Adh	GenieEST	CDS	410677	411401	52.507000	+	1	transcript "64"
Adh	GenieEST	CDS	411728	411831	-12.030000	+	0	transcript "64"
Adh	GenieEST	CDS	411898	412000	-5.267300	+	0	transcript "64"
Adh	GenieEST	stop_codon	411998	412000	0	+	0	transcript "64"
Adh	GenieEST	CDS	415576	416211	75.256000	-	0	transcript "43"
Adh	GenieEST	stop_codon	415576	415578	0	-	0	transcript "43"
Adh	GenieEST	CDS	416276	416749	86.237000	-	0	transcript "43"
Adh	GenieEST	CDS	417100	417111	-1.109900	-	0	transcript "43"
Adh	GenieEST	start_codon	417109	417111	0	-	0	transcript "43"
Adh	GenieEST	CDS	426746	427525	146.500000	-	0	transcript "44"
Adh	GenieEST	stop_codon	426746	426748	0	-	0	transcript "44"
Adh	GenieEST	start_codon	427523	427525	0	-	0	transcript "44"
Adh	GenieEST	CDS	438979	439800	140.060000	-	0	transcript "45"
Adh	GenieEST	stop_codon	438979	438981	0	-	0	transcript "45"
Adh	GenieEST	CDS	440839	440850	-2.874600	-	0	transcript "45"
Adh	GenieEST	start_codon	440848	440850	0	-	0	transcript "45"
Adh	GenieEST	CDS	448271	448290	-0.847070	+	0	transcript "46"
Adh	GenieEST	start_codon	448271	448273	0	+	0	transcript "46"
Adh	GenieEST	CDS	448467	448607	9.262700	+	0	transcript "46"
Adh	GenieEST	CDS	449015	449330	20.178000	+	0	transcript "46"
Adh	GenieEST	stop_codon	449328	449330	0	+	0	transcript "46"
Adh	GenieEST	CDS	451645	451914	26.155000	+	0	transcript "47"
Adh	GenieEST	start_codon	451645	451647	0	+	0	transcript "47"
Adh	GenieEST	stop_codon	451912	451914	0	+	0	transcript "47"
Adh	GenieEST	CDS	454701	454755	-0.308080	+	0	transcript "48"
Adh	GenieEST	start_codon	454701	454703	0	+	0	transcript "48"
Adh	GenieEST	CDS	454814	454931	1.564400	+	1	transcript "48"
Adh	GenieEST	CDS	454999	455702	69.604000	+	0	transcript "48"
Adh	GenieEST	CDS	455870	456263	31.935000	+	1	transcript "48"
Adh	GenieEST	CDS	457279	457488	5.405000	+	0	transcript "48"
Adh	GenieEST	CDS	457649	458206	25.663000	+	0	transcript "48"
Adh	GenieEST	CDS	458285	458488	12.755000	+	0	transcript "48"
Adh	GenieEST	CDS	458547	458802	7.621900	+	0	transcript "48"
Adh	GenieEST	stop_codon	458800	458802	0	+	0	transcript "48"
Adh	GenieEST	CDS	458837	459146	33.197000	-	0	transcript "49"
Adh	GenieEST	stop_codon	458837	458839	0	-	0	transcript "49"
Adh	GenieEST	CDS	459225	459761	66.611000	-	1	transcript "49"
Adh	GenieEST	CDS	460256	460653	46.632000	-	1	transcript "49"
Adh	GenieEST	CDS	460730	460959	-8.603400	-	0	transcript "49"
Adh	GenieEST	CDS	461268	461443	16.057000	-	0	transcript "49"
Adh	GenieEST	CDS	461500	461675	6.836200	-	1	transcript "49"
Adh	GenieEST	CDS	461823	461883	-10.814000	-	0	transcript "49"
Adh	GenieEST	CDS	462096	462584	43.863000	-	1	transcript "49"
Adh	GenieEST	CDS	462646	463209	69.520000	-	1	transcript "49"
Adh	GenieEST	CDS	463368	463657	40.621000	-	1	transcript "49"
Adh	GenieEST	start_codon	463655	463657	0	-	0	transcript "49"
Adh	GenieEST	CDS	464353	464549	6.740100	+	0	transcript "50"
Adh	GenieEST	start_codon	464353	464355	0	+	0	transcript "50"
Adh	GenieEST	CDS	464888	465434	69.426000	+	0	transcript "50"
Adh	GenieEST	stop_codon	465432	465434	0	+	0	transcript "50"
Adh	GenieEST	CDS	467979	469628	54.973000	-	0	transcript "51"
Adh	GenieEST	stop_codon	467979	467981	0	-	0	transcript "51"
Adh	GenieEST	CDS	470226	470396	-10.705000	-	0	transcript "51"
Adh	GenieEST	start_codon	470394	470396	0	-	0	transcript "51"
Adh	GenieEST	CDS	471109	471296	2.447600	+	0	transcript "52"
Adh	GenieEST	start_codon	471109	471111	0	+	0	transcript "52"
Adh	GenieEST	CDS	471441	471687	15.840000	+	0	transcript "52"
Adh	GenieEST	CDS	471752	471856	5.237500	+	0	transcript "52"
Adh	GenieEST	CDS	471944	472490	52.378000	+	0	transcript "52"
Adh	GenieEST	CDS	472557	472823	21.299000	+	1	transcript "52"
Adh	GenieEST	CDS	472965	473093	-1.081500	+	1	transcript "52"
Adh	GenieEST	CDS	473909	474023	-10.696000	+	1	transcript "52"
Adh	GenieEST	CDS	474087	474189	-6.057700	+	0	transcript "52"
Adh	GenieEST	CDS	474251	474306	-5.381900	+	0	transcript "52"
Adh	GenieEST	CDS	474365	475283	73.043000	+	0	transcript "52"
Adh	GenieEST	CDS	475427	476389	57.618000	+	0	transcript "52"
Adh	GenieEST	stop_codon	476387	476389	0	+	0	transcript "52"
Adh	GenieEST	CDS	477171	477490	25.992000	-	0	transcript "53"
Adh	GenieEST	stop_codon	477171	477173	0	-	0	transcript "53"
Adh	GenieEST	CDS	477548	479329	157.600000	-	0	transcript "53"
Adh	GenieEST	CDS	479386	479753	19.508000	-	0	transcript "53"
Adh	GenieEST	CDS	479815	479958	6.614600	-	1	transcript "53"
Adh	GenieEST	CDS	480147	480287	5.059100	-	1	transcript "53"
Adh	GenieEST	CDS	480343	480480	9.766900	-	1	transcript "53"
Adh	GenieEST	CDS	480586	480617	2.328000	-	1	transcript "53"
Adh	GenieEST	start_codon	480615	480617	0	-	0	transcript "53"
Adh	GenieEST	CDS	486682	487236	64.142000	-	0	transcript "54"
Adh	GenieEST	stop_codon	486682	486684	0	-	0	transcript "54"
Adh	GenieEST	start_codon	487234	487236	0	-	0	transcript "54"
Adh	GenieEST	CDS	507364	507393	-2.491400	+	0	transcript "65"
Adh	GenieEST	start_codon	507364	507366	0	+	0	transcript "65"
Adh	GenieEST	CDS	509536	509783	30.707000	+	0	transcript "65"
Adh	GenieEST	CDS	509881	510226	60.789000	+	0	transcript "65"
Adh	GenieEST	CDS	510287	510786	87.527000	+	0	transcript "65"
Adh	GenieEST	CDS	511784	512375	94.084000	+	0	transcript "65"
Adh	GenieEST	CDS	512435	512758	48.437000	+	0	transcript "65"
Adh	GenieEST	stop_codon	512756	512758	0	+	0	transcript "65"
Adh	GenieEST	CDS	513238	513912	102.390000	-	0	transcript "66"
Adh	GenieEST	stop_codon	513238	513240	0	-	0	transcript "66"
Adh	GenieEST	start_codon	513910	513912	0	-	0	transcript "66"
Adh	GenieEST	CDS	520781	521850	122.850000	+	0	transcript "67"
Adh	GenieEST	start_codon	520781	520783	0	+	0	transcript "67"
Adh	GenieEST	CDS	522013	522988	88.994000	+	0	transcript "67"
Adh	GenieEST	stop_codon	522986	522988	0	+	0	transcript "67"
Adh	GenieEST	CDS	541380	542513	122.200000	+	0	transcript "68"
Adh	GenieEST	start_codon	541380	541382	0	+	0	transcript "68"
Adh	GenieEST	stop_codon	542511	542513	0	+	0	transcript "68"
Adh	GenieEST	CDS	555360	555824	40.790000	+	0	transcript "69"
Adh	GenieEST	start_codon	555360	555362	0	+	0	transcript "69"
Adh	GenieEST	CDS	555920	556370	30.003000	+	0	transcript "69"
Adh	GenieEST	CDS	556436	556503	1.463100	+	1	transcript "69"
Adh	GenieEST	stop_codon	556501	556503	0	+	0	transcript "69"
Adh	GenieEST	CDS	570386	570745	30.570000	+	0	transcript "70"
Adh	GenieEST	start_codon	570386	570388	0	+	0	transcript "70"
Adh	GenieEST	stop_codon	570743	570745	0	+	0	transcript "70"
Adh	GenieEST	CDS	581768	581877	11.944000	+	0	transcript "71"
Adh	GenieEST	start_codon	581768	581770	0	+	0	transcript "71"
Adh	GenieEST	CDS	582235	582361	6.377200	+	0	transcript "71"
Adh	GenieEST	stop_codon	582359	582361	0	+	0	transcript "71"
Adh	GenieEST	CDS	598403	598796	56.574000	+	0	transcript "97"
Adh	GenieEST	start_codon	598403	598405	0	+	0	transcript "97"
Adh	GenieEST	CDS	598857	599119	24.534000	+	1	transcript "97"
Adh	GenieEST	CDS	599219	600433	106.310000	+	0	transcript "97"
Adh	GenieEST	stop_codon	600431	600433	0	+	0	transcript "97"
Adh	GenieEST	CDS	601945	602889	12.322000	-	0	transcript "98"
Adh	GenieEST	stop_codon	601945	601947	0	-	0	transcript "98"
Adh	GenieEST	CDS	602944	603000	1.701900	-	0	transcript "98"
Adh	GenieEST	start_codon	602998	603000	0	-	0	transcript "98"
Adh	GenieEST	CDS	603442	603723	10.382000	-	0	transcript "99"
Adh	GenieEST	stop_codon	603442	603444	0	-	0	transcript "99"
Adh	GenieEST	CDS	603886	603951	-5.125300	-	0	transcript "99"
Adh	GenieEST	CDS	604280	604323	-2.584100	-	0	transcript "99"
Adh	GenieEST	CDS	604411	604456	-4.444900	-	0	transcript "99"
Adh	GenieEST	start_codon	604454	604456	0	-	0	transcript "99"
Adh	GenieEST	CDS	650075	650110	-2.646100	+	0	transcript "72"
Adh	GenieEST	start_codon	650075	650077	0	+	0	transcript "72"
Adh	GenieEST	CDS	650611	651153	102.410000	+	0	transcript "72"
Adh	GenieEST	CDS	651278	651478	15.920000	+	0	transcript "72"
Adh	GenieEST	CDS	651583	652282	112.260000	+	0	transcript "72"
Adh	GenieEST	CDS	652397	652824	102.860000	+	1	transcript "72"
Adh	GenieEST	stop_codon	652822	652824	0	+	0	transcript "72"
Adh	GenieEST	CDS	657691	658001	15.595000	-	0	transcript "73"
Adh	GenieEST	stop_codon	657691	657693	0	-	0	transcript "73"
Adh	GenieEST	CDS	658058	658265	18.579000	-	0	transcript "73"
Adh	GenieEST	CDS	658326	658463	10.081000	-	0	transcript "73"
Adh	GenieEST	CDS	658526	660852	290.200000	-	0	transcript "73"
Adh	GenieEST	CDS	660917	661331	79.630000	-	0	transcript "73"
Adh	GenieEST	CDS	661834	661866	-0.860640	-	0	transcript "73"
Adh	GenieEST	start_codon	661864	661866	0	-	0	transcript "73"
Adh	GenieEST	CDS	679874	680889	126.190000	-	0	transcript "74"
Adh	GenieEST	stop_codon	679874	679876	0	-	0	transcript "74"
Adh	GenieEST	CDS	681018	681033	-1.737900	-	0	transcript "74"
Adh	GenieEST	start_codon	681031	681033	0	-	0	transcript "74"
Adh	GenieEST	CDS	682511	682771	1.846400	-	0	transcript "75"
Adh	GenieEST	stop_codon	682511	682513	0	-	0	transcript "75"
Adh	GenieEST	CDS	682831	682969	3.587900	-	0	transcript "75"
Adh	GenieEST	CDS	689469	689746	15.688000	-	1	transcript "75"
Adh	GenieEST	CDS	689811	689983	20.609000	-	0	transcript "75"
Adh	GenieEST	CDS	690663	691035	50.209000	-	0	transcript "75"
Adh	GenieEST	start_codon	691033	691035	0	-	0	transcript "75"
Adh	GenieEST	CDS	754773	754919	12.975000	+	0	transcript "76"
Adh	GenieEST	start_codon	754773	754775	0	+	0	transcript "76"
Adh	GenieEST	stop_codon	754917	754919	0	+	0	transcript "76"
Adh	GenieEST	CDS	757457	757873	47.792000	+	0	transcript "77"
Adh	GenieEST	start_codon	757457	757459	0	+	0	transcript "77"
Adh	GenieEST	stop_codon	757871	757873	0	+	0	transcript "77"
Adh	GenieEST	CDS	771216	771615	21.669000	+	0	transcript "78"
Adh	GenieEST	start_codon	771216	771218	0	+	0	transcript "78"
Adh	GenieEST	CDS	771955	772460	37.971000	+	1	transcript "78"
Adh	GenieEST	stop_codon	772458	772460	0	+	0	transcript "78"
Adh	GenieEST	CDS	779378	779413	-2.468700	+	0	transcript "79"
Adh	GenieEST	start_codon	779378	779380	0	+	0	transcript "79"
Adh	GenieEST	CDS	779692	781583	159.360000	+	0	transcript "79"
Adh	GenieEST	CDS	781886	782726	79.380000	+	0	transcript "79"
Adh	GenieEST	stop_codon	782724	782726	0	+	0	transcript "79"
Adh	GenieEST	CDS	801996	802961	116.510000	+	0	transcript "100"
Adh	GenieEST	start_codon	801996	801998	0	+	0	transcript "100"
Adh	GenieEST	stop_codon	802959	802961	0	+	0	transcript "100"
Adh	GenieEST	CDS	812924	812990	0.713830	+	0	transcript "80"
Adh	GenieEST	start_codon	812924	812926	0	+	0	transcript "80"
Adh	GenieEST	CDS	813291	814650	109.200000	+	1	transcript "80"
Adh	GenieEST	CDS	814726	814981	1.824500	+	0	transcript "80"
Adh	GenieEST	CDS	815046	815235	2.299600	+	0	transcript "80"
Adh	GenieEST	CDS	815317	815442	0.630260	+	1	transcript "80"
Adh	GenieEST	CDS	815528	817215	174.530000	+	1	transcript "80"
Adh	GenieEST	CDS	817273	818025	64.672000	+	0	transcript "80"
Adh	GenieEST	CDS	818086	818367	12.906000	+	0	transcript "80"
Adh	GenieEST	CDS	818447	818574	6.149600	+	0	transcript "80"
Adh	GenieEST	CDS	818633	819290	71.964000	+	0	transcript "80"
Adh	GenieEST	CDS	820171	820789	68.645000	+	0	transcript "80"
Adh	GenieEST	CDS	820846	820979	5.429300	+	1	transcript "80"
Adh	GenieEST	CDS	821037	821265	10.632000	+	0	transcript "80"
Adh	GenieEST	CDS	821333	821487	16.597000	+	1	transcript "80"
Adh	GenieEST	stop_codon	821485	821487	0	+	0	transcript "80"
Adh	GenieEST	CDS	822205	822454	10.460000	+	0	transcript "81"
Adh	GenieEST	start_codon	822205	822207	0	+	0	transcript "81"
Adh	GenieEST	CDS	822511	822848	20.375000	+	1	transcript "81"
Adh	GenieEST	CDS	822907	824011	69.757000	+	0	transcript "81"
Adh	GenieEST	CDS	824074	824822	39.780000	+	1	transcript "81"
Adh	GenieEST	CDS	824885	825688	59.063000	+	0	transcript "81"
Adh	GenieEST	CDS	825804	826423	15.824000	+	0	transcript "81"
Adh	GenieEST	CDS	826980	827087	-0.491250	+	0	transcript "81"
Adh	GenieEST	CDS	827148	827476	31.570000	+	0	transcript "81"
Adh	GenieEST	CDS	828063	828343	32.078000	+	1	transcript "81"
Adh	GenieEST	stop_codon	828341	828343	0	+	0	transcript "81"
Adh	GenieEST	CDS	832137	833672	151.590000	+	0	transcript "82"
Adh	GenieEST	start_codon	832137	832139	0	+	0	transcript "82"
Adh	GenieEST	stop_codon	833670	833672	0	+	0	transcript "82"
Adh	GenieEST	CDS	835092	835312	31.621000	+	0	transcript "83"
Adh	GenieEST	start_codon	835092	835094	0	+	0	transcript "83"
Adh	GenieEST	CDS	836514	837106	65.237000	+	0	transcript "83"
Adh	GenieEST	CDS	837173	837428	18.300000	+	1	transcript "83"
Adh	GenieEST	CDS	837486	837859	34.479000	+	0	transcript "83"
Adh	GenieEST	CDS	837919	838152	24.878000	+	1	transcript "83"
Adh	GenieEST	CDS	838217	839076	109.480000	+	1	transcript "83"
Adh	GenieEST	stop_codon	839074	839076	0	+	0	transcript "83"
Adh	GenieEST	CDS	839712	839872	-8.832400	-	0	transcript "84"
Adh	GenieEST	stop_codon	839712	839714	0	-	0	transcript "84"
Adh	GenieEST	CDS	840060	840448	18.918000	-	0	transcript "84"
Adh	GenieEST	CDS	841158	841333	-1.827000	-	1	transcript "84"
Adh	GenieEST	CDS	841389	841969	48.777000	-	0	transcript "84"
Adh	GenieEST	CDS	842034	842419	31.992000	-	0	transcript "84"
Adh	GenieEST	CDS	842969	843375	73.977000	-	1	transcript "84"
Adh	GenieEST	CDS	843445	843518	2.785500	-	0	transcript "84"
Adh	GenieEST	CDS	843799	843808	-1.136300	-	0	transcript "84"
Adh	GenieEST	start_codon	843806	843808	0	-	0	transcript "84"
Adh	GenieEST	CDS	845892	846056	10.361000	+	0	transcript "85"
Adh	GenieEST	start_codon	845892	845894	0	+	0	transcript "85"
Adh	GenieEST	CDS	846157	846339	-8.883200	+	0	transcript "85"
Adh	GenieEST	stop_codon	846337	846339	0	+	0	transcript "85"
Adh	GenieEST	CDS	846397	847372	135.720000	-	0	transcript "86"
Adh	GenieEST	stop_codon	846397	846399	0	-	0	transcript "86"
Adh	GenieEST	CDS	847433	848154	64.432000	-	1	transcript "86"
Adh	GenieEST	CDS	848208	848609	48.366000	-	0	transcript "86"
Adh	GenieEST	CDS	848668	848733	7.073700	-	0	transcript "86"
Adh	GenieEST	start_codon	848731	848733	0	-	0	transcript "86"
Adh	GenieEST	CDS	849268	849277	-1.559800	+	0	transcript "87"
Adh	GenieEST	start_codon	849268	849270	0	+	0	transcript "87"
Adh	GenieEST	CDS	851077	851190	10.665000	+	1	transcript "87"
Adh	GenieEST	CDS	851256	851436	16.138000	+	1	transcript "87"
Adh	GenieEST	CDS	851491	851673	17.969000	+	0	transcript "87"
Adh	GenieEST	CDS	851742	851919	21.041000	+	0	transcript "87"
Adh	GenieEST	stop_codon	851917	851919	0	+	0	transcript "87"
Adh	GenieEST	CDS	853116	855014	304.840000	+	0	transcript "88"
Adh	GenieEST	start_codon	853116	853118	0	+	0	transcript "88"
Adh	GenieEST	stop_codon	855012	855014	0	+	0	transcript "88"
Adh	GenieEST	CDS	855874	855922	1.880600	+	0	transcript "89"
Adh	GenieEST	start_codon	855874	855876	0	+	0	transcript "89"
Adh	GenieEST	CDS	855982	856031	-4.428900	+	1	transcript "89"
Adh	GenieEST	CDS	856092	856876	114.970000	+	0	transcript "89"
Adh	GenieEST	CDS	856942	858029	89.593000	+	0	transcript "89"
Adh	GenieEST	CDS	858109	858341	3.931200	+	1	transcript "89"
Adh	GenieEST	CDS	858418	858966	50.237000	+	0	transcript "89"
Adh	GenieEST	stop_codon	858964	858966	0	+	0	transcript "89"
Adh	GenieEST	CDS	870684	870866	13.644000	-	0	transcript "90"
Adh	GenieEST	stop_codon	870684	870686	0	-	0	transcript "90"
Adh	GenieEST	start_codon	870864	870866	0	-	0	transcript "90"
Adh	GenieEST	CDS	872557	872818	10.799000	-	0	transcript "91"
Adh	GenieEST	stop_codon	872557	872559	0	-	0	transcript "91"
Adh	GenieEST	CDS	872891	873131	17.889000	-	1	transcript "91"
Adh	GenieEST	CDS	873191	873321	0.446900	-	0	transcript "91"
Adh	GenieEST	CDS	873388	873527	2.295400	-	1	transcript "91"
Adh	GenieEST	CDS	873583	874124	41.511000	-	0	transcript "91"
Adh	GenieEST	CDS	874273	874541	7.269300	-	0	transcript "91"
Adh	GenieEST	CDS	874599	874870	19.296000	-	1	transcript "91"
Adh	GenieEST	start_codon	874868	874870	0	-	0	transcript "91"
Adh	GenieEST	CDS	884916	885676	113.080000	-	0	transcript "92"
Adh	GenieEST	stop_codon	884916	884918	0	-	0	transcript "92"
Adh	GenieEST	CDS	885967	886798	150.730000	-	0	transcript "92"
Adh	GenieEST	CDS	887891	887908	-2.451600	-	0	transcript "92"
Adh	GenieEST	start_codon	887906	887908	0	-	0	transcript "92"
Adh	GenieEST	CDS	910572	910742	6.497100	-	0	transcript "93"
Adh	GenieEST	stop_codon	910572	910574	0	-	0	transcript "93"
Adh	GenieEST	CDS	910801	911055	31.243000	-	0	transcript "93"
Adh	GenieEST	start_codon	911053	911055	0	-	0	transcript "93"
Adh	GenieEST	CDS	918151	918795	75.491000	-	0	transcript "94"
Adh	GenieEST	stop_codon	918151	918153	0	-	0	transcript "94"
Adh	GenieEST	CDS	918858	918869	-1.928000	-	0	transcript "94"
Adh	GenieEST	start_codon	918867	918869	0	-	0	transcript "94"
Adh	GenieEST	CDS	944218	944493	21.855000	-	0	transcript "95"
Adh	GenieEST	stop_codon	944218	944220	0	-	0	transcript "95"
Adh	GenieEST	start_codon	944491	944493	0	-	0	transcript "95"
Adh	GenieEST	CDS	984981	985070	6.638600	+	0	transcript "96"
Adh	GenieEST	start_codon	984981	984983	0	+	0	transcript "96"
Adh	GenieEST	CDS	985373	986896	277.490000	+	0	transcript "96"
Adh	GenieEST	stop_codon	986894	986896	0	+	0	transcript "96"
Adh	GenieEST	CDS	1041376	1041530	7.550600	-	0	transcript "101"
Adh	GenieEST	stop_codon	1041376	1041378	0	-	0	transcript "101"
Adh	GenieEST	CDS	1041602	1041989	21.581000	-	0	transcript "101"
Adh	GenieEST	CDS	1042386	1042688	28.998000	-	0	transcript "101"
Adh	GenieEST	start_codon	1042686	1042688	0	-	0	transcript "101"
Adh	GenieEST	CDS	1094414	1094610	6.346800	-	0	transcript "102"
Adh	GenieEST	stop_codon	1094414	1094416	0	-	0	transcript "102"
Adh	GenieEST	CDS	1094867	1095215	10.626000	-	0	transcript "102"
Adh	GenieEST	CDS	1095422	1095533	-2.338700	-	0	transcript "102"
Adh	GenieEST	CDS	1095586	1095735	9.619500	-	1	transcript "102"
Adh	GenieEST	CDS	1095848	1095987	5.042400	-	1	transcript "102"
Adh	GenieEST	CDS	1096062	1096196	9.104500	-	0	transcript "102"
Adh	GenieEST	CDS	1096326	1098979	304.150000	-	0	transcript "102"
Adh	GenieEST	CDS	1099099	1099111	-1.379500	-	0	transcript "102"
Adh	GenieEST	start_codon	1099109	1099111	0	-	0	transcript "102"
Adh	GenieEST	CDS	1104411	1104965	86.735000	-	0	transcript "129"
Adh	GenieEST	stop_codon	1104411	1104413	0	-	0	transcript "129"
Adh	GenieEST	start_codon	1104963	1104965	0	-	0	transcript "129"
Adh	GenieEST	CDS	1110074	1110172	16.149000	+	0	transcript "103"
Adh	GenieEST	start_codon	1110074	1110076	0	+	0	transcript "103"
Adh	GenieEST	CDS	1110238	1110642	91.938000	+	0	transcript "103"
Adh	GenieEST	CDS	1110713	1110979	44.173000	+	0	transcript "103"
Adh	GenieEST	stop_codon	1110977	1110979	0	+	0	transcript "103"
Adh	GenieEST	CDS	1111283	1111378	9.383100	+	0	transcript "104"
Adh	GenieEST	start_codon	1111283	1111285	0	+	0	transcript "104"
Adh	GenieEST	CDS	1111805	1112209	19.743000	+	0	transcript "104"
Adh	GenieEST	CDS	1112261	1112578	13.427000	+	0	transcript "104"
Adh	GenieEST	stop_codon	1112576	1112578	0	+	0	transcript "104"
Adh	GenieEST	CDS	1115807	1115987	7.158300	+	0	transcript "105"
Adh	GenieEST	start_codon	1115807	1115809	0	+	0	transcript "105"
Adh	GenieEST	CDS	1116315	1116493	16.016000	+	1	transcript "105"
Adh	GenieEST	stop_codon	1116491	1116493	0	+	0	transcript "105"
Adh	GenieEST	CDS	1117474	1117608	24.390000	+	0	transcript "106"
Adh	GenieEST	start_codon	1117474	1117476	0	+	0	transcript "106"
Adh	GenieEST	stop_codon	1117606	1117608	0	+	0	transcript "106"
Adh	GenieEST	CDS	1136212	1136258	-3.188700	-	0	transcript "107"
Adh	GenieEST	stop_codon	1136212	1136214	0	-	0	transcript "107"
Adh	GenieEST	CDS	1136483	1136509	-8.449000	-	0	transcript "107"
Adh	GenieEST	CDS	1145575	1145647	0.224460	-	0	transcript "107"
Adh	GenieEST	start_codon	1145645	1145647	0	-	0	transcript "107"
Adh	GenieEST	CDS	1206614	1206790	40.716000	+	0	transcript "130"
Adh	GenieEST	start_codon	1206614	1206616	0	+	0	transcript "130"
Adh	GenieEST	CDS	1207666	1207953	59.930000	+	0	transcript "130"
Adh	GenieEST	stop_codon	1207951	1207953	0	+	0	transcript "130"
Adh	GenieEST	CDS	1218630	1218652	-6.454600	-	0	transcript "108"
Adh	GenieEST	stop_codon	1218630	1218632	0	-	0	transcript "108"
Adh	GenieEST	CDS	1218756	1220253	31.350000	-	0	transcript "108"
Adh	GenieEST	CDS	1220453	1221762	10.474000	-	0	transcript "108"
Adh	GenieEST	CDS	1222288	1222395	1.781000	-	0	transcript "108"
Adh	GenieEST	CDS	1222483	1222579	-6.141500	-	0	transcript "108"
Adh	GenieEST	start_codon	1222577	1222579	0	-	0	transcript "108"
Adh	GenieEST	CDS	1229684	1230733	85.374000	+	0	transcript "109"
Adh	GenieEST	start_codon	1229684	1229686	0	+	0	transcript "109"
Adh	GenieEST	stop_codon	1230731	1230733	0	+	0	transcript "109"
Adh	GenieEST	CDS	1231127	1231384	65.899000	-	0	transcript "110"
Adh	GenieEST	stop_codon	1231127	1231129	0	-	0	transcript "110"
Adh	GenieEST	CDS	1231452	1231463	-2.119700	-	0	transcript "110"
Adh	GenieEST	start_codon	1231461	1231463	0	-	0	transcript "110"
Adh	GenieEST	CDS	1233087	1233293	38.174000	+	0	transcript "111"
Adh	GenieEST	start_codon	1233087	1233089	0	+	0	transcript "111"
Adh	GenieEST	stop_codon	1233291	1233293	0	+	0	transcript "111"
Adh	GenieEST	CDS	1250633	1251421	93.812000	+	0	transcript "112"
Adh	GenieEST	start_codon	1250633	1250635	0	+	0	transcript "112"
Adh	GenieEST	stop_codon	1251419	1251421	0	+	0	transcript "112"
Adh	GenieEST	CDS	1252523	1253617	68.034000	+	0	transcript "113"
Adh	GenieEST	start_codon	1252523	1252525	0	+	0	transcript "113"
Adh	GenieEST	stop_codon	1253615	1253617	0	+	0	transcript "113"
Adh	GenieEST	CDS	1255669	1256823	119.160000	+	0	transcript "114"
Adh	GenieEST	start_codon	1255669	1255671	0	+	0	transcript "114"
Adh	GenieEST	stop_codon	1256821	1256823	0	+	0	transcript "114"
Adh	GenieEST	CDS	1263535	1264034	-11.756000	-	0	transcript "115"
Adh	GenieEST	stop_codon	1263535	1263537	0	-	0	transcript "115"
Adh	GenieEST	CDS	1264126	1264237	-8.132700	-	0	transcript "115"
Adh	GenieEST	start_codon	1264235	1264237	0	-	0	transcript "115"
Adh	GenieEST	CDS	1271377	1272140	13.632000	-	0	transcript "116"
Adh	GenieEST	stop_codon	1271377	1271379	0	-	0	transcript "116"
Adh	GenieEST	CDS	1272217	1272271	0.605850	-	0	transcript "116"
Adh	GenieEST	start_codon	1272269	1272271	0	-	0	transcript "116"
Adh	GenieEST	CDS	1294081	1294187	-5.114300	-	0	transcript "117"
Adh	GenieEST	stop_codon	1294081	1294083	0	-	0	transcript "117"
Adh	GenieEST	CDS	1297137	1297461	-2.245000	-	0	transcript "117"
Adh	GenieEST	start_codon	1297459	1297461	0	-	0	transcript "117"
Adh	GenieEST	CDS	1334780	1335024	12.306000	-	0	transcript "118"
Adh	GenieEST	stop_codon	1334780	1334782	0	-	0	transcript "118"
Adh	GenieEST	CDS	1335080	1335356	11.423000	-	0	transcript "118"
Adh	GenieEST	CDS	1335416	1336157	45.509000	-	0	transcript "118"
Adh	GenieEST	CDS	1336453	1336720	2.078200	-	1	transcript "118"
Adh	GenieEST	CDS	1338337	1338640	33.416000	-	0	transcript "118"
Adh	GenieEST	CDS	1338702	1338785	9.234600	-	0	transcript "118"
Adh	GenieEST	start_codon	1338783	1338785	0	-	0	transcript "118"
Adh	GenieEST	CDS	1365077	1365100	-7.689600	-	0	transcript "119"
Adh	GenieEST	stop_codon	1365077	1365079	0	-	0	transcript "119"
Adh	GenieEST	CDS	1365170	1365361	12.666000	-	0	transcript "119"
Adh	GenieEST	CDS	1365421	1365611	0.834990	-	0	transcript "119"
Adh	GenieEST	CDS	1365666	1365732	5.211000	-	0	transcript "119"
Adh	GenieEST	start_codon	1365730	1365732	0	-	0	transcript "119"
Adh	GenieEST	CDS	1371868	1371921	0.380390	-	0	transcript "120"
Adh	GenieEST	stop_codon	1371868	1371870	0	-	0	transcript "120"
Adh	GenieEST	CDS	1371971	1372213	15.395000	-	0	transcript "120"
Adh	GenieEST	start_codon	1372211	1372213	0	-	0	transcript "120"
Adh	GenieEST	CDS	1372338	1372372	-5.657800	-	0	transcript "121"
Adh	GenieEST	stop_codon	1372338	1372340	0	-	0	transcript "121"
Adh	GenieEST	CDS	1373531	1373546	-2.234200	-	0	transcript "121"
Adh	GenieEST	start_codon	1373544	1373546	0	-	0	transcript "121"
Adh	GenieEST	CDS	1398183	1398833	89.997000	-	0	transcript "131"
Adh	GenieEST	stop_codon	1398183	1398185	0	-	0	transcript "131"
Adh	GenieEST	CDS	1399403	1399429	-1.532700	-	0	transcript "131"
Adh	GenieEST	start_codon	1399427	1399429	0	-	0	transcript "131"
Adh	GenieEST	CDS	1401419	1401445	-6.795300	-	0	transcript "132"
Adh	GenieEST	stop_codon	1401419	1401421	0	-	0	transcript "132"
Adh	GenieEST	CDS	1401633	1401874	42.690000	-	0	transcript "132"
Adh	GenieEST	CDS	1402535	1402643	2.930000	-	0	transcript "132"
Adh	GenieEST	CDS	1402808	1402995	15.412000	-	0	transcript "132"
Adh	GenieEST	CDS	1403930	1404047	8.017300	-	0	transcript "132"
Adh	GenieEST	start_codon	1404045	1404047	0	-	0	transcript "132"
Adh	GenieEST	CDS	1415492	1415566	-1.380300	+	0	transcript "122"
Adh	GenieEST	start_codon	1415492	1415494	0	+	0	transcript "122"
Adh	GenieEST	CDS	1415885	1416055	-8.786900	+	0	transcript "122"
Adh	GenieEST	CDS	1416197	1418081	144.810000	+	0	transcript "122"
Adh	GenieEST	CDS	1418142	1419321	94.855000	+	1	transcript "122"
Adh	GenieEST	CDS	1419378	1419918	18.692000	+	0	transcript "122"
Adh	GenieEST	stop_codon	1419916	1419918	0	+	0	transcript "122"
Adh	GenieEST	CDS	1425535	1425752	4.637200	-	0	transcript "123"
Adh	GenieEST	stop_codon	1425535	1425537	0	-	0	transcript "123"
Adh	GenieEST	CDS	1426168	1426258	7.701700	-	0	transcript "123"
Adh	GenieEST	start_codon	1426256	1426258	0	-	0	transcript "123"
Adh	GenieEST	CDS	1465977	1466019	-2.836900	-	0	transcript "124"
Adh	GenieEST	stop_codon	1465977	1465979	0	-	0	transcript "124"
Adh	GenieEST	CDS	1466153	1466744	85.975000	-	1	transcript "124"
Adh	GenieEST	CDS	1466876	1467307	33.471000	-	0	transcript "124"
Adh	GenieEST	CDS	1473611	1473745	5.442900	-	0	transcript "124"
Adh	GenieEST	CDS	1473857	1473914	-11.545000	-	0	transcript "124"
Adh	GenieEST	CDS	1481966	1482165	-9.343100	-	0	transcript "124"
Adh	GenieEST	CDS	1484357	1484396	-2.162100	-	0	transcript "124"
Adh	GenieEST	start_codon	1484394	1484396	0	-	0	transcript "124"
Adh	GenieEST	CDS	1495484	1495522	1.469100	+	0	transcript "125"
Adh	GenieEST	start_codon	1495484	1495486	0	+	0	transcript "125"
Adh	GenieEST	CDS	1495620	1495919	25.497000	+	0	transcript "125"
Adh	GenieEST	CDS	1495977	1496198	18.637000	+	0	transcript "125"
Adh	GenieEST	stop_codon	1496196	1496198	0	+	0	transcript "125"
Adh	GenieEST	CDS	1496304	1496815	76.325000	-	0	transcript "126"
Adh	GenieEST	stop_codon	1496304	1496306	0	-	0	transcript "126"
Adh	GenieEST	CDS	1496865	1497000	25.236000	-	0	transcript "126"
Adh	GenieEST	start_codon	1496998	1497000	0	-	0	transcript "126"
Adh	GenieEST	CDS	1497576	1498121	124.250000	+	0	transcript "127"
Adh	GenieEST	start_codon	1497576	1497578	0	+	0	transcript "127"
Adh	GenieEST	stop_codon	1498119	1498121	0	+	0	transcript "127"
Adh	GenieEST	CDS	1498334	1499046	65.715000	-	0	transcript "128"
Adh	GenieEST	stop_codon	1498334	1498336	0	-	0	transcript "128"
Adh	GenieEST	CDS	1499102	1499249	10.056000	-	0	transcript "128"
Adh	GenieEST	start_codon	1499247	1499249	0	-	0	transcript "128"
Adh	GenieEST	CDS	1500039	1500797	82.096000	+	0	transcript "133"
Adh	GenieEST	start_codon	1500039	1500041	0	+	0	transcript "133"
Adh	GenieEST	CDS	1500954	1501010	-2.097600	+	0	transcript "133"
Adh	GenieEST	stop_codon	1501008	1501010	0	+	0	transcript "133"
Adh	GenieEST	CDS	1515068	1515175	5.871800	+	0	transcript "134"
Adh	GenieEST	start_codon	1515068	1515070	0	+	0	transcript "134"
Adh	GenieEST	CDS	1515266	1515436	20.435000	+	0	transcript "134"
Adh	GenieEST	CDS	1515498	1515714	11.218000	+	0	transcript "134"
Adh	GenieEST	CDS	1515807	1515972	6.709800	+	1	transcript "134"
Adh	GenieEST	CDS	1516036	1516279	18.450000	+	0	transcript "134"
Adh	GenieEST	CDS	1516339	1516527	-2.014100	+	0	transcript "134"
Adh	GenieEST	stop_codon	1516525	1516527	0	+	0	transcript "134"
Adh	GenieEST	CDS	1519306	1519382	-2.829400	+	0	transcript "135"
Adh	GenieEST	start_codon	1519306	1519308	0	+	0	transcript "135"
Adh	GenieEST	CDS	1519441	1519564	-3.660600	+	0	transcript "135"
Adh	GenieEST	CDS	1519897	1520023	-7.102600	+	0	transcript "135"
Adh	GenieEST	CDS	1520081	1520337	11.739000	+	1	transcript "135"
Adh	GenieEST	CDS	1520398	1520535	-2.078900	+	0	transcript "135"
Adh	GenieEST	CDS	1521654	1521834	18.846000	+	0	transcript "135"
Adh	GenieEST	CDS	1522286	1522308	-8.716800	+	1	transcript "135"
Adh	GenieEST	stop_codon	1522306	1522308	0	+	0	transcript "135"
Adh	GenieEST	CDS	1525248	1525447	36.152000	+	0	transcript "136"
Adh	GenieEST	start_codon	1525248	1525250	0	+	0	transcript "136"
Adh	GenieEST	CDS	1526237	1526642	49.907000	+	0	transcript "136"
Adh	GenieEST	CDS	1526702	1527379	63.185000	+	0	transcript "136"
Adh	GenieEST	stop_codon	1527377	1527379	0	+	0	transcript "136"
Adh	GenieEST	CDS	1527523	1527636	8.675300	-	0	transcript "137"
Adh	GenieEST	stop_codon	1527523	1527525	0	-	0	transcript "137"
Adh	GenieEST	CDS	1527705	1528201	69.856000	-	0	transcript "137"
Adh	GenieEST	CDS	1528291	1528426	17.615000	-	0	transcript "137"
Adh	GenieEST	start_codon	1528424	1528426	0	-	0	transcript "137"
Adh	GenieEST	CDS	1529588	1529971	80.971000	+	0	transcript "138"
Adh	GenieEST	start_codon	1529588	1529590	0	+	0	transcript "138"
Adh	GenieEST	CDS	1530746	1531626	104.260000	+	0	transcript "138"
Adh	GenieEST	CDS	1531685	1531892	18.041000	+	0	transcript "138"
Adh	GenieEST	CDS	1531958	1532269	35.008000	+	0	transcript "138"
Adh	GenieEST	stop_codon	1532267	1532269	0	+	0	transcript "138"
Adh	GenieEST	CDS	1535065	1535271	-2.504300	-	0	transcript "139"
Adh	GenieEST	stop_codon	1535065	1535067	0	-	0	transcript "139"
Adh	GenieEST	CDS	1535341	1535461	-1.928100	-	0	transcript "139"
Adh	GenieEST	CDS	1535530	1535676	-3.039100	-	1	transcript "139"
Adh	GenieEST	CDS	1535739	1536304	53.865000	-	1	transcript "139"
Adh	GenieEST	CDS	1536364	1537150	67.782000	-	0	transcript "139"
Adh	GenieEST	CDS	1537212	1538662	122.580000	-	1	transcript "139"
Adh	GenieEST	CDS	1538719	1541113	170.440000	-	0	transcript "139"
Adh	GenieEST	CDS	1541178	1541378	6.934800	-	1	transcript "139"
Adh	GenieEST	CDS	1541445	1541794	14.039000	-	1	transcript "139"
Adh	GenieEST	CDS	1542125	1542385	42.652000	-	0	transcript "139"
Adh	GenieEST	CDS	1543103	1543173	-0.155980	-	0	transcript "139"
Adh	GenieEST	CDS	1547400	1547409	-1.787900	-	0	transcript "139"
Adh	GenieEST	start_codon	1547407	1547409	0	-	0	transcript "139"
Adh	GenieEST	CDS	1549142	1550017	162.070000	-	0	transcript "140"
Adh	GenieEST	stop_codon	1549142	1549144	0	-	0	transcript "140"
Adh	GenieEST	CDS	1550084	1550149	8.933300	-	0	transcript "140"
Adh	GenieEST	start_codon	1550147	1550149	0	-	0	transcript "140"
Adh	GenieEST	CDS	1554085	1554599	69.360000	-	0	transcript "141"
Adh	GenieEST	stop_codon	1554085	1554087	0	-	0	transcript "141"
Adh	GenieEST	CDS	1554841	1555107	40.725000	-	0	transcript "141"
Adh	GenieEST	CDS	1556588	1557278	107.790000	-	0	transcript "141"
Adh	GenieEST	start_codon	1557276	1557278	0	-	0	transcript "141"
Adh	GenieEST	CDS	1558057	1558080	-0.775290	+	0	transcript "142"
Adh	GenieEST	start_codon	1558057	1558059	0	+	0	transcript "142"
Adh	GenieEST	CDS	1558134	1558521	54.139000	+	0	transcript "142"
Adh	GenieEST	CDS	1558685	1558960	7.562300	+	1	transcript "142"
Adh	GenieEST	CDS	1559053	1559117	-3.361000	+	1	transcript "142"
Adh	GenieEST	stop_codon	1559115	1559117	0	+	0	transcript "142"
Adh	GenieEST	CDS	1562491	1563081	16.131000	+	0	transcript "143"
Adh	GenieEST	start_codon	1562491	1562493	0	+	0	transcript "143"
Adh	GenieEST	CDS	1563140	1563353	11.370000	+	0	transcript "143"
Adh	GenieEST	CDS	1563418	1563689	14.601000	+	1	transcript "143"
Adh	GenieEST	CDS	1563761	1563814	-0.682990	+	0	transcript "143"
Adh	GenieEST	stop_codon	1563812	1563814	0	+	0	transcript "143"
Adh	GenieEST	CDS	1565296	1565530	33.303000	+	0	transcript "144"
Adh	GenieEST	start_codon	1565296	1565298	0	+	0	transcript "144"
Adh	GenieEST	CDS	1566007	1566032	-5.226500	+	1	transcript "144"
Adh	GenieEST	stop_codon	1566030	1566032	0	+	0	transcript "144"
Adh	GenieEST	CDS	1576485	1576515	-3.331200	+	0	transcript "145"
Adh	GenieEST	start_codon	1576485	1576487	0	+	0	transcript "145"
Adh	GenieEST	CDS	1576691	1576943	8.151900	+	1	transcript "145"
Adh	GenieEST	CDS	1577036	1577406	49.371000	+	0	transcript "145"
Adh	GenieEST	CDS	1577568	1577860	11.645000	+	1	transcript "145"
Adh	GenieEST	CDS	1577926	1578108	10.510000	+	0	transcript "145"
Adh	GenieEST	stop_codon	1578106	1578108	0	+	0	transcript "145"
Adh	GenieEST	CDS	1580640	1580685	3.562700	+	0	transcript "146"
Adh	GenieEST	start_codon	1580640	1580642	0	+	0	transcript "146"
Adh	GenieEST	CDS	1580750	1580880	-3.640600	+	1	transcript "146"
Adh	GenieEST	CDS	1580946	1581227	15.101000	+	0	transcript "146"
Adh	GenieEST	CDS	1581294	1581623	13.812000	+	0	transcript "146"
Adh	GenieEST	CDS	1581774	1582136	39.592000	+	0	transcript "146"
Adh	GenieEST	CDS	1582201	1582292	0.821060	+	0	transcript "146"
Adh	GenieEST	CDS	1583070	1583334	18.473000	+	0	transcript "146"
Adh	GenieEST	CDS	1584330	1584828	60.419000	+	0	transcript "146"
Adh	GenieEST	CDS	1584949	1585094	20.028000	+	1	transcript "146"
Adh	GenieEST	CDS	1585153	1585380	15.833000	+	0	transcript "146"
Adh	GenieEST	stop_codon	1585378	1585380	0	+	0	transcript "146"
Adh	GenieEST	CDS	1599218	1600177	99.690000	+	0	transcript "170"
Adh	GenieEST	start_codon	1599218	1599220	0	+	0	transcript "170"
Adh	GenieEST	CDS	1601744	1602527	44.462000	+	0	transcript "170"
Adh	GenieEST	CDS	1603452	1603885	46.001000	+	1	transcript "170"
Adh	GenieEST	CDS	1603951	1605404	89.413000	+	0	transcript "170"
Adh	GenieEST	CDS	1605651	1606718	58.620000	+	0	transcript "170"
Adh	GenieEST	CDS	1606791	1607142	13.218000	+	0	transcript "170"
Adh	GenieEST	CDS	1607205	1607306	1.218200	+	0	transcript "170"
Adh	GenieEST	stop_codon	1607304	1607306	0	+	0	transcript "170"
Adh	GenieEST	CDS	1653232	1653414	18.635000	-	0	transcript "147"
Adh	GenieEST	stop_codon	1653232	1653234	0	-	0	transcript "147"
Adh	GenieEST	CDS	1653857	1657133	248.900000	-	0	transcript "147"
Adh	GenieEST	CDS	1657232	1657338	9.682700	-	1	transcript "147"
Adh	GenieEST	start_codon	1657336	1657338	0	-	0	transcript "147"
Adh	GenieEST	CDS	1667412	1667446	-5.767700	-	0	transcript "148"
Adh	GenieEST	stop_codon	1667412	1667414	0	-	0	transcript "148"
Adh	GenieEST	CDS	1667694	1667970	40.648000	-	0	transcript "148"
Adh	GenieEST	start_codon	1667968	1667970	0	-	0	transcript "148"
Adh	GenieEST	CDS	1718580	1718725	17.066000	-	0	transcript "149"
Adh	GenieEST	stop_codon	1718580	1718582	0	-	0	transcript "149"
Adh	GenieEST	CDS	1719195	1719342	8.610400	-	0	transcript "149"
Adh	GenieEST	CDS	1719504	1720004	59.547000	-	0	transcript "149"
Adh	GenieEST	start_codon	1720002	1720004	0	-	0	transcript "149"
Adh	GenieEST	CDS	1726252	1726435	18.276000	-	0	transcript "150"
Adh	GenieEST	stop_codon	1726252	1726254	0	-	0	transcript "150"
Adh	GenieEST	CDS	1730116	1730236	-0.531940	-	1	transcript "150"
Adh	GenieEST	CDS	1731062	1731172	3.575600	-	0	transcript "150"
Adh	GenieEST	CDS	1735826	1736004	1.676000	-	0	transcript "150"
Adh	GenieEST	CDS	1737215	1737246	-0.087101	-	1	transcript "150"
Adh	GenieEST	start_codon	1737244	1737246	0	-	0	transcript "150"
Adh	GenieEST	CDS	1738791	1739218	79.569000	+	0	transcript "151"
Adh	GenieEST	start_codon	1738791	1738793	0	+	0	transcript "151"
Adh	GenieEST	CDS	1740300	1740540	24.083000	+	0	transcript "151"
Adh	GenieEST	CDS	1740659	1740939	36.239000	+	0	transcript "151"
Adh	GenieEST	CDS	1740995	1742042	128.040000	+	0	transcript "151"
Adh	GenieEST	CDS	1742104	1742446	41.061000	+	0	transcript "151"
Adh	GenieEST	CDS	1742886	1743193	32.811000	+	1	transcript "151"
Adh	GenieEST	stop_codon	1743191	1743193	0	+	0	transcript "151"
Adh	GenieEST	CDS	1744620	1745915	173.240000	-	0	transcript "152"
Adh	GenieEST	stop_codon	1744620	1744622	0	-	0	transcript "152"
Adh	GenieEST	start_codon	1745913	1745915	0	-	0	transcript "152"
Adh	GenieEST	CDS	1746292	1746308	-0.898620	+	0	transcript "153"
Adh	GenieEST	start_codon	1746292	1746294	0	+	0	transcript "153"
Adh	GenieEST	CDS	1746401	1746842	44.773000	+	0	transcript "153"
Adh	GenieEST	stop_codon	1746840	1746842	0	+	0	transcript "153"
Adh	GenieEST	CDS	1747065	1747238	4.316400	-	0	transcript "154"
Adh	GenieEST	stop_codon	1747065	1747067	0	-	0	transcript "154"
Adh	GenieEST	CDS	1747451	1747757	30.192000	-	0	transcript "154"
Adh	GenieEST	CDS	1747825	1748093	23.447000	-	1	transcript "154"
Adh	GenieEST	CDS	1748156	1748310	21.005000	-	0	transcript "154"
Adh	GenieEST	CDS	1748434	1748590	8.617300	-	0	transcript "154"
Adh	GenieEST	CDS	1748671	1748943	43.556000	-	0	transcript "154"
Adh	GenieEST	CDS	1749089	1749100	-1.099900	-	0	transcript "154"
Adh	GenieEST	start_codon	1749098	1749100	0	-	0	transcript "154"
Adh	GenieEST	CDS	1751358	1751492	2.015700	-	0	transcript "155"
Adh	GenieEST	stop_codon	1751358	1751360	0	-	0	transcript "155"
Adh	GenieEST	CDS	1751564	1751652	-0.897740	-	0	transcript "155"
Adh	GenieEST	CDS	1751722	1751956	9.798200	-	0	transcript "155"
Adh	GenieEST	CDS	1752027	1752278	20.062000	-	0	transcript "155"
Adh	GenieEST	CDS	1752622	1752780	10.515000	-	0	transcript "155"
Adh	GenieEST	CDS	1752984	1753316	29.151000	-	0	transcript "155"
Adh	GenieEST	CDS	1753422	1753778	35.429000	-	0	transcript "155"
Adh	GenieEST	start_codon	1753776	1753778	0	-	0	transcript "155"
Adh	GenieEST	CDS	1756026	1756178	6.599000	-	0	transcript "156"
Adh	GenieEST	stop_codon	1756026	1756028	0	-	0	transcript "156"
Adh	GenieEST	CDS	1756248	1756386	11.448000	-	0	transcript "156"
Adh	GenieEST	CDS	1756448	1756671	7.635000	-	1	transcript "156"
Adh	GenieEST	CDS	1756797	1756939	6.568000	-	0	transcript "156"
Adh	GenieEST	CDS	1757005	1757119	-3.131000	-	0	transcript "156"
Adh	GenieEST	CDS	1757182	1757352	-2.755300	-	0	transcript "156"
Adh	GenieEST	CDS	1757415	1757585	-0.968630	-	0	transcript "156"
Adh	GenieEST	CDS	1757648	1758409	75.512000	-	0	transcript "156"
Adh	GenieEST	CDS	1758473	1758856	21.947000	-	0	transcript "156"
Adh	GenieEST	CDS	1760557	1760678	6.174300	-	0	transcript "156"
Adh	GenieEST	CDS	1760768	1760795	-9.303900	-	0	transcript "156"
Adh	GenieEST	CDS	1761621	1761674	-1.216300	-	0	transcript "156"
Adh	GenieEST	start_codon	1761672	1761674	0	-	0	transcript "156"
Adh	GenieEST	CDS	1763921	1764042	13.792000	-	0	transcript "157"
Adh	GenieEST	stop_codon	1763921	1763923	0	-	0	transcript "157"
Adh	GenieEST	CDS	1764272	1764501	26.108000	-	0	transcript "157"
Adh	GenieEST	CDS	1764574	1764638	4.108800	-	1	transcript "157"
Adh	GenieEST	start_codon	1764636	1764638	0	-	0	transcript "157"
Adh	GenieEST	CDS	1774781	1775557	60.106000	+	0	transcript "158"
Adh	GenieEST	start_codon	1774781	1774783	0	+	0	transcript "158"
Adh	GenieEST	stop_codon	1775555	1775557	0	+	0	transcript "158"
Adh	GenieEST	CDS	1781133	1781825	40.865000	-	0	transcript "159"
Adh	GenieEST	stop_codon	1781133	1781135	0	-	0	transcript "159"
Adh	GenieEST	start_codon	1781823	1781825	0	-	0	transcript "159"
Adh	GenieEST	CDS	1787599	1788915	89.121000	+	0	transcript "160"
Adh	GenieEST	start_codon	1787599	1787601	0	+	0	transcript "160"
Adh	GenieEST	stop_codon	1788913	1788915	0	+	0	transcript "160"
Adh	GenieEST	CDS	1807761	1808498	45.439000	-	0	transcript "171"
Adh	GenieEST	stop_codon	1807761	1807763	0	-	0	transcript "171"
Adh	GenieEST	start_codon	1808496	1808498	0	-	0	transcript "171"
Adh	GenieEST	CDS	1823746	1825158	195.170000	+	0	transcript "161"
Adh	GenieEST	start_codon	1823746	1823748	0	+	0	transcript "161"
Adh	GenieEST	stop_codon	1825156	1825158	0	+	0	transcript "161"
Adh	GenieEST	CDS	1850650	1851240	27.146000	-	0	transcript "162"
Adh	GenieEST	stop_codon	1850650	1850652	0	-	0	transcript "162"
Adh	GenieEST	start_codon	1851238	1851240	0	-	0	transcript "162"
Adh	GenieEST	CDS	1880956	1881043	10.579000	+	0	transcript "163"
Adh	GenieEST	start_codon	1880956	1880958	0	+	0	transcript "163"
Adh	GenieEST	CDS	1881643	1881824	19.202000	+	1	transcript "163"
Adh	GenieEST	stop_codon	1881822	1881824	0	+	0	transcript "163"
Adh	GenieEST	CDS	1913374	1914932	160.550000	-	0	transcript "164"
Adh	GenieEST	stop_codon	1913374	1913376	0	-	0	transcript "164"
Adh	GenieEST	CDS	1914995	1915082	7.886500	-	0	transcript "164"
Adh	GenieEST	start_codon	1915080	1915082	0	-	0	transcript "164"
Adh	GenieEST	CDS	1923109	1924563	79.103000	+	0	transcript "165"
Adh	GenieEST	start_codon	1923109	1923111	0	+	0	transcript "165"
Adh	GenieEST	stop_codon	1924561	1924563	0	+	0	transcript "165"
Adh	GenieEST	CDS	1936726	1937031	9.894400	+	0	transcript "166"
Adh	GenieEST	start_codon	1936726	1936728	0	+	0	transcript "166"
Adh	GenieEST	stop_codon	1937029	1937031	0	+	0	transcript "166"
Adh	GenieEST	CDS	1966586	1967758	181.240000	-	0	transcript "167"
Adh	GenieEST	stop_codon	1966586	1966588	0	-	0	transcript "167"
Adh	GenieEST	start_codon	1967756	1967758	0	-	0	transcript "167"
Adh	GenieEST	CDS	1974488	1975018	47.539000	+	0	transcript "168"
Adh	GenieEST	start_codon	1974488	1974490	0	+	0	transcript "168"
Adh	GenieEST	stop_codon	1975016	1975018	0	+	0	transcript "168"
Adh	GenieEST	CDS	1988872	1989075	20.217000	+	0	transcript "169"
Adh	GenieEST	start_codon	1988872	1988874	0	+	0	transcript "169"
Adh	GenieEST	CDS	1991768	1992877	102.860000	+	0	transcript "169"
Adh	GenieEST	CDS	1992942	1993204	22.211000	+	0	transcript "169"
Adh	GenieEST	CDS	1993350	1993566	23.985000	+	0	transcript "169"
Adh	GenieEST	stop_codon	1993564	1993566	0	+	0	transcript "169"
Adh	GenieEST	CDS	2040123	2040280	14.809000	+	0	transcript "172"
Adh	GenieEST	start_codon	2040123	2040125	0	+	0	transcript "172"
Adh	GenieEST	CDS	2040432	2040689	4.368000	+	0	transcript "172"
Adh	GenieEST	CDS	2040748	2040772	-9.333900	+	0	transcript "172"
Adh	GenieEST	stop_codon	2040770	2040772	0	+	0	transcript "172"
Adh	GenieEST	CDS	2068604	2070501	213.670000	+	0	transcript "173"
Adh	GenieEST	start_codon	2068604	2068606	0	+	0	transcript "173"
Adh	GenieEST	CDS	2071510	2072677	134.250000	+	0	transcript "173"
Adh	GenieEST	stop_codon	2072675	2072677	0	+	0	transcript "173"
Adh	GenieEST	CDS	2100551	2101336	68.671000	-	0	transcript "189"
Adh	GenieEST	stop_codon	2100551	2100553	0	-	0	transcript "189"
Adh	GenieEST	start_codon	2101334	2101336	0	-	0	transcript "189"
Adh	GenieEST	CDS	2103622	2104169	37.875000	-	0	transcript "190"
Adh	GenieEST	stop_codon	2103622	2103624	0	-	0	transcript "190"
Adh	GenieEST	CDS	2104226	2104442	12.426000	-	0	transcript "190"
Adh	GenieEST	start_codon	2104440	2104442	0	-	0	transcript "190"
Adh	GenieEST	CDS	2105170	2105720	28.868000	-	0	transcript "191"
Adh	GenieEST	stop_codon	2105170	2105172	0	-	0	transcript "191"
Adh	GenieEST	CDS	2105774	2105970	-0.992050	-	0	transcript "191"
Adh	GenieEST	CDS	2106662	2106717	-3.319800	-	1	transcript "191"
Adh	GenieEST	start_codon	2106715	2106717	0	-	0	transcript "191"
Adh	GenieEST	CDS	2118335	2118551	12.315000	+	0	transcript "174"
Adh	GenieEST	start_codon	2118335	2118337	0	+	0	transcript "174"
Adh	GenieEST	CDS	2118614	2119161	33.902000	+	1	transcript "174"
Adh	GenieEST	stop_codon	2119159	2119161	0	+	0	transcript "174"
Adh	GenieEST	CDS	2119874	2120025	4.335600	+	0	transcript "175"
Adh	GenieEST	start_codon	2119874	2119876	0	+	0	transcript "175"
Adh	GenieEST	CDS	2120092	2120194	-0.705710	+	0	transcript "175"
Adh	GenieEST	CDS	2120312	2121269	84.484000	+	0	transcript "175"
Adh	GenieEST	CDS	2121336	2121745	24.388000	+	1	transcript "175"
Adh	GenieEST	stop_codon	2121743	2121745	0	+	0	transcript "175"
Adh	GenieEST	CDS	2137486	2137679	17.966000	-	0	transcript "176"
Adh	GenieEST	stop_codon	2137486	2137488	0	-	0	transcript "176"
Adh	GenieEST	CDS	2137746	2137902	9.717800	-	0	transcript "176"
Adh	GenieEST	CDS	2137961	2138116	-3.238100	-	0	transcript "176"
Adh	GenieEST	CDS	2138186	2138671	37.446000	-	0	transcript "176"
Adh	GenieEST	CDS	2138733	2138994	8.043700	-	0	transcript "176"
Adh	GenieEST	CDS	2139065	2139169	-3.226600	-	1	transcript "176"
Adh	GenieEST	CDS	2139824	2140056	26.368000	-	1	transcript "176"
Adh	GenieEST	CDS	2140148	2140353	11.527000	-	0	transcript "176"
Adh	GenieEST	CDS	2140417	2140630	6.515100	-	0	transcript "176"
Adh	GenieEST	CDS	2140705	2141412	64.568000	-	0	transcript "176"
Adh	GenieEST	CDS	2141468	2141749	25.699000	-	0	transcript "176"
Adh	GenieEST	CDS	2141998	2142465	84.197000	-	0	transcript "176"
Adh	GenieEST	start_codon	2142463	2142465	0	-	0	transcript "176"
Adh	GenieEST	CDS	2149418	2149510	-1.696100	+	0	transcript "177"
Adh	GenieEST	start_codon	2149418	2149420	0	+	0	transcript "177"
Adh	GenieEST	CDS	2149741	2150734	41.145000	+	0	transcript "177"
Adh	GenieEST	CDS	2151057	2151169	6.071600	+	1	transcript "177"
Adh	GenieEST	stop_codon	2151167	2151169	0	+	0	transcript "177"
Adh	GenieEST	CDS	2180707	2180982	39.139000	-	0	transcript "192"
Adh	GenieEST	stop_codon	2180707	2180709	0	-	0	transcript "192"
Adh	GenieEST	CDS	2181100	2181325	10.738000	-	0	transcript "192"
Adh	GenieEST	CDS	2181392	2182662	184.190000	-	1	transcript "192"
Adh	GenieEST	CDS	2189454	2189790	8.765300	-	0	transcript "192"
Adh	GenieEST	CDS	2192626	2192725	-13.060000	-	1	transcript "192"
Adh	GenieEST	CDS	2199659	2199764	-2.211300	-	0	transcript "192"
Adh	GenieEST	start_codon	2199762	2199764	0	-	0	transcript "192"
Adh	GenieEST	CDS	2201531	2201677	13.748000	-	0	transcript "193"
Adh	GenieEST	stop_codon	2201531	2201533	0	-	0	transcript "193"
Adh	GenieEST	CDS	2202376	2202477	6.884700	-	0	transcript "193"
Adh	GenieEST	CDS	2202548	2202802	47.739000	-	0	transcript "193"
Adh	GenieEST	start_codon	2202800	2202802	0	-	0	transcript "193"
Adh	GenieEST	CDS	2204183	2205278	146.840000	+	0	transcript "194"
Adh	GenieEST	start_codon	2204183	2204185	0	+	0	transcript "194"
Adh	GenieEST	CDS	2205332	2207403	254.790000	+	1	transcript "194"
Adh	GenieEST	stop_codon	2207401	2207403	0	+	0	transcript "194"
Adh	GenieEST	CDS	2208922	2209531	79.802000	-	0	transcript "195"
Adh	GenieEST	stop_codon	2208922	2208924	0	-	0	transcript "195"
Adh	GenieEST	CDS	2209593	2209904	30.197000	-	1	transcript "195"
Adh	GenieEST	CDS	2209967	2211186	122.400000	-	1	transcript "195"
Adh	GenieEST	CDS	2211243	2211671	57.730000	-	0	transcript "195"
Adh	GenieEST	CDS	2212036	2212128	0.328570	-	0	transcript "195"
Adh	GenieEST	CDS	2212212	2212220	-1.856500	-	0	transcript "195"
Adh	GenieEST	start_codon	2212218	2212220	0	-	0	transcript "195"
Adh	GenieEST	CDS	2216202	2216447	41.837000	+	0	transcript "196"
Adh	GenieEST	start_codon	2216202	2216204	0	+	0	transcript "196"
Adh	GenieEST	CDS	2216609	2217034	63.310000	+	0	transcript "196"
Adh	GenieEST	CDS	2217099	2217403	47.179000	+	0	transcript "196"
Adh	GenieEST	CDS	2217501	2217537	-4.518600	+	0	transcript "196"
Adh	GenieEST	stop_codon	2217535	2217537	0	+	0	transcript "196"
Adh	GenieEST	CDS	2218461	2218494	-0.024883	-	0	transcript "197"
Adh	GenieEST	stop_codon	2218461	2218463	0	-	0	transcript "197"
Adh	GenieEST	CDS	2218559	2218905	24.071000	-	1	transcript "197"
Adh	GenieEST	CDS	2218966	2219871	64.497000	-	0	transcript "197"
Adh	GenieEST	CDS	2219932	2220057	8.451900	-	0	transcript "197"
Adh	GenieEST	start_codon	2220055	2220057	0	-	0	transcript "197"
Adh	GenieEST	CDS	2220565	2222197	149.130000	-	0	transcript "198"
Adh	GenieEST	stop_codon	2220565	2220567	0	-	0	transcript "198"
Adh	GenieEST	CDS	2222257	2222379	3.912100	-	1	transcript "198"
Adh	GenieEST	CDS	2222435	2222667	10.918000	-	1	transcript "198"
Adh	GenieEST	CDS	2222723	2222818	0.261080	-	0	transcript "198"
Adh	GenieEST	CDS	2222876	2222890	-2.973800	-	0	transcript "198"
Adh	GenieEST	start_codon	2222888	2222890	0	-	0	transcript "198"
Adh	GenieEST	CDS	2223170	2223346	11.638000	-	0	transcript "199"
Adh	GenieEST	stop_codon	2223170	2223172	0	-	0	transcript "199"
Adh	GenieEST	CDS	2223403	2223556	3.527500	-	0	transcript "199"
Adh	GenieEST	CDS	2223854	2224229	47.923000	-	1	transcript "199"
Adh	GenieEST	CDS	2224289	2224367	4.695800	-	0	transcript "199"
Adh	GenieEST	start_codon	2224365	2224367	0	-	0	transcript "199"
Adh	GenieEST	CDS	2303448	2304641	130.210000	+	0	transcript "200"
Adh	GenieEST	start_codon	2303448	2303450	0	+	0	transcript "200"
Adh	GenieEST	stop_codon	2304639	2304641	0	+	0	transcript "200"
Adh	GenieEST	CDS	2305038	2305397	28.689000	+	0	transcript "201"
Adh	GenieEST	start_codon	2305038	2305040	0	+	0	transcript "201"
Adh	GenieEST	CDS	2305489	2305763	12.856000	+	0	transcript "201"
Adh	GenieEST	CDS	2305829	2306951	102.410000	+	0	transcript "201"
Adh	GenieEST	stop_codon	2306949	2306951	0	+	0	transcript "201"
Adh	GenieEST	CDS	2328290	2328403	-3.779300	-	0	transcript "178"
Adh	GenieEST	stop_codon	2328290	2328292	0	-	0	transcript "178"
Adh	GenieEST	CDS	2328611	2329967	56.281000	-	0	transcript "178"
Adh	GenieEST	CDS	2330026	2330181	1.204700	-	1	transcript "178"
Adh	GenieEST	CDS	2330235	2330344	0.108220	-	1	transcript "178"
Adh	GenieEST	start_codon	2330342	2330344	0	-	0	transcript "178"
Adh	GenieEST	CDS	2339377	2340420	45.738000	-	0	transcript "179"
Adh	GenieEST	stop_codon	2339377	2339379	0	-	0	transcript "179"
Adh	GenieEST	CDS	2340535	2341630	3.693900	-	0	transcript "179"
Adh	GenieEST	CDS	2341682	2341790	-8.486900	-	1	transcript "179"
Adh	GenieEST	CDS	2341973	2341993	-9.380700	-	0	transcript "179"
Adh	GenieEST	CDS	2342049	2342274	-3.916900	-	0	transcript "179"
Adh	GenieEST	CDS	2342341	2342492	-3.319400	-	0	transcript "179"
Adh	GenieEST	CDS	2342842	2343700	42.190000	-	0	transcript "179"
Adh	GenieEST	start_codon	2343698	2343700	0	-	0	transcript "179"
Adh	GenieEST	CDS	2349595	2349890	11.860000	-	0	transcript "180"
Adh	GenieEST	stop_codon	2349595	2349597	0	-	0	transcript "180"
Adh	GenieEST	CDS	2349968	2350893	53.532000	-	0	transcript "180"
Adh	GenieEST	CDS	2351765	2352026	5.369500	-	1	transcript "180"
Adh	GenieEST	CDS	2352080	2353052	69.399000	-	0	transcript "180"
Adh	GenieEST	start_codon	2353050	2353052	0	-	0	transcript "180"
Adh	GenieEST	CDS	2357064	2357090	-4.679200	-	0	transcript "181"
Adh	GenieEST	stop_codon	2357064	2357066	0	-	0	transcript "181"
Adh	GenieEST	CDS	2357224	2357480	12.321000	-	0	transcript "181"
Adh	GenieEST	CDS	2357539	2357674	11.472000	-	0	transcript "181"
Adh	GenieEST	CDS	2358742	2358953	7.540000	-	0	transcript "181"
Adh	GenieEST	CDS	2359091	2359130	-5.855600	-	0	transcript "181"
Adh	GenieEST	start_codon	2359128	2359130	0	-	0	transcript "181"
Adh	GenieEST	CDS	2374157	2374294	-5.608100	+	0	transcript "182"
Adh	GenieEST	start_codon	2374157	2374159	0	+	0	transcript "182"
Adh	GenieEST	CDS	2374356	2375075	21.245000	+	0	transcript "182"
Adh	GenieEST	CDS	2375254	2375405	5.444300	+	0	transcript "182"
Adh	GenieEST	CDS	2377144	2377201	-4.832100	+	0	transcript "182"
Adh	GenieEST	stop_codon	2377199	2377201	0	+	0	transcript "182"
Adh	GenieEST	CDS	2392235	2392737	14.263000	+	0	transcript "183"
Adh	GenieEST	start_codon	2392235	2392237	0	+	0	transcript "183"
Adh	GenieEST	CDS	2392800	2393115	-6.510800	+	0	transcript "183"
Adh	GenieEST	stop_codon	2393113	2393115	0	+	0	transcript "183"
Adh	GenieEST	CDS	2428833	2429381	58.160000	+	0	transcript "184"
Adh	GenieEST	start_codon	2428833	2428835	0	+	0	transcript "184"
Adh	GenieEST	stop_codon	2429379	2429381	0	+	0	transcript "184"
Adh	GenieEST	CDS	2453955	2454115	17.440000	+	0	transcript "185"
Adh	GenieEST	start_codon	2453955	2453957	0	+	0	transcript "185"
Adh	GenieEST	CDS	2454180	2454275	-4.696000	+	0	transcript "185"
Adh	GenieEST	CDS	2454348	2454498	1.371100	+	0	transcript "185"
Adh	GenieEST	stop_codon	2454496	2454498	0	+	0	transcript "185"
Adh	GenieEST	CDS	2481671	2481850	8.111400	+	0	transcript "186"
Adh	GenieEST	start_codon	2481671	2481673	0	+	0	transcript "186"
Adh	GenieEST	CDS	2483447	2483582	11.326000	+	0	transcript "186"
Adh	GenieEST	CDS	2483839	2483972	-5.040400	+	1	transcript "186"
Adh	GenieEST	CDS	2484693	2484866	11.913000	+	0	transcript "186"
Adh	GenieEST	stop_codon	2484864	2484866	0	+	0	transcript "186"
Adh	GenieEST	CDS	2485924	2485932	-3.141100	+	0	transcript "187"
Adh	GenieEST	start_codon	2485924	2485926	0	+	0	transcript "187"
Adh	GenieEST	CDS	2486400	2486522	10.288000	+	0	transcript "187"
Adh	GenieEST	CDS	2486596	2486808	18.933000	+	0	transcript "187"
Adh	GenieEST	stop_codon	2486806	2486808	0	+	0	transcript "187"
Adh	GenieEST	CDS	2491469	2491493	-4.106500	+	0	transcript "188"
Adh	GenieEST	start_codon	2491469	2491471	0	+	0	transcript "188"
Adh	GenieEST	CDS	2492334	2492354	-7.186600	+	1	transcript "188"
Adh	GenieEST	CDS	2492481	2492504	-5.129600	+	1	transcript "188"
Adh	GenieEST	CDS	2493083	2493119	-8.340800	+	1	transcript "188"
Adh	GenieEST	CDS	2493286	2493620	32.205000	+	0	transcript "188"
Adh	GenieEST	CDS	2493682	2493731	-5.435500	+	1	transcript "188"
Adh	GenieEST	CDS	2494047	2494116	-5.286800	+	0	transcript "188"
Adh	GenieEST	CDS	2494180	2494259	2.885600	+	1	transcript "188"
Adh	GenieEST	CDS	2494325	2494651	43.869000	+	0	transcript "188"
Adh	GenieEST	CDS	2495100	2495225	9.476900	+	0	transcript "188"
Adh	GenieEST	CDS	2495286	2495667	55.740000	+	0	transcript "188"
Adh	GenieEST	CDS	2495861	2496988	183.770000	+	1	transcript "188"
Adh	GenieEST	CDS	2497217	2497464	46.977000	+	1	transcript "188"
Adh	GenieEST	stop_codon	2497462	2497464	0	+	0	transcript "188"
Adh	GenieEST	CDS	2528864	2528881	-1.526000	+	0	transcript "202"
Adh	GenieEST	start_codon	2528864	2528866	0	+	0	transcript "202"
Adh	GenieEST	CDS	2529073	2529195	-0.309760	+	0	transcript "202"
Adh	GenieEST	CDS	2529260	2529455	8.160900	+	0	transcript "202"
Adh	GenieEST	CDS	2529735	2530156	33.281000	+	1	transcript "202"
Adh	GenieEST	stop_codon	2530154	2530156	0	+	0	transcript "202"
Adh	GenieEST	CDS	2544295	2545124	57.144000	+	0	transcript "203"
Adh	GenieEST	start_codon	2544295	2544297	0	+	0	transcript "203"
Adh	GenieEST	CDS	2545309	2545387	-10.209000	+	0	transcript "203"
Adh	GenieEST	stop_codon	2545385	2545387	0	+	0	transcript "203"
Adh	GenieEST	CDS	2580916	2581059	11.316000	+	0	transcript "204"
Adh	GenieEST	start_codon	2580916	2580918	0	+	0	transcript "204"
Adh	GenieEST	stop_codon	2581057	2581059	0	+	0	transcript "204"
Adh	GenieEST	CDS	2583113	2583547	43.746000	+	0	transcript "205"
Adh	GenieEST	start_codon	2583113	2583115	0	+	0	transcript "205"
Adh	GenieEST	stop_codon	2583545	2583547	0	+	0	transcript "205"
Adh	GenieEST	CDS	2584165	2584353	5.547100	-	0	transcript "206"
Adh	GenieEST	stop_codon	2584165	2584167	0	-	0	transcript "206"
Adh	GenieEST	CDS	2584891	2584914	-0.204400	-	0	transcript "206"
Adh	GenieEST	start_codon	2584912	2584914	0	-	0	transcript "206"
Adh	GenieEST	CDS	2619156	2619165	-2.863300	+	0	transcript "207"
Adh	GenieEST	start_codon	2619156	2619158	0	+	0	transcript "207"
Adh	GenieEST	CDS	2619518	2620403	93.274000	+	1	transcript "207"
Adh	GenieEST	CDS	2621231	2622507	220.180000	+	0	transcript "207"
Adh	GenieEST	CDS	2622578	2622803	20.540000	+	1	transcript "207"
Adh	GenieEST	CDS	2623675	2623781	-5.712100	+	0	transcript "207"
Adh	GenieEST	CDS	2624114	2624266	-0.627910	+	1	transcript "207"
Adh	GenieEST	CDS	2624694	2624875	24.931000	+	1	transcript "207"
Adh	GenieEST	CDS	2624976	2625495	63.111000	+	0	transcript "207"
Adh	GenieEST	CDS	2625559	2625752	13.220000	+	1	transcript "207"
Adh	GenieEST	CDS	2626124	2626333	14.590000	+	0	transcript "207"
Adh	GenieEST	CDS	2626392	2626510	4.554800	+	0	transcript "207"
Adh	GenieEST	CDS	2626595	2626653	-2.693800	+	0	transcript "207"
Adh	GenieEST	CDS	2626937	2627063	-5.290600	+	1	transcript "207"
Adh	GenieEST	CDS	2628166	2628325	-0.506020	+	0	transcript "207"
Adh	GenieEST	stop_codon	2628323	2628325	0	+	0	transcript "207"
Adh	GenieEST	CDS	2632071	2632090	-2.826100	+	0	transcript "208"
Adh	GenieEST	start_codon	2632071	2632073	0	+	0	transcript "208"
Adh	GenieEST	CDS	2632152	2632298	11.833000	+	0	transcript "208"
Adh	GenieEST	CDS	2632363	2632834	-7.683800	+	0	transcript "208"
Adh	GenieEST	CDS	2633272	2633337	-5.463000	+	0	transcript "208"
Adh	GenieEST	CDS	2633397	2633645	10.199000	+	0	transcript "208"
Adh	GenieEST	CDS	2633706	2634365	84.189000	+	0	transcript "208"
Adh	GenieEST	CDS	2634452	2634889	67.398000	+	0	transcript "208"
Adh	GenieEST	stop_codon	2634887	2634889	0	+	0	transcript "208"
Adh	GenieEST	CDS	2638322	2638414	2.386200	+	0	transcript "209"
Adh	GenieEST	start_codon	2638322	2638324	0	+	0	transcript "209"
Adh	GenieEST	CDS	2638470	2639006	60.615000	+	0	transcript "209"
Adh	GenieEST	stop_codon	2639004	2639006	0	+	0	transcript "209"
Adh	GenieEST	CDS	2660848	2661318	9.935500	+	0	transcript "210"
Adh	GenieEST	start_codon	2660848	2660850	0	+	0	transcript "210"
Adh	GenieEST	CDS	2661378	2662292	3.398200	+	0	transcript "210"
Adh	GenieEST	CDS	2662428	2662463	-7.439200	+	0	transcript "210"
Adh	GenieEST	stop_codon	2662461	2662463	0	+	0	transcript "210"
Adh	GenieEST	CDS	2683427	2683452	4.763900	+	0	transcript "211"
Adh	GenieEST	start_codon	2683427	2683429	0	+	0	transcript "211"
Adh	GenieEST	CDS	2684880	2686209	177.890000	+	0	transcript "211"
Adh	GenieEST	CDS	2686394	2686570	10.052000	+	0	transcript "211"
Adh	GenieEST	CDS	2686628	2686705	-0.550860	+	0	transcript "211"
Adh	GenieEST	CDS	2686770	2687146	44.148000	+	0	transcript "211"
Adh	GenieEST	CDS	2687211	2687359	10.852000	+	0	transcript "211"
Adh	GenieEST	CDS	2687415	2687920	79.657000	+	1	transcript "211"
Adh	GenieEST	CDS	2687988	2688230	20.025000	+	0	transcript "211"
Adh	GenieEST	CDS	2688302	2688395	-8.850700	+	0	transcript "211"
Adh	GenieEST	CDS	2688462	2688883	33.320000	+	1	transcript "211"
Adh	GenieEST	CDS	2689073	2689183	1.409900	+	0	transcript "211"
Adh	GenieEST	stop_codon	2689181	2689183	0	+	0	transcript "211"
Adh	GenieEST	CDS	2697858	2698028	13.349000	-	0	transcript "237"
Adh	GenieEST	stop_codon	2697858	2697860	0	-	0	transcript "237"
Adh	GenieEST	CDS	2698091	2698210	7.366600	-	0	transcript "237"
Adh	GenieEST	start_codon	2698208	2698210	0	-	0	transcript "237"
Adh	GenieEST	CDS	2698932	2698966	-3.108100	-	0	transcript "238"
Adh	GenieEST	stop_codon	2698932	2698934	0	-	0	transcript "238"
Adh	GenieEST	CDS	2699376	2699418	-9.748800	-	0	transcript "238"
Adh	GenieEST	CDS	2706336	2706347	-2.986900	-	0	transcript "238"
Adh	GenieEST	start_codon	2706345	2706347	0	-	0	transcript "238"
Adh	GenieEST	CDS	2707374	2707439	9.374900	+	0	transcript "239"
Adh	GenieEST	start_codon	2707374	2707376	0	+	0	transcript "239"
Adh	GenieEST	CDS	2707509	2708522	146.720000	+	0	transcript "239"
Adh	GenieEST	stop_codon	2708520	2708522	0	+	0	transcript "239"
Adh	GenieEST	CDS	2709485	2710765	131.080000	-	0	transcript "240"
Adh	GenieEST	stop_codon	2709485	2709487	0	-	0	transcript "240"
Adh	GenieEST	CDS	2711195	2711209	-1.967000	-	0	transcript "240"
Adh	GenieEST	start_codon	2711207	2711209	0	-	0	transcript "240"
Adh	GenieEST	CDS	2711460	2711538	2.609700	+	0	transcript "241"
Adh	GenieEST	start_codon	2711460	2711462	0	+	0	transcript "241"
Adh	GenieEST	CDS	2711599	2711717	0.172310	+	1	transcript "241"
Adh	GenieEST	CDS	2711781	2711853	-5.646000	+	0	transcript "241"
Adh	GenieEST	CDS	2711910	2712440	66.915000	+	1	transcript "241"
Adh	GenieEST	CDS	2712522	2712646	4.115800	+	1	transcript "241"
Adh	GenieEST	stop_codon	2712644	2712646	0	+	0	transcript "241"
Adh	GenieEST	CDS	2714781	2716277	272.530000	-	0	transcript "212"
Adh	GenieEST	stop_codon	2714781	2714783	0	-	0	transcript "212"
Adh	GenieEST	CDS	2716683	2716697	-1.801700	-	0	transcript "212"
Adh	GenieEST	start_codon	2716695	2716697	0	-	0	transcript "212"
Adh	GenieEST	CDS	2727707	2727754	-4.392600	-	0	transcript "213"
Adh	GenieEST	stop_codon	2727707	2727709	0	-	0	transcript "213"
Adh	GenieEST	CDS	2728123	2728429	28.086000	-	0	transcript "213"
Adh	GenieEST	CDS	2736358	2736449	8.245200	-	1	transcript "213"
Adh	GenieEST	start_codon	2736447	2736449	0	-	0	transcript "213"
Adh	GenieEST	CDS	2737704	2737731	-2.598300	+	0	transcript "214"
Adh	GenieEST	start_codon	2737704	2737706	0	+	0	transcript "214"
Adh	GenieEST	CDS	2737860	2738132	50.538000	+	1	transcript "214"
Adh	GenieEST	CDS	2738403	2739461	115.810000	+	1	transcript "214"
Adh	GenieEST	CDS	2739531	2740039	48.481000	+	1	transcript "214"
Adh	GenieEST	stop_codon	2740037	2740039	0	+	0	transcript "214"
Adh	GenieEST	CDS	2740542	2741090	57.903000	+	0	transcript "215"
Adh	GenieEST	start_codon	2740542	2740544	0	+	0	transcript "215"
Adh	GenieEST	stop_codon	2741088	2741090	0	+	0	transcript "215"
Adh	GenieEST	CDS	2741387	2741990	53.930000	-	0	transcript "216"
Adh	GenieEST	stop_codon	2741387	2741389	0	-	0	transcript "216"
Adh	GenieEST	CDS	2742220	2742230	-2.233500	-	1	transcript "216"
Adh	GenieEST	start_codon	2742228	2742230	0	-	0	transcript "216"
Adh	GenieEST	CDS	2743611	2745122	140.020000	+	0	transcript "217"
Adh	GenieEST	start_codon	2743611	2743613	0	+	0	transcript "217"
Adh	GenieEST	stop_codon	2745120	2745122	0	+	0	transcript "217"
Adh	GenieEST	CDS	2746815	2747453	59.714000	-	0	transcript "218"
Adh	GenieEST	stop_codon	2746815	2746817	0	-	0	transcript "218"
Adh	GenieEST	CDS	2748132	2748572	54.989000	-	0	transcript "218"
Adh	GenieEST	start_codon	2748570	2748572	0	-	0	transcript "218"
Adh	GenieEST	CDS	2749655	2749696	-3.998500	+	0	transcript "219"
Adh	GenieEST	start_codon	2749655	2749657	0	+	0	transcript "219"
Adh	GenieEST	CDS	2749753	2750868	78.489000	+	0	transcript "219"
Adh	GenieEST	stop_codon	2750866	2750868	0	+	0	transcript "219"
Adh	GenieEST	CDS	2751337	2751465	8.605300	-	0	transcript "220"
Adh	GenieEST	stop_codon	2751337	2751339	0	-	0	transcript "220"
Adh	GenieEST	CDS	2751521	2751711	11.249000	-	0	transcript "220"
Adh	GenieEST	CDS	2751778	2751871	0.393390	-	0	transcript "220"
Adh	GenieEST	CDS	2751973	2751984	-3.386200	-	0	transcript "220"
Adh	GenieEST	start_codon	2751982	2751984	0	-	0	transcript "220"
Adh	GenieEST	CDS	2752612	2752742	2.044100	+	0	transcript "221"
Adh	GenieEST	start_codon	2752612	2752614	0	+	0	transcript "221"
Adh	GenieEST	CDS	2752822	2752985	-5.825600	+	0	transcript "221"
Adh	GenieEST	CDS	2753042	2753322	8.142700	+	1	transcript "221"
Adh	GenieEST	CDS	2753446	2753475	-5.180900	+	0	transcript "221"
Adh	GenieEST	stop_codon	2753473	2753475	0	+	0	transcript "221"
Adh	GenieEST	CDS	2755219	2755580	37.251000	-	0	transcript "222"
Adh	GenieEST	stop_codon	2755219	2755221	0	-	0	transcript "222"
Adh	GenieEST	CDS	2755775	2755883	3.547500	-	0	transcript "222"
Adh	GenieEST	CDS	2755954	2756092	12.949000	-	0	transcript "222"
Adh	GenieEST	CDS	2756201	2756274	3.157900	-	1	transcript "222"
Adh	GenieEST	start_codon	2756272	2756274	0	-	0	transcript "222"
Adh	GenieEST	CDS	2756920	2757589	74.489000	+	0	transcript "223"
Adh	GenieEST	start_codon	2756920	2756922	0	+	0	transcript "223"
Adh	GenieEST	CDS	2757658	2758391	71.632000	+	1	transcript "223"
Adh	GenieEST	stop_codon	2758389	2758391	0	+	0	transcript "223"
Adh	GenieEST	CDS	2759163	2759190	-7.485200	-	0	transcript "224"
Adh	GenieEST	stop_codon	2759163	2759165	0	-	0	transcript "224"
Adh	GenieEST	CDS	2759260	2759403	2.355400	-	1	transcript "224"
Adh	GenieEST	CDS	2759527	2759639	-3.355800	-	1	transcript "224"
Adh	GenieEST	CDS	2759701	2759850	4.709800	-	0	transcript "224"
Adh	GenieEST	start_codon	2759848	2759850	0	-	0	transcript "224"
Adh	GenieEST	CDS	2760361	2760672	39.630000	+	0	transcript "225"
Adh	GenieEST	start_codon	2760361	2760363	0	+	0	transcript "225"
Adh	GenieEST	CDS	2760766	2761087	36.943000	+	0	transcript "225"
Adh	GenieEST	CDS	2761141	2762087	99.804000	+	1	transcript "225"
Adh	GenieEST	stop_codon	2762085	2762087	0	+	0	transcript "225"
Adh	GenieEST	CDS	2762639	2762710	1.164500	-	0	transcript "226"
Adh	GenieEST	stop_codon	2762639	2762641	0	-	0	transcript "226"
Adh	GenieEST	CDS	2763711	2763992	43.628000	-	0	transcript "226"
Adh	GenieEST	start_codon	2763990	2763992	0	-	0	transcript "226"
Adh	GenieEST	CDS	2772212	2772430	20.916000	-	0	transcript "227"
Adh	GenieEST	stop_codon	2772212	2772214	0	-	0	transcript "227"
Adh	GenieEST	CDS	2772600	2772777	19.593000	-	0	transcript "227"
Adh	GenieEST	CDS	2773593	2774153	73.657000	-	1	transcript "227"
Adh	GenieEST	CDS	2774236	2774314	3.111000	-	1	transcript "227"
Adh	GenieEST	CDS	2774754	2774782	-5.764700	-	0	transcript "227"
Adh	GenieEST	CDS	2775140	2775159	-1.631600	-	1	transcript "227"
Adh	GenieEST	start_codon	2775157	2775159	0	-	0	transcript "227"
Adh	GenieEST	CDS	2776429	2777295	55.672000	+	0	transcript "228"
Adh	GenieEST	start_codon	2776429	2776431	0	+	0	transcript "228"
Adh	GenieEST	stop_codon	2777293	2777295	0	+	0	transcript "228"
Adh	GenieEST	CDS	2777390	2777609	18.848000	-	0	transcript "229"
Adh	GenieEST	stop_codon	2777390	2777392	0	-	0	transcript "229"
Adh	GenieEST	CDS	2777672	2778342	63.593000	-	1	transcript "229"
Adh	GenieEST	start_codon	2778340	2778342	0	-	0	transcript "229"
Adh	GenieEST	CDS	2779268	2779279	-2.413600	+	0	transcript "230"
Adh	GenieEST	start_codon	2779268	2779270	0	+	0	transcript "230"
Adh	GenieEST	CDS	2779339	2779566	30.076000	+	0	transcript "230"
Adh	GenieEST	stop_codon	2779564	2779566	0	+	0	transcript "230"
Adh	GenieEST	CDS	2786019	2786051	-6.603400	-	0	transcript "231"
Adh	GenieEST	stop_codon	2786019	2786021	0	-	0	transcript "231"
Adh	GenieEST	CDS	2786105	2786724	-13.048000	-	0	transcript "231"
Adh	GenieEST	CDS	2786839	2787069	2.061600	-	0	transcript "231"
Adh	GenieEST	CDS	2787444	2787885	18.708000	-	0	transcript "231"
Adh	GenieEST	CDS	2787948	2788341	5.315800	-	0	transcript "231"
Adh	GenieEST	CDS	2788808	2789086	-2.006600	-	1	transcript "231"
Adh	GenieEST	CDS	2789143	2789555	10.375000	-	1	transcript "231"
Adh	GenieEST	CDS	2790007	2791015	-0.827880	-	0	transcript "231"
Adh	GenieEST	CDS	2791870	2792011	4.232500	-	1	transcript "231"
Adh	GenieEST	CDS	2792082	2792601	44.397000	-	0	transcript "231"
Adh	GenieEST	start_codon	2792599	2792601	0	-	0	transcript "231"
Adh	GenieEST	CDS	2793626	2798713	210.370000	-	0	transcript "232"
Adh	GenieEST	stop_codon	2793626	2793628	0	-	0	transcript "232"
Adh	GenieEST	start_codon	2798711	2798713	0	-	0	transcript "232"
Adh	GenieEST	CDS	2802355	2802394	-3.954200	+	0	transcript "242"
Adh	GenieEST	start_codon	2802355	2802357	0	+	0	transcript "242"
Adh	GenieEST	CDS	2802473	2802813	27.264000	+	1	transcript "242"
Adh	GenieEST	stop_codon	2802811	2802813	0	+	0	transcript "242"
Adh	GenieEST	CDS	2804442	2805730	227.740000	-	0	transcript "243"
Adh	GenieEST	stop_codon	2804442	2804444	0	-	0	transcript "243"
Adh	GenieEST	CDS	2805800	2805812	-2.477800	-	0	transcript "243"
Adh	GenieEST	start_codon	2805810	2805812	0	-	0	transcript "243"
Adh	GenieEST	CDS	2815178	2815829	55.309000	+	0	transcript "233"
Adh	GenieEST	start_codon	2815178	2815180	0	+	0	transcript "233"
Adh	GenieEST	CDS	2815894	2816135	-1.339700	+	1	transcript "233"
Adh	GenieEST	stop_codon	2816133	2816135	0	+	0	transcript "233"
Adh	GenieEST	CDS	2843324	2843386	5.943900	+	0	transcript "234"
Adh	GenieEST	start_codon	2843324	2843326	0	+	0	transcript "234"
Adh	GenieEST	stop_codon	2843384	2843386	0	+	0	transcript "234"
Adh	GenieEST	CDS	2849759	2849784	-1.924300	-	0	transcript "235"
Adh	GenieEST	stop_codon	2849759	2849761	0	-	0	transcript "235"
Adh	GenieEST	CDS	2853744	2854099	39.970000	-	0	transcript "235"
Adh	GenieEST	CDS	2854197	2855182	70.274000	-	1	transcript "235"
Adh	GenieEST	start_codon	2855180	2855182	0	-	0	transcript "235"
Adh	GenieEST	CDS	2894707	2895247	43.958000	+	0	transcript "244"
Adh	GenieEST	start_codon	2894707	2894709	0	+	0	transcript "244"
Adh	GenieEST	CDS	2895319	2895977	33.530000	+	1	transcript "244"
Adh	GenieEST	stop_codon	2895975	2895977	0	+	0	transcript "244"
Adh	GenieEST	CDS	2896655	2896763	-1.988800	+	0	transcript "245"
Adh	GenieEST	start_codon	2896655	2896657	0	+	0	transcript "245"
Adh	GenieEST	CDS	2898444	2899001	40.503000	+	1	transcript "245"
Adh	GenieEST	CDS	2899061	2899716	57.697000	+	1	transcript "245"
Adh	GenieEST	stop_codon	2899714	2899716	0	+	0	transcript "245"
Adh	GenieEST	CDS	2900448	2900565	-0.580870	+	0	transcript "246"
Adh	GenieEST	start_codon	2900448	2900450	0	+	0	transcript "246"
Adh	GenieEST	CDS	2900634	2901185	37.401000	+	1	transcript "246"
Adh	GenieEST	CDS	2901452	2902107	61.781000	+	1	transcript "246"
Adh	GenieEST	stop_codon	2902105	2902107	0	+	0	transcript "246"
Adh	GenieEST	CDS	2916879	2917012	24.868000	-	0	transcript "236"
Adh	GenieEST	stop_codon	2916879	2916881	0	-	0	transcript "236"
Adh	GenieEST	CDS	2917311	2917504	41.327000	-	0	transcript "236"
Adh	GenieEST	CDS	2917751	2917988	33.398000	-	1	transcript "236"
Adh	GenieEST	CDS	2918253	2918513	50.022000	-	0	transcript "236"
Adh	GenieEST	CDS	2918684	2918711	1.011700	-	0	transcript "236"
Adh	GenieEST	start_codon	2918709	2918711	0	-	0	transcript "236"
##gff-version 1
##GenieESTHOM  EST and homology integrated Submission 3
##date 99-7-23
#
# compfly: 1. Removed all TSS entries
#
#
#
Adh	GenieESTHOM	CDS	12	58	-8.893800	-	0	transcript "1"
Adh	GenieESTHOM	stop_codon	12	14	0	-	0	transcript "1"
Adh	GenieESTHOM	CDS	124	441	25.605000	-	0	transcript "1"
Adh	GenieESTHOM	CDS	2379	2862	73.384000	-	0	transcript "1"
Adh	GenieESTHOM	CDS	3225	3452	44.678000	-	0	transcript "1"
Adh	GenieESTHOM	start_codon	3450	3452	0	-	0	transcript "1"
Adh	GenieESTHOM	CDS	6353	6378	-10.856000	-	0	transcript "2"
Adh	GenieESTHOM	stop_codon	6353	6355	0	-	0	transcript "2"
Adh	GenieESTHOM	CDS	6718	7012	52.546000	-	0	transcript "2"
Adh	GenieESTHOM	CDS	7179	7231	4.253100	-	0	transcript "2"
Adh	GenieESTHOM	CDS	28665	28744	-3.475400	-	0	transcript "2"
Adh	GenieESTHOM	CDS	29160	29479	51.721000	-	1	transcript "2"
Adh	GenieESTHOM	start_codon	29477	29479	0	-	0	transcript "2"
Adh	GenieESTHOM	CDS	34783	34822	-1.418400	+	0	transcript "3"
Adh	GenieESTHOM	start_codon	34783	34785	0	+	0	transcript "3"
Adh	GenieESTHOM	CDS	34884	35332	38.456000	+	1	transcript "3"
Adh	GenieESTHOM	stop_codon	35330	35332	0	+	0	transcript "3"
Adh	GenieESTHOM	CDS	35433	35749	14.862000	-	0	transcript "4"
Adh	GenieESTHOM	stop_codon	35433	35435	0	-	0	transcript "4"
Adh	GenieESTHOM	CDS	35938	36226	23.090000	-	0	transcript "4"
Adh	GenieESTHOM	start_codon	36224	36226	0	-	0	transcript "4"
Adh	GenieESTHOM	CDS	36488	37315	72.179000	+	0	transcript "5"
Adh	GenieESTHOM	start_codon	36488	36490	0	+	0	transcript "5"
Adh	GenieESTHOM	stop_codon	37313	37315	0	+	0	transcript "5"
Adh	GenieESTHOM	CDS	40843	40919	-2.635100	-	0	transcript "6"
Adh	GenieESTHOM	stop_codon	40843	40845	0	-	0	transcript "6"
Adh	GenieESTHOM	CDS	42887	43076	-4.201100	-	0	transcript "6"
Adh	GenieESTHOM	start_codon	43074	43076	0	-	0	transcript "6"
Adh	GenieESTHOM	CDS	54448	55815	856.510000	+	0	transcript "7"
Adh	GenieESTHOM	start_codon	54448	54450	0	+	0	transcript "7"
Adh	GenieESTHOM	CDS	56032	56083	-4.723100	+	0	transcript "7"
Adh	GenieESTHOM	CDS	56155	58817	1514.300000	+	1	transcript "7"
Adh	GenieESTHOM	stop_codon	58815	58817	0	+	0	transcript "7"
Adh	GenieESTHOM	CDS	89305	90750	81.106000	-	0	transcript "8"
Adh	GenieESTHOM	stop_codon	89305	89307	0	-	0	transcript "8"
Adh	GenieESTHOM	start_codon	90748	90750	0	-	0	transcript "8"
Adh	GenieESTHOM	CDS	93123	94111	316.450000	-	0	transcript "9"
Adh	GenieESTHOM	stop_codon	93123	93125	0	-	0	transcript "9"
Adh	GenieESTHOM	CDS	94315	94333	-2.470500	-	0	transcript "9"
Adh	GenieESTHOM	start_codon	94331	94333	0	-	0	transcript "9"
Adh	GenieESTHOM	CDS	103223	103244	-0.982150	+	0	transcript "57"
Adh	GenieESTHOM	start_codon	103223	103225	0	+	0	transcript "57"
Adh	GenieESTHOM	CDS	103543	103739	79.465000	+	1	transcript "57"
Adh	GenieESTHOM	CDS	103808	104330	345.860000	+	0	transcript "57"
Adh	GenieESTHOM	CDS	104721	104749	-7.107100	+	1	transcript "57"
Adh	GenieESTHOM	stop_codon	104747	104749	0	+	0	transcript "57"
Adh	GenieESTHOM	CDS	117056	117107	7.713200	+	0	transcript "10"
Adh	GenieESTHOM	start_codon	117056	117058	0	+	0	transcript "10"
Adh	GenieESTHOM	CDS	117406	117527	10.511000	+	1	transcript "10"
Adh	GenieESTHOM	stop_codon	117525	117527	0	+	0	transcript "10"
Adh	GenieESTHOM	CDS	124325	124954	331.690000	+	0	transcript "11"
Adh	GenieESTHOM	start_codon	124325	124327	0	+	0	transcript "11"
Adh	GenieESTHOM	stop_codon	124952	124954	0	+	0	transcript "11"
Adh	GenieESTHOM	CDS	126817	126858	0.155620	+	0	transcript "12"
Adh	GenieESTHOM	start_codon	126817	126819	0	+	0	transcript "12"
Adh	GenieESTHOM	CDS	127146	127292	9.950700	+	0	transcript "12"
Adh	GenieESTHOM	CDS	127771	127931	36.506000	+	0	transcript "12"
Adh	GenieESTHOM	CDS	127991	128225	125.780000	+	0	transcript "12"
Adh	GenieESTHOM	CDS	128296	129334	709.450000	+	0	transcript "12"
Adh	GenieESTHOM	CDS	129429	129965	86.096000	+	1	transcript "12"
Adh	GenieESTHOM	CDS	130136	130401	31.158000	+	1	transcript "12"
Adh	GenieESTHOM	stop_codon	130399	130401	0	+	0	transcript "12"
Adh	GenieESTHOM	CDS	131015	131248	41.281000	+	0	transcript "13"
Adh	GenieESTHOM	start_codon	131015	131017	0	+	0	transcript "13"
Adh	GenieESTHOM	stop_codon	131246	131248	0	+	0	transcript "13"
Adh	GenieESTHOM	CDS	133458	133548	4.549900	-	0	transcript "14"
Adh	GenieESTHOM	stop_codon	133458	133460	0	-	0	transcript "14"
Adh	GenieESTHOM	CDS	133612	134233	293.090000	-	1	transcript "14"
Adh	GenieESTHOM	CDS	134862	134967	11.918000	-	0	transcript "14"
Adh	GenieESTHOM	start_codon	134965	134967	0	-	0	transcript "14"
Adh	GenieESTHOM	CDS	159578	159874	37.047000	+	0	transcript "15"
Adh	GenieESTHOM	start_codon	159578	159580	0	+	0	transcript "15"
Adh	GenieESTHOM	CDS	161727	162105	31.487000	+	0	transcript "15"
Adh	GenieESTHOM	CDS	162442	162557	10.899000	+	1	transcript "15"
Adh	GenieESTHOM	CDS	162616	163137	79.679000	+	0	transcript "15"
Adh	GenieESTHOM	CDS	164190	164417	21.761000	+	0	transcript "15"
Adh	GenieESTHOM	stop_codon	164415	164417	0	+	0	transcript "15"
Adh	GenieESTHOM	CDS	181255	181409	4.814000	-	0	transcript "16"
Adh	GenieESTHOM	stop_codon	181255	181257	0	-	0	transcript "16"
Adh	GenieESTHOM	CDS	183107	183551	44.401000	-	0	transcript "16"
Adh	GenieESTHOM	CDS	183600	183635	-2.067600	-	0	transcript "16"
Adh	GenieESTHOM	CDS	183699	183764	-0.591140	-	0	transcript "16"
Adh	GenieESTHOM	CDS	183835	184040	21.644000	-	0	transcript "16"
Adh	GenieESTHOM	CDS	184241	184282	-0.391800	-	0	transcript "16"
Adh	GenieESTHOM	CDS	184388	184409	-1.916300	-	0	transcript "16"
Adh	GenieESTHOM	start_codon	184407	184409	0	-	0	transcript "16"
Adh	GenieESTHOM	CDS	202128	202646	184.900000	+	0	transcript "58"
Adh	GenieESTHOM	start_codon	202128	202130	0	+	0	transcript "58"
Adh	GenieESTHOM	CDS	202700	203975	355.950000	+	0	transcript "58"
Adh	GenieESTHOM	CDS	204044	204138	-1.831600	+	1	transcript "58"
Adh	GenieESTHOM	stop_codon	204136	204138	0	+	0	transcript "58"
Adh	GenieESTHOM	CDS	216144	216761	72.615000	-	0	transcript "17"
Adh	GenieESTHOM	stop_codon	216144	216146	0	-	0	transcript "17"
Adh	GenieESTHOM	CDS	216820	217121	29.538000	-	0	transcript "17"
Adh	GenieESTHOM	CDS	217192	217226	-9.733700	-	0	transcript "17"
Adh	GenieESTHOM	CDS	217600	217616	-2.043700	-	1	transcript "17"
Adh	GenieESTHOM	start_codon	217614	217616	0	-	0	transcript "17"
Adh	GenieESTHOM	CDS	229944	230462	96.650000	+	0	transcript "18"
Adh	GenieESTHOM	start_codon	229944	229946	0	+	0	transcript "18"
Adh	GenieESTHOM	stop_codon	230460	230462	0	+	0	transcript "18"
Adh	GenieESTHOM	CDS	255763	256697	492.340000	-	0	transcript "19"
Adh	GenieESTHOM	stop_codon	255763	255765	0	-	0	transcript "19"
Adh	GenieESTHOM	CDS	257315	257324	-2.690200	-	0	transcript "19"
Adh	GenieESTHOM	start_codon	257322	257324	0	-	0	transcript "19"
Adh	GenieESTHOM	CDS	263721	263735	-0.738090	+	0	transcript "20"
Adh	GenieESTHOM	start_codon	263721	263723	0	+	0	transcript "20"
Adh	GenieESTHOM	CDS	265088	266322	506.380000	+	0	transcript "20"
Adh	GenieESTHOM	CDS	266392	266619	94.779000	+	0	transcript "20"
Adh	GenieESTHOM	CDS	266684	266867	100.710000	+	0	transcript "20"
Adh	GenieESTHOM	CDS	266935	267073	50.827000	+	0	transcript "20"
Adh	GenieESTHOM	CDS	267134	267234	31.809000	+	1	transcript "20"
Adh	GenieESTHOM	stop_codon	267232	267234	0	+	0	transcript "20"
Adh	GenieESTHOM	CDS	267633	267656	2.325000	+	0	transcript "21"
Adh	GenieESTHOM	start_codon	267633	267635	0	+	0	transcript "21"
Adh	GenieESTHOM	CDS	267912	268061	1.426700	+	0	transcript "21"
Adh	GenieESTHOM	stop_codon	268059	268061	0	+	0	transcript "21"
Adh	GenieESTHOM	CDS	268751	268798	1.940200	-	0	transcript "22"
Adh	GenieESTHOM	stop_codon	268751	268753	0	-	0	transcript "22"
Adh	GenieESTHOM	CDS	269006	269157	16.212000	-	0	transcript "22"
Adh	GenieESTHOM	CDS	269222	269559	45.070000	-	0	transcript "22"
Adh	GenieESTHOM	CDS	269629	269785	1.070900	-	1	transcript "22"
Adh	GenieESTHOM	CDS	269849	269907	-1.524200	-	0	transcript "22"
Adh	GenieESTHOM	CDS	270235	270314	6.550500	-	1	transcript "22"
Adh	GenieESTHOM	start_codon	270312	270314	0	-	0	transcript "22"
Adh	GenieESTHOM	CDS	274751	275848	559.830000	+	0	transcript "23"
Adh	GenieESTHOM	start_codon	274751	274753	0	+	0	transcript "23"
Adh	GenieESTHOM	stop_codon	275846	275848	0	+	0	transcript "23"
Adh	GenieESTHOM	CDS	276361	276696	29.297000	-	0	transcript "24"
Adh	GenieESTHOM	stop_codon	276361	276363	0	-	0	transcript "24"
Adh	GenieESTHOM	CDS	276748	277188	38.485000	-	0	transcript "24"
Adh	GenieESTHOM	start_codon	277186	277188	0	-	0	transcript "24"
Adh	GenieESTHOM	CDS	277921	278103	6.440000	+	0	transcript "25"
Adh	GenieESTHOM	start_codon	277921	277923	0	+	0	transcript "25"
Adh	GenieESTHOM	CDS	278222	278345	-4.638900	+	0	transcript "25"
Adh	GenieESTHOM	CDS	278537	278737	10.413000	+	1	transcript "25"
Adh	GenieESTHOM	CDS	278802	279272	20.087000	+	1	transcript "25"
Adh	GenieESTHOM	CDS	279548	279726	-3.015900	+	1	transcript "25"
Adh	GenieESTHOM	CDS	280031	280247	11.078000	+	0	transcript "25"
Adh	GenieESTHOM	CDS	280310	280610	19.682000	+	1	transcript "25"
Adh	GenieESTHOM	CDS	280674	280986	16.831000	+	0	transcript "25"
Adh	GenieESTHOM	CDS	281051	281202	-3.583300	+	0	transcript "25"
Adh	GenieESTHOM	CDS	281264	281447	-9.390000	+	0	transcript "25"
Adh	GenieESTHOM	CDS	281550	281787	16.961000	+	0	transcript "25"
Adh	GenieESTHOM	CDS	281848	282471	26.817000	+	1	transcript "25"
Adh	GenieESTHOM	CDS	282539	283541	67.621000	+	1	transcript "25"
Adh	GenieESTHOM	CDS	283608	284052	28.347000	+	0	transcript "25"
Adh	GenieESTHOM	stop_codon	284050	284052	0	+	0	transcript "25"
Adh	GenieESTHOM	CDS	284770	284915	10.180000	+	0	transcript "26"
Adh	GenieESTHOM	start_codon	284770	284772	0	+	0	transcript "26"
Adh	GenieESTHOM	CDS	284969	285346	45.932000	+	0	transcript "26"
Adh	GenieESTHOM	CDS	285416	286886	123.730000	+	0	transcript "26"
Adh	GenieESTHOM	stop_codon	286884	286886	0	+	0	transcript "26"
Adh	GenieESTHOM	CDS	287599	288240	278.190000	+	0	transcript "27"
Adh	GenieESTHOM	start_codon	287599	287601	0	+	0	transcript "27"
Adh	GenieESTHOM	CDS	288298	288379	4.780600	+	0	transcript "27"
Adh	GenieESTHOM	CDS	288647	292676	1954.700000	+	1	transcript "27"
Adh	GenieESTHOM	CDS	292788	292896	0.085265	+	0	transcript "27"
Adh	GenieESTHOM	stop_codon	292894	292896	0	+	0	transcript "27"
Adh	GenieESTHOM	CDS	297680	297713	0.359620	+	0	transcript "59"
Adh	GenieESTHOM	start_codon	297680	297682	0	+	0	transcript "59"
Adh	GenieESTHOM	CDS	302560	302718	41.189000	+	1	transcript "59"
Adh	GenieESTHOM	CDS	302786	303405	224.620000	+	1	transcript "59"
Adh	GenieESTHOM	stop_codon	303403	303405	0	+	0	transcript "59"
Adh	GenieESTHOM	CDS	303960	304272	0.105630	-	0	transcript "60"
Adh	GenieESTHOM	stop_codon	303960	303962	0	-	0	transcript "60"
Adh	GenieESTHOM	CDS	304330	305201	27.951000	-	1	transcript "60"
Adh	GenieESTHOM	start_codon	305199	305201	0	-	0	transcript "60"
Adh	GenieESTHOM	CDS	305396	305516	12.570000	+	0	transcript "61"
Adh	GenieESTHOM	start_codon	305396	305398	0	+	0	transcript "61"
Adh	GenieESTHOM	CDS	305577	305737	8.046600	+	1	transcript "61"
Adh	GenieESTHOM	CDS	305803	306108	28.500000	+	0	transcript "61"
Adh	GenieESTHOM	CDS	306230	306385	13.195000	+	0	transcript "61"
Adh	GenieESTHOM	stop_codon	306383	306385	0	+	0	transcript "61"
Adh	GenieESTHOM	CDS	306476	306985	22.905000	-	0	transcript "62"
Adh	GenieESTHOM	stop_codon	306476	306478	0	-	0	transcript "62"
Adh	GenieESTHOM	start_codon	306983	306985	0	-	0	transcript "62"
Adh	GenieESTHOM	CDS	307965	309056	747.570000	+	0	transcript "63"
Adh	GenieESTHOM	start_codon	307965	307967	0	+	0	transcript "63"
Adh	GenieESTHOM	CDS	309110	309467	208.190000	+	0	transcript "63"
Adh	GenieESTHOM	CDS	309530	310452	589.920000	+	1	transcript "63"
Adh	GenieESTHOM	CDS	310517	311365	519.810000	+	0	transcript "63"
Adh	GenieESTHOM	CDS	311428	312318	572.960000	+	0	transcript "63"
Adh	GenieESTHOM	CDS	312387	313020	406.000000	+	0	transcript "63"
Adh	GenieESTHOM	CDS	313086	313129	-10.839000	+	1	transcript "63"
Adh	GenieESTHOM	stop_codon	313127	313129	0	+	0	transcript "63"
Adh	GenieESTHOM	CDS	315138	315899	111.860000	+	0	transcript "28"
Adh	GenieESTHOM	start_codon	315138	315140	0	+	0	transcript "28"
Adh	GenieESTHOM	CDS	316433	316800	62.965000	+	0	transcript "28"
Adh	GenieESTHOM	CDS	316865	317462	91.715000	+	0	transcript "28"
Adh	GenieESTHOM	stop_codon	317460	317462	0	+	0	transcript "28"
Adh	GenieESTHOM	CDS	317891	318548	393.310000	-	0	transcript "29"
Adh	GenieESTHOM	stop_codon	317891	317893	0	-	0	transcript "29"
Adh	GenieESTHOM	CDS	318608	319430	527.990000	-	1	transcript "29"
Adh	GenieESTHOM	CDS	319486	321442	1298.400000	-	0	transcript "29"
Adh	GenieESTHOM	start_codon	321440	321442	0	-	0	transcript "29"
Adh	GenieESTHOM	CDS	321967	323027	154.480000	-	0	transcript "30"
Adh	GenieESTHOM	stop_codon	321967	321969	0	-	0	transcript "30"
Adh	GenieESTHOM	CDS	323097	323169	7.790100	-	0	transcript "30"
Adh	GenieESTHOM	start_codon	323167	323169	0	-	0	transcript "30"
Adh	GenieESTHOM	CDS	323788	324885	711.830000	+	0	transcript "31"
Adh	GenieESTHOM	start_codon	323788	323790	0	+	0	transcript "31"
Adh	GenieESTHOM	CDS	324939	325223	148.610000	+	0	transcript "31"
Adh	GenieESTHOM	stop_codon	325221	325223	0	+	0	transcript "31"
Adh	GenieESTHOM	CDS	325240	325634	-8.033300	-	0	transcript "32"
Adh	GenieESTHOM	stop_codon	325240	325242	0	-	0	transcript "32"
Adh	GenieESTHOM	CDS	325689	326352	25.314000	-	0	transcript "32"
Adh	GenieESTHOM	CDS	326412	326822	53.101000	-	0	transcript "32"
Adh	GenieESTHOM	start_codon	326820	326822	0	-	0	transcript "32"
Adh	GenieESTHOM	CDS	327175	328002	129.850000	+	0	transcript "33"
Adh	GenieESTHOM	start_codon	327175	327177	0	+	0	transcript "33"
Adh	GenieESTHOM	stop_codon	328000	328002	0	+	0	transcript "33"
Adh	GenieESTHOM	CDS	328048	328357	34.136000	-	0	transcript "34"
Adh	GenieESTHOM	stop_codon	328048	328050	0	-	0	transcript "34"
Adh	GenieESTHOM	CDS	328473	328634	8.911700	-	1	transcript "34"
Adh	GenieESTHOM	CDS	328690	328733	-3.199800	-	1	transcript "34"
Adh	GenieESTHOM	start_codon	328731	328733	0	-	0	transcript "34"
Adh	GenieESTHOM	CDS	329808	330183	47.338000	+	0	transcript "35"
Adh	GenieESTHOM	start_codon	329808	329810	0	+	0	transcript "35"
Adh	GenieESTHOM	CDS	331090	331184	-4.749500	+	1	transcript "35"
Adh	GenieESTHOM	stop_codon	331182	331184	0	+	0	transcript "35"
Adh	GenieESTHOM	CDS	334589	334786	12.218000	-	0	transcript "36"
Adh	GenieESTHOM	stop_codon	334589	334591	0	-	0	transcript "36"
Adh	GenieESTHOM	CDS	334847	335125	21.128000	-	0	transcript "36"
Adh	GenieESTHOM	CDS	335195	335230	-3.998600	-	0	transcript "36"
Adh	GenieESTHOM	start_codon	335228	335230	0	-	0	transcript "36"
Adh	GenieESTHOM	CDS	336668	337323	52.024000	-	0	transcript "37"
Adh	GenieESTHOM	stop_codon	336668	336670	0	-	0	transcript "37"
Adh	GenieESTHOM	CDS	337379	337413	-5.745400	-	0	transcript "37"
Adh	GenieESTHOM	CDS	338171	338879	101.290000	-	1	transcript "37"
Adh	GenieESTHOM	CDS	338944	339013	7.482500	-	0	transcript "37"
Adh	GenieESTHOM	start_codon	339011	339013	0	-	0	transcript "37"
Adh	GenieESTHOM	CDS	340529	340634	11.726000	+	0	transcript "38"
Adh	GenieESTHOM	start_codon	340529	340531	0	+	0	transcript "38"
Adh	GenieESTHOM	CDS	340705	340870	12.403000	+	1	transcript "38"
Adh	GenieESTHOM	CDS	340926	341517	89.596000	+	0	transcript "38"
Adh	GenieESTHOM	stop_codon	341515	341517	0	+	0	transcript "38"
Adh	GenieESTHOM	CDS	341713	341857	22.650000	+	0	transcript "39"
Adh	GenieESTHOM	start_codon	341713	341715	0	+	0	transcript "39"
Adh	GenieESTHOM	CDS	342003	342689	106.980000	+	1	transcript "39"
Adh	GenieESTHOM	CDS	343143	343368	12.786000	+	1	transcript "39"
Adh	GenieESTHOM	CDS	343432	343984	43.658000	+	0	transcript "39"
Adh	GenieESTHOM	stop_codon	343982	343984	0	+	0	transcript "39"
Adh	GenieESTHOM	CDS	346994	347038	-12.460000	-	0	transcript "40"
Adh	GenieESTHOM	stop_codon	346994	346996	0	-	0	transcript "40"
Adh	GenieESTHOM	CDS	356285	356311	-0.207320	-	0	transcript "40"
Adh	GenieESTHOM	start_codon	356309	356311	0	-	0	transcript "40"
Adh	GenieESTHOM	CDS	373286	373501	11.227000	+	0	transcript "41"
Adh	GenieESTHOM	start_codon	373286	373288	0	+	0	transcript "41"
Adh	GenieESTHOM	stop_codon	373499	373501	0	+	0	transcript "41"
Adh	GenieESTHOM	CDS	384853	384925	-3.988200	+	0	transcript "42"
Adh	GenieESTHOM	start_codon	384853	384855	0	+	0	transcript "42"
Adh	GenieESTHOM	CDS	385051	385283	24.931000	+	1	transcript "42"
Adh	GenieESTHOM	CDS	385717	385788	3.241100	+	0	transcript "42"
Adh	GenieESTHOM	stop_codon	385786	385788	0	+	0	transcript "42"
Adh	GenieESTHOM	CDS	388523	388657	3.871400	+	0	transcript "43"
Adh	GenieESTHOM	start_codon	388523	388525	0	+	0	transcript "43"
Adh	GenieESTHOM	CDS	388780	388921	4.675900	+	0	transcript "43"
Adh	GenieESTHOM	CDS	389006	389140	14.841000	+	1	transcript "43"
Adh	GenieESTHOM	CDS	389208	390491	191.370000	+	1	transcript "43"
Adh	GenieESTHOM	CDS	390556	390673	0.323100	+	1	transcript "43"
Adh	GenieESTHOM	CDS	390737	391112	44.058000	+	0	transcript "43"
Adh	GenieESTHOM	CDS	391177	391500	38.133000	+	0	transcript "43"
Adh	GenieESTHOM	stop_codon	391498	391500	0	+	0	transcript "43"
Adh	GenieESTHOM	CDS	393573	393814	18.119000	-	0	transcript "64"
Adh	GenieESTHOM	stop_codon	393573	393575	0	-	0	transcript "64"
Adh	GenieESTHOM	CDS	393894	394052	12.706000	-	0	transcript "64"
Adh	GenieESTHOM	CDS	394383	395732	170.930000	-	0	transcript "64"
Adh	GenieESTHOM	CDS	395826	397468	208.880000	-	0	transcript "64"
Adh	GenieESTHOM	CDS	397532	397682	11.414000	-	1	transcript "64"
Adh	GenieESTHOM	CDS	398773	398794	-4.281500	-	0	transcript "64"
Adh	GenieESTHOM	start_codon	398792	398794	0	-	0	transcript "64"
Adh	GenieESTHOM	CDS	399301	399469	-12.149000	+	0	transcript "65"
Adh	GenieESTHOM	start_codon	399301	399303	0	+	0	transcript "65"
Adh	GenieESTHOM	CDS	400317	400345	-8.850700	+	1	transcript "65"
Adh	GenieESTHOM	CDS	400398	400923	342.940000	+	0	transcript "65"
Adh	GenieESTHOM	CDS	401350	401713	230.630000	+	1	transcript "65"
Adh	GenieESTHOM	CDS	401775	402341	368.160000	+	0	transcript "65"
Adh	GenieESTHOM	CDS	402399	402539	73.794000	+	0	transcript "65"
Adh	GenieESTHOM	CDS	402607	402783	100.360000	+	0	transcript "65"
Adh	GenieESTHOM	CDS	402844	402874	-7.457700	+	0	transcript "65"
Adh	GenieESTHOM	CDS	403468	404414	172.630000	+	0	transcript "65"
Adh	GenieESTHOM	CDS	404467	405027	96.020000	+	0	transcript "65"
Adh	GenieESTHOM	CDS	405085	405391	64.586000	+	0	transcript "65"
Adh	GenieESTHOM	stop_codon	405389	405391	0	+	0	transcript "65"
Adh	GenieESTHOM	CDS	405952	406314	36.346000	+	0	transcript "66"
Adh	GenieESTHOM	start_codon	405952	405954	0	+	0	transcript "66"
Adh	GenieESTHOM	stop_codon	406312	406314	0	+	0	transcript "66"
Adh	GenieESTHOM	CDS	408759	409001	25.167000	+	0	transcript "67"
Adh	GenieESTHOM	start_codon	408759	408761	0	+	0	transcript "67"
Adh	GenieESTHOM	CDS	409150	409656	58.546000	+	0	transcript "67"
Adh	GenieESTHOM	CDS	410157	410315	13.634000	+	0	transcript "67"
Adh	GenieESTHOM	CDS	410372	410612	61.176000	+	0	transcript "67"
Adh	GenieESTHOM	CDS	410677	411431	256.840000	+	1	transcript "67"
Adh	GenieESTHOM	CDS	411728	411831	-12.019000	+	0	transcript "67"
Adh	GenieESTHOM	CDS	411898	412000	-5.042700	+	0	transcript "67"
Adh	GenieESTHOM	stop_codon	411998	412000	0	+	0	transcript "67"
Adh	GenieESTHOM	CDS	415576	416211	75.256000	-	0	transcript "44"
Adh	GenieESTHOM	stop_codon	415576	415578	0	-	0	transcript "44"
Adh	GenieESTHOM	CDS	416276	416749	86.237000	-	0	transcript "44"
Adh	GenieESTHOM	CDS	417100	417111	-1.109900	-	0	transcript "44"
Adh	GenieESTHOM	start_codon	417109	417111	0	-	0	transcript "44"
Adh	GenieESTHOM	CDS	426746	427525	146.500000	-	0	transcript "45"
Adh	GenieESTHOM	stop_codon	426746	426748	0	-	0	transcript "45"
Adh	GenieESTHOM	start_codon	427523	427525	0	-	0	transcript "45"
Adh	GenieESTHOM	CDS	438979	439800	140.060000	-	0	transcript "46"
Adh	GenieESTHOM	stop_codon	438979	438981	0	-	0	transcript "46"
Adh	GenieESTHOM	CDS	440839	440850	-2.874600	-	0	transcript "46"
Adh	GenieESTHOM	start_codon	440848	440850	0	-	0	transcript "46"
Adh	GenieESTHOM	CDS	448271	448290	-0.847070	+	0	transcript "47"
Adh	GenieESTHOM	start_codon	448271	448273	0	+	0	transcript "47"
Adh	GenieESTHOM	CDS	448467	448607	9.262700	+	0	transcript "47"
Adh	GenieESTHOM	CDS	449015	449330	20.178000	+	0	transcript "47"
Adh	GenieESTHOM	stop_codon	449328	449330	0	+	0	transcript "47"
Adh	GenieESTHOM	CDS	451645	451914	26.155000	+	0	transcript "48"
Adh	GenieESTHOM	start_codon	451645	451647	0	+	0	transcript "48"
Adh	GenieESTHOM	stop_codon	451912	451914	0	+	0	transcript "48"
Adh	GenieESTHOM	CDS	454701	454755	-0.308080	+	0	transcript "49"
Adh	GenieESTHOM	start_codon	454701	454703	0	+	0	transcript "49"
Adh	GenieESTHOM	CDS	454814	454931	1.564400	+	1	transcript "49"
Adh	GenieESTHOM	CDS	454999	455702	69.604000	+	0	transcript "49"
Adh	GenieESTHOM	CDS	455870	456263	31.935000	+	1	transcript "49"
Adh	GenieESTHOM	CDS	457279	457488	5.405000	+	0	transcript "49"
Adh	GenieESTHOM	CDS	457649	458206	25.663000	+	0	transcript "49"
Adh	GenieESTHOM	CDS	458285	458488	12.755000	+	0	transcript "49"
Adh	GenieESTHOM	CDS	458547	458802	7.621900	+	0	transcript "49"
Adh	GenieESTHOM	stop_codon	458800	458802	0	+	0	transcript "49"
Adh	GenieESTHOM	CDS	458837	459146	33.197000	-	0	transcript "50"
Adh	GenieESTHOM	stop_codon	458837	458839	0	-	0	transcript "50"
Adh	GenieESTHOM	CDS	459225	459761	66.611000	-	1	transcript "50"
Adh	GenieESTHOM	CDS	460256	460653	46.632000	-	1	transcript "50"
Adh	GenieESTHOM	CDS	460730	460959	-8.603400	-	0	transcript "50"
Adh	GenieESTHOM	CDS	461268	461443	16.057000	-	0	transcript "50"
Adh	GenieESTHOM	CDS	461500	461675	6.836200	-	1	transcript "50"
Adh	GenieESTHOM	CDS	461823	461883	-10.814000	-	0	transcript "50"
Adh	GenieESTHOM	CDS	462096	462584	43.863000	-	1	transcript "50"
Adh	GenieESTHOM	CDS	462646	463209	69.520000	-	1	transcript "50"
Adh	GenieESTHOM	CDS	463368	463657	40.621000	-	1	transcript "50"
Adh	GenieESTHOM	start_codon	463655	463657	0	-	0	transcript "50"
Adh	GenieESTHOM	CDS	464353	464549	6.740100	+	0	transcript "51"
Adh	GenieESTHOM	start_codon	464353	464355	0	+	0	transcript "51"
Adh	GenieESTHOM	CDS	464888	465434	69.426000	+	0	transcript "51"
Adh	GenieESTHOM	stop_codon	465432	465434	0	+	0	transcript "51"
Adh	GenieESTHOM	CDS	467979	469628	54.973000	-	0	transcript "52"
Adh	GenieESTHOM	stop_codon	467979	467981	0	-	0	transcript "52"
Adh	GenieESTHOM	CDS	470226	470396	-10.705000	-	0	transcript "52"
Adh	GenieESTHOM	start_codon	470394	470396	0	-	0	transcript "52"
Adh	GenieESTHOM	CDS	471109	471296	54.289000	+	0	transcript "53"
Adh	GenieESTHOM	start_codon	471109	471111	0	+	0	transcript "53"
Adh	GenieESTHOM	CDS	471441	471687	101.860000	+	0	transcript "53"
Adh	GenieESTHOM	CDS	471752	471856	29.606000	+	0	transcript "53"
Adh	GenieESTHOM	CDS	471944	472490	225.450000	+	0	transcript "53"
Adh	GenieESTHOM	CDS	472557	472823	136.790000	+	1	transcript "53"
Adh	GenieESTHOM	CDS	472965	473128	40.305000	+	1	transcript "53"
Adh	GenieESTHOM	stop_codon	473126	473128	0	+	0	transcript "53"
Adh	GenieESTHOM	CDS	474118	474189	-0.583600	+	0	transcript "54"
Adh	GenieESTHOM	start_codon	474118	474120	0	+	0	transcript "54"
Adh	GenieESTHOM	CDS	474251	474306	-5.381900	+	0	transcript "54"
Adh	GenieESTHOM	CDS	474365	475283	73.043000	+	0	transcript "54"
Adh	GenieESTHOM	CDS	475427	476389	57.618000	+	0	transcript "54"
Adh	GenieESTHOM	stop_codon	476387	476389	0	+	0	transcript "54"
Adh	GenieESTHOM	CDS	477171	477490	25.992000	-	0	transcript "55"
Adh	GenieESTHOM	stop_codon	477171	477173	0	-	0	transcript "55"
Adh	GenieESTHOM	CDS	477548	479329	157.600000	-	0	transcript "55"
Adh	GenieESTHOM	CDS	479386	479753	19.508000	-	0	transcript "55"
Adh	GenieESTHOM	CDS	479815	479958	6.614600	-	1	transcript "55"
Adh	GenieESTHOM	CDS	480147	480287	5.059100	-	1	transcript "55"
Adh	GenieESTHOM	CDS	480343	480480	9.766900	-	1	transcript "55"
Adh	GenieESTHOM	CDS	480586	480617	2.328000	-	1	transcript "55"
Adh	GenieESTHOM	start_codon	480615	480617	0	-	0	transcript "55"
Adh	GenieESTHOM	CDS	486682	487236	64.142000	-	0	transcript "56"
Adh	GenieESTHOM	stop_codon	486682	486684	0	-	0	transcript "56"
Adh	GenieESTHOM	start_codon	487234	487236	0	-	0	transcript "56"
Adh	GenieESTHOM	CDS	507364	507393	-2.491400	+	0	transcript "68"
Adh	GenieESTHOM	start_codon	507364	507366	0	+	0	transcript "68"
Adh	GenieESTHOM	CDS	509536	509783	30.707000	+	0	transcript "68"
Adh	GenieESTHOM	CDS	509881	510226	149.120000	+	0	transcript "68"
Adh	GenieESTHOM	CDS	510287	510786	87.527000	+	0	transcript "68"
Adh	GenieESTHOM	CDS	511784	512375	214.590000	+	0	transcript "68"
Adh	GenieESTHOM	CDS	512435	512758	81.060000	+	0	transcript "68"
Adh	GenieESTHOM	stop_codon	512756	512758	0	+	0	transcript "68"
Adh	GenieESTHOM	CDS	513238	513912	102.390000	-	0	transcript "69"
Adh	GenieESTHOM	stop_codon	513238	513240	0	-	0	transcript "69"
Adh	GenieESTHOM	start_codon	513910	513912	0	-	0	transcript "69"
Adh	GenieESTHOM	CDS	520781	521850	302.740000	+	0	transcript "70"
Adh	GenieESTHOM	start_codon	520781	520783	0	+	0	transcript "70"
Adh	GenieESTHOM	CDS	522013	522988	350.100000	+	0	transcript "70"
Adh	GenieESTHOM	stop_codon	522986	522988	0	+	0	transcript "70"
Adh	GenieESTHOM	CDS	541380	542513	122.200000	+	0	transcript "71"
Adh	GenieESTHOM	start_codon	541380	541382	0	+	0	transcript "71"
Adh	GenieESTHOM	stop_codon	542511	542513	0	+	0	transcript "71"
Adh	GenieESTHOM	CDS	555360	555824	40.790000	+	0	transcript "72"
Adh	GenieESTHOM	start_codon	555360	555362	0	+	0	transcript "72"
Adh	GenieESTHOM	CDS	555920	556370	30.003000	+	0	transcript "72"
Adh	GenieESTHOM	CDS	556436	556503	1.463100	+	1	transcript "72"
Adh	GenieESTHOM	stop_codon	556501	556503	0	+	0	transcript "72"
Adh	GenieESTHOM	CDS	570063	570098	-3.000200	+	0	transcript "73"
Adh	GenieESTHOM	start_codon	570063	570065	0	+	0	transcript "73"
Adh	GenieESTHOM	CDS	570329	570703	147.320000	+	0	transcript "73"
Adh	GenieESTHOM	CDS	570872	570955	-1.656500	+	0	transcript "73"
Adh	GenieESTHOM	stop_codon	570953	570955	0	+	0	transcript "73"
Adh	GenieESTHOM	CDS	581768	581877	11.944000	+	0	transcript "74"
Adh	GenieESTHOM	start_codon	581768	581770	0	+	0	transcript "74"
Adh	GenieESTHOM	CDS	582235	582361	6.377200	+	0	transcript "74"
Adh	GenieESTHOM	stop_codon	582359	582361	0	+	0	transcript "74"
Adh	GenieESTHOM	CDS	598403	598796	57.267000	+	0	transcript "101"
Adh	GenieESTHOM	start_codon	598403	598405	0	+	0	transcript "101"
Adh	GenieESTHOM	CDS	598857	599119	24.849000	+	1	transcript "101"
Adh	GenieESTHOM	CDS	599219	600433	107.520000	+	0	transcript "101"
Adh	GenieESTHOM	stop_codon	600431	600433	0	+	0	transcript "101"
Adh	GenieESTHOM	CDS	601945	602889	12.661000	-	0	transcript "102"
Adh	GenieESTHOM	stop_codon	601945	601947	0	-	0	transcript "102"
Adh	GenieESTHOM	CDS	602944	603000	1.766000	-	0	transcript "102"
Adh	GenieESTHOM	start_codon	602998	603000	0	-	0	transcript "102"
Adh	GenieESTHOM	CDS	603442	603723	10.526000	-	0	transcript "103"
Adh	GenieESTHOM	stop_codon	603442	603444	0	-	0	transcript "103"
Adh	GenieESTHOM	CDS	603886	603951	-5.117700	-	0	transcript "103"
Adh	GenieESTHOM	CDS	604280	604323	-2.488000	-	0	transcript "103"
Adh	GenieESTHOM	CDS	604411	604456	-4.497600	-	0	transcript "103"
Adh	GenieESTHOM	start_codon	604454	604456	0	-	0	transcript "103"
Adh	GenieESTHOM	CDS	650075	650110	-2.646100	+	0	transcript "75"
Adh	GenieESTHOM	start_codon	650075	650077	0	+	0	transcript "75"
Adh	GenieESTHOM	CDS	650611	651153	102.410000	+	0	transcript "75"
Adh	GenieESTHOM	CDS	651278	651499	90.283000	+	0	transcript "75"
Adh	GenieESTHOM	CDS	651583	652282	112.260000	+	0	transcript "75"
Adh	GenieESTHOM	CDS	652397	652824	102.860000	+	1	transcript "75"
Adh	GenieESTHOM	stop_codon	652822	652824	0	+	0	transcript "75"
Adh	GenieESTHOM	CDS	657691	658001	15.595000	-	0	transcript "76"
Adh	GenieESTHOM	stop_codon	657691	657693	0	-	0	transcript "76"
Adh	GenieESTHOM	CDS	658058	658265	18.579000	-	0	transcript "76"
Adh	GenieESTHOM	CDS	658326	658463	10.081000	-	0	transcript "76"
Adh	GenieESTHOM	CDS	658526	660852	290.200000	-	0	transcript "76"
Adh	GenieESTHOM	CDS	660917	661331	79.630000	-	0	transcript "76"
Adh	GenieESTHOM	CDS	661834	661866	-0.860640	-	0	transcript "76"
Adh	GenieESTHOM	start_codon	661864	661866	0	-	0	transcript "76"
Adh	GenieESTHOM	CDS	679874	680889	226.020000	-	0	transcript "77"
Adh	GenieESTHOM	stop_codon	679874	679876	0	-	0	transcript "77"
Adh	GenieESTHOM	CDS	681018	681033	-1.737900	-	0	transcript "77"
Adh	GenieESTHOM	start_codon	681031	681033	0	-	0	transcript "77"
Adh	GenieESTHOM	CDS	682455	682488	-7.541900	-	0	transcript "78"
Adh	GenieESTHOM	stop_codon	682455	682457	0	-	0	transcript "78"
Adh	GenieESTHOM	CDS	682611	682771	62.955000	-	1	transcript "78"
Adh	GenieESTHOM	CDS	682831	682969	46.735000	-	0	transcript "78"
Adh	GenieESTHOM	CDS	689469	689746	106.570000	-	1	transcript "78"
Adh	GenieESTHOM	CDS	689811	689983	38.704000	-	0	transcript "78"
Adh	GenieESTHOM	CDS	690663	691035	50.209000	-	0	transcript "78"
Adh	GenieESTHOM	start_codon	691033	691035	0	-	0	transcript "78"
Adh	GenieESTHOM	CDS	754773	754919	12.975000	+	0	transcript "79"
Adh	GenieESTHOM	start_codon	754773	754775	0	+	0	transcript "79"
Adh	GenieESTHOM	stop_codon	754917	754919	0	+	0	transcript "79"
Adh	GenieESTHOM	CDS	757457	757873	47.792000	+	0	transcript "80"
Adh	GenieESTHOM	start_codon	757457	757459	0	+	0	transcript "80"
Adh	GenieESTHOM	stop_codon	757871	757873	0	+	0	transcript "80"
Adh	GenieESTHOM	CDS	771216	771615	21.669000	+	0	transcript "81"
Adh	GenieESTHOM	start_codon	771216	771218	0	+	0	transcript "81"
Adh	GenieESTHOM	CDS	771955	772460	37.971000	+	1	transcript "81"
Adh	GenieESTHOM	stop_codon	772458	772460	0	+	0	transcript "81"
Adh	GenieESTHOM	CDS	779378	779413	-2.468700	+	0	transcript "82"
Adh	GenieESTHOM	start_codon	779378	779380	0	+	0	transcript "82"
Adh	GenieESTHOM	CDS	779692	781583	518.100000	+	0	transcript "82"
Adh	GenieESTHOM	CDS	781886	782681	268.360000	+	0	transcript "82"
Adh	GenieESTHOM	CDS	783624	783650	-9.063200	+	0	transcript "82"
Adh	GenieESTHOM	stop_codon	783648	783650	0	+	0	transcript "82"
Adh	GenieESTHOM	CDS	801996	802961	116.510000	+	0	transcript "104"
Adh	GenieESTHOM	start_codon	801996	801998	0	+	0	transcript "104"
Adh	GenieESTHOM	stop_codon	802959	802961	0	+	0	transcript "104"
Adh	GenieESTHOM	CDS	812924	812990	0.713830	+	0	transcript "83"
Adh	GenieESTHOM	start_codon	812924	812926	0	+	0	transcript "83"
Adh	GenieESTHOM	CDS	813291	814650	402.580000	+	1	transcript "83"
Adh	GenieESTHOM	CDS	814726	814981	50.186000	+	0	transcript "83"
Adh	GenieESTHOM	CDS	815046	815442	114.670000	+	0	transcript "83"
Adh	GenieESTHOM	CDS	815528	817215	174.530000	+	1	transcript "83"
Adh	GenieESTHOM	CDS	817273	818025	126.610000	+	0	transcript "83"
Adh	GenieESTHOM	CDS	818086	818367	32.661000	+	0	transcript "83"
Adh	GenieESTHOM	CDS	818447	818574	6.149600	+	0	transcript "83"
Adh	GenieESTHOM	CDS	818633	819290	71.964000	+	0	transcript "83"
Adh	GenieESTHOM	CDS	820171	820789	68.645000	+	0	transcript "83"
Adh	GenieESTHOM	CDS	820846	820979	5.429300	+	1	transcript "83"
Adh	GenieESTHOM	CDS	821037	821265	10.632000	+	0	transcript "83"
Adh	GenieESTHOM	CDS	821333	821487	16.597000	+	1	transcript "83"
Adh	GenieESTHOM	stop_codon	821485	821487	0	+	0	transcript "83"
Adh	GenieESTHOM	CDS	822205	822454	10.460000	+	0	transcript "84"
Adh	GenieESTHOM	start_codon	822205	822207	0	+	0	transcript "84"
Adh	GenieESTHOM	CDS	822511	822848	20.375000	+	1	transcript "84"
Adh	GenieESTHOM	CDS	822907	824011	69.757000	+	0	transcript "84"
Adh	GenieESTHOM	CDS	824074	824822	39.780000	+	1	transcript "84"
Adh	GenieESTHOM	CDS	824885	825688	59.063000	+	0	transcript "84"
Adh	GenieESTHOM	CDS	825804	826423	15.824000	+	0	transcript "84"
Adh	GenieESTHOM	CDS	826980	827087	-0.491250	+	0	transcript "84"
Adh	GenieESTHOM	CDS	827148	827476	31.570000	+	0	transcript "84"
Adh	GenieESTHOM	CDS	828063	828343	32.078000	+	1	transcript "84"
Adh	GenieESTHOM	stop_codon	828341	828343	0	+	0	transcript "84"
Adh	GenieESTHOM	CDS	832137	833672	151.590000	+	0	transcript "85"
Adh	GenieESTHOM	start_codon	832137	832139	0	+	0	transcript "85"
Adh	GenieESTHOM	stop_codon	833670	833672	0	+	0	transcript "85"
Adh	GenieESTHOM	CDS	835092	835312	31.621000	+	0	transcript "86"
Adh	GenieESTHOM	start_codon	835092	835094	0	+	0	transcript "86"
Adh	GenieESTHOM	CDS	836514	837106	65.237000	+	0	transcript "86"
Adh	GenieESTHOM	CDS	837173	837428	18.300000	+	1	transcript "86"
Adh	GenieESTHOM	CDS	837486	837859	34.479000	+	0	transcript "86"
Adh	GenieESTHOM	CDS	837919	838152	24.878000	+	1	transcript "86"
Adh	GenieESTHOM	CDS	838217	839076	109.480000	+	1	transcript "86"
Adh	GenieESTHOM	stop_codon	839074	839076	0	+	0	transcript "86"
Adh	GenieESTHOM	CDS	839712	839872	-8.832400	-	0	transcript "87"
Adh	GenieESTHOM	stop_codon	839712	839714	0	-	0	transcript "87"
Adh	GenieESTHOM	CDS	840060	840448	18.918000	-	0	transcript "87"
Adh	GenieESTHOM	CDS	841158	841333	-1.827000	-	1	transcript "87"
Adh	GenieESTHOM	CDS	841389	841969	48.777000	-	0	transcript "87"
Adh	GenieESTHOM	CDS	842034	842419	31.992000	-	0	transcript "87"
Adh	GenieESTHOM	CDS	842969	843375	73.977000	-	1	transcript "87"
Adh	GenieESTHOM	CDS	843445	843518	2.785500	-	0	transcript "87"
Adh	GenieESTHOM	CDS	843799	843808	-1.136300	-	0	transcript "87"
Adh	GenieESTHOM	start_codon	843806	843808	0	-	0	transcript "87"
Adh	GenieESTHOM	CDS	845892	846056	10.361000	+	0	transcript "88"
Adh	GenieESTHOM	start_codon	845892	845894	0	+	0	transcript "88"
Adh	GenieESTHOM	CDS	846157	846339	-8.883200	+	0	transcript "88"
Adh	GenieESTHOM	stop_codon	846337	846339	0	+	0	transcript "88"
Adh	GenieESTHOM	CDS	846397	847372	135.720000	-	0	transcript "89"
Adh	GenieESTHOM	stop_codon	846397	846399	0	-	0	transcript "89"
Adh	GenieESTHOM	CDS	847433	848154	64.432000	-	1	transcript "89"
Adh	GenieESTHOM	CDS	848208	848609	48.366000	-	0	transcript "89"
Adh	GenieESTHOM	CDS	848668	848733	7.073700	-	0	transcript "89"
Adh	GenieESTHOM	start_codon	848731	848733	0	-	0	transcript "89"
Adh	GenieESTHOM	CDS	849268	849277	-1.559800	+	0	transcript "90"
Adh	GenieESTHOM	start_codon	849268	849270	0	+	0	transcript "90"
Adh	GenieESTHOM	CDS	851077	851190	10.665000	+	1	transcript "90"
Adh	GenieESTHOM	CDS	851256	851436	16.138000	+	1	transcript "90"
Adh	GenieESTHOM	CDS	851491	851673	17.969000	+	0	transcript "90"
Adh	GenieESTHOM	CDS	851742	851919	21.041000	+	0	transcript "90"
Adh	GenieESTHOM	stop_codon	851917	851919	0	+	0	transcript "90"
Adh	GenieESTHOM	CDS	853116	855014	304.840000	+	0	transcript "91"
Adh	GenieESTHOM	start_codon	853116	853118	0	+	0	transcript "91"
Adh	GenieESTHOM	stop_codon	855012	855014	0	+	0	transcript "91"
Adh	GenieESTHOM	CDS	855874	855922	1.880600	+	0	transcript "92"
Adh	GenieESTHOM	start_codon	855874	855876	0	+	0	transcript "92"
Adh	GenieESTHOM	CDS	855982	856031	-4.428900	+	1	transcript "92"
Adh	GenieESTHOM	CDS	856092	856876	543.200000	+	0	transcript "92"
Adh	GenieESTHOM	CDS	856942	858029	670.430000	+	0	transcript "92"
Adh	GenieESTHOM	CDS	858109	858341	121.680000	+	1	transcript "92"
Adh	GenieESTHOM	CDS	858418	858966	339.340000	+	0	transcript "92"
Adh	GenieESTHOM	stop_codon	858964	858966	0	+	0	transcript "92"
Adh	GenieESTHOM	CDS	870684	870866	13.644000	-	0	transcript "93"
Adh	GenieESTHOM	stop_codon	870684	870686	0	-	0	transcript "93"
Adh	GenieESTHOM	start_codon	870864	870866	0	-	0	transcript "93"
Adh	GenieESTHOM	CDS	872557	872818	10.799000	-	0	transcript "94"
Adh	GenieESTHOM	stop_codon	872557	872559	0	-	0	transcript "94"
Adh	GenieESTHOM	CDS	872891	873131	17.889000	-	1	transcript "94"
Adh	GenieESTHOM	CDS	873191	873321	0.446900	-	0	transcript "94"
Adh	GenieESTHOM	CDS	873388	873527	2.295400	-	1	transcript "94"
Adh	GenieESTHOM	CDS	873583	874124	312.520000	-	0	transcript "94"
Adh	GenieESTHOM	CDS	874273	874541	7.269300	-	0	transcript "94"
Adh	GenieESTHOM	CDS	874599	874870	19.296000	-	1	transcript "94"
Adh	GenieESTHOM	start_codon	874868	874870	0	-	0	transcript "94"
Adh	GenieESTHOM	CDS	884916	885676	113.080000	-	0	transcript "95"
Adh	GenieESTHOM	stop_codon	884916	884918	0	-	0	transcript "95"
Adh	GenieESTHOM	CDS	885967	886798	150.730000	-	0	transcript "95"
Adh	GenieESTHOM	CDS	887891	887908	-2.451600	-	0	transcript "95"
Adh	GenieESTHOM	start_codon	887906	887908	0	-	0	transcript "95"
Adh	GenieESTHOM	CDS	910572	910742	6.497100	-	0	transcript "96"
Adh	GenieESTHOM	stop_codon	910572	910574	0	-	0	transcript "96"
Adh	GenieESTHOM	CDS	910801	911055	31.243000	-	0	transcript "96"
Adh	GenieESTHOM	start_codon	911053	911055	0	-	0	transcript "96"
Adh	GenieESTHOM	CDS	918151	918795	75.491000	-	0	transcript "97"
Adh	GenieESTHOM	stop_codon	918151	918153	0	-	0	transcript "97"
Adh	GenieESTHOM	CDS	918858	918869	-1.928000	-	0	transcript "97"
Adh	GenieESTHOM	start_codon	918867	918869	0	-	0	transcript "97"
Adh	GenieESTHOM	CDS	944218	944493	21.855000	-	0	transcript "98"
Adh	GenieESTHOM	stop_codon	944218	944220	0	-	0	transcript "98"
Adh	GenieESTHOM	start_codon	944491	944493	0	-	0	transcript "98"
Adh	GenieESTHOM	CDS	959527	959749	99.884000	-	0	transcript "99"
Adh	GenieESTHOM	stop_codon	959527	959529	0	-	0	transcript "99"
Adh	GenieESTHOM	CDS	961229	962655	265.300000	-	1	transcript "99"
Adh	GenieESTHOM	start_codon	962653	962655	0	-	0	transcript "99"
Adh	GenieESTHOM	CDS	984981	985070	6.638600	+	0	transcript "100"
Adh	GenieESTHOM	start_codon	984981	984983	0	+	0	transcript "100"
Adh	GenieESTHOM	CDS	985373	986896	1176.600000	+	0	transcript "100"
Adh	GenieESTHOM	stop_codon	986894	986896	0	+	0	transcript "100"
Adh	GenieESTHOM	CDS	1041376	1041530	7.550600	-	0	transcript "105"
Adh	GenieESTHOM	stop_codon	1041376	1041378	0	-	0	transcript "105"
Adh	GenieESTHOM	CDS	1041602	1041989	21.581000	-	0	transcript "105"
Adh	GenieESTHOM	CDS	1042386	1042688	28.998000	-	0	transcript "105"
Adh	GenieESTHOM	start_codon	1042686	1042688	0	-	0	transcript "105"
Adh	GenieESTHOM	CDS	1056859	1057314	223.540000	-	0	transcript "106"
Adh	GenieESTHOM	stop_codon	1056859	1056861	0	-	0	transcript "106"
Adh	GenieESTHOM	start_codon	1057312	1057314	0	-	0	transcript "106"
Adh	GenieESTHOM	CDS	1094414	1094610	6.346800	-	0	transcript "107"
Adh	GenieESTHOM	stop_codon	1094414	1094416	0	-	0	transcript "107"
Adh	GenieESTHOM	CDS	1094867	1095215	10.626000	-	0	transcript "107"
Adh	GenieESTHOM	CDS	1095422	1095533	-2.338700	-	0	transcript "107"
Adh	GenieESTHOM	CDS	1095586	1095735	9.619500	-	1	transcript "107"
Adh	GenieESTHOM	CDS	1095848	1095987	5.042400	-	1	transcript "107"
Adh	GenieESTHOM	CDS	1096062	1096196	9.104500	-	0	transcript "107"
Adh	GenieESTHOM	CDS	1096326	1098979	304.150000	-	0	transcript "107"
Adh	GenieESTHOM	CDS	1099099	1099111	-1.379500	-	0	transcript "107"
Adh	GenieESTHOM	start_codon	1099109	1099111	0	-	0	transcript "107"
Adh	GenieESTHOM	CDS	1104411	1104965	269.150000	-	0	transcript "134"
Adh	GenieESTHOM	stop_codon	1104411	1104413	0	-	0	transcript "134"
Adh	GenieESTHOM	start_codon	1104963	1104965	0	-	0	transcript "134"
Adh	GenieESTHOM	CDS	1110074	1110172	48.726000	+	0	transcript "108"
Adh	GenieESTHOM	start_codon	1110074	1110076	0	+	0	transcript "108"
Adh	GenieESTHOM	CDS	1110238	1110642	275.490000	+	0	transcript "108"
Adh	GenieESTHOM	CDS	1110713	1110979	173.970000	+	0	transcript "108"
Adh	GenieESTHOM	stop_codon	1110977	1110979	0	+	0	transcript "108"
Adh	GenieESTHOM	CDS	1111283	1111378	9.383100	+	0	transcript "109"
Adh	GenieESTHOM	start_codon	1111283	1111285	0	+	0	transcript "109"
Adh	GenieESTHOM	CDS	1111805	1112209	216.820000	+	0	transcript "109"
Adh	GenieESTHOM	CDS	1112261	1112578	43.088000	+	0	transcript "109"
Adh	GenieESTHOM	stop_codon	1112576	1112578	0	+	0	transcript "109"
Adh	GenieESTHOM	CDS	1115807	1115987	7.158300	+	0	transcript "110"
Adh	GenieESTHOM	start_codon	1115807	1115809	0	+	0	transcript "110"
Adh	GenieESTHOM	CDS	1116315	1116493	16.016000	+	1	transcript "110"
Adh	GenieESTHOM	stop_codon	1116491	1116493	0	+	0	transcript "110"
Adh	GenieESTHOM	CDS	1117474	1117608	24.390000	+	0	transcript "111"
Adh	GenieESTHOM	start_codon	1117474	1117476	0	+	0	transcript "111"
Adh	GenieESTHOM	stop_codon	1117606	1117608	0	+	0	transcript "111"
Adh	GenieESTHOM	CDS	1136212	1136258	-3.188700	-	0	transcript "112"
Adh	GenieESTHOM	stop_codon	1136212	1136214	0	-	0	transcript "112"
Adh	GenieESTHOM	CDS	1136483	1136509	-8.449000	-	0	transcript "112"
Adh	GenieESTHOM	CDS	1145575	1145647	0.224460	-	0	transcript "112"
Adh	GenieESTHOM	start_codon	1145645	1145647	0	-	0	transcript "112"
Adh	GenieESTHOM	CDS	1206614	1206790	40.716000	+	0	transcript "135"
Adh	GenieESTHOM	start_codon	1206614	1206616	0	+	0	transcript "135"
Adh	GenieESTHOM	CDS	1207666	1207953	59.930000	+	0	transcript "135"
Adh	GenieESTHOM	stop_codon	1207951	1207953	0	+	0	transcript "135"
Adh	GenieESTHOM	CDS	1218630	1218652	-6.454600	-	0	transcript "113"
Adh	GenieESTHOM	stop_codon	1218630	1218632	0	-	0	transcript "113"
Adh	GenieESTHOM	CDS	1218756	1220253	31.350000	-	0	transcript "113"
Adh	GenieESTHOM	CDS	1220453	1221762	10.474000	-	0	transcript "113"
Adh	GenieESTHOM	CDS	1222288	1222395	1.781000	-	0	transcript "113"
Adh	GenieESTHOM	CDS	1222483	1222579	-6.141500	-	0	transcript "113"
Adh	GenieESTHOM	start_codon	1222577	1222579	0	-	0	transcript "113"
Adh	GenieESTHOM	CDS	1229684	1230733	85.374000	+	0	transcript "114"
Adh	GenieESTHOM	start_codon	1229684	1229686	0	+	0	transcript "114"
Adh	GenieESTHOM	stop_codon	1230731	1230733	0	+	0	transcript "114"
Adh	GenieESTHOM	CDS	1231127	1231384	65.899000	-	0	transcript "115"
Adh	GenieESTHOM	stop_codon	1231127	1231129	0	-	0	transcript "115"
Adh	GenieESTHOM	CDS	1231452	1231463	-2.119700	-	0	transcript "115"
Adh	GenieESTHOM	start_codon	1231461	1231463	0	-	0	transcript "115"
Adh	GenieESTHOM	CDS	1233087	1233293	38.174000	+	0	transcript "116"
Adh	GenieESTHOM	start_codon	1233087	1233089	0	+	0	transcript "116"
Adh	GenieESTHOM	stop_codon	1233291	1233293	0	+	0	transcript "116"
Adh	GenieESTHOM	CDS	1250633	1251421	93.812000	+	0	transcript "117"
Adh	GenieESTHOM	start_codon	1250633	1250635	0	+	0	transcript "117"
Adh	GenieESTHOM	stop_codon	1251419	1251421	0	+	0	transcript "117"
Adh	GenieESTHOM	CDS	1252523	1253617	68.034000	+	0	transcript "118"
Adh	GenieESTHOM	start_codon	1252523	1252525	0	+	0	transcript "118"
Adh	GenieESTHOM	stop_codon	1253615	1253617	0	+	0	transcript "118"
Adh	GenieESTHOM	CDS	1255669	1256823	119.160000	+	0	transcript "119"
Adh	GenieESTHOM	start_codon	1255669	1255671	0	+	0	transcript "119"
Adh	GenieESTHOM	stop_codon	1256821	1256823	0	+	0	transcript "119"
Adh	GenieESTHOM	CDS	1263535	1264034	-11.756000	-	0	transcript "120"
Adh	GenieESTHOM	stop_codon	1263535	1263537	0	-	0	transcript "120"
Adh	GenieESTHOM	CDS	1264126	1264237	-8.132700	-	0	transcript "120"
Adh	GenieESTHOM	start_codon	1264235	1264237	0	-	0	transcript "120"
Adh	GenieESTHOM	CDS	1271377	1272140	13.632000	-	0	transcript "121"
Adh	GenieESTHOM	stop_codon	1271377	1271379	0	-	0	transcript "121"
Adh	GenieESTHOM	CDS	1272217	1272271	0.605850	-	0	transcript "121"
Adh	GenieESTHOM	start_codon	1272269	1272271	0	-	0	transcript "121"
Adh	GenieESTHOM	CDS	1294081	1294187	-5.114300	-	0	transcript "122"
Adh	GenieESTHOM	stop_codon	1294081	1294083	0	-	0	transcript "122"
Adh	GenieESTHOM	CDS	1297137	1298310	689.560000	-	0	transcript "122"
Adh	GenieESTHOM	start_codon	1298308	1298310	0	-	0	transcript "122"
Adh	GenieESTHOM	CDS	1334780	1335024	34.717000	-	0	transcript "123"
Adh	GenieESTHOM	stop_codon	1334780	1334782	0	-	0	transcript "123"
Adh	GenieESTHOM	CDS	1335080	1335356	85.692000	-	0	transcript "123"
Adh	GenieESTHOM	CDS	1335416	1336149	280.570000	-	0	transcript "123"
Adh	GenieESTHOM	CDS	1336553	1336720	1.020500	-	0	transcript "123"
Adh	GenieESTHOM	CDS	1338337	1338640	138.800000	-	0	transcript "123"
Adh	GenieESTHOM	CDS	1338702	1338785	9.234600	-	0	transcript "123"
Adh	GenieESTHOM	start_codon	1338783	1338785	0	-	0	transcript "123"
Adh	GenieESTHOM	CDS	1365077	1365100	-7.689600	-	0	transcript "124"
Adh	GenieESTHOM	stop_codon	1365077	1365079	0	-	0	transcript "124"
Adh	GenieESTHOM	CDS	1365170	1365361	12.666000	-	0	transcript "124"
Adh	GenieESTHOM	CDS	1365421	1365611	0.834990	-	0	transcript "124"
Adh	GenieESTHOM	CDS	1365666	1365732	5.211000	-	0	transcript "124"
Adh	GenieESTHOM	start_codon	1365730	1365732	0	-	0	transcript "124"
Adh	GenieESTHOM	CDS	1371868	1371921	0.380390	-	0	transcript "125"
Adh	GenieESTHOM	stop_codon	1371868	1371870	0	-	0	transcript "125"
Adh	GenieESTHOM	CDS	1371971	1372213	15.395000	-	0	transcript "125"
Adh	GenieESTHOM	start_codon	1372211	1372213	0	-	0	transcript "125"
Adh	GenieESTHOM	CDS	1372338	1372372	-5.657800	-	0	transcript "126"
Adh	GenieESTHOM	stop_codon	1372338	1372340	0	-	0	transcript "126"
Adh	GenieESTHOM	CDS	1373531	1373546	-2.234200	-	0	transcript "126"
Adh	GenieESTHOM	start_codon	1373544	1373546	0	-	0	transcript "126"
Adh	GenieESTHOM	CDS	1398183	1398833	89.997000	-	0	transcript "136"
Adh	GenieESTHOM	stop_codon	1398183	1398185	0	-	0	transcript "136"
Adh	GenieESTHOM	CDS	1399403	1399429	-1.532700	-	0	transcript "136"
Adh	GenieESTHOM	start_codon	1399427	1399429	0	-	0	transcript "136"
Adh	GenieESTHOM	CDS	1401419	1401445	-6.795300	-	0	transcript "137"
Adh	GenieESTHOM	stop_codon	1401419	1401421	0	-	0	transcript "137"
Adh	GenieESTHOM	CDS	1401633	1401874	42.690000	-	0	transcript "137"
Adh	GenieESTHOM	CDS	1402535	1402643	2.930000	-	0	transcript "137"
Adh	GenieESTHOM	CDS	1402808	1402995	15.412000	-	0	transcript "137"
Adh	GenieESTHOM	CDS	1403930	1404047	8.017300	-	0	transcript "137"
Adh	GenieESTHOM	start_codon	1404045	1404047	0	-	0	transcript "137"
Adh	GenieESTHOM	CDS	1415492	1415566	-1.380300	+	0	transcript "127"
Adh	GenieESTHOM	start_codon	1415492	1415494	0	+	0	transcript "127"
Adh	GenieESTHOM	CDS	1415885	1417887	641.780000	+	0	transcript "127"
Adh	GenieESTHOM	CDS	1417987	1418081	4.168600	+	0	transcript "127"
Adh	GenieESTHOM	CDS	1418142	1419321	470.390000	+	1	transcript "127"
Adh	GenieESTHOM	CDS	1419378	1419876	131.660000	+	0	transcript "127"
Adh	GenieESTHOM	CDS	1419934	1419972	-5.887700	+	0	transcript "127"
Adh	GenieESTHOM	stop_codon	1419970	1419972	0	+	0	transcript "127"
Adh	GenieESTHOM	CDS	1425535	1425752	4.637200	-	0	transcript "128"
Adh	GenieESTHOM	stop_codon	1425535	1425537	0	-	0	transcript "128"
Adh	GenieESTHOM	CDS	1426168	1426258	7.701700	-	0	transcript "128"
Adh	GenieESTHOM	start_codon	1426256	1426258	0	-	0	transcript "128"
Adh	GenieESTHOM	CDS	1465977	1466019	-2.836900	-	0	transcript "129"
Adh	GenieESTHOM	stop_codon	1465977	1465979	0	-	0	transcript "129"
Adh	GenieESTHOM	CDS	1466153	1466744	85.975000	-	1	transcript "129"
Adh	GenieESTHOM	CDS	1466876	1467307	33.471000	-	0	transcript "129"
Adh	GenieESTHOM	CDS	1473611	1473745	5.442900	-	0	transcript "129"
Adh	GenieESTHOM	CDS	1473857	1473914	-11.545000	-	0	transcript "129"
Adh	GenieESTHOM	CDS	1481966	1482165	-9.343100	-	0	transcript "129"
Adh	GenieESTHOM	CDS	1484357	1484396	-2.162100	-	0	transcript "129"
Adh	GenieESTHOM	start_codon	1484394	1484396	0	-	0	transcript "129"
Adh	GenieESTHOM	CDS	1495484	1495522	1.469100	+	0	transcript "130"
Adh	GenieESTHOM	start_codon	1495484	1495486	0	+	0	transcript "130"
Adh	GenieESTHOM	CDS	1495620	1495919	25.497000	+	0	transcript "130"
Adh	GenieESTHOM	CDS	1495977	1496198	18.637000	+	0	transcript "130"
Adh	GenieESTHOM	stop_codon	1496196	1496198	0	+	0	transcript "130"
Adh	GenieESTHOM	CDS	1496304	1496815	76.325000	-	0	transcript "131"
Adh	GenieESTHOM	stop_codon	1496304	1496306	0	-	0	transcript "131"
Adh	GenieESTHOM	CDS	1496865	1497000	25.236000	-	0	transcript "131"
Adh	GenieESTHOM	start_codon	1496998	1497000	0	-	0	transcript "131"
Adh	GenieESTHOM	CDS	1497576	1498121	124.250000	+	0	transcript "132"
Adh	GenieESTHOM	start_codon	1497576	1497578	0	+	0	transcript "132"
Adh	GenieESTHOM	stop_codon	1498119	1498121	0	+	0	transcript "132"
Adh	GenieESTHOM	CDS	1498334	1499046	65.715000	-	0	transcript "133"
Adh	GenieESTHOM	stop_codon	1498334	1498336	0	-	0	transcript "133"
Adh	GenieESTHOM	CDS	1499102	1499249	10.056000	-	0	transcript "133"
Adh	GenieESTHOM	start_codon	1499247	1499249	0	-	0	transcript "133"
Adh	GenieESTHOM	CDS	1500039	1500797	82.096000	+	0	transcript "138"
Adh	GenieESTHOM	start_codon	1500039	1500041	0	+	0	transcript "138"
Adh	GenieESTHOM	CDS	1500954	1501010	-2.097600	+	0	transcript "138"
Adh	GenieESTHOM	stop_codon	1501008	1501010	0	+	0	transcript "138"
Adh	GenieESTHOM	CDS	1515068	1515175	5.871800	+	0	transcript "139"
Adh	GenieESTHOM	start_codon	1515068	1515070	0	+	0	transcript "139"
Adh	GenieESTHOM	CDS	1515266	1515436	20.435000	+	0	transcript "139"
Adh	GenieESTHOM	CDS	1515498	1515714	11.218000	+	0	transcript "139"
Adh	GenieESTHOM	CDS	1515807	1515972	6.709800	+	1	transcript "139"
Adh	GenieESTHOM	CDS	1516036	1516279	18.450000	+	0	transcript "139"
Adh	GenieESTHOM	CDS	1516339	1516527	-2.014100	+	0	transcript "139"
Adh	GenieESTHOM	stop_codon	1516525	1516527	0	+	0	transcript "139"
Adh	GenieESTHOM	CDS	1519306	1519382	-2.829400	+	0	transcript "140"
Adh	GenieESTHOM	start_codon	1519306	1519308	0	+	0	transcript "140"
Adh	GenieESTHOM	CDS	1519441	1519564	-3.660600	+	0	transcript "140"
Adh	GenieESTHOM	CDS	1519897	1520023	-7.102600	+	0	transcript "140"
Adh	GenieESTHOM	CDS	1520081	1520337	11.739000	+	1	transcript "140"
Adh	GenieESTHOM	CDS	1520398	1520535	-2.078900	+	0	transcript "140"
Adh	GenieESTHOM	CDS	1521654	1521834	18.846000	+	0	transcript "140"
Adh	GenieESTHOM	CDS	1522286	1522308	-8.716800	+	1	transcript "140"
Adh	GenieESTHOM	stop_codon	1522306	1522308	0	+	0	transcript "140"
Adh	GenieESTHOM	CDS	1525248	1525447	36.152000	+	0	transcript "141"
Adh	GenieESTHOM	start_codon	1525248	1525250	0	+	0	transcript "141"
Adh	GenieESTHOM	CDS	1526237	1526642	49.907000	+	0	transcript "141"
Adh	GenieESTHOM	CDS	1526702	1527379	63.185000	+	0	transcript "141"
Adh	GenieESTHOM	stop_codon	1527377	1527379	0	+	0	transcript "141"
Adh	GenieESTHOM	CDS	1527523	1527636	8.675300	-	0	transcript "142"
Adh	GenieESTHOM	stop_codon	1527523	1527525	0	-	0	transcript "142"
Adh	GenieESTHOM	CDS	1527705	1528201	69.856000	-	0	transcript "142"
Adh	GenieESTHOM	CDS	1528291	1528426	17.615000	-	0	transcript "142"
Adh	GenieESTHOM	start_codon	1528424	1528426	0	-	0	transcript "142"
Adh	GenieESTHOM	CDS	1529588	1529971	80.971000	+	0	transcript "143"
Adh	GenieESTHOM	start_codon	1529588	1529590	0	+	0	transcript "143"
Adh	GenieESTHOM	CDS	1530746	1531626	104.260000	+	0	transcript "143"
Adh	GenieESTHOM	CDS	1531685	1531892	18.041000	+	0	transcript "143"
Adh	GenieESTHOM	CDS	1531958	1532269	35.008000	+	0	transcript "143"
Adh	GenieESTHOM	stop_codon	1532267	1532269	0	+	0	transcript "143"
Adh	GenieESTHOM	CDS	1535065	1535271	-2.504300	-	0	transcript "144"
Adh	GenieESTHOM	stop_codon	1535065	1535067	0	-	0	transcript "144"
Adh	GenieESTHOM	CDS	1535341	1535461	-1.928100	-	0	transcript "144"
Adh	GenieESTHOM	CDS	1535530	1535676	31.168000	-	1	transcript "144"
Adh	GenieESTHOM	CDS	1535739	1536304	281.050000	-	1	transcript "144"
Adh	GenieESTHOM	CDS	1536364	1537150	298.270000	-	0	transcript "144"
Adh	GenieESTHOM	CDS	1537212	1538662	266.390000	-	1	transcript "144"
Adh	GenieESTHOM	CDS	1538719	1541113	984.830000	-	0	transcript "144"
Adh	GenieESTHOM	CDS	1541178	1541378	6.934800	-	1	transcript "144"
Adh	GenieESTHOM	CDS	1541445	1541794	14.039000	-	1	transcript "144"
Adh	GenieESTHOM	CDS	1542125	1542385	42.652000	-	0	transcript "144"
Adh	GenieESTHOM	CDS	1543103	1543173	-0.155980	-	0	transcript "144"
Adh	GenieESTHOM	CDS	1547400	1547409	-1.787900	-	0	transcript "144"
Adh	GenieESTHOM	start_codon	1547407	1547409	0	-	0	transcript "144"
Adh	GenieESTHOM	CDS	1549142	1550017	162.070000	-	0	transcript "145"
Adh	GenieESTHOM	stop_codon	1549142	1549144	0	-	0	transcript "145"
Adh	GenieESTHOM	CDS	1550084	1550149	8.933300	-	0	transcript "145"
Adh	GenieESTHOM	start_codon	1550147	1550149	0	-	0	transcript "145"
Adh	GenieESTHOM	CDS	1554085	1554599	69.360000	-	0	transcript "146"
Adh	GenieESTHOM	stop_codon	1554085	1554087	0	-	0	transcript "146"
Adh	GenieESTHOM	CDS	1554841	1555107	40.725000	-	0	transcript "146"
Adh	GenieESTHOM	CDS	1556588	1557278	107.790000	-	0	transcript "146"
Adh	GenieESTHOM	start_codon	1557276	1557278	0	-	0	transcript "146"
Adh	GenieESTHOM	CDS	1558057	1558080	-0.775290	+	0	transcript "147"
Adh	GenieESTHOM	start_codon	1558057	1558059	0	+	0	transcript "147"
Adh	GenieESTHOM	CDS	1558134	1558521	54.139000	+	0	transcript "147"
Adh	GenieESTHOM	CDS	1558685	1558960	7.562300	+	1	transcript "147"
Adh	GenieESTHOM	CDS	1559053	1559117	-3.361000	+	1	transcript "147"
Adh	GenieESTHOM	stop_codon	1559115	1559117	0	+	0	transcript "147"
Adh	GenieESTHOM	CDS	1561458	1561671	-4.122100	+	0	transcript "148"
Adh	GenieESTHOM	start_codon	1561458	1561460	0	+	0	transcript "148"
Adh	GenieESTHOM	CDS	1561989	1562278	49.596000	+	1	transcript "148"
Adh	GenieESTHOM	CDS	1562338	1563081	424.230000	+	0	transcript "148"
Adh	GenieESTHOM	CDS	1563140	1563353	105.830000	+	0	transcript "148"
Adh	GenieESTHOM	CDS	1563418	1563689	148.530000	+	1	transcript "148"
Adh	GenieESTHOM	CDS	1563761	1563814	7.522600	+	0	transcript "148"
Adh	GenieESTHOM	stop_codon	1563812	1563814	0	+	0	transcript "148"
Adh	GenieESTHOM	CDS	1565296	1565530	33.303000	+	0	transcript "149"
Adh	GenieESTHOM	start_codon	1565296	1565298	0	+	0	transcript "149"
Adh	GenieESTHOM	CDS	1566007	1566032	-5.226500	+	1	transcript "149"
Adh	GenieESTHOM	stop_codon	1566030	1566032	0	+	0	transcript "149"
Adh	GenieESTHOM	CDS	1576485	1576515	-3.331200	+	0	transcript "150"
Adh	GenieESTHOM	start_codon	1576485	1576487	0	+	0	transcript "150"
Adh	GenieESTHOM	CDS	1576691	1576943	8.151900	+	1	transcript "150"
Adh	GenieESTHOM	CDS	1577036	1577406	49.371000	+	0	transcript "150"
Adh	GenieESTHOM	CDS	1577568	1577860	11.645000	+	1	transcript "150"
Adh	GenieESTHOM	CDS	1577926	1578108	10.510000	+	0	transcript "150"
Adh	GenieESTHOM	stop_codon	1578106	1578108	0	+	0	transcript "150"
Adh	GenieESTHOM	CDS	1580640	1580685	3.562700	+	0	transcript "151"
Adh	GenieESTHOM	start_codon	1580640	1580642	0	+	0	transcript "151"
Adh	GenieESTHOM	CDS	1580750	1580880	-3.640600	+	1	transcript "151"
Adh	GenieESTHOM	CDS	1580946	1581227	15.101000	+	0	transcript "151"
Adh	GenieESTHOM	CDS	1581294	1581623	13.812000	+	0	transcript "151"
Adh	GenieESTHOM	CDS	1581774	1582136	39.592000	+	0	transcript "151"
Adh	GenieESTHOM	CDS	1582201	1582292	0.821060	+	0	transcript "151"
Adh	GenieESTHOM	CDS	1583070	1583334	18.473000	+	0	transcript "151"
Adh	GenieESTHOM	CDS	1584330	1584828	60.419000	+	0	transcript "151"
Adh	GenieESTHOM	CDS	1584949	1585094	20.028000	+	1	transcript "151"
Adh	GenieESTHOM	CDS	1585153	1585380	15.833000	+	0	transcript "151"
Adh	GenieESTHOM	stop_codon	1585378	1585380	0	+	0	transcript "151"
Adh	GenieESTHOM	CDS	1599218	1600177	99.690000	+	0	transcript "175"
Adh	GenieESTHOM	start_codon	1599218	1599220	0	+	0	transcript "175"
Adh	GenieESTHOM	CDS	1601744	1602527	191.250000	+	0	transcript "175"
Adh	GenieESTHOM	CDS	1603452	1603885	207.540000	+	1	transcript "175"
Adh	GenieESTHOM	CDS	1603951	1605404	1013.400000	+	0	transcript "175"
Adh	GenieESTHOM	CDS	1605651	1606718	197.240000	+	0	transcript "175"
Adh	GenieESTHOM	CDS	1606791	1607118	190.040000	+	0	transcript "175"
Adh	GenieESTHOM	CDS	1607205	1607306	34.938000	+	0	transcript "175"
Adh	GenieESTHOM	stop_codon	1607304	1607306	0	+	0	transcript "175"
Adh	GenieESTHOM	CDS	1653146	1653414	3.942300	-	0	transcript "152"
Adh	GenieESTHOM	stop_codon	1653146	1653148	0	-	0	transcript "152"
Adh	GenieESTHOM	CDS	1653937	1656880	577.800000	-	0	transcript "152"
Adh	GenieESTHOM	CDS	1656971	1657133	1.482800	-	0	transcript "152"
Adh	GenieESTHOM	CDS	1657232	1657338	9.682700	-	1	transcript "152"
Adh	GenieESTHOM	start_codon	1657336	1657338	0	-	0	transcript "152"
Adh	GenieESTHOM	CDS	1667412	1667446	-5.767700	-	0	transcript "153"
Adh	GenieESTHOM	stop_codon	1667412	1667414	0	-	0	transcript "153"
Adh	GenieESTHOM	CDS	1667694	1667970	40.648000	-	0	transcript "153"
Adh	GenieESTHOM	start_codon	1667968	1667970	0	-	0	transcript "153"
Adh	GenieESTHOM	CDS	1718580	1718725	17.066000	-	0	transcript "154"
Adh	GenieESTHOM	stop_codon	1718580	1718582	0	-	0	transcript "154"
Adh	GenieESTHOM	CDS	1719195	1719342	8.610400	-	0	transcript "154"
Adh	GenieESTHOM	CDS	1719504	1720004	59.547000	-	0	transcript "154"
Adh	GenieESTHOM	start_codon	1720002	1720004	0	-	0	transcript "154"
Adh	GenieESTHOM	CDS	1726252	1726435	18.276000	-	0	transcript "155"
Adh	GenieESTHOM	stop_codon	1726252	1726254	0	-	0	transcript "155"
Adh	GenieESTHOM	CDS	1730116	1730236	-0.531940	-	1	transcript "155"
Adh	GenieESTHOM	CDS	1731062	1731172	3.575600	-	0	transcript "155"
Adh	GenieESTHOM	CDS	1735826	1736004	1.676000	-	0	transcript "155"
Adh	GenieESTHOM	CDS	1737215	1737246	-0.087101	-	1	transcript "155"
Adh	GenieESTHOM	start_codon	1737244	1737246	0	-	0	transcript "155"
Adh	GenieESTHOM	CDS	1738791	1739218	79.569000	+	0	transcript "156"
Adh	GenieESTHOM	start_codon	1738791	1738793	0	+	0	transcript "156"
Adh	GenieESTHOM	CDS	1740300	1740540	24.083000	+	0	transcript "156"
Adh	GenieESTHOM	CDS	1740659	1740939	36.239000	+	0	transcript "156"
Adh	GenieESTHOM	CDS	1740995	1742042	128.040000	+	0	transcript "156"
Adh	GenieESTHOM	CDS	1742104	1742446	41.061000	+	0	transcript "156"
Adh	GenieESTHOM	CDS	1742886	1743193	32.811000	+	1	transcript "156"
Adh	GenieESTHOM	stop_codon	1743191	1743193	0	+	0	transcript "156"
Adh	GenieESTHOM	CDS	1744620	1745915	173.240000	-	0	transcript "157"
Adh	GenieESTHOM	stop_codon	1744620	1744622	0	-	0	transcript "157"
Adh	GenieESTHOM	start_codon	1745913	1745915	0	-	0	transcript "157"
Adh	GenieESTHOM	CDS	1746292	1746308	-0.898620	+	0	transcript "158"
Adh	GenieESTHOM	start_codon	1746292	1746294	0	+	0	transcript "158"
Adh	GenieESTHOM	CDS	1746401	1746842	44.773000	+	0	transcript "158"
Adh	GenieESTHOM	stop_codon	1746840	1746842	0	+	0	transcript "158"
Adh	GenieESTHOM	CDS	1747065	1747238	4.316400	-	0	transcript "159"
Adh	GenieESTHOM	stop_codon	1747065	1747067	0	-	0	transcript "159"
Adh	GenieESTHOM	CDS	1747451	1747757	30.192000	-	0	transcript "159"
Adh	GenieESTHOM	CDS	1747825	1748093	23.447000	-	1	transcript "159"
Adh	GenieESTHOM	CDS	1748156	1748310	21.005000	-	0	transcript "159"
Adh	GenieESTHOM	CDS	1748434	1748590	8.617300	-	0	transcript "159"
Adh	GenieESTHOM	CDS	1748671	1748943	43.556000	-	0	transcript "159"
Adh	GenieESTHOM	CDS	1749089	1749100	-1.099900	-	0	transcript "159"
Adh	GenieESTHOM	start_codon	1749098	1749100	0	-	0	transcript "159"
Adh	GenieESTHOM	CDS	1751358	1751492	2.015700	-	0	transcript "160"
Adh	GenieESTHOM	stop_codon	1751358	1751360	0	-	0	transcript "160"
Adh	GenieESTHOM	CDS	1751564	1751652	-0.897740	-	0	transcript "160"
Adh	GenieESTHOM	CDS	1751722	1751956	9.798200	-	0	transcript "160"
Adh	GenieESTHOM	CDS	1752027	1752278	20.062000	-	0	transcript "160"
Adh	GenieESTHOM	CDS	1752622	1752780	10.515000	-	0	transcript "160"
Adh	GenieESTHOM	CDS	1752984	1753316	29.151000	-	0	transcript "160"
Adh	GenieESTHOM	CDS	1753422	1753778	35.429000	-	0	transcript "160"
Adh	GenieESTHOM	start_codon	1753776	1753778	0	-	0	transcript "160"
Adh	GenieESTHOM	CDS	1756026	1756178	6.599000	-	0	transcript "161"
Adh	GenieESTHOM	stop_codon	1756026	1756028	0	-	0	transcript "161"
Adh	GenieESTHOM	CDS	1756248	1756366	59.717000	-	0	transcript "161"
Adh	GenieESTHOM	CDS	1756431	1756671	72.984000	-	0	transcript "161"
Adh	GenieESTHOM	CDS	1756797	1756939	23.740000	-	0	transcript "161"
Adh	GenieESTHOM	CDS	1757005	1757119	15.191000	-	0	transcript "161"
Adh	GenieESTHOM	CDS	1757182	1757352	50.352000	-	0	transcript "161"
Adh	GenieESTHOM	CDS	1757415	1757585	61.683000	-	0	transcript "161"
Adh	GenieESTHOM	CDS	1757648	1758409	281.560000	-	0	transcript "161"
Adh	GenieESTHOM	CDS	1758473	1758856	48.591000	-	0	transcript "161"
Adh	GenieESTHOM	CDS	1760557	1760678	6.174300	-	0	transcript "161"
Adh	GenieESTHOM	CDS	1760768	1760795	-9.303900	-	0	transcript "161"
Adh	GenieESTHOM	CDS	1761621	1761674	-1.216300	-	0	transcript "161"
Adh	GenieESTHOM	start_codon	1761672	1761674	0	-	0	transcript "161"
Adh	GenieESTHOM	CDS	1763921	1764042	13.792000	-	0	transcript "162"
Adh	GenieESTHOM	stop_codon	1763921	1763923	0	-	0	transcript "162"
Adh	GenieESTHOM	CDS	1764272	1764501	26.108000	-	0	transcript "162"
Adh	GenieESTHOM	CDS	1764574	1764638	4.108800	-	1	transcript "162"
Adh	GenieESTHOM	start_codon	1764636	1764638	0	-	0	transcript "162"
Adh	GenieESTHOM	CDS	1774781	1775557	60.106000	+	0	transcript "163"
Adh	GenieESTHOM	start_codon	1774781	1774783	0	+	0	transcript "163"
Adh	GenieESTHOM	stop_codon	1775555	1775557	0	+	0	transcript "163"
Adh	GenieESTHOM	CDS	1781133	1781825	40.865000	-	0	transcript "164"
Adh	GenieESTHOM	stop_codon	1781133	1781135	0	-	0	transcript "164"
Adh	GenieESTHOM	start_codon	1781823	1781825	0	-	0	transcript "164"
Adh	GenieESTHOM	CDS	1787599	1788915	89.121000	+	0	transcript "165"
Adh	GenieESTHOM	start_codon	1787599	1787601	0	+	0	transcript "165"
Adh	GenieESTHOM	stop_codon	1788913	1788915	0	+	0	transcript "165"
Adh	GenieESTHOM	CDS	1807761	1808498	45.439000	-	0	transcript "176"
Adh	GenieESTHOM	stop_codon	1807761	1807763	0	-	0	transcript "176"
Adh	GenieESTHOM	start_codon	1808496	1808498	0	-	0	transcript "176"
Adh	GenieESTHOM	CDS	1823746	1825158	366.610000	+	0	transcript "166"
Adh	GenieESTHOM	start_codon	1823746	1823748	0	+	0	transcript "166"
Adh	GenieESTHOM	stop_codon	1825156	1825158	0	+	0	transcript "166"
Adh	GenieESTHOM	CDS	1850650	1851240	27.146000	-	0	transcript "167"
Adh	GenieESTHOM	stop_codon	1850650	1850652	0	-	0	transcript "167"
Adh	GenieESTHOM	start_codon	1851238	1851240	0	-	0	transcript "167"
Adh	GenieESTHOM	CDS	1880956	1881043	10.579000	+	0	transcript "168"
Adh	GenieESTHOM	start_codon	1880956	1880958	0	+	0	transcript "168"
Adh	GenieESTHOM	CDS	1881643	1881824	19.202000	+	1	transcript "168"
Adh	GenieESTHOM	stop_codon	1881822	1881824	0	+	0	transcript "168"
Adh	GenieESTHOM	CDS	1913374	1914932	365.100000	-	0	transcript "169"
Adh	GenieESTHOM	stop_codon	1913374	1913376	0	-	0	transcript "169"
Adh	GenieESTHOM	CDS	1914995	1915082	7.886500	-	0	transcript "169"
Adh	GenieESTHOM	start_codon	1915080	1915082	0	-	0	transcript "169"
Adh	GenieESTHOM	CDS	1923109	1924563	79.103000	+	0	transcript "170"
Adh	GenieESTHOM	start_codon	1923109	1923111	0	+	0	transcript "170"
Adh	GenieESTHOM	stop_codon	1924561	1924563	0	+	0	transcript "170"
Adh	GenieESTHOM	CDS	1937623	1938637	318.830000	+	0	transcript "171"
Adh	GenieESTHOM	start_codon	1937623	1937625	0	+	0	transcript "171"
Adh	GenieESTHOM	CDS	1938713	1938757	-2.633800	+	1	transcript "171"
Adh	GenieESTHOM	CDS	1938943	1942443	1546.200000	+	1	transcript "171"
Adh	GenieESTHOM	CDS	1943506	1943576	-8.593700	+	1	transcript "171"
Adh	GenieESTHOM	stop_codon	1943574	1943576	0	+	0	transcript "171"
Adh	GenieESTHOM	CDS	1966586	1967738	835.930000	-	0	transcript "172"
Adh	GenieESTHOM	stop_codon	1966586	1966588	0	-	0	transcript "172"
Adh	GenieESTHOM	CDS	1967938	1967975	1.917100	-	1	transcript "172"
Adh	GenieESTHOM	start_codon	1967973	1967975	0	-	0	transcript "172"
Adh	GenieESTHOM	CDS	1974488	1975018	47.539000	+	0	transcript "173"
Adh	GenieESTHOM	start_codon	1974488	1974490	0	+	0	transcript "173"
Adh	GenieESTHOM	stop_codon	1975016	1975018	0	+	0	transcript "173"
Adh	GenieESTHOM	CDS	1988872	1989075	20.217000	+	0	transcript "174"
Adh	GenieESTHOM	start_codon	1988872	1988874	0	+	0	transcript "174"
Adh	GenieESTHOM	CDS	1991768	1992877	411.330000	+	0	transcript "174"
Adh	GenieESTHOM	CDS	1992942	1993204	106.670000	+	0	transcript "174"
Adh	GenieESTHOM	CDS	1993350	1993566	23.985000	+	0	transcript "174"
Adh	GenieESTHOM	stop_codon	1993564	1993566	0	+	0	transcript "174"
Adh	GenieESTHOM	CDS	2040123	2040280	14.809000	+	0	transcript "177"
Adh	GenieESTHOM	start_codon	2040123	2040125	0	+	0	transcript "177"
Adh	GenieESTHOM	CDS	2040432	2040689	4.368000	+	0	transcript "177"
Adh	GenieESTHOM	CDS	2040748	2040772	-9.333900	+	0	transcript "177"
Adh	GenieESTHOM	stop_codon	2040770	2040772	0	+	0	transcript "177"
Adh	GenieESTHOM	CDS	2068604	2070501	421.760000	+	0	transcript "178"
Adh	GenieESTHOM	start_codon	2068604	2068606	0	+	0	transcript "178"
Adh	GenieESTHOM	CDS	2071510	2072677	134.250000	+	0	transcript "178"
Adh	GenieESTHOM	stop_codon	2072675	2072677	0	+	0	transcript "178"
Adh	GenieESTHOM	CDS	2076918	2077999	386.290000	+	0	transcript "179"
Adh	GenieESTHOM	start_codon	2076918	2076920	0	+	0	transcript "179"
Adh	GenieESTHOM	CDS	2078140	2081209	1330.300000	+	0	transcript "179"
Adh	GenieESTHOM	CDS	2081746	2082312	125.690000	+	0	transcript "179"
Adh	GenieESTHOM	CDS	2082788	2082832	-3.936900	+	0	transcript "179"
Adh	GenieESTHOM	stop_codon	2082830	2082832	0	+	0	transcript "179"
Adh	GenieESTHOM	CDS	2100551	2101336	195.080000	-	0	transcript "196"
Adh	GenieESTHOM	stop_codon	2100551	2100553	0	-	0	transcript "196"
Adh	GenieESTHOM	start_codon	2101334	2101336	0	-	0	transcript "196"
Adh	GenieESTHOM	CDS	2102169	2102722	119.460000	-	0	transcript "197"
Adh	GenieESTHOM	stop_codon	2102169	2102171	0	-	0	transcript "197"
Adh	GenieESTHOM	CDS	2102776	2102924	9.328500	-	0	transcript "197"
Adh	GenieESTHOM	CDS	2103626	2104169	131.640000	-	1	transcript "197"
Adh	GenieESTHOM	CDS	2104226	2104442	28.436000	-	0	transcript "197"
Adh	GenieESTHOM	start_codon	2104440	2104442	0	-	0	transcript "197"
Adh	GenieESTHOM	CDS	2105170	2105720	172.670000	-	0	transcript "198"
Adh	GenieESTHOM	stop_codon	2105170	2105172	0	-	0	transcript "198"
Adh	GenieESTHOM	CDS	2105774	2106005	9.040500	-	0	transcript "198"
Adh	GenieESTHOM	start_codon	2106003	2106005	0	-	0	transcript "198"
Adh	GenieESTHOM	CDS	2106963	2107445	97.829000	+	0	transcript "199"
Adh	GenieESTHOM	start_codon	2106963	2106965	0	+	0	transcript "199"
Adh	GenieESTHOM	stop_codon	2107443	2107445	0	+	0	transcript "199"
Adh	GenieESTHOM	CDS	2118335	2118551	12.315000	+	0	transcript "180"
Adh	GenieESTHOM	start_codon	2118335	2118337	0	+	0	transcript "180"
Adh	GenieESTHOM	CDS	2118614	2119161	33.902000	+	1	transcript "180"
Adh	GenieESTHOM	stop_codon	2119159	2119161	0	+	0	transcript "180"
Adh	GenieESTHOM	CDS	2119874	2120025	4.335600	+	0	transcript "181"
Adh	GenieESTHOM	start_codon	2119874	2119876	0	+	0	transcript "181"
Adh	GenieESTHOM	CDS	2120092	2120194	-0.705710	+	0	transcript "181"
Adh	GenieESTHOM	CDS	2120312	2121269	84.484000	+	0	transcript "181"
Adh	GenieESTHOM	CDS	2121336	2121745	24.388000	+	1	transcript "181"
Adh	GenieESTHOM	stop_codon	2121743	2121745	0	+	0	transcript "181"
Adh	GenieESTHOM	CDS	2137486	2137679	17.966000	-	0	transcript "182"
Adh	GenieESTHOM	stop_codon	2137486	2137488	0	-	0	transcript "182"
Adh	GenieESTHOM	CDS	2137746	2137902	9.717800	-	0	transcript "182"
Adh	GenieESTHOM	CDS	2137961	2138116	-3.238100	-	0	transcript "182"
Adh	GenieESTHOM	CDS	2138186	2138671	37.446000	-	0	transcript "182"
Adh	GenieESTHOM	CDS	2138733	2138994	8.043700	-	0	transcript "182"
Adh	GenieESTHOM	CDS	2139065	2139169	-3.226600	-	1	transcript "182"
Adh	GenieESTHOM	CDS	2139824	2140056	26.368000	-	1	transcript "182"
Adh	GenieESTHOM	CDS	2140148	2140353	11.527000	-	0	transcript "182"
Adh	GenieESTHOM	CDS	2140417	2140630	6.515100	-	0	transcript "182"
Adh	GenieESTHOM	CDS	2140705	2141412	64.568000	-	0	transcript "182"
Adh	GenieESTHOM	CDS	2141468	2141749	25.699000	-	0	transcript "182"
Adh	GenieESTHOM	CDS	2141998	2142465	84.197000	-	0	transcript "182"
Adh	GenieESTHOM	start_codon	2142463	2142465	0	-	0	transcript "182"
Adh	GenieESTHOM	CDS	2149418	2149510	-1.696100	+	0	transcript "183"
Adh	GenieESTHOM	start_codon	2149418	2149420	0	+	0	transcript "183"
Adh	GenieESTHOM	CDS	2149741	2150734	41.145000	+	0	transcript "183"
Adh	GenieESTHOM	CDS	2151057	2151169	6.071600	+	1	transcript "183"
Adh	GenieESTHOM	stop_codon	2151167	2151169	0	+	0	transcript "183"
Adh	GenieESTHOM	CDS	2173107	2174016	196.410000	+	0	transcript "184"
Adh	GenieESTHOM	start_codon	2173107	2173109	0	+	0	transcript "184"
Adh	GenieESTHOM	CDS	2174130	2177240	894.460000	+	1	transcript "184"
Adh	GenieESTHOM	CDS	2177353	2178710	106.640000	+	1	transcript "184"
Adh	GenieESTHOM	stop_codon	2178708	2178710	0	+	0	transcript "184"
Adh	GenieESTHOM	CDS	2180707	2180982	39.139000	-	0	transcript "200"
Adh	GenieESTHOM	stop_codon	2180707	2180709	0	-	0	transcript "200"
Adh	GenieESTHOM	CDS	2181100	2181264	14.864000	-	0	transcript "200"
Adh	GenieESTHOM	start_codon	2181262	2181264	0	-	0	transcript "200"
Adh	GenieESTHOM	CDS	2181285	2181325	-7.023600	-	0	transcript "201"
Adh	GenieESTHOM	stop_codon	2181285	2181287	0	-	0	transcript "201"
Adh	GenieESTHOM	CDS	2181408	2182641	875.310000	-	0	transcript "201"
Adh	GenieESTHOM	CDS	2189454	2189790	8.765300	-	0	transcript "201"
Adh	GenieESTHOM	CDS	2192626	2192725	-13.060000	-	1	transcript "201"
Adh	GenieESTHOM	CDS	2199659	2199764	-2.211300	-	0	transcript "201"
Adh	GenieESTHOM	start_codon	2199762	2199764	0	-	0	transcript "201"
Adh	GenieESTHOM	CDS	2201531	2201677	13.748000	-	0	transcript "202"
Adh	GenieESTHOM	stop_codon	2201531	2201533	0	-	0	transcript "202"
Adh	GenieESTHOM	CDS	2202376	2202477	6.884700	-	0	transcript "202"
Adh	GenieESTHOM	CDS	2202548	2202802	47.739000	-	0	transcript "202"
Adh	GenieESTHOM	start_codon	2202800	2202802	0	-	0	transcript "202"
Adh	GenieESTHOM	CDS	2204183	2205278	501.350000	+	0	transcript "203"
Adh	GenieESTHOM	start_codon	2204183	2204185	0	+	0	transcript "203"
Adh	GenieESTHOM	CDS	2205332	2207387	945.870000	+	1	transcript "203"
Adh	GenieESTHOM	CDS	2207754	2207829	-4.192000	+	0	transcript "203"
Adh	GenieESTHOM	stop_codon	2207827	2207829	0	+	0	transcript "203"
Adh	GenieESTHOM	CDS	2208922	2209531	351.250000	-	0	transcript "204"
Adh	GenieESTHOM	stop_codon	2208922	2208924	0	-	0	transcript "204"
Adh	GenieESTHOM	CDS	2209593	2209904	35.086000	-	1	transcript "204"
Adh	GenieESTHOM	CDS	2209967	2211186	793.210000	-	1	transcript "204"
Adh	GenieESTHOM	CDS	2211243	2211647	270.530000	-	0	transcript "204"
Adh	GenieESTHOM	CDS	2212036	2212168	65.526000	-	0	transcript "204"
Adh	GenieESTHOM	CDS	2212228	2212394	-6.007300	-	1	transcript "204"
Adh	GenieESTHOM	start_codon	2212392	2212394	0	-	0	transcript "204"
Adh	GenieESTHOM	CDS	2216202	2216447	41.837000	+	0	transcript "205"
Adh	GenieESTHOM	start_codon	2216202	2216204	0	+	0	transcript "205"
Adh	GenieESTHOM	CDS	2216609	2217034	63.310000	+	0	transcript "205"
Adh	GenieESTHOM	CDS	2217099	2217403	47.179000	+	0	transcript "205"
Adh	GenieESTHOM	CDS	2217501	2217537	-4.518600	+	0	transcript "205"
Adh	GenieESTHOM	stop_codon	2217535	2217537	0	+	0	transcript "205"
Adh	GenieESTHOM	CDS	2218461	2218494	-0.024883	-	0	transcript "206"
Adh	GenieESTHOM	stop_codon	2218461	2218463	0	-	0	transcript "206"
Adh	GenieESTHOM	CDS	2218559	2218905	24.071000	-	1	transcript "206"
Adh	GenieESTHOM	CDS	2218966	2219871	64.497000	-	0	transcript "206"
Adh	GenieESTHOM	CDS	2219932	2220057	8.451900	-	0	transcript "206"
Adh	GenieESTHOM	start_codon	2220055	2220057	0	-	0	transcript "206"
Adh	GenieESTHOM	CDS	2220565	2222197	149.130000	-	0	transcript "207"
Adh	GenieESTHOM	stop_codon	2220565	2220567	0	-	0	transcript "207"
Adh	GenieESTHOM	CDS	2222257	2222379	3.912100	-	1	transcript "207"
Adh	GenieESTHOM	CDS	2222435	2222667	10.918000	-	1	transcript "207"
Adh	GenieESTHOM	CDS	2222723	2222818	0.261080	-	0	transcript "207"
Adh	GenieESTHOM	CDS	2222876	2222890	-2.973800	-	0	transcript "207"
Adh	GenieESTHOM	start_codon	2222888	2222890	0	-	0	transcript "207"
Adh	GenieESTHOM	CDS	2223170	2223346	11.638000	-	0	transcript "208"
Adh	GenieESTHOM	stop_codon	2223170	2223172	0	-	0	transcript "208"
Adh	GenieESTHOM	CDS	2223403	2223556	3.527500	-	0	transcript "208"
Adh	GenieESTHOM	CDS	2223854	2224229	47.923000	-	1	transcript "208"
Adh	GenieESTHOM	CDS	2224289	2224367	4.695800	-	0	transcript "208"
Adh	GenieESTHOM	start_codon	2224365	2224367	0	-	0	transcript "208"
Adh	GenieESTHOM	CDS	2303448	2304641	130.210000	+	0	transcript "209"
Adh	GenieESTHOM	start_codon	2303448	2303450	0	+	0	transcript "209"
Adh	GenieESTHOM	stop_codon	2304639	2304641	0	+	0	transcript "209"
Adh	GenieESTHOM	CDS	2305038	2305397	28.689000	+	0	transcript "210"
Adh	GenieESTHOM	start_codon	2305038	2305040	0	+	0	transcript "210"
Adh	GenieESTHOM	CDS	2305489	2305763	12.856000	+	0	transcript "210"
Adh	GenieESTHOM	CDS	2305829	2306951	238.220000	+	0	transcript "210"
Adh	GenieESTHOM	stop_codon	2306949	2306951	0	+	0	transcript "210"
Adh	GenieESTHOM	CDS	2328290	2328403	-3.779300	-	0	transcript "185"
Adh	GenieESTHOM	stop_codon	2328290	2328292	0	-	0	transcript "185"
Adh	GenieESTHOM	CDS	2328611	2329967	236.900000	-	0	transcript "185"
Adh	GenieESTHOM	CDS	2330026	2330181	21.848000	-	1	transcript "185"
Adh	GenieESTHOM	CDS	2330235	2330652	28.577000	-	1	transcript "185"
Adh	GenieESTHOM	CDS	2331269	2331323	3.659500	-	0	transcript "185"
Adh	GenieESTHOM	start_codon	2331321	2331323	0	-	0	transcript "185"
Adh	GenieESTHOM	CDS	2338860	2338925	0.578200	-	0	transcript "186"
Adh	GenieESTHOM	stop_codon	2338860	2338862	0	-	0	transcript "186"
Adh	GenieESTHOM	CDS	2339434	2340420	210.270000	-	0	transcript "186"
Adh	GenieESTHOM	CDS	2340535	2341630	3.693900	-	0	transcript "186"
Adh	GenieESTHOM	CDS	2341682	2341790	-8.486900	-	1	transcript "186"
Adh	GenieESTHOM	CDS	2341973	2341993	-9.380700	-	0	transcript "186"
Adh	GenieESTHOM	CDS	2342049	2342274	-3.916900	-	0	transcript "186"
Adh	GenieESTHOM	CDS	2342341	2342492	-3.319400	-	0	transcript "186"
Adh	GenieESTHOM	CDS	2342842	2343877	155.560000	-	0	transcript "186"
Adh	GenieESTHOM	start_codon	2343875	2343877	0	-	0	transcript "186"
Adh	GenieESTHOM	CDS	2349595	2349890	11.860000	-	0	transcript "187"
Adh	GenieESTHOM	stop_codon	2349595	2349597	0	-	0	transcript "187"
Adh	GenieESTHOM	CDS	2349968	2350893	53.532000	-	0	transcript "187"
Adh	GenieESTHOM	CDS	2351765	2352026	5.369500	-	1	transcript "187"
Adh	GenieESTHOM	CDS	2352080	2353052	69.399000	-	0	transcript "187"
Adh	GenieESTHOM	start_codon	2353050	2353052	0	-	0	transcript "187"
Adh	GenieESTHOM	CDS	2357064	2357090	-4.679200	-	0	transcript "188"
Adh	GenieESTHOM	stop_codon	2357064	2357066	0	-	0	transcript "188"
Adh	GenieESTHOM	CDS	2357224	2357480	12.321000	-	0	transcript "188"
Adh	GenieESTHOM	CDS	2357539	2357674	11.472000	-	0	transcript "188"
Adh	GenieESTHOM	CDS	2358742	2358953	7.540000	-	0	transcript "188"
Adh	GenieESTHOM	CDS	2359091	2359130	-5.855600	-	0	transcript "188"
Adh	GenieESTHOM	start_codon	2359128	2359130	0	-	0	transcript "188"
Adh	GenieESTHOM	CDS	2374157	2374294	-5.608100	+	0	transcript "189"
Adh	GenieESTHOM	start_codon	2374157	2374159	0	+	0	transcript "189"
Adh	GenieESTHOM	CDS	2374356	2375075	21.245000	+	0	transcript "189"
Adh	GenieESTHOM	CDS	2375254	2375405	5.444300	+	0	transcript "189"
Adh	GenieESTHOM	CDS	2377144	2377201	-4.832100	+	0	transcript "189"
Adh	GenieESTHOM	stop_codon	2377199	2377201	0	+	0	transcript "189"
Adh	GenieESTHOM	CDS	2392235	2392737	14.263000	+	0	transcript "190"
Adh	GenieESTHOM	start_codon	2392235	2392237	0	+	0	transcript "190"
Adh	GenieESTHOM	CDS	2392800	2393115	-6.510800	+	0	transcript "190"
Adh	GenieESTHOM	stop_codon	2393113	2393115	0	+	0	transcript "190"
Adh	GenieESTHOM	CDS	2428833	2429381	189.530000	+	0	transcript "191"
Adh	GenieESTHOM	start_codon	2428833	2428835	0	+	0	transcript "191"
Adh	GenieESTHOM	stop_codon	2429379	2429381	0	+	0	transcript "191"
Adh	GenieESTHOM	CDS	2453955	2454115	17.440000	+	0	transcript "192"
Adh	GenieESTHOM	start_codon	2453955	2453957	0	+	0	transcript "192"
Adh	GenieESTHOM	CDS	2454180	2454275	-4.696000	+	0	transcript "192"
Adh	GenieESTHOM	CDS	2454348	2454498	1.371100	+	0	transcript "192"
Adh	GenieESTHOM	stop_codon	2454496	2454498	0	+	0	transcript "192"
Adh	GenieESTHOM	CDS	2481671	2481850	8.111400	+	0	transcript "193"
Adh	GenieESTHOM	start_codon	2481671	2481673	0	+	0	transcript "193"
Adh	GenieESTHOM	CDS	2483447	2483582	11.326000	+	0	transcript "193"
Adh	GenieESTHOM	CDS	2483839	2483972	-5.040400	+	1	transcript "193"
Adh	GenieESTHOM	CDS	2484693	2484866	11.913000	+	0	transcript "193"
Adh	GenieESTHOM	stop_codon	2484864	2484866	0	+	0	transcript "193"
Adh	GenieESTHOM	CDS	2485924	2485932	-3.141100	+	0	transcript "194"
Adh	GenieESTHOM	start_codon	2485924	2485926	0	+	0	transcript "194"
Adh	GenieESTHOM	CDS	2486400	2486522	10.288000	+	0	transcript "194"
Adh	GenieESTHOM	CDS	2486596	2486808	18.933000	+	0	transcript "194"
Adh	GenieESTHOM	stop_codon	2486806	2486808	0	+	0	transcript "194"
Adh	GenieESTHOM	CDS	2491469	2491493	-4.106500	+	0	transcript "195"
Adh	GenieESTHOM	start_codon	2491469	2491471	0	+	0	transcript "195"
Adh	GenieESTHOM	CDS	2492334	2492354	-7.186600	+	1	transcript "195"
Adh	GenieESTHOM	CDS	2492481	2492504	-5.129600	+	1	transcript "195"
Adh	GenieESTHOM	CDS	2493083	2493119	-8.340800	+	1	transcript "195"
Adh	GenieESTHOM	CDS	2493286	2493620	176.660000	+	0	transcript "195"
Adh	GenieESTHOM	CDS	2493682	2493731	5.483700	+	1	transcript "195"
Adh	GenieESTHOM	CDS	2494047	2494116	20.505000	+	0	transcript "195"
Adh	GenieESTHOM	CDS	2494180	2494259	26.303000	+	1	transcript "195"
Adh	GenieESTHOM	CDS	2494325	2494681	220.930000	+	0	transcript "195"
Adh	GenieESTHOM	CDS	2495100	2495225	50.481000	+	0	transcript "195"
Adh	GenieESTHOM	CDS	2495286	2495667	235.450000	+	0	transcript "195"
Adh	GenieESTHOM	CDS	2495861	2496988	847.200000	+	1	transcript "195"
Adh	GenieESTHOM	CDS	2497217	2497464	163.830000	+	1	transcript "195"
Adh	GenieESTHOM	stop_codon	2497462	2497464	0	+	0	transcript "195"
Adh	GenieESTHOM	CDS	2528864	2528881	-1.526000	+	0	transcript "211"
Adh	GenieESTHOM	start_codon	2528864	2528866	0	+	0	transcript "211"
Adh	GenieESTHOM	CDS	2529073	2529195	-0.309760	+	0	transcript "211"
Adh	GenieESTHOM	CDS	2529260	2529455	8.160900	+	0	transcript "211"
Adh	GenieESTHOM	CDS	2529735	2530156	33.281000	+	1	transcript "211"
Adh	GenieESTHOM	stop_codon	2530154	2530156	0	+	0	transcript "211"
Adh	GenieESTHOM	CDS	2544295	2545124	57.144000	+	0	transcript "212"
Adh	GenieESTHOM	start_codon	2544295	2544297	0	+	0	transcript "212"
Adh	GenieESTHOM	CDS	2545309	2545387	-10.209000	+	0	transcript "212"
Adh	GenieESTHOM	stop_codon	2545385	2545387	0	+	0	transcript "212"
Adh	GenieESTHOM	CDS	2580916	2581059	11.316000	+	0	transcript "213"
Adh	GenieESTHOM	start_codon	2580916	2580918	0	+	0	transcript "213"
Adh	GenieESTHOM	stop_codon	2581057	2581059	0	+	0	transcript "213"
Adh	GenieESTHOM	CDS	2583113	2583547	43.746000	+	0	transcript "214"
Adh	GenieESTHOM	start_codon	2583113	2583115	0	+	0	transcript "214"
Adh	GenieESTHOM	stop_codon	2583545	2583547	0	+	0	transcript "214"
Adh	GenieESTHOM	CDS	2584165	2584353	5.547100	-	0	transcript "215"
Adh	GenieESTHOM	stop_codon	2584165	2584167	0	-	0	transcript "215"
Adh	GenieESTHOM	CDS	2584891	2584914	-0.204400	-	0	transcript "215"
Adh	GenieESTHOM	start_codon	2584912	2584914	0	-	0	transcript "215"
Adh	GenieESTHOM	CDS	2590910	2591975	562.470000	+	0	transcript "216"
Adh	GenieESTHOM	start_codon	2590910	2590912	0	+	0	transcript "216"
Adh	GenieESTHOM	CDS	2592085	2594357	1203.900000	+	1	transcript "216"
Adh	GenieESTHOM	stop_codon	2594355	2594357	0	+	0	transcript "216"
Adh	GenieESTHOM	CDS	2594365	2595141	118.660000	+	0	transcript "217"
Adh	GenieESTHOM	start_codon	2594365	2594367	0	+	0	transcript "217"
Adh	GenieESTHOM	stop_codon	2595139	2595141	0	+	0	transcript "217"
Adh	GenieESTHOM	CDS	2604868	2608021	1653.400000	-	0	transcript "248"
Adh	GenieESTHOM	stop_codon	2604868	2604870	0	-	0	transcript "248"
Adh	GenieESTHOM	CDS	2608162	2609243	369.140000	-	1	transcript "248"
Adh	GenieESTHOM	start_codon	2609241	2609243	0	-	0	transcript "248"
Adh	GenieESTHOM	CDS	2619156	2619165	-2.863300	+	0	transcript "218"
Adh	GenieESTHOM	start_codon	2619156	2619158	0	+	0	transcript "218"
Adh	GenieESTHOM	CDS	2619518	2620403	267.020000	+	1	transcript "218"
Adh	GenieESTHOM	CDS	2621231	2622507	1036.400000	+	0	transcript "218"
Adh	GenieESTHOM	CDS	2622578	2622803	161.290000	+	1	transcript "218"
Adh	GenieESTHOM	CDS	2623675	2623781	-5.712100	+	0	transcript "218"
Adh	GenieESTHOM	CDS	2624114	2624266	-0.627910	+	1	transcript "218"
Adh	GenieESTHOM	CDS	2624694	2624875	122.240000	+	1	transcript "218"
Adh	GenieESTHOM	CDS	2624976	2625495	341.560000	+	0	transcript "218"
Adh	GenieESTHOM	CDS	2625559	2625784	124.370000	+	1	transcript "218"
Adh	GenieESTHOM	CDS	2625851	2626052	152.020000	+	0	transcript "218"
Adh	GenieESTHOM	CDS	2626124	2626333	121.750000	+	0	transcript "218"
Adh	GenieESTHOM	CDS	2626392	2626510	51.626000	+	0	transcript "218"
Adh	GenieESTHOM	CDS	2626595	2626653	-2.693800	+	0	transcript "218"
Adh	GenieESTHOM	CDS	2626937	2627063	-5.290600	+	1	transcript "218"
Adh	GenieESTHOM	CDS	2628166	2628325	-0.506020	+	0	transcript "218"
Adh	GenieESTHOM	stop_codon	2628323	2628325	0	+	0	transcript "218"
Adh	GenieESTHOM	CDS	2632081	2632298	83.224000	+	0	transcript "219"
Adh	GenieESTHOM	start_codon	2632081	2632083	0	+	0	transcript "219"
Adh	GenieESTHOM	CDS	2632363	2632834	274.660000	+	0	transcript "219"
Adh	GenieESTHOM	CDS	2632889	2632972	23.514000	+	0	transcript "219"
Adh	GenieESTHOM	CDS	2633149	2633337	91.966000	+	0	transcript "219"
Adh	GenieESTHOM	CDS	2633397	2633645	134.860000	+	0	transcript "219"
Adh	GenieESTHOM	CDS	2633706	2634365	429.610000	+	0	transcript "219"
Adh	GenieESTHOM	CDS	2634452	2634889	71.848000	+	0	transcript "219"
Adh	GenieESTHOM	stop_codon	2634887	2634889	0	+	0	transcript "219"
Adh	GenieESTHOM	CDS	2637683	2637692	-1.770500	+	0	transcript "220"
Adh	GenieESTHOM	start_codon	2637683	2637685	0	+	0	transcript "220"
Adh	GenieESTHOM	CDS	2638284	2638414	54.024000	+	1	transcript "220"
Adh	GenieESTHOM	CDS	2638470	2639006	403.330000	+	0	transcript "220"
Adh	GenieESTHOM	stop_codon	2639004	2639006	0	+	0	transcript "220"
Adh	GenieESTHOM	CDS	2660848	2661318	9.935500	+	0	transcript "221"
Adh	GenieESTHOM	start_codon	2660848	2660850	0	+	0	transcript "221"
Adh	GenieESTHOM	CDS	2661378	2662292	3.398200	+	0	transcript "221"
Adh	GenieESTHOM	CDS	2662428	2662463	-7.439200	+	0	transcript "221"
Adh	GenieESTHOM	stop_codon	2662461	2662463	0	+	0	transcript "221"
Adh	GenieESTHOM	CDS	2683427	2683452	4.763900	+	0	transcript "222"
Adh	GenieESTHOM	start_codon	2683427	2683429	0	+	0	transcript "222"
Adh	GenieESTHOM	CDS	2684880	2686209	177.890000	+	0	transcript "222"
Adh	GenieESTHOM	CDS	2686394	2686570	10.052000	+	0	transcript "222"
Adh	GenieESTHOM	CDS	2686628	2686705	-0.550860	+	0	transcript "222"
Adh	GenieESTHOM	CDS	2686770	2687146	44.148000	+	0	transcript "222"
Adh	GenieESTHOM	CDS	2687211	2687359	10.852000	+	0	transcript "222"
Adh	GenieESTHOM	CDS	2687415	2687920	79.657000	+	1	transcript "222"
Adh	GenieESTHOM	CDS	2687988	2688230	20.025000	+	0	transcript "222"
Adh	GenieESTHOM	CDS	2688302	2688395	-8.850700	+	0	transcript "222"
Adh	GenieESTHOM	CDS	2688462	2688883	33.320000	+	1	transcript "222"
Adh	GenieESTHOM	CDS	2689073	2689183	1.409900	+	0	transcript "222"
Adh	GenieESTHOM	stop_codon	2689181	2689183	0	+	0	transcript "222"
Adh	GenieESTHOM	CDS	2696138	2696190	-9.377800	-	0	transcript "249"
Adh	GenieESTHOM	stop_codon	2696138	2696140	0	-	0	transcript "249"
Adh	GenieESTHOM	CDS	2696349	2696446	43.569000	-	0	transcript "249"
Adh	GenieESTHOM	CDS	2696513	2696644	2.701200	-	1	transcript "249"
Adh	GenieESTHOM	CDS	2696876	2696947	4.438200	-	1	transcript "249"
Adh	GenieESTHOM	CDS	2697862	2698028	13.095000	-	1	transcript "249"
Adh	GenieESTHOM	CDS	2698091	2698210	52.536000	-	0	transcript "249"
Adh	GenieESTHOM	start_codon	2698208	2698210	0	-	0	transcript "249"
Adh	GenieESTHOM	CDS	2698932	2698966	-3.108100	-	0	transcript "250"
Adh	GenieESTHOM	stop_codon	2698932	2698934	0	-	0	transcript "250"
Adh	GenieESTHOM	CDS	2699376	2699418	-9.748800	-	0	transcript "250"
Adh	GenieESTHOM	CDS	2706336	2706347	-2.986900	-	0	transcript "250"
Adh	GenieESTHOM	start_codon	2706345	2706347	0	-	0	transcript "250"
Adh	GenieESTHOM	CDS	2707374	2707439	9.374900	+	0	transcript "251"
Adh	GenieESTHOM	start_codon	2707374	2707376	0	+	0	transcript "251"
Adh	GenieESTHOM	CDS	2707509	2708522	146.720000	+	0	transcript "251"
Adh	GenieESTHOM	stop_codon	2708520	2708522	0	+	0	transcript "251"
Adh	GenieESTHOM	CDS	2709485	2710753	881.190000	-	0	transcript "252"
Adh	GenieESTHOM	stop_codon	2709485	2709487	0	-	0	transcript "252"
Adh	GenieESTHOM	CDS	2711195	2711209	-1.967000	-	0	transcript "252"
Adh	GenieESTHOM	start_codon	2711207	2711209	0	-	0	transcript "252"
Adh	GenieESTHOM	CDS	2711460	2711538	2.609700	+	0	transcript "253"
Adh	GenieESTHOM	start_codon	2711460	2711462	0	+	0	transcript "253"
Adh	GenieESTHOM	CDS	2711599	2711717	0.172310	+	1	transcript "253"
Adh	GenieESTHOM	CDS	2711781	2711853	-5.646000	+	0	transcript "253"
Adh	GenieESTHOM	CDS	2711910	2712440	154.000000	+	1	transcript "253"
Adh	GenieESTHOM	CDS	2712522	2712646	18.259000	+	1	transcript "253"
Adh	GenieESTHOM	stop_codon	2712644	2712646	0	+	0	transcript "253"
Adh	GenieESTHOM	CDS	2714781	2716277	272.530000	-	0	transcript "223"
Adh	GenieESTHOM	stop_codon	2714781	2714783	0	-	0	transcript "223"
Adh	GenieESTHOM	CDS	2716683	2716697	-1.801700	-	0	transcript "223"
Adh	GenieESTHOM	start_codon	2716695	2716697	0	-	0	transcript "223"
Adh	GenieESTHOM	CDS	2727707	2727754	-4.392600	-	0	transcript "224"
Adh	GenieESTHOM	stop_codon	2727707	2727709	0	-	0	transcript "224"
Adh	GenieESTHOM	CDS	2728123	2728429	28.086000	-	0	transcript "224"
Adh	GenieESTHOM	CDS	2736358	2736449	8.245200	-	1	transcript "224"
Adh	GenieESTHOM	start_codon	2736447	2736449	0	-	0	transcript "224"
Adh	GenieESTHOM	CDS	2737704	2737731	-2.598300	+	0	transcript "225"
Adh	GenieESTHOM	start_codon	2737704	2737706	0	+	0	transcript "225"
Adh	GenieESTHOM	CDS	2737860	2738132	50.538000	+	1	transcript "225"
Adh	GenieESTHOM	CDS	2738403	2739461	115.810000	+	1	transcript "225"
Adh	GenieESTHOM	CDS	2739531	2740039	48.481000	+	1	transcript "225"
Adh	GenieESTHOM	stop_codon	2740037	2740039	0	+	0	transcript "225"
Adh	GenieESTHOM	CDS	2740542	2741090	57.903000	+	0	transcript "226"
Adh	GenieESTHOM	start_codon	2740542	2740544	0	+	0	transcript "226"
Adh	GenieESTHOM	stop_codon	2741088	2741090	0	+	0	transcript "226"
Adh	GenieESTHOM	CDS	2741387	2741990	53.930000	-	0	transcript "227"
Adh	GenieESTHOM	stop_codon	2741387	2741389	0	-	0	transcript "227"
Adh	GenieESTHOM	CDS	2742220	2742230	-2.233500	-	1	transcript "227"
Adh	GenieESTHOM	start_codon	2742228	2742230	0	-	0	transcript "227"
Adh	GenieESTHOM	CDS	2743611	2745122	140.020000	+	0	transcript "228"
Adh	GenieESTHOM	start_codon	2743611	2743613	0	+	0	transcript "228"
Adh	GenieESTHOM	stop_codon	2745120	2745122	0	+	0	transcript "228"
Adh	GenieESTHOM	CDS	2746815	2747453	59.714000	-	0	transcript "229"
Adh	GenieESTHOM	stop_codon	2746815	2746817	0	-	0	transcript "229"
Adh	GenieESTHOM	CDS	2748132	2748572	54.989000	-	0	transcript "229"
Adh	GenieESTHOM	start_codon	2748570	2748572	0	-	0	transcript "229"
Adh	GenieESTHOM	CDS	2749655	2749696	-3.998500	+	0	transcript "230"
Adh	GenieESTHOM	start_codon	2749655	2749657	0	+	0	transcript "230"
Adh	GenieESTHOM	CDS	2749753	2750868	78.489000	+	0	transcript "230"
Adh	GenieESTHOM	stop_codon	2750866	2750868	0	+	0	transcript "230"
Adh	GenieESTHOM	CDS	2751337	2751465	8.605300	-	0	transcript "231"
Adh	GenieESTHOM	stop_codon	2751337	2751339	0	-	0	transcript "231"
Adh	GenieESTHOM	CDS	2751521	2751711	11.249000	-	0	transcript "231"
Adh	GenieESTHOM	CDS	2751778	2751871	0.393390	-	0	transcript "231"
Adh	GenieESTHOM	CDS	2751973	2751984	-3.386200	-	0	transcript "231"
Adh	GenieESTHOM	start_codon	2751982	2751984	0	-	0	transcript "231"
Adh	GenieESTHOM	CDS	2752612	2752742	2.044100	+	0	transcript "232"
Adh	GenieESTHOM	start_codon	2752612	2752614	0	+	0	transcript "232"
Adh	GenieESTHOM	CDS	2752822	2752985	-5.825600	+	0	transcript "232"
Adh	GenieESTHOM	CDS	2753042	2753322	8.142700	+	1	transcript "232"
Adh	GenieESTHOM	CDS	2753446	2753475	-5.180900	+	0	transcript "232"
Adh	GenieESTHOM	stop_codon	2753473	2753475	0	+	0	transcript "232"
Adh	GenieESTHOM	CDS	2755219	2755580	37.251000	-	0	transcript "233"
Adh	GenieESTHOM	stop_codon	2755219	2755221	0	-	0	transcript "233"
Adh	GenieESTHOM	CDS	2755775	2755883	3.547500	-	0	transcript "233"
Adh	GenieESTHOM	CDS	2755954	2756092	12.949000	-	0	transcript "233"
Adh	GenieESTHOM	CDS	2756201	2756274	3.157900	-	1	transcript "233"
Adh	GenieESTHOM	start_codon	2756272	2756274	0	-	0	transcript "233"
Adh	GenieESTHOM	CDS	2756920	2757589	161.060000	+	0	transcript "234"
Adh	GenieESTHOM	start_codon	2756920	2756922	0	+	0	transcript "234"
Adh	GenieESTHOM	CDS	2757658	2758391	407.280000	+	1	transcript "234"
Adh	GenieESTHOM	stop_codon	2758389	2758391	0	+	0	transcript "234"
Adh	GenieESTHOM	CDS	2759163	2759190	-7.485200	-	0	transcript "235"
Adh	GenieESTHOM	stop_codon	2759163	2759165	0	-	0	transcript "235"
Adh	GenieESTHOM	CDS	2759260	2759403	2.355400	-	1	transcript "235"
Adh	GenieESTHOM	CDS	2759527	2759639	-3.355800	-	1	transcript "235"
Adh	GenieESTHOM	CDS	2759701	2759850	4.709800	-	0	transcript "235"
Adh	GenieESTHOM	start_codon	2759848	2759850	0	-	0	transcript "235"
Adh	GenieESTHOM	CDS	2760361	2760672	185.660000	+	0	transcript "236"
Adh	GenieESTHOM	start_codon	2760361	2760363	0	+	0	transcript "236"
Adh	GenieESTHOM	CDS	2760766	2761087	182.710000	+	0	transcript "236"
Adh	GenieESTHOM	CDS	2761141	2762087	595.860000	+	1	transcript "236"
Adh	GenieESTHOM	stop_codon	2762085	2762087	0	+	0	transcript "236"
Adh	GenieESTHOM	CDS	2762639	2762710	1.164500	-	0	transcript "237"
Adh	GenieESTHOM	stop_codon	2762639	2762641	0	-	0	transcript "237"
Adh	GenieESTHOM	CDS	2763711	2763968	176.870000	-	0	transcript "237"
Adh	GenieESTHOM	CDS	2764030	2764118	27.052000	-	0	transcript "237"
Adh	GenieESTHOM	CDS	2764461	2764506	-4.966700	-	0	transcript "237"
Adh	GenieESTHOM	start_codon	2764504	2764506	0	-	0	transcript "237"
Adh	GenieESTHOM	CDS	2772212	2772430	122.650000	-	0	transcript "238"
Adh	GenieESTHOM	stop_codon	2772212	2772214	0	-	0	transcript "238"
Adh	GenieESTHOM	CDS	2772600	2772777	87.383000	-	0	transcript "238"
Adh	GenieESTHOM	CDS	2773593	2774304	629.290000	-	1	transcript "238"
Adh	GenieESTHOM	CDS	2774754	2774782	-5.764700	-	0	transcript "238"
Adh	GenieESTHOM	CDS	2775140	2775159	-1.631600	-	1	transcript "238"
Adh	GenieESTHOM	start_codon	2775157	2775159	0	-	0	transcript "238"
Adh	GenieESTHOM	CDS	2776429	2777295	55.672000	+	0	transcript "239"
Adh	GenieESTHOM	start_codon	2776429	2776431	0	+	0	transcript "239"
Adh	GenieESTHOM	stop_codon	2777293	2777295	0	+	0	transcript "239"
Adh	GenieESTHOM	CDS	2777390	2777609	18.848000	-	0	transcript "240"
Adh	GenieESTHOM	stop_codon	2777390	2777392	0	-	0	transcript "240"
Adh	GenieESTHOM	CDS	2777672	2778342	63.593000	-	1	transcript "240"
Adh	GenieESTHOM	start_codon	2778340	2778342	0	-	0	transcript "240"
Adh	GenieESTHOM	CDS	2779268	2779279	-2.413600	+	0	transcript "241"
Adh	GenieESTHOM	start_codon	2779268	2779270	0	+	0	transcript "241"
Adh	GenieESTHOM	CDS	2779339	2779566	30.076000	+	0	transcript "241"
Adh	GenieESTHOM	stop_codon	2779564	2779566	0	+	0	transcript "241"
Adh	GenieESTHOM	CDS	2786019	2786051	-6.603400	-	0	transcript "242"
Adh	GenieESTHOM	stop_codon	2786019	2786021	0	-	0	transcript "242"
Adh	GenieESTHOM	CDS	2786105	2786724	-13.048000	-	0	transcript "242"
Adh	GenieESTHOM	CDS	2786839	2787069	2.061600	-	0	transcript "242"
Adh	GenieESTHOM	CDS	2787444	2787885	18.708000	-	0	transcript "242"
Adh	GenieESTHOM	CDS	2787948	2788341	5.315800	-	0	transcript "242"
Adh	GenieESTHOM	CDS	2788808	2789086	-2.006600	-	1	transcript "242"
Adh	GenieESTHOM	CDS	2789143	2789555	10.375000	-	1	transcript "242"
Adh	GenieESTHOM	CDS	2790007	2791015	-0.827880	-	0	transcript "242"
Adh	GenieESTHOM	CDS	2791870	2792011	4.232500	-	1	transcript "242"
Adh	GenieESTHOM	CDS	2792082	2792601	44.397000	-	0	transcript "242"
Adh	GenieESTHOM	start_codon	2792599	2792601	0	-	0	transcript "242"
Adh	GenieESTHOM	CDS	2793626	2798713	210.370000	-	0	transcript "243"
Adh	GenieESTHOM	stop_codon	2793626	2793628	0	-	0	transcript "243"
Adh	GenieESTHOM	start_codon	2798711	2798713	0	-	0	transcript "243"
Adh	GenieESTHOM	CDS	2802355	2802394	-3.954200	+	0	transcript "254"
Adh	GenieESTHOM	start_codon	2802355	2802357	0	+	0	transcript "254"
Adh	GenieESTHOM	CDS	2802473	2802813	27.264000	+	1	transcript "254"
Adh	GenieESTHOM	stop_codon	2802811	2802813	0	+	0	transcript "254"
Adh	GenieESTHOM	CDS	2804442	2805730	682.240000	-	0	transcript "255"
Adh	GenieESTHOM	stop_codon	2804442	2804444	0	-	0	transcript "255"
Adh	GenieESTHOM	CDS	2805800	2805812	-2.477800	-	0	transcript "255"
Adh	GenieESTHOM	start_codon	2805810	2805812	0	-	0	transcript "255"
Adh	GenieESTHOM	CDS	2815178	2815829	55.309000	+	0	transcript "244"
Adh	GenieESTHOM	start_codon	2815178	2815180	0	+	0	transcript "244"
Adh	GenieESTHOM	CDS	2815894	2816135	-1.339700	+	1	transcript "244"
Adh	GenieESTHOM	stop_codon	2816133	2816135	0	+	0	transcript "244"
Adh	GenieESTHOM	CDS	2843324	2843386	5.943900	+	0	transcript "245"
Adh	GenieESTHOM	start_codon	2843324	2843326	0	+	0	transcript "245"
Adh	GenieESTHOM	stop_codon	2843384	2843386	0	+	0	transcript "245"
Adh	GenieESTHOM	CDS	2849759	2849784	-1.924300	-	0	transcript "246"
Adh	GenieESTHOM	stop_codon	2849759	2849761	0	-	0	transcript "246"
Adh	GenieESTHOM	CDS	2853744	2854099	39.970000	-	0	transcript "246"
Adh	GenieESTHOM	CDS	2854197	2855182	70.274000	-	1	transcript "246"
Adh	GenieESTHOM	start_codon	2855180	2855182	0	-	0	transcript "246"
Adh	GenieESTHOM	CDS	2894587	2895247	393.380000	+	0	transcript "256"
Adh	GenieESTHOM	start_codon	2894587	2894589	0	+	0	transcript "256"
Adh	GenieESTHOM	CDS	2895319	2895977	389.680000	+	1	transcript "256"
Adh	GenieESTHOM	stop_codon	2895975	2895977	0	+	0	transcript "256"
Adh	GenieESTHOM	CDS	2896655	2896763	-1.988800	+	0	transcript "257"
Adh	GenieESTHOM	start_codon	2896655	2896657	0	+	0	transcript "257"
Adh	GenieESTHOM	CDS	2898444	2899001	353.810000	+	1	transcript "257"
Adh	GenieESTHOM	CDS	2899061	2899716	403.540000	+	1	transcript "257"
Adh	GenieESTHOM	stop_codon	2899714	2899716	0	+	0	transcript "257"
Adh	GenieESTHOM	CDS	2900448	2900565	74.363000	+	0	transcript "258"
Adh	GenieESTHOM	start_codon	2900448	2900450	0	+	0	transcript "258"
Adh	GenieESTHOM	CDS	2900634	2901185	327.510000	+	1	transcript "258"
Adh	GenieESTHOM	CDS	2901452	2902107	413.480000	+	1	transcript "258"
Adh	GenieESTHOM	stop_codon	2902105	2902107	0	+	0	transcript "258"
Adh	GenieESTHOM	CDS	2916879	2917012	24.868000	-	0	transcript "247"
Adh	GenieESTHOM	stop_codon	2916879	2916881	0	-	0	transcript "247"
Adh	GenieESTHOM	CDS	2917311	2917504	41.327000	-	0	transcript "247"
Adh	GenieESTHOM	CDS	2917751	2917988	151.490000	-	1	transcript "247"
Adh	GenieESTHOM	CDS	2918253	2918513	50.022000	-	0	transcript "247"
Adh	GenieESTHOM	CDS	2918684	2918711	1.011700	-	0	transcript "247"
Adh	GenieESTHOM	start_codon	2918709	2918711	0	-	0	transcript "247"
# This output is a fully automatic dump
# No manual intervention was used at all to doctor the results
#
# The final field contains the following information
# Pfam-id - the Pfam id
# key - a unique gene key in this Pfam set
#       (ie, when one domain is split into two exons, each exon will have the same key)
# Pfam-acc - the Pfam accession
# Desc - Pfam description line.
#
# compfly: 1. transcript grouping "cleaned" for viewer Jul 7 (MR)
#
#
Adh	GeneWise	CDS	6722	6859	25.02	+	.	transcript "0.PF00131.1"
Adh	GeneWise	CDS	18575	19129	216.46	-	.	transcript "0.PF00078.2"
Adh	GeneWise	CDS	57579	58370	84.21	+	.	transcript "0.PF00078.3"
Adh	GeneWise	CDS	93573	94097	62.79	-	.	transcript "0.PF00078.4"
Adh	GeneWise	CDS	1056877	1057296	270.25	-	.	transcript "100.PF00179.1"
Adh	GeneWise	CDS	1098135	1098419	42.34	-	.	transcript "100.PF00169.2"
Adh	GeneWise	CDS	1110095	1110172	122.11	+	.	transcript "110.PF00106.1"
Adh	GeneWise	CDS	1110238	1110642	122.11	+	.	transcript "110.PF00106.1"
Adh	GeneWise	CDS	1110713	1110775	122.11	+	.	transcript "110.PF00106.1"
Adh	GeneWise	CDS	1110803	1110958	107.75	+	.	transcript "110.PF00663.2"
Adh	GeneWise	CDS	1111301	1111378	123.29	+	.	transcript "110.PF00106.3"
Adh	GeneWise	CDS	1111805	1112209	123.29	+	.	transcript "110.PF00106.3"
Adh	GeneWise	CDS	1112261	1112323	123.29	+	.	transcript "110.PF00106.3"
Adh	GeneWise	CDS	1112357	1112512	105.30	+	.	transcript "110.PF00663.4"
Adh	GeneWise	CDS	1229705	1229791	40.73	+	.	transcript "120.PF00569.1"
Adh	GeneWise	CDS	1256062	1256616	236.51	+	.	transcript "120.PF00004.2"
Adh	GeneWise	CDS	1272553	1272655	39.61	-	.	transcript "120.PF00089.3"
Adh	GeneWise	CDS	1272447	1272492	39.61	-	.	transcript "120.PF00089.3"
Adh	GeneWise	CDS	1272217	1272395	39.61	-	.	transcript "120.PF00089.3"
Adh	GeneWise	CDS	1271764	1272140	39.61	-	.	transcript "120.PF00089.3"
Adh	GeneWise	CDS	1274014	1274116	79.94	-	.	transcript "120.PF00089.4"
Adh	GeneWise	CDS	1273891	1273936	79.94	-	.	transcript "120.PF00089.4"
Adh	GeneWise	CDS	1273652	1273827	79.94	-	.	transcript "120.PF00089.4"
Adh	GeneWise	CDS	1273241	1273596	79.94	-	.	transcript "120.PF00089.4"
Adh	GeneWise	CDS	1285971	1286073	64.07	-	.	transcript "120.PF00089.5"
Adh	GeneWise	CDS	1285814	1285859	64.07	-	.	transcript "120.PF00089.5"
Adh	GeneWise	CDS	1285595	1285746	64.07	-	.	transcript "120.PF00089.5"
Adh	GeneWise	CDS	1285159	1285502	64.07	-	.	transcript "120.PF00089.5"
Adh	GeneWise	CDS	1297576	1297623	30.69	-	.	transcript "120.PF00098.6"
Adh	GeneWise	CDS	1335080	1335356	134.34	-	.	transcript "130.PF00209.1"
Adh	GeneWise	CDS	1334906	1335024	134.34	-	.	transcript "130.PF00209.1"
Adh	GeneWise	CDS	1335419	1336117	287.15	-	.	transcript "130.PF00209.2"
Adh	GeneWise	CDS	1338337	1338577	149.92	-	.	transcript "130.PF00209.3"
Adh	GeneWise	CDS	1337784	1337917	149.92	-	.	transcript "130.PF00209.3"
Adh	GeneWise	CDS	1477523	1478077	210.54	+	.	transcript "140.PF00078.1"
Adh	GeneWise	CDS	1497633	1497830	43.75	+	.	transcript "140.PF00808.2"
Adh	GeneWise	CDS	1518630	1518710	25.56	+	.	transcript "150.PF00287.1"
Adh	GeneWise	CDS	1520812	1521206	194.66	-	.	transcript "150.PF00147.2"
Adh	GeneWise	CDS	1520636	1520750	194.66	-	.	transcript "150.PF00147.2"
Adh	GeneWise	CDS	1536221	1536292	47.93	-	.	transcript "150.PF00784.3"
Adh	GeneWise	CDS	1536298	1536591	76.43	-	.	transcript "150.PF00784.4"
Adh	GeneWise	CDS	1538153	1538470	191.67	-	.	transcript "150.PF00784.5"
Adh	GeneWise	CDS	1542125	1542211	982.93	-	.	transcript "150.PF00063.6"
Adh	GeneWise	CDS	1541445	1541794	982.93	-	.	transcript "150.PF00063.6"
Adh	GeneWise	CDS	1541178	1541378	982.93	-	.	transcript "150.PF00063.6"
Adh	GeneWise	CDS	1539781	1541113	982.93	-	.	transcript "150.PF00063.6"
Adh	GeneWise	CDS	1549151	1549810	414.84	-	.	transcript "150.PF01096.7"
Adh	GeneWise	CDS	1562407	1562982	226.37	+	.	transcript "150.PF00270.8"
Adh	GeneWise	CDS	1563200	1563353	116.49	+	.	transcript "150.PF00271.9"
Adh	GeneWise	CDS	1563418	1563509	116.49	+	.	transcript "150.PF00271.9"
Adh	GeneWise	CDS	1605025	1605081	40.63	+	.	transcript "160.PF01422.1"
Adh	GeneWise	CDS	1605184	1605243	40.23	+	.	transcript "160.PF01422.2"
Adh	GeneWise	CDS	1605358	1605405	33.56	+	.	transcript "160.PF01422.3"
Adh	GeneWise	CDS	1605781	1605852	47.61	+	.	transcript "160.PF01422.4"
Adh	GeneWise	CDS	1605967	1606026	33.37	+	.	transcript "160.PF01422.5"
Adh	GeneWise	CDS	1606048	1606107	50.95	+	.	transcript "160.PF01422.6"
Adh	GeneWise	CDS	1606381	1606452	43.84	+	.	transcript "160.PF01422.7"
Adh	GeneWise	CDS	1606477	1606539	42.88	+	.	transcript "160.PF01422.8"
Adh	GeneWise	CDS	1606972	1607121	75.44	+	.	transcript "160.PF01424.9"
Adh	GeneWise	CDS	1757169	1757358	300.54	-	.	transcript "170.PF00888.1"
Adh	GeneWise	CDS	1757005	1757115	300.54	-	.	transcript "170.PF00888.1"
Adh	GeneWise	CDS	1756797	1756939	300.54	-	.	transcript "170.PF00888.1"
Adh	GeneWise	CDS	1756448	1756671	300.54	-	.	transcript "170.PF00888.1"
Adh	GeneWise	CDS	1756248	1756386	300.54	-	.	transcript "170.PF00888.1"
Adh	GeneWise	CDS	1756029	1756178	300.54	-	.	transcript "170.PF00888.1"
Adh	GeneWise	CDS	1757648	1758838	383.79	-	.	transcript "170.PF00888.2"
Adh	GeneWise	CDS	1757415	1757585	383.79	-	.	transcript "170.PF00888.2"
Adh	GeneWise	CDS	1764574	1764608	174.03	-	.	transcript "170.PF01042.3"
Adh	GeneWise	CDS	1764272	1764501	174.03	-	.	transcript "170.PF01042.3"
Adh	GeneWise	CDS	1763957	1764042	174.03	-	.	transcript "170.PF01042.3"
Adh	GeneWise	CDS	1824670	1824738	34.10	+	.	transcript "180.PF00096.1"
Adh	GeneWise	CDS	1824775	1824843	33.91	+	.	transcript "180.PF00096.2"
Adh	GeneWise	CDS	1824853	1824921	31.72	+	.	transcript "180.PF00096.3"
Adh	GeneWise	CDS	1824937	1825005	35.94	+	.	transcript "180.PF00096.4"
Adh	GeneWise	CDS	1825021	1825077	27.01	+	.	transcript "180.PF00096.5"
Adh	GeneWise	CDS	1913566	1913637	31.71	-	.	transcript "190.PF00096.1"
Adh	GeneWise	CDS	1913653	1913721	37.33	-	.	transcript "190.PF00096.2"
Adh	GeneWise	CDS	1913737	1913805	34.54	-	.	transcript "190.PF00096.3"
Adh	GeneWise	CDS	1913815	1913883	32.60	-	.	transcript "190.PF00096.4"
Adh	GeneWise	CDS	1913920	1913988	33.18	-	.	transcript "190.PF00096.5"
Adh	GeneWise	CDS	1914151	1914219	30.95	-	.	transcript "190.PF00096.6"
Adh	GeneWise	CDS	1938900	1939208	46.60	+	.	transcript "190.PF00077.7"
Adh	GeneWise	CDS	1939794	1940342	182.56	+	.	transcript "190.PF00078.8"
Adh	GeneWise	CDS	1966604	1966675	30.17	-	.	transcript "190.PF00096.9"
Adh	GeneWise	CDS	1966691	1966759	38.90	-	.	transcript "190.PF00096.10"
Adh	GeneWise	CDS	1966775	1966843	34.54	-	.	transcript "190.PF00096.11"
Adh	GeneWise	CDS	1966853	1966921	29.69	-	.	transcript "190.PF00096.12"
Adh	GeneWise	CDS	1966958	1967026	28.88	-	.	transcript "190.PF00096.13"
Adh	GeneWise	CDS	1992347	1992877	165.36	+	.	transcript "190.PF00222.14"
Adh	GeneWise	CDS	1992942	1993204	165.36	+	.	transcript "190.PF00222.14"
Adh	GeneWise	CDS	1993350	1993437	165.36	+	.	transcript "190.PF00222.14"
Adh	GeneWise	CDS	202311	202646	178.48	+	.	transcript "20.PF01224.1"
Adh	GeneWise	CDS	202700	203071	178.48	+	.	transcript "20.PF01224.1"
Adh	GeneWise	CDS	203429	203998	86.39	+	.	transcript "20.PF01224.2"
Adh	GeneWise	CDS	217024	217137	44.86	-	.	transcript "20.PF00097.3"
Adh	GeneWise	CDS	256201	256572	26.27	-	.	transcript "20.PF00078.4"
Adh	GeneWise	CDS	274820	275683	299.30	+	.	transcript "20.PF00069.5"
Adh	GeneWise	CDS	280184	280293	139.67	+	.	transcript "20.PF00005.6"
Adh	GeneWise	CDS	280350	280610	139.67	+	.	transcript "20.PF00005.6"
Adh	GeneWise	CDS	280674	280839	139.67	+	.	transcript "20.PF00005.6"
Adh	GeneWise	CDS	283030	283541	132.59	+	.	transcript "20.PF00005.7"
Adh	GeneWise	CDS	283608	283659	132.59	+	.	transcript "20.PF00005.7"
Adh	GeneWise	CDS	289600	290166	300.40	+	.	transcript "20.PF01369.8"
Adh	GeneWise	CDS	2069402	2069551	48.64	+	.	transcript "200.PF01463.1"
Adh	GeneWise	CDS	2078138	2078437	97.80	+	.	transcript "200.PF00077.2"
Adh	GeneWise	CDS	2078801	2079355	257.73	+	.	transcript "200.PF00078.3"
Adh	GeneWise	CDS	2100563	2101141	230.21	-	.	transcript "210.PF01400.1"
Adh	GeneWise	CDS	2102776	2102821	136.77	-	.	transcript "210.PF01400.2"
Adh	GeneWise	CDS	2102178	2102722	136.77	-	.	transcript "210.PF01400.2"
Adh	GeneWise	CDS	2104226	2104271	246.20	-	.	transcript "210.PF01400.3"
Adh	GeneWise	CDS	2103634	2104169	246.20	-	.	transcript "210.PF01400.3"
Adh	GeneWise	CDS	2105774	2105822	254.92	-	.	transcript "210.PF01400.4"
Adh	GeneWise	CDS	2105182	2105720	254.92	-	.	transcript "210.PF01400.4"
Adh	GeneWise	CDS	2106818	2106860	222.33	+	.	transcript "210.PF01400.5"
Adh	GeneWise	CDS	2106931	2107442	222.33	+	.	transcript "210.PF01400.5"
Adh	GeneWise	CDS	2118503	2118551	248.68	+	.	transcript "210.PF01400.6"
Adh	GeneWise	CDS	2118614	2119149	248.68	+	.	transcript "210.PF01400.6"
Adh	GeneWise	CDS	2149849	2150544	165.22	+	.	transcript "210.PF00089.7"
Adh	GeneWise	CDS	2158723	2159415	133.19	+	.	transcript "210.PF00089.8"
Adh	GeneWise	CDS	2174060	2174362	41.83	+	.	transcript "210.PF00077.9"
Adh	GeneWise	CDS	2174750	2175301	228.50	+	.	transcript "210.PF00078.10"
Adh	GeneWise	CDS	2181643	2181969	167.87	-	.	transcript "210.PF00134.11"
Adh	GeneWise	CDS	2204618	2205103	119.85	+	.	transcript "220.PF00270.1"
Adh	GeneWise	CDS	2209966	2211165	231.95	-	.	transcript "220.PF00135.2"
Adh	GeneWise	CDS	2211243	2211443	59.00	-	.	transcript "220.PF00135.3"
Adh	GeneWise	CDS	2288607	2288804	47.81	-	.	transcript "220.PF00089.4"
Adh	GeneWise	CDS	2330235	2330611	139.64	-	.	transcript "230.PF01433.1"
Adh	GeneWise	CDS	2330026	2330181	139.64	-	.	transcript "230.PF01433.1"
Adh	GeneWise	CDS	2329358	2329967	139.64	-	.	transcript "230.PF01433.1"
Adh	GeneWise	CDS	2339437	2340396	150.06	-	.	transcript "230.PF00207.2"
Adh	GeneWise	CDS	2340595	2340978	139.34	-	.	transcript "230.PF00207.3"
Adh	GeneWise	CDS	2341682	2341734	68.09	-	.	transcript "230.PF00207.4"
Adh	GeneWise	CDS	2341384	2341630	68.09	-	.	transcript "230.PF00207.4"
Adh	GeneWise	CDS	2350278	2350862	119.51	-	.	transcript "230.PF00450.5"
Adh	GeneWise	CDS	2352549	2352962	102.66	-	.	transcript "230.PF00450.6"
Adh	GeneWise	CDS	2374458	2375150	143.70	+	.	transcript "230.PF00089.7"
Adh	GeneWise	CDS	2591597	2591644	30.69	+	.	transcript "250.PF00098.1"
Adh	GeneWise	CDS	2606806	2607360	257.73	-	.	transcript "260.PF00078.1"
Adh	GeneWise	CDS	2607724	2608023	97.80	-	.	transcript "260.PF00077.2"
Adh	GeneWise	CDS	2709674	2710000	107.86	-	.	transcript "270.PF00581.1"
Adh	GeneWise	CDS	2711909	2712025	37.47	+	.	transcript "270.PF00400.2"
Adh	GeneWise	CDS	2728117	2728233	53.65	-	.	transcript "270.PF00010.3"
Adh	GeneWise	CDS	2743692	2745089	245.78	+	.	transcript "270.PF00067.4"
Adh	GeneWise	CDS	2751778	2751841	26.94	-	.	transcript "270.PF00241.5"
Adh	GeneWise	CDS	2751521	2751711	26.94	-	.	transcript "270.PF00241.5"
Adh	GeneWise	CDS	2751340	2751465	26.94	-	.	transcript "270.PF00241.5"
Adh	GeneWise	CDS	2758116	2758367	68.21	+	.	transcript "270.PF00804.6"
Adh	GeneWise	CDS	2761356	2761451	35.76	+	.	transcript "270.PF00400.7"
Adh	GeneWise	CDS	2761491	2761592	40.00	+	.	transcript "270.PF00400.8"
Adh	GeneWise	CDS	2761902	2762000	43.03	+	.	transcript "270.PF00400.9"
Adh	GeneWise	CDS	2763864	2763959	29.33	-	.	transcript "270.PF00023.10"
Adh	GeneWise	CDS	2764030	2764119	40.63	-	.	transcript "270.PF00023.11"
Adh	GeneWise	CDS	2772332	2772412	27.47	-	.	transcript "270.PF00023.12"
Adh	GeneWise	CDS	2772597	2772674	28.89	-	.	transcript "270.PF00023.13"
Adh	GeneWise	CDS	2772690	2772776	29.05	-	.	transcript "270.PF00023.14"
Adh	GeneWise	CDS	2804964	2805281	181.66	-	.	transcript "280.PF00085.1"
Adh	GeneWise	CDS	2805351	2805674	154.79	-	.	transcript "280.PF00085.2"
Adh	GeneWise	CDS	2899210	2899434	25.71	+	.	transcript "280.PF00704.3"
Adh	GeneWise	CDS	2901922	2902014	30.66	+	.	transcript "290.PF00704.1"
Adh	GeneWise	CDS	302559	302642	29.76	+	.	transcript "30.PF00194.1"
Adh	GeneWise	CDS	302818	303387	305.19	+	.	transcript "30.PF00194.2"
Adh	GeneWise	CDS	308718	309056	211.47	+	.	transcript "30.PF00621.3"
Adh	GeneWise	CDS	309110	309316	211.47	+	.	transcript "30.PF00621.3"
Adh	GeneWise	CDS	309529	309843	70.80	+	.	transcript "30.PF00169.4"
Adh	GeneWise	CDS	309982	310149	99.66	+	.	transcript "30.PF00618.5"
Adh	GeneWise	CDS	310619	311173	328.01	+	.	transcript "30.PF00617.6"
Adh	GeneWise	CDS	315519	315923	67.72	+	.	transcript "30.PF00282.7"
Adh	GeneWise	CDS	316460	316800	303.38	+	.	transcript "30.PF00282.8"
Adh	GeneWise	CDS	316865	317231	303.38	+	.	transcript "30.PF00282.8"
Adh	GeneWise	CDS	318185	318472	67.92	-	.	transcript "30.PF00476.9"
Adh	GeneWise	CDS	318631	319023	142.95	-	.	transcript "30.PF00476.10"
Adh	GeneWise	CDS	322855	322941	27.86	-	.	transcript "30.PF00400.11"
Adh	GeneWise	CDS	389681	389791	25.64	+	.	transcript "30.PF00169.12"
Adh	GeneWise	CDS	390425	390491	159.45	+	.	transcript "30.PF01412.13"
Adh	GeneWise	CDS	390556	390673	159.45	+	.	transcript "30.PF01412.13"
Adh	GeneWise	CDS	390737	390908	159.45	+	.	transcript "30.PF01412.13"
Adh	GeneWise	CDS	400389	400923	968.42	+	.	transcript "40.PF01401.1"
Adh	GeneWise	CDS	401350	401713	968.42	+	.	transcript "40.PF01401.1"
Adh	GeneWise	CDS	401775	402341	968.42	+	.	transcript "40.PF01401.1"
Adh	GeneWise	CDS	402399	402539	968.42	+	.	transcript "40.PF01401.1"
Adh	GeneWise	CDS	402607	402766	968.42	+	.	transcript "40.PF01401.1"
Adh	GeneWise	CDS	403714	404226	49.36	+	.	transcript "40.PF01401.2"
Adh	GeneWise	CDS	404651	405027	76.27	+	.	transcript "40.PF01401.3"
Adh	GeneWise	CDS	405085	405385	76.27	+	.	transcript "40.PF01401.3"
Adh	GeneWise	CDS	405973	406206	99.88	+	.	transcript "40.PF00708.4"
Adh	GeneWise	CDS	410360	410612	491.74	+	.	transcript "40.PF01401.5"
Adh	GeneWise	CDS	410677	411401	491.74	+	.	transcript "40.PF01401.5"
Adh	GeneWise	CDS	411728	411831	491.74	+	.	transcript "40.PF01401.5"
Adh	GeneWise	CDS	411898	411994	491.74	+	.	transcript "40.PF01401.5"
Adh	GeneWise	CDS	448465	448607	99.37	+	.	transcript "40.PF01401.6"
Adh	GeneWise	CDS	449015	449174	99.37	+	.	transcript "40.PF01401.6"
Adh	GeneWise	CDS	454656	454748	25.91	+	.	transcript "40.PF00008.7"
Adh	GeneWise	CDS	454843	454926	26.13	+	.	transcript "40.PF00008.8"
Adh	GeneWise	CDS	462879	462983	30.79	-	.	transcript "40.PF00008.9"
Adh	GeneWise	CDS	465117	465209	27.88	+	.	transcript "40.PF00008.10"
Adh	GeneWise	CDS	468921	469025	26.33	-	.	transcript "40.PF00008.11"
Adh	GeneWise	CDS	469470	469565	27.22	-	.	transcript "40.PF00008.12"
Adh	GeneWise	CDS	471944	472490	128.75	+	.	transcript "40.PF00067.13"
Adh	GeneWise	CDS	472557	472823	128.75	+	.	transcript "40.PF00067.13"
Adh	GeneWise	CDS	472965	473107	128.75	+	.	transcript "40.PF00067.13"
Adh	GeneWise	CDS	474576	474680	26.31	+	.	transcript "40.PF00008.14"
Adh	GeneWise	CDS	474903	474992	25.65	+	.	transcript "40.PF00008.15"
Adh	GeneWise	CDS	478260	479003	155.22	-	.	transcript "40.PF00001.16"
Adh	GeneWise	CDS	562636	562755	43.16	+	.	transcript "50.PF00065.1"
Adh	GeneWise	CDS	570329	570658	196.75	+	.	transcript "50.PF00065.2"
Adh	GeneWise	CDS	574279	574483	144.02	+	.	transcript "50.PF00065.3"
Adh	GeneWise	CDS	575409	575515	144.02	+	.	transcript "50.PF00065.3"
Adh	GeneWise	CDS	577206	577319	35.80	+	.	transcript "50.PF00065.4"
Adh	GeneWise	CDS	582851	582973	42.61	+	.	transcript "50.PF00065.5"
Adh	GeneWise	CDS	655551	655919	30.63	-	.	transcript "60.PF01456.1"
Adh	GeneWise	CDS	682598	682771	55.91	-	.	transcript "60.PF00069.2"
Adh	GeneWise	CDS	689468	689719	48.50	-	.	transcript "60.PF00069.3"
Adh	GeneWise	CDS	772008	772298	47.26	+	.	transcript "70.PF00055.1"
Adh	GeneWise	CDS	779683	780135	64.15	+	.	transcript "70.PF00055.2"
Adh	GeneWise	CDS	780148	780294	28.28	+	.	transcript "70.PF00053.3"
Adh	GeneWise	CDS	780301	780426	25.28	+	.	transcript "70.PF00053.4"
Adh	GeneWise	CDS	780463	780585	59.64	+	.	transcript "70.PF00053.5"
Adh	GeneWise	CDS	780595	780738	70.12	+	.	transcript "70.PF00053.6"
Adh	GeneWise	CDS	781501	781583	60.22	+	.	transcript "70.PF00053.7"
Adh	GeneWise	CDS	781886	781946	60.22	+	.	transcript "70.PF00053.7"
Adh	GeneWise	CDS	782055	782162	37.76	+	.	transcript "70.PF00053.8"
Adh	GeneWise	CDS	782169	782294	62.28	+	.	transcript "70.PF00053.9"
Adh	GeneWise	CDS	782301	782414	57.57	+	.	transcript "70.PF00053.10"
Adh	GeneWise	CDS	782442	782564	84.49	+	.	transcript "70.PF00053.11"
Adh	GeneWise	CDS	813293	813433	91.51	+	.	transcript "80.PF00053.1"
Adh	GeneWise	CDS	813440	813586	89.25	+	.	transcript "80.PF00053.2"
Adh	GeneWise	CDS	813599	813718	39.71	+	.	transcript "80.PF00053.3"
Adh	GeneWise	CDS	813725	813856	70.22	+	.	transcript "80.PF00053.4"
Adh	GeneWise	CDS	813863	814021	53.75	+	.	transcript "80.PF00053.5"
Adh	GeneWise	CDS	814928	814981	70.93	+	.	transcript "80.PF00053.6"
Adh	GeneWise	CDS	815046	815129	70.93	+	.	transcript "80.PF00053.6"
Adh	GeneWise	CDS	815136	815294	45.71	+	.	transcript "80.PF00053.7"
Adh	GeneWise	CDS	815301	815408	60.27	+	.	transcript "80.PF00053.8"
Adh	GeneWise	CDS	818709	819140	44.02	+	.	transcript "80.PF00054.9"
Adh	GeneWise	CDS	820291	820695	63.84	+	.	transcript "80.PF00054.10"
Adh	GeneWise	CDS	820890	820979	40.09	+	.	transcript "80.PF00054.11"
Adh	GeneWise	CDS	821037	821265	40.09	+	.	transcript "80.PF00054.11"
Adh	GeneWise	CDS	821333	821409	40.09	+	.	transcript "80.PF00054.11"
Adh	GeneWise	CDS	832152	832253	36.28	+	.	transcript "80.PF00569.12"
Adh	GeneWise	CDS	839716	840312	197.38	-	.	transcript "80.PF00089.13"
Adh	GeneWise	CDS	851121	851190	262.29	+	.	transcript "80.PF00071.14"
Adh	GeneWise	CDS	851256	851436	262.29	+	.	transcript "80.PF00071.14"
Adh	GeneWise	CDS	851491	851673	262.29	+	.	transcript "80.PF00071.14"
Adh	GeneWise	CDS	851742	851916	262.29	+	.	transcript "80.PF00071.14"
Adh	GeneWise	CDS	853566	854129	66.29	+	.	transcript "80.PF00535.15"
Adh	GeneWise	CDS	857846	858029	302.78	+	.	transcript "80.PF00488.16"
Adh	GeneWise	CDS	858109	858341	302.78	+	.	transcript "80.PF00488.16"
Adh	GeneWise	CDS	858406	858738	251.05	+	.	transcript "80.PF00488.17"
Adh	GeneWise	CDS	885180	885236	26.49	-	.	transcript "80.PF00096.18"
Adh	GeneWise	CDS	918415	918510	43.67	-	.	transcript "90.PF00379.1"
Adh	GeneWise	CDS	961399	962196	114.81	-	.	transcript "90.PF00078.2"
Adh	GeneWise	CDS	986516	986572	25.20	+	.	transcript "90.PF00096.3"
# total domains 184
#
# compfly: 1. transcript grouping "cleaned" for viewer  Jul 7 (MR)
#          2. Reverse strand numbering reversed Jan 19 (MR)
#
Adh	BLOCKS	CDS	57486	57621	3.7	+	3	transcript "0"
Adh	BLOCKS	CDS	57624	57723	0.01	+	3	transcript "0"
Adh	BLOCKS	CDS	57888	57924	0.14	+	3	transcript "1"
Adh	BLOCKS	CDS	58059	58095	0.00027	+	3	transcript "1"
Adh	BLOCKS	CDS	202335	202422	1.6e-06	+	3	transcript "2"
Adh	BLOCKS	CDS	202338	202491	1.2e-24	+	3	transcript "2"
Adh	BLOCKS	CDS	203471	203522	0.0029	+	2	transcript "2"
Adh	BLOCKS	CDS	275192	275282	2.9e-11	+	2	transcript "3"
Adh	BLOCKS	CDS	275381	275426	0.013	+	2	transcript "3"
Adh	BLOCKS	CDS	280211	280244	9.5	+	2	transcript "4"
Adh	BLOCKS	CDS	283381	283474	1.4e-05	+	1	transcript "4"
Adh	BLOCKS	CDS	289870	289954	5.4e-15	+	1	transcript "5"
Adh	BLOCKS	CDS	289996	290065	0.00012	+	1	transcript "5"
Adh	BLOCKS	CDS	302586	302676	0.053	+	3	transcript "6"
Adh	BLOCKS	CDS	302872	302980	2.3e-21	+	1	transcript "6"
Adh	BLOCKS	CDS	302989	303061	2.2e-10	+	1	transcript "6"
Adh	BLOCKS	CDS	303181	303277	1.4e-20	+	1	transcript "6"
Adh	BLOCKS	CDS	303310	303409	2.7e+02	+	1	transcript "6"
Adh	BLOCKS	CDS	310024	310066	3.5	+	1	transcript "7"
Adh	BLOCKS	CDS	310069	310171	8.3e-15	+	1	transcript "7"
Adh	BLOCKS	CDS	310303	310351	0.00058	+	1	transcript "7"
Adh	BLOCKS	CDS	310616	310685	0.02	+	2	transcript "8"
Adh	BLOCKS	CDS	316736	316763	0.00024	+	2	transcript "9"
Adh	BLOCKS	CDS	327274	327406	1.6e-23	+	1	transcript "10"
Adh	BLOCKS	CDS	327631	327754	5e-25	+	1	transcript "10"
Adh	BLOCKS	CDS	327877	327955	4.5e-07	+	1	transcript "10"
Adh	BLOCKS	CDS	390597	390648	3.3e-05	+	3	transcript "11"
Adh	BLOCKS	CDS	400404	400539	9.3e-30	+	3	transcript "12"
Adh	BLOCKS	CDS	400590	400746	1.8e-34	+	3	transcript "12"
Adh	BLOCKS	CDS	400785	400905	4.2e-27	+	3	transcript "12"
Adh	BLOCKS	CDS	401334	401457	3.3e-11	+	3	transcript "12"
Adh	BLOCKS	CDS	401532	401679	1.5e-42	+	3	transcript "12"
Adh	BLOCKS	CDS	401743	401857	8e-08	+	1	transcript "12"
Adh	BLOCKS	CDS	401860	401971	6e-32	+	1	transcript "12"
Adh	BLOCKS	CDS	401980	402121	4.2e-37	+	1	transcript "12"
Adh	BLOCKS	CDS	402124	402241	1.8e-30	+	1	transcript "12"
Adh	BLOCKS	CDS	402244	402343	1.9e-23	+	1	transcript "12"
Adh	BLOCKS	CDS	402403	402511	4.2e-19	+	1	transcript "12"
Adh	BLOCKS	CDS	402677	402794	3.9e-24	+	2	transcript "12"
Adh	BLOCKS	CDS	403894	404014	7.5e-05	+	1	transcript "13"
Adh	BLOCKS	CDS	404930	405029	12	+	2	transcript "13"
Adh	BLOCKS	CDS	405296	405413	0.033	+	2	transcript "13"
Adh	BLOCKS	CDS	405988	406126	8.9e-23	+	1	transcript "14"
Adh	BLOCKS	CDS	410474	410594	9e-05	+	2	transcript "15"
Adh	BLOCKS	CDS	410661	410784	1.1	+	3	transcript "15"
Adh	BLOCKS	CDS	410859	411006	6.6e-19	+	3	transcript "15"
Adh	BLOCKS	CDS	411009	411123	0.2	+	3	transcript "15"
Adh	BLOCKS	CDS	411123	411234	2.8e-18	+	3	transcript "15"
Adh	BLOCKS	CDS	411243	411384	1.7e-15	+	3	transcript "15"
Adh	BLOCKS	CDS	411713	411830	0.097	+	2	transcript "15"
Adh	BLOCKS	CDS	411899	411998	1.1e-13	+	2	transcript "15"
Adh	BLOCKS	CDS	448471	448579	0.0034	+	1	transcript "15"
Adh	BLOCKS	CDS	449085	449202	0.02	+	3	transcript "15"
Adh	BLOCKS	CDS	474516	474618	0.87	+	3	transcript "16"
Adh	BLOCKS	CDS	474723	474825	0.067	+	3	transcript "16"
Adh	BLOCKS	CDS	510398	510443	0.0083	+	2	transcript "17"
Adh	BLOCKS	CDS	521459	521504	0.27	+	2	transcript "18"
Adh	BLOCKS	CDS	570305	570416	0.0072	+	2	transcript "19"
Adh	BLOCKS	CDS	570467	570494	4.8e+02	+	2	transcript "19"
Adh	BLOCKS	CDS	570551	570665	7.1e-22	+	2	transcript "19"
Adh	BLOCKS	CDS	574354	574477	6.7e-17	+	1	transcript "19"
Adh	BLOCKS	CDS	779782	779824	1.2e+03	+	1	transcript "20"
Adh	BLOCKS	CDS	779938	779986	9.4e+02	+	1	transcript "20"
Adh	BLOCKS	CDS	779989	780058	0.28	+	1	transcript "20"
Adh	BLOCKS	CDS	780226	780262	0.01	+	1	transcript "21"
Adh	BLOCKS	CDS	780385	780421	0.095	+	1	transcript "22"
Adh	BLOCKS	CDS	781516	781591	0.00066	+	1	transcript "23"
Adh	BLOCKS	CDS	782235	782271	0.095	+	3	transcript "24"
Adh	BLOCKS	CDS	782496	782532	0.9	+	3	transcript "25"
Adh	BLOCKS	CDS	814310	814340	8.3e+02	+	2	transcript "26"
Adh	BLOCKS	CDS	814346	814397	0.59	+	2	transcript "26"
Adh	BLOCKS	CDS	814595	814637	1.6e+02	+	2	transcript "26"
Adh	BLOCKS	CDS	815064	815100	0.54	+	3	transcript "27"
Adh	BLOCKS	CDS	832218	832266	0.0075	+	3	transcript "28"
Adh	BLOCKS	CDS	851300	851417	0.003	+	2	transcript "29"
Adh	BLOCKS	CDS	854178	854241	0.59	+	3	transcript "30"
Adh	BLOCKS	CDS	857048	857162	6.5e-13	+	2	transcript "31"
Adh	BLOCKS	CDS	858141	858267	1.6e-21	+	3	transcript "31"
Adh	BLOCKS	CDS	858382	858523	4.6e-11	+	1	transcript "31"
Adh	BLOCKS	CDS	858556	858589	0.0035	+	1	transcript "31"
Adh	BLOCKS	CDS	858652	858751	8.3e-10	+	1	transcript "31"
Adh	BLOCKS	CDS	1110550	1110661	2.3e-12	+	1	transcript "32"
Adh	BLOCKS	CDS	1112117	1112228	4.3e-15	+	2	transcript "33"
Adh	BLOCKS	CDS	1112300	1112327	1e+03	+	2	transcript "33"
Adh	BLOCKS	CDS	1229756	1229804	0.00046	+	2	transcript "34"
Adh	BLOCKS	CDS	1255963	1256023	0.00088	+	1	transcript "35"
Adh	BLOCKS	CDS	1256071	1256134	3e-13	+	1	transcript "35"
Adh	BLOCKS	CDS	1256170	1256296	1.3e-08	+	1	transcript "35"
Adh	BLOCKS	CDS	1256344	1256482	2.6e-05	+	1	transcript "35"
Adh	BLOCKS	CDS	1256572	1256629	0.0054	+	1	transcript "35"
Adh	BLOCKS	CDS	1477634	1477694	2.7e-07	+	2	transcript "36"
Adh	BLOCKS	CDS	1477826	1477892	1.3e-11	+	2	transcript "36"
Adh	BLOCKS	CDS	1497630	1497774	15	+	3	transcript "37"
Adh	BLOCKS	CDS	1497777	1497897	0.045	+	3	transcript "37"
Adh	BLOCKS	CDS	1554359	1554455	0.074	+	2	transcript "38"
Adh	BLOCKS	CDS	1562440	1562554	3.8e-22	+	1	transcript "39"
Adh	BLOCKS	CDS	1562575	1562650	0.00022	+	1	transcript "39"
Adh	BLOCKS	CDS	1562827	1562896	4.3e-10	+	1	transcript "39"
Adh	BLOCKS	CDS	1563396	1563531	1.4e-11	+	3	transcript "39"
Adh	BLOCKS	CDS	1601870	1601960	0.099	+	2	transcript "40"
Adh	BLOCKS	CDS	1601885	1601933	0.18	+	2	transcript "40"
Adh	BLOCKS	CDS	1601894	1602020	0.00012	+	2	transcript "40"
Adh	BLOCKS	CDS	1601954	1602044	0.084	+	2	transcript "40"
Adh	BLOCKS	CDS	1601963	1602065	0.0044	+	2	transcript "40"
Adh	BLOCKS	CDS	1601978	1602104	0.0031	+	2	transcript "40"
Adh	BLOCKS	CDS	1602038	1602128	0.00055	+	2	transcript "40"
Adh	BLOCKS	CDS	1602047	1602149	0.76	+	2	transcript "40"
Adh	BLOCKS	CDS	1602053	1602101	0.021	+	2	transcript "40"
Adh	BLOCKS	CDS	1602062	1602188	3.2e-05	+	2	transcript "40"
Adh	BLOCKS	CDS	1602101	1602137	0.0015	+	2	transcript "40"
Adh	BLOCKS	CDS	1602122	1602212	8.7e-05	+	2	transcript "40"
Adh	BLOCKS	CDS	1602131	1602233	1	+	2	transcript "40"
Adh	BLOCKS	CDS	1602146	1602272	0.00099	+	2	transcript "40"
Adh	BLOCKS	CDS	1602206	1602296	4.1e-07	+	2	transcript "40"
Adh	BLOCKS	CDS	1602221	1602269	0.1	+	2	transcript "40"
Adh	BLOCKS	CDS	1604752	1604803	0.0035	+	1	transcript "41"
Adh	BLOCKS	CDS	1606906	1606942	14	+	1	transcript "41"
Adh	BLOCKS	CDS	1824859	1824949	0.18	+	1	transcript "42"
Adh	BLOCKS	CDS	1824874	1824922	0.54	+	1	transcript "42"
Adh	BLOCKS	CDS	1824883	1825009	7.9e-05	+	1	transcript "42"
Adh	BLOCKS	CDS	1824922	1824958	0.00035	+	1	transcript "42"
Adh	BLOCKS	CDS	1824943	1825033	1.4	+	1	transcript "42"
Adh	BLOCKS	CDS	1824958	1825006	0.54	+	1	transcript "42"
Adh	BLOCKS	CDS	1824967	1825093	0.0042	+	1	transcript "42"
Adh	BLOCKS	CDS	1939899	1939959	0.00036	+	3	transcript "43"
Adh	BLOCKS	CDS	1940091	1940157	4.6e-07	+	3	transcript "43"
Adh	BLOCKS	CDS	1992236	1992260	1.3e+04	+	2	transcript "44"
Adh	BLOCKS	CDS	1992323	1992407	1.1e+02	+	2	transcript "44"
Adh	BLOCKS	CDS	1992485	1992512	8.3	+	2	transcript "44"
Adh	BLOCKS	CDS	1992746	1992782	1.9	+	2	transcript "44"
Adh	BLOCKS	CDS	1992824	1992842	9.6e+03	+	2	transcript "44"
Adh	BLOCKS	CDS	2078912	2078972	1.7e-10	+	2	transcript "45"
Adh	BLOCKS	CDS	2079104	2079170	5.1e-15	+	2	transcript "45"
Adh	BLOCKS	CDS	2106966	2107020	0.88	+	3	transcript "46"
Adh	BLOCKS	CDS	2107131	2107185	3.5e-05	+	3	transcript "46"
Adh	BLOCKS	CDS	2107188	2107239	17	+	3	transcript "46"
Adh	BLOCKS	CDS	2107305	2107350	2.4e-07	+	3	transcript "46"
Adh	BLOCKS	CDS	2107416	2107455	8e+03	+	3	transcript "46"
Adh	BLOCKS	CDS	2118649	2118703	13	+	1	transcript "47"
Adh	BLOCKS	CDS	2118826	2118880	1e-06	+	1	transcript "47"
Adh	BLOCKS	CDS	2118883	2118934	7.1	+	1	transcript "47"
Adh	BLOCKS	CDS	2119000	2119045	0.00012	+	1	transcript "47"
Adh	BLOCKS	CDS	2119117	2119156	1.7	+	1	transcript "47"
Adh	BLOCKS	CDS	2120150	2120189	3.2e+02	+	2	transcript "48"
Adh	BLOCKS	CDS	2120402	2120441	0.096	+	2	transcript "48"
Adh	BLOCKS	CDS	2150434	2150557	7e-06	+	1	transcript "49"
Adh	BLOCKS	CDS	2150464	2150566	0.00034	+	1	transcript "49"
Adh	BLOCKS	CDS	2158795	2158843	0.071	+	1	transcript "50"
Adh	BLOCKS	CDS	2158795	2158846	3.3	+	1	transcript "50"
Adh	BLOCKS	CDS	2158801	2158897	1.6e+04	+	1	transcript "50"
Adh	BLOCKS	CDS	2159269	2159308	1.9	+	1	transcript "50"
Adh	BLOCKS	CDS	2159272	2159341	2.6e+03	+	1	transcript "50"
Adh	BLOCKS	CDS	2159305	2159428	2e-08	+	1	transcript "50"
Adh	BLOCKS	CDS	2159335	2159437	9.6e-05	+	1	transcript "50"
Adh	BLOCKS	CDS	2159362	2159446	0.58	+	1	transcript "50"
Adh	BLOCKS	CDS	2159389	2159428	24	+	1	transcript "50"
Adh	BLOCKS	CDS	2174858	2174918	2e-07	+	2	transcript "51"
Adh	BLOCKS	CDS	2175050	2175116	1.8e-14	+	2	transcript "51"
Adh	BLOCKS	CDS	2205646	2205784	4.7e-34	+	1	transcript "52"
Adh	BLOCKS	CDS	2205841	2205880	1e-06	+	1	transcript "52"
Adh	BLOCKS	CDS	2306694	2306754	0.014	+	3	transcript "53"
Adh	BLOCKS	CDS	2306856	2306892	6.4e+02	+	3	transcript "53"
Adh	BLOCKS	CDS	2593977	2594139	1.1e-06	+	3	transcript "54"
Adh	BLOCKS	CDS	2594458	2594620	1.7e-08	+	1	transcript "54"
Adh	BLOCKS	CDS	2594734	2594890	0.00018	+	1	transcript "54"
Adh	BLOCKS	CDS	2624134	2624179	7.3e-09	+	1	transcript "55"
Adh	BLOCKS	CDS	2624158	2624239	19	+	1	transcript "55"
Adh	BLOCKS	CDS	2624807	2624885	5.2e-06	+	2	transcript "55"
Adh	BLOCKS	CDS	2624973	2625024	3.4e+03	+	3	transcript "55"
Adh	BLOCKS	CDS	2625018	2625105	1.3	+	3	transcript "55"
Adh	BLOCKS	CDS	2625090	2625162	7.1e-17	+	3	transcript "55"
Adh	BLOCKS	CDS	2625402	2625486	3.8e+02	+	3	transcript "55"
Adh	BLOCKS	CDS	2625903	2625987	0.0022	+	3	transcript "55"
Adh	BLOCKS	CDS	2625906	2625987	1.3	+	3	transcript "55"
Adh	BLOCKS	CDS	2626094	2626172	5.5e-05	+	2	transcript "55"
Adh	BLOCKS	CDS	2629431	2629515	0.09	+	3	transcript "55"
Adh	BLOCKS	CDS	2631096	2631180	7.2	+	3	transcript "55"
Adh	BLOCKS	CDS	2632520	2632580	2.9e-11	+	2	transcript "55"
Adh	BLOCKS	CDS	2632667	2632751	0.4	+	2	transcript "55"
Adh	BLOCKS	CDS	2633257	2633299	1.9e-09	+	1	transcript "55"
Adh	BLOCKS	CDS	2633272	2633356	4.6	+	1	transcript "55"
Adh	BLOCKS	CDS	2633460	2633496	0.018	+	3	transcript "55"
Adh	BLOCKS	CDS	2633460	2633538	0.12	+	3	transcript "55"
Adh	BLOCKS	CDS	2685520	2685676	5.1e-06	+	1	transcript "56"
Adh	BLOCKS	CDS	2744937	2745030	2.5e-08	+	3	transcript "57"
Adh	BLOCKS	CDS	2750095	2750221	0.033	+	1	transcript "58"
Adh	BLOCKS	CDS	2750134	2750170	0.00021	+	1	transcript "58"
Adh	BLOCKS	CDS	2750155	2750245	0.00015	+	1	transcript "58"
Adh	BLOCKS	CDS	2750218	2750254	0.074	+	1	transcript "58"
Adh	BLOCKS	CDS	2750347	2750473	0.48	+	1	transcript "58"
Adh	BLOCKS	CDS	2750422	2750470	0.024	+	1	transcript "58"
Adh	BLOCKS	CDS	2758143	2758290	1.4e-18	+	3	transcript "59"
Adh	BLOCKS	CDS	2898608	2898662	0.39	+	2	transcript "60"
Adh	BLOCKS	CDS	2805584	2805620 4.9e-05	-	1	transcript "61"
Adh	BLOCKS	CDS	2805191	2805227 1.7e-06	-	1	transcript "62"
Adh	BLOCKS	CDS	2777877	2778006 5.7e-22	-	3	transcript "63"
Adh	BLOCKS	CDS	2764074	2764122 0.45	-	3	transcript "64"
Adh	BLOCKS	CDS	2763944	2763971 6.1	-	1	transcript "64"
Adh	BLOCKS	CDS	2709985	2710045 7.1e+02	-	2	transcript "65"
Adh	BLOCKS	CDS	2709910	2709970 2.7e-13	-	2	transcript "65"
Adh	BLOCKS	CDS	2709793	2709853 1.7e-07	-	2	transcript "65"
Adh	BLOCKS	CDS	2709694	2709757 6.9e-10	-	2	transcript "65"
Adh	BLOCKS	CDS	2709622	2709673 2.1	-	2	transcript "65"
Adh	BLOCKS	CDS	2607219	2607279 1.7e-10	-	3	transcript "66"
Adh	BLOCKS	CDS	2607021	2607087 5.1e-15	-	3	transcript "66"
Adh	BLOCKS	CDS	2352821	2352890 0.0059	-	1	transcript "67"
Adh	BLOCKS	CDS	2352725	2352794 0.0011	-	1	transcript "67"
Adh	BLOCKS	CDS	2351760	2351868 0.029	-	3	transcript "67"
Adh	BLOCKS	CDS	2350706	2350775 0.00022	-	1	transcript "68"
Adh	BLOCKS	CDS	2350610	2350679 8.8e-05	-	1	transcript "68"
Adh	BLOCKS	CDS	2350460	2350499 85	-	1	transcript "68"
Adh	BLOCKS	CDS	2349804	2349879 0.49	-	3	transcript "68"
Adh	BLOCKS	CDS	2349624	2349732 1.7	-	3	transcript "68"
Adh	BLOCKS	CDS	2343499	2343583 0.00029	-	2	transcript "69"
Adh	BLOCKS	CDS	2343274	2343310 2.4e+02	-	2	transcript "69"
Adh	BLOCKS	CDS	2343181	2343229 16	-	2	transcript "69"
Adh	BLOCKS	CDS	2341713	2341740 45	-	3	transcript "69"
Adh	BLOCKS	CDS	2341548	2341608 0.027	-	3	transcript "69"
Adh	BLOCKS	CDS	2341428	2341515 4.6e-09	-	3	transcript "69"
Adh	BLOCKS	CDS	2340885	2340978 1e-06	-	3	transcript "69"
Adh	BLOCKS	CDS	2340732	2340765 0.0085	-	3	transcript "69"
Adh	BLOCKS	CDS	2340594	2340672 74	-	3	transcript "69"
Adh	BLOCKS	CDS	2340054	2340144 8.1e-09	-	3	transcript "69"
Adh	BLOCKS	CDS	2339454	2339550 0.0056	-	3	transcript "69"
Adh	BLOCKS	CDS	2288726	2288765 0.33	-	1	transcript "70"
Adh	BLOCKS	CDS	2218665	2218791 0.0024	-	3	transcript "71"
Adh	BLOCKS	CDS	2211395	2211455 0.0016	-	1	transcript "72"
Adh	BLOCKS	CDS	2211263	2211293 0.012	-	1	transcript "72"
Adh	BLOCKS	CDS	2211144	2211174 0.85	-	3	transcript "72"
Adh	BLOCKS	CDS	2211042	2211087 3.2e-05	-	3	transcript "72"
Adh	BLOCKS	CDS	2210895	2211015 6.7e-17	-	3	transcript "72"
Adh	BLOCKS	CDS	2181855	2181954 8.4e-20	-	3	transcript "73"
Adh	BLOCKS	CDS	2181732	2181822 3.9e-13	-	3	transcript "73"
Adh	BLOCKS	CDS	2105484	2105538 4.1e-05	-	3	transcript "74"
Adh	BLOCKS	CDS	2105430	2105481 0.15	-	3	transcript "74"
Adh	BLOCKS	CDS	2105319	2105364 1.1e-07	-	3	transcript "74"
Adh	BLOCKS	CDS	2103933	2103987 8.5e-08	-	3	transcript "75"
Adh	BLOCKS	CDS	2103879	2103930 5.9	-	3	transcript "75"
Adh	BLOCKS	CDS	2103768	2103813 0.0011	-	3	transcript "75"
Adh	BLOCKS	CDS	2102480	2102534 0.00015	-	1	transcript "76"
Adh	BLOCKS	CDS	2102426	2102477 11	-	1	transcript "76"
Adh	BLOCKS	CDS	2102312	2102357 0.0021	-	1	transcript "76"
Adh	BLOCKS	CDS	2102204	2102243 9.3	-	1	transcript "76"
Adh	BLOCKS	CDS	2101033	2101087 9.1e+02	-	2	transcript "77"
Adh	BLOCKS	CDS	2100856	2100910 4.2e-08	-	2	transcript "77"
Adh	BLOCKS	CDS	2100802	2100853 11	-	2	transcript "77"
Adh	BLOCKS	CDS	2100691	2100736 0.15	-	2	transcript "77"
Adh	BLOCKS	CDS	2100586	2100625 63	-	2	transcript "77"
Adh	BLOCKS	CDS	1966777	1966867 0.14	-	2	transcript "78"
Adh	BLOCKS	CDS	1966804	1966852 0.027	-	2	transcript "78"
Adh	BLOCKS	CDS	1966717	1966843 0.00026	-	2	transcript "78"
Adh	BLOCKS	CDS	1966768	1966804 0.00025	-	2	transcript "78"
Adh	BLOCKS	CDS	1966693	1966783 0.012	-	2	transcript "78"
Adh	BLOCKS	CDS	1966633	1966759 0.29	-	2	transcript "78"
Adh	BLOCKS	CDS	1966636	1966684 0.66	-	2	transcript "78"
Adh	BLOCKS	CDS	1913739	1913829 0.14	-	3	transcript "79"
Adh	BLOCKS	CDS	1913766	1913814 0.027	-	3	transcript "79"
Adh	BLOCKS	CDS	1913679	1913805 0.00018	-	3	transcript "79"
Adh	BLOCKS	CDS	1913730	1913766 0.00035	-	3	transcript "79"
Adh	BLOCKS	CDS	1913682	1913730 0.2	-	3	transcript "79"
Adh	BLOCKS	CDS	1913595	1913721 1.8e-05	-	3	transcript "79"
Adh	BLOCKS	CDS	1764461	1764557 3.2e+03	-	1	transcript "80"
Adh	BLOCKS	CDS	1764290	1764437 2.7e-19	-	1	transcript "80"
Adh	BLOCKS	CDS	1763971	1764058 8.6e-11	-	2	transcript "80"
Adh	BLOCKS	CDS	1758226	1758262 32	-	2	transcript "81"
Adh	BLOCKS	CDS	1757489	1757555 3e-10	-	1	transcript "81"
Adh	BLOCKS	CDS	1757283	1757352 4.8e-06	-	3	transcript "81"
Adh	BLOCKS	CDS	1757035	1757113 5.4	-	2	transcript "81"
Adh	BLOCKS	CDS	1756049	1756151 4.1e-14	-	1	transcript "81"
Adh	BLOCKS	CDS	1730156	1730234 0.97	-	1	transcript "82"
Adh	BLOCKS	CDS	1655590	1655629 1.4	-	2	transcript "83"
Adh	BLOCKS	CDS	1655581	1655620 2.5	-	2	transcript "83"
Adh	BLOCKS	CDS	1655155	1655194 0.043	-	2	transcript "84"
Adh	BLOCKS	CDS	1655146	1655185 0.17	-	2	transcript "84"
Adh	BLOCKS	CDS	1654795	1654834 6.2	-	2	transcript "84"
Adh	BLOCKS	CDS	1549168	1549276 3.2e-23	-	2	transcript "85"
Adh	BLOCKS	CDS	1549165	1549276 1.1e-07	-	2	transcript "85"
Adh	BLOCKS	CDS	1541755	1541812 0.00014	-	2	transcript "86"
Adh	BLOCKS	CDS	1541569	1541644 3e-16	-	2	transcript "86"
Adh	BLOCKS	CDS	1541434	1541515 0.00044	-	2	transcript "86"
Adh	BLOCKS	CDS	1540599	1540683 7.2e-17	-	3	transcript "86"
Adh	BLOCKS	CDS	1540437	1540521 85	-	3	transcript "86"
Adh	BLOCKS	CDS	1538377	1538482 2.6e-12	-	2	transcript "87"
Adh	BLOCKS	CDS	1538290	1538374 3.8e-09	-	2	transcript "87"
Adh	BLOCKS	CDS	1538221	1538257 4.6	-	2	transcript "87"
Adh	BLOCKS	CDS	1538170	1538209 0.37	-	2	transcript "87"
Adh	BLOCKS	CDS	1536504	1536609 2.8e-11	-	3	transcript "88"
Adh	BLOCKS	CDS	1536417	1536501 6.3e-07	-	3	transcript "88"
Adh	BLOCKS	CDS	1536238	1536277 0.059	-	2	transcript "88"
Adh	BLOCKS	CDS	1521146	1521254 6.5e-10	-	1	transcript "89"
Adh	BLOCKS	CDS	1521095	1521131 5.1e+03	-	1	transcript "89"
Adh	BLOCKS	CDS	1521026	1521074 9.2e+03	-	1	transcript "89"
Adh	BLOCKS	CDS	1520945	1520987 2.8e+04	-	1	transcript "89"
Adh	BLOCKS	CDS	1520792	1520879 19	-	1	transcript "89"
Adh	BLOCKS	CDS	1338421	1338568 4.1e-24	-	2	transcript "90"
Adh	BLOCKS	CDS	1337813	1337960 3e-06	-	1	transcript "90"
Adh	BLOCKS	CDS	1336616	1336763 0.078	-	1	transcript "90"
Adh	BLOCKS	CDS	1335964	1336117 2.1e-20	-	2	transcript "90"
Adh	BLOCKS	CDS	1335763	1335919 3.8e-16	-	2	transcript "90"
Adh	BLOCKS	CDS	1335508	1335634 3.7e-05	-	2	transcript "90"
Adh	BLOCKS	CDS	1335134	1335296 2e-18	-	1	transcript "90"
Adh	BLOCKS	CDS	1295112	1295274 1.1e-06	-	3	transcript "91"
Adh	BLOCKS	CDS	1294632	1294794 1.7e-08	-	3	transcript "91"
Adh	BLOCKS	CDS	1294362	1294518 0.00018	-	3	transcript "91"
Adh	BLOCKS	CDS	1057059	1057200 7.9e-25	-	3	transcript "92"
Adh	BLOCKS	CDS	1057056	1057086 6.4e+02	-	3	transcript "92"
Adh	BLOCKS	CDS	1056948	1056987 5.5	-	3	transcript "92"
Adh	BLOCKS	CDS	962178	962313  2e+03	-	3	transcript "93"
Adh	BLOCKS	CDS	962076	962175  0.00012	-	3	transcript "93"
Adh	BLOCKS	CDS	961875	961911  0.19	-	3	transcript "93"
Adh	BLOCKS	CDS	961704	961740  0.00017	-	3	transcript "93"
Adh	BLOCKS	CDS	918540	918576  6.5	-	3	transcript "94"
Adh	BLOCKS	CDS	918456	918525  0.0033	-	3	transcript "94"
Adh	BLOCKS	CDS	918258	918321  2.6e+03	-	3	transcript "95"
Adh	BLOCKS	CDS	918180	918249  0.0028	-	3	transcript "95"
Adh	BLOCKS	CDS	874654	874684  7.4e+03	-	2	transcript "96"
Adh	BLOCKS	CDS	873209	873287  0.13	-	1	transcript "96"
Adh	BLOCKS	CDS	872682	872817  8.8e-07	-	3	transcript "96"
Adh	BLOCKS	CDS	840204	840252  5.2e-05	-	3	transcript "97"
Adh	BLOCKS	CDS	839793	839862  2.8e-06	-	3	transcript "97"
Adh	BLOCKS	CDS	839733	839772  3.3e+02	-	3	transcript "97"
Adh	BLOCKS	CDS	658621	658648  27	-	2	transcript "98"
Adh	BLOCKS	CDS	657711	657825  1.1e+02	-	3	transcript "98"
Adh	BLOCKS	CDS	652592	652715  0.012	-	1	transcript "99"
Adh	BLOCKS	CDS	478733	478850  2.7e-05	-	1	transcript "100"
Adh	BLOCKS	CDS	478382	478460  0.025	-	1	transcript "100"
Adh	BLOCKS	CDS	478253	478301  0.00041	-	1	transcript "100"
Adh	BLOCKS	CDS	469445	469547  0.19	-	1	transcript "101"
Adh	BLOCKS	CDS	320350	320374  32	-	2	transcript "102"
Adh	BLOCKS	CDS	319008	319080  8.4e-08	-	3	transcript "102"
Adh	BLOCKS	CDS	318840	318882  14	-	3	transcript "102"
Adh	BLOCKS	CDS	318783	318822  0.0018	-	3	transcript "102"
Adh	BLOCKS	CDS	304925	305006  9.5e-09	-	1	transcript "103"
Adh	BLOCKS	CDS	304829	304883  77	-	1	transcript "103"
Adh	BLOCKS	CDS	304559	304694  9.8e-12	-	1	transcript "103"
Adh	BLOCKS	CDS	256506	256542  0.00017	-	3	transcript "104"
Adh	BLOCKS	CDS	134135	134174  1.2	-	1	transcript "105"
Adh	BLOCKS	CDS	134126	134165  0.039	-	1	transcript "105"
Adh	BLOCKS	CDS	133997	134036  15	-	1	transcript "105"
Adh	BLOCKS	CDS	94055	94091   3e-05	-	1	transcript "106"
Adh	BLOCKS	CDS	93884	93920   0.23	-	1	transcript "106"
Adh	BLOCKS	CDS	90153	90306   3.2e-07	-	3	transcript "107"
Adh	BLOCKS	CDS	90009	90144   1.6e-08	-	3	transcript "107"
Adh	BLOCKS	CDS	89724	89880   1.9e-13	-	3	transcript "107"
Adh	BLOCKS	CDS	18988	19048   2.1e-07	-	2	transcript "108"
Adh	BLOCKS	CDS	18790	18856   4.9e-14	-	2	transcript "108"
#   
# compfly: 1. replaced "AG_BIODV" with "CoreInspector" Oct 20 (MR)   
#  
# CoreInspector is a novel approach independent of IUPAC consensi,
# weight matrices, and neural networks.
# CoreInspector was developed by Scherf et.al. (GSF AG BIODV).
# Publication of CoreInspector is in preparation.
#
# Ranking: 3.0 (best), 2.0 (moderate), 1.0 (weak)
#
# GSF-Institute of Mammalian Genetics, AG BIODV
#
# CoreInspector
  
Adh     CoreInspector        TSS     12470   12471   1.0     -       . 
Adh     CoreInspector        TSS     107330  107331  1.0     -       . 
Adh     CoreInspector        TSS     159279  159280  2.0     -       . 
Adh     CoreInspector        TSS     276898  276899  2.0     -       . 
Adh     CoreInspector        TSS     399411  399412  3.0     +       . 
Adh     CoreInspector        TSS     462412  462413  2.0     +       . 
Adh     CoreInspector        TSS     463481  463482  3.0     +       . 
Adh     CoreInspector        TSS     533662  533663  2.0     -       . 
Adh     CoreInspector        TSS     605968  605969  2.0     +       . 
Adh     CoreInspector        TSS     605886  605887  2.0     -       . 
Adh     CoreInspector        TSS     1211064 1211065 1.0     -       . 
Adh     CoreInspector        TSS     1225185 1225186 1.0     +       . 
Adh     CoreInspector        TSS     1341361 1341362 1.0     -       . 
Adh     CoreInspector        TSS     1474452 1474453 3.0     +       . 
Adh     CoreInspector        TSS     1481455 1481456 3.0     +       . 
Adh     CoreInspector        TSS     1560585 1560586 2.0     -       . 
Adh     CoreInspector        TSS     1671141 1671142 1.0     +       . 
Adh     CoreInspector        TSS     1960734 1960735 1.0     +       . 
Adh     CoreInspector        TSS     1967890 1967891 2.0     +       . 
Adh     CoreInspector        TSS     2016780 2016781 1.0     -       . 
Adh     CoreInspector        TSS     2115365 2115366 2.0     +       . 
Adh     CoreInspector        TSS     2198638 2198639 2.0     -       . 
Adh     CoreInspector        TSS     2734095 2734096 1.0     +       . 
# 
# compfly: 1. replaced "MAGPIE" with "MAGPIEProm" Oct 20 (MR) 
#
Adh	MAGPIEProm	promotor	11811	11850	.	-	2	transcript "dm_001_MP_dna_1"	
Adh	MAGPIEProm	promotor	14503	14542	.	-	1	transcript "dm_001_GS_dna_2"	
Adh	MAGPIEProm	promotor	14565	14604	.	+	2	transcript "dm_001_GS_dna_3"	
Adh	MAGPIEProm	promotor	20446	20485	.	-	1	transcript "dm_001_GS_dna_4"	
Adh	MAGPIEProm	promotor	21475	21514	.	+	0	transcript "dm_001_GS_dna_5"	
Adh	MAGPIEProm	promotor	22440	22479	.	+	2	transcript "dm_001_GS_dna_6"	
Adh	MAGPIEProm	promotor	23662	23701	.	+	0	transcript "dm_001_GS_dna_7"	
Adh	MAGPIEProm	promotor	26522	26561	.	+	1	transcript "dm_001_GS_dna_8"	
Adh	MAGPIEProm	promotor	30944	30983	.	-	0	transcript "dm_001_GS_dna_9"	
Adh	MAGPIEProm	promotor	50976	51015	.	+	2	transcript "dm_002_MP_dna_2"	
Adh	MAGPIEProm	promotor	65857	65896	.	-	1	transcript "dm_002_GS_dna_3"	
Adh	MAGPIEProm	promotor	67561	67600	.	+	0	transcript "dm_002_GS_dna_4"	
Adh	MAGPIEProm	promotor	78643	78682	.	+	0	transcript "dm_002_GS_dna_5"	
Adh	MAGPIEProm	promotor	88780	88819	.	-	1	transcript "dm_002_GS_dna_6"	
Adh	MAGPIEProm	promotor	90986	91025	.	-	0	transcript "dm_002_GS_dna_7"	
Adh	MAGPIEProm	promotor	92375	92414	.	-	0	transcript "dm_003_GS_dna_1"	
Adh	MAGPIEProm	promotor	92784	92823	.	-	2	transcript "dm_002_GS_dna_8"	
Adh	MAGPIEProm	promotor	94786	94825	.	-	1	transcript "dm_003_GS_dna_2"	
Adh	MAGPIEProm	promotor	95927	95966	.	-	0	transcript "dm_003_GS_dna_3"	
Adh	MAGPIEProm	promotor	96076	96115	.	+	0	transcript "dm_003_GS_dna_4"	
Adh	MAGPIEProm	promotor	112496	112535	.	-	0	transcript "dm_003_GS_dna_5"	
Adh	MAGPIEProm	promotor	112588	112627	.	+	0	transcript "dm_003_GS_dna_6"	
Adh	MAGPIEProm	promotor	118030	118069	.	+	0	transcript "dm_003_GS_dna_7"	
Adh	MAGPIEProm	promotor	123697	123736	.	+	0	transcript "dm_003_MP_dna_8"	
Adh	MAGPIEProm	promotor	135290	135329	.	-	0	transcript "dm_003_GS_dna_9"	
Adh	MAGPIEProm	promotor	157266	157305	.	-	2	transcript "dm_004_GS_dna_1"	
Adh	MAGPIEProm	promotor	158506	158545	.	+	0	transcript "dm_004_GS_dna_2"	
Adh	MAGPIEProm	promotor	171036	171075	.	-	2	transcript "dm_004_GS_dna_3"	
Adh	MAGPIEProm	promotor	186857	186896	.	-	0	transcript "dm_005_GS_dna_1"	
Adh	MAGPIEProm	promotor	190776	190815	.	+	2	transcript "dm_005_GS_dna_2"	
Adh	MAGPIEProm	promotor	211350	211389	.	-	2	transcript "dm_005_GS_dna_3"	
Adh	MAGPIEProm	promotor	218833	218872	.	-	1	transcript "dm_005_GS_dna_4"	
Adh	MAGPIEProm	promotor	220064	220103	.	+	1	transcript "dm_005_GS_dna_5"	
Adh	MAGPIEProm	promotor	225295	225334	.	+	0	transcript "dm_005_GS_dna_6"	
Adh	MAGPIEProm	promotor	225295	225334	.	+	0	transcript "dm_006_GS_dna_1"	
Adh	MAGPIEProm	promotor	241635	241674	.	-	2	transcript "dm_006_GS_dna_2"	
Adh	MAGPIEProm	promotor	245669	245708	.	-	0	transcript "dm_006_GS_dna_3"	
Adh	MAGPIEProm	promotor	245802	245841	.	+	2	transcript "dm_006_GS_dna_4"	
Adh	MAGPIEProm	promotor	274679	274718	.	+	1	transcript "dm_007_MP_dna_2"	
Adh	MAGPIEProm	promotor	277255	277294	.	-	1	transcript "dm_007_GS_dna_3"	
Adh	MAGPIEProm	promotor	277442	277481	.	+	1	transcript "dm_007_GS_dna_4"	
Adh	MAGPIEProm	promotor	284461	284500	.	+	0	transcript "dm_007_GS_dna_5"	
Adh	MAGPIEProm	promotor	287170	287209	.	+	0	transcript "dm_007_GS_dna_6"	
Adh	MAGPIEProm	promotor	297532	297571	.	+	0	transcript "dm_007_GS_dna_7"	
Adh	MAGPIEProm	promotor	305287	305326	.	-	1	transcript "dm_007_GS_dna_8"	
Adh	MAGPIEProm	promotor	305332	305371	.	+	0	transcript "dm_007_GS_dna_9"	
Adh	MAGPIEProm	promotor	321562	321601	.	-	1	transcript "dm_008_MP_dna_2"	
Adh	MAGPIEProm	promotor	323489	323528	.	-	0	transcript "dm_008_MP_dna_3"	
Adh	MAGPIEProm	promotor	323573	323612	.	+	1	transcript "dm_008_MP_dna_4"	
Adh	MAGPIEProm	promotor	326907	326946	.	-	2	transcript "dm_008_MP_dna_5"	
Adh	MAGPIEProm	promotor	327035	327074	.	+	1	transcript "dm_008_MP_dna_6"	
Adh	MAGPIEProm	promotor	328843	328882	.	-	1	transcript "dm_008_GS_dna_7"	
Adh	MAGPIEProm	promotor	328976	329015	.	+	1	transcript "dm_008_GS_dna_8"	
Adh	MAGPIEProm	promotor	337635	337674	.	-	2	transcript "dm_008_GS_dna_9"	
Adh	MAGPIEProm	promotor	364995	365034	.	-	2	transcript "dm_009_GS_dna_1"	
Adh	MAGPIEProm	promotor	366368	366407	.	-	0	transcript "dm_009_GS_dna_2"	
Adh	MAGPIEProm	promotor	367184	367223	.	+	1	transcript "dm_009_GS_dna_3"	
Adh	MAGPIEProm	promotor	372861	372900	.	+	2	transcript "dm_009_GS_dna_4"	
Adh	MAGPIEProm	promotor	398124	398163	.	-	2	transcript "dm_009_GS_dna_5"	
Adh	MAGPIEProm	promotor	399364	399403	.	+	0	transcript "dm_009_MP_dna_6"	
Adh	MAGPIEProm	promotor	407910	407949	.	+	2	transcript "dm_009_GS_dna_7"	
Adh	MAGPIEProm	promotor	407910	407949	.	+	2	transcript "dm_010_GS_dna_2"	
Adh	MAGPIEProm	promotor	425167	425206	.	-	1	transcript "dm_010_GS_dna_3"	
Adh	MAGPIEProm	promotor	428436	428475	.	-	2	transcript "dm_010_GS_dna_4"	
Adh	MAGPIEProm	promotor	441218	441257	.	-	0	transcript "dm_010_GS_dna_5"	
Adh	MAGPIEProm	promotor	444780	444819	.	-	2	transcript "dm_010_GS_dna_6"	
Adh	MAGPIEProm	promotor	445121	445160	.	+	1	transcript "dm_010_GS_dna_7"	
Adh	MAGPIEProm	promotor	461061	461100	.	-	2	transcript "dm_011_GS_dna_2"	
Adh	MAGPIEProm	promotor	463722	463761	.	-	2	transcript "dm_011_GS_dna_3"	
Adh	MAGPIEProm	promotor	463905	463944	.	+	2	transcript "dm_011_GS_dna_4"	
Adh	MAGPIEProm	promotor	466833	466872	.	-	2	transcript "dm_011_GS_dna_5"	
Adh	MAGPIEProm	promotor	470118	470157	.	-	2	transcript "dm_011_GS_dna_6"	
Adh	MAGPIEProm	promotor	471017	471056	.	+	1	transcript "dm_011_GS_dna_7"	
Adh	MAGPIEProm	promotor	490400	490439	.	-	0	transcript "dm_011_GS_dna_8"	
Adh	MAGPIEProm	promotor	490755	490794	.	+	2	transcript "dm_011_GS_dna_9"	
Adh	MAGPIEProm	promotor	497580	497619	.	+	2	transcript "dm_012_GS_dna_2"	
Adh	MAGPIEProm	promotor	508872	508911	.	+	2	transcript "dm_012_GS_dna_3"	
Adh	MAGPIEProm	promotor	520350	520389	.	-	2	transcript "dm_012_GS_dna_4"	
Adh	MAGPIEProm	promotor	520720	520759	.	+	0	transcript "dm_012_GS_dna_5"	
Adh	MAGPIEProm	promotor	525872	525911	.	-	0	transcript "dm_012_GS_dna_6"	
Adh	MAGPIEProm	promotor	527182	527221	.	+	0	transcript "dm_012_GS_dna_7"	
Adh	MAGPIEProm	promotor	537914	537953	.	-	0	transcript "dm_012_GS_dna_8"	
Adh	MAGPIEProm	promotor	540109	540148	.	-	1	transcript "dm_012_GS_dna_9"	
Adh	MAGPIEProm	promotor	553125	553164	.	-	2	transcript "dm_013_GS_dna_2"	
Adh	MAGPIEProm	promotor	555221	555260	.	+	1	transcript "dm_013_GS_dna_3"	
Adh	MAGPIEProm	promotor	567525	567564	.	-	2	transcript "dm_013_GS_dna_4"	
Adh	MAGPIEProm	promotor	567891	567930	.	+	2	transcript "dm_013_GS_dna_5"	
Adh	MAGPIEProm	promotor	582565	582604	.	-	1	transcript "dm_013_GS_dna_6"	
Adh	MAGPIEProm	promotor	594652	594691	.	-	1	transcript "dm_014_GS_dna_2"	
Adh	MAGPIEProm	promotor	596223	596262	.	+	2	transcript "dm_014_GS_dna_3"	
Adh	MAGPIEProm	promotor	603345	603384	.	-	2	transcript "dm_014_GS_dna_4"	
Adh	MAGPIEProm	promotor	604512	604551	.	-	2	transcript "dm_014_GS_dna_5"	
Adh	MAGPIEProm	promotor	604553	604592	.	+	1	transcript "dm_014_GS_dna_6"	
Adh	MAGPIEProm	promotor	609055	609094	.	+	0	transcript "dm_014_GS_dna_7"	
Adh	MAGPIEProm	promotor	623251	623290	.	-	1	transcript "dm_014_GS_dna_8"	
Adh	MAGPIEProm	promotor	623588	623627	.	+	1	transcript "dm_014_GS_dna_9"	
Adh	MAGPIEProm	promotor	635592	635631	.	-	2	transcript "dm_015_GS_dna_1"	
Adh	MAGPIEProm	promotor	638576	638615	.	+	1	transcript "dm_015_GS_dna_2"	
Adh	MAGPIEProm	promotor	670753	670792	.	-	1	transcript "dm_015_GS_dna_3"	
Adh	MAGPIEProm	promotor	671105	671144	.	+	1	transcript "dm_015_GS_dna_4"	
Adh	MAGPIEProm	promotor	695136	695175	.	-	2	transcript "dm_016_GS_dna_2"	
Adh	MAGPIEProm	promotor	696259	696298	.	+	0	transcript "dm_016_GS_dna_3"	
Adh	MAGPIEProm	promotor	710055	710094	.	-	2	transcript "dm_016_GS_dna_4"	
Adh	MAGPIEProm	promotor	728598	728637	.	+	2	transcript "dm_017_GS_dna_2"	
Adh	MAGPIEProm	promotor	748142	748181	.	-	0	transcript "dm_017_GS_dna_3"	
Adh	MAGPIEProm	promotor	748260	748299	.	+	2	transcript "dm_017_GS_dna_4"	
Adh	MAGPIEProm	promotor	757360	757399	.	+	0	transcript "dm_017_GS_dna_5"	
Adh	MAGPIEProm	promotor	788466	788505	.	-	2	transcript "dm_018_GS_dna_2"	
Adh	MAGPIEProm	promotor	788613	788652	.	+	2	transcript "dm_018_GS_dna_3"	
Adh	MAGPIEProm	promotor	800772	800811	.	+	2	transcript "dm_018_GS_dna_4"	
Adh	MAGPIEProm	promotor	822027	822066	.	+	2	transcript "dm_019_GS_dna_2"	
Adh	MAGPIEProm	promotor	827707	827746	.	+	0	transcript "dm_019_GS_dna_3"	
Adh	MAGPIEProm	promotor	840424	840463	.	-	1	transcript "dm_019_GS_dna_4"	
Adh	MAGPIEProm	promotor	842815	842854	.	-	1	transcript "dm_019_GS_dna_5"	
Adh	MAGPIEProm	promotor	849659	849698	.	-	0	transcript "dm_019_GS_dna_6"	
Adh	MAGPIEProm	promotor	849758	849797	.	+	1	transcript "dm_019_MP_dna_7"	
Adh	MAGPIEProm	promotor	852480	852519	.	+	2	transcript "dm_019_GS_dna_8"	
Adh	MAGPIEProm	promotor	855323	855362	.	+	1	transcript "dm_019_GS_dna_9"	
Adh	MAGPIEProm	promotor	869815	869854	.	-	1	transcript "dm_020_GS_dna_2"	
Adh	MAGPIEProm	promotor	872057	872096	.	-	0	transcript "dm_020_GS_dna_3"	
Adh	MAGPIEProm	promotor	874904	874943	.	-	0	transcript "dm_020_MP_dna_4"	
Adh	MAGPIEProm	promotor	875143	875182	.	+	0	transcript "dm_020_GS_dna_5"	
Adh	MAGPIEProm	promotor	901658	901697	.	-	0	transcript "dm_020_GS_dna_6"	
Adh	MAGPIEProm	promotor	908811	908850	.	-	2	transcript "dm_021_GS_dna_1"	
Adh	MAGPIEProm	promotor	911080	911119	.	-	1	transcript "dm_021_GS_dna_2"	
Adh	MAGPIEProm	promotor	913861	913900	.	+	0	transcript "dm_021_GS_dna_3"	
Adh	MAGPIEProm	promotor	918940	918979	.	-	1	transcript "dm_021_GS_dna_4"	
Adh	MAGPIEProm	promotor	922035	922074	.	-	2	transcript "dm_021_GS_dna_5"	
Adh	MAGPIEProm	promotor	923467	923506	.	+	0	transcript "dm_021_GS_dna_6"	
Adh	MAGPIEProm	promotor	930796	930835	.	-	1	transcript "dm_021_GS_dna_7"	
Adh	MAGPIEProm	promotor	930876	930915	.	+	2	transcript "dm_021_GS_dna_8"	
Adh	MAGPIEProm	promotor	937190	937229	.	+	1	transcript "dm_021_GS_dna_9"	
Adh	MAGPIEProm	promotor	948459	948498	.	-	2	transcript "dm_022_GS_dna_1"	
Adh	MAGPIEProm	promotor	967376	967415	.	-	0	transcript "dm_022_MP_dna_2"	
Adh	MAGPIEProm	promotor	971165	971204	.	+	1	transcript "dm_022_GS_dna_3"	
Adh	MAGPIEProm	promotor	982483	982522	.	-	1	transcript "dm_022_GS_dna_4"	
Adh	MAGPIEProm	promotor	982880	982919	.	+	1	transcript "dm_022_MP_dna_5"	
Adh	MAGPIEProm	promotor	988533	988572	.	+	2	transcript "dm_022_GS_dna_6"	
Adh	MAGPIEProm	promotor	996883	996922	.	+	0	transcript "dm_023_GS_dna_2"	
Adh	MAGPIEProm	promotor	1004003	1004042	.	-	0	transcript "dm_023_GS_dna_3"	
Adh	MAGPIEProm	promotor	1004644	1004683	.	+	0	transcript "dm_023_GS_dna_4"	
Adh	MAGPIEProm	promotor	1011946	1011985	.	+	0	transcript "dm_023_GS_dna_5"	
Adh	MAGPIEProm	promotor	1018041	1018080	.	+	2	transcript "dm_023_GS_dna_6"	
Adh	MAGPIEProm	promotor	1035957	1035996	.	-	2	transcript "dm_023_GS_dna_7"	
Adh	MAGPIEProm	promotor	1035957	1035996	.	-	2	transcript "dm_024_GS_dna_1"	
Adh	MAGPIEProm	promotor	1042847	1042886	.	-	0	transcript "dm_024_GS_dna_2"	
Adh	MAGPIEProm	promotor	1043276	1043315	.	+	1	transcript "dm_024_GS_dna_3"	
Adh	MAGPIEProm	promotor	1048271	1048310	.	-	0	transcript "dm_024_GS_dna_4"	
Adh	MAGPIEProm	promotor	1050896	1050935	.	-	0	transcript "dm_024_GS_dna_5"	
Adh	MAGPIEProm	promotor	1057745	1057784	.	-	0	transcript "dm_024_GS_dna_6"	
Adh	MAGPIEProm	promotor	1057805	1057844	.	+	1	transcript "dm_024_GS_dna_7"	
Adh	MAGPIEProm	promotor	1068041	1068080	.	-	0	transcript "dm_024_GS_dna_8"	
Adh	MAGPIEProm	promotor	1068139	1068178	.	+	0	transcript "dm_024_GS_dna_9"	
Adh	MAGPIEProm	promotor	1080726	1080765	.	+	2	transcript "dm_025_GS_dna_2"	
Adh	MAGPIEProm	promotor	1107700	1107739	.	-	1	transcript "dm_025_MP_dna_3"	
Adh	MAGPIEProm	promotor	1109965	1110004	.	+	0	transcript "dm_025_MP_dna_4"	
Adh	MAGPIEProm	promotor	1114115	1114154	.	+	1	transcript "dm_025_GS_dna_5"	
Adh	MAGPIEProm	promotor	1119428	1119467	.	-	0	transcript "dm_025_GS_dna_6"	
Adh	MAGPIEProm	promotor	1119952	1119991	.	+	0	transcript "dm_025_GS_dna_7"	
Adh	MAGPIEProm	promotor	1129749	1129788	.	-	2	transcript "dm_026_GS_dna_2"	
Adh	MAGPIEProm	promotor	1136412	1136451	.	-	2	transcript "dm_026_GS_dna_3"	
Adh	MAGPIEProm	promotor	1144853	1144892	.	-	0	transcript "dm_026_MP_dna_4"	
Adh	MAGPIEProm	promotor	1146203	1146242	.	-	0	transcript "dm_026_GS_dna_5"	
Adh	MAGPIEProm	promotor	1149670	1149709	.	-	1	transcript "dm_026_GS_dna_6"	
Adh	MAGPIEProm	promotor	1152452	1152491	.	+	1	transcript "dm_026_GS_dna_7"	
Adh	MAGPIEProm	promotor	1156627	1156666	.	+	0	transcript "dm_026_GS_dna_8"	
Adh	MAGPIEProm	promotor	1183177	1183216	.	-	1	transcript "dm_027_GS_dna_2"	
Adh	MAGPIEProm	promotor	1184688	1184727	.	+	2	transcript "dm_027_GS_dna_3"	
Adh	MAGPIEProm	promotor	1197253	1197292	.	-	1	transcript "dm_027_GS_dna_4"	
Adh	MAGPIEProm	promotor	1198705	1198744	.	+	0	transcript "dm_027_GS_dna_5"	
Adh	MAGPIEProm	promotor	1204108	1204147	.	+	0	transcript "dm_027_GS_dna_6"	
Adh	MAGPIEProm	promotor	1207161	1207200	.	+	2	transcript "dm_027_GS_dna_7"	
Adh	MAGPIEProm	promotor	1226741	1226780	.	-	0	transcript "dm_028_GS_dna_1"	
Adh	MAGPIEProm	promotor	1227425	1227464	.	+	1	transcript "dm_028_GS_dna_2"	
Adh	MAGPIEProm	promotor	1231495	1231534	.	-	1	transcript "dm_028_GS_dna_3"	
Adh	MAGPIEProm	promotor	1232131	1232170	.	+	0	transcript "dm_028_GS_dna_4"	
Adh	MAGPIEProm	promotor	1234046	1234085	.	+	1	transcript "dm_028_GS_dna_5"	
Adh	MAGPIEProm	promotor	1238216	1238255	.	-	0	transcript "dm_028_GS_dna_6"	
Adh	MAGPIEProm	promotor	1241002	1241041	.	+	0	transcript "dm_028_GS_dna_7"	
Adh	MAGPIEProm	promotor	1252382	1252421	.	+	1	transcript "dm_028_GS_dna_8"	
Adh	MAGPIEProm	promotor	1254467	1254506	.	+	1	transcript "dm_028_GS_dna_9"	
Adh	MAGPIEProm	promotor	1269041	1269080	.	-	0	transcript "dm_029_GS_dna_2"	
Adh	MAGPIEProm	promotor	1276739	1276778	.	-	0	transcript "dm_029_GS_dna_3"	
Adh	MAGPIEProm	promotor	1277878	1277917	.	+	0	transcript "dm_029_GS_dna_4"	
Adh	MAGPIEProm	promotor	1279207	1279246	.	+	0	transcript "dm_029_GS_dna_5"	
Adh	MAGPIEProm	promotor	1286208	1286247	.	-	2	transcript "dm_029_GS_dna_6"	
Adh	MAGPIEProm	promotor	1286572	1286611	.	+	0	transcript "dm_029_GS_dna_7"	
Adh	MAGPIEProm	promotor	1291835	1291874	.	+	1	transcript "dm_029_GS_dna_8"	
Adh	MAGPIEProm	promotor	1300215	1300254	.	-	2	transcript "dm_029_MP_dna_9"	
Adh	MAGPIEProm	promotor	1323482	1323521	.	-	0	transcript "dm_030_GS_dna_2"	
Adh	MAGPIEProm	promotor	1323546	1323585	.	+	2	transcript "dm_030_GS_dna_3"	
Adh	MAGPIEProm	promotor	1334431	1334470	.	-	1	transcript "dm_030_GS_dna_4"	
Adh	MAGPIEProm	promotor	1340589	1340628	.	-	2	transcript "dm_030_GS_dna_5"	
Adh	MAGPIEProm	promotor	1363850	1363889	.	+	1	transcript "dm_031_GS_dna_2"	
Adh	MAGPIEProm	promotor	1370610	1370649	.	-	2	transcript "dm_031_MP_dna_3"	
Adh	MAGPIEProm	promotor	1385082	1385121	.	-	2	transcript "dm_031_MP_dna_4"	
Adh	MAGPIEProm	promotor	1386585	1386624	.	+	2	transcript "dm_031_GS_dna_5"	
Adh	MAGPIEProm	promotor	1414087	1414126	.	-	1	transcript "dm_032_GS_dna_1"	
Adh	MAGPIEProm	promotor	1414178	1414217	.	+	1	transcript "dm_032_GS_dna_2"	
Adh	MAGPIEProm	promotor	1432581	1432620	.	-	2	transcript "dm_032_GS_dna_3"	
Adh	MAGPIEProm	promotor	1432803	1432842	.	+	2	transcript "dm_032_GS_dna_4"	
Adh	MAGPIEProm	promotor	1454082	1454121	.	-	2	transcript "dm_033_GS_dna_2"	
Adh	MAGPIEProm	promotor	1454587	1454626	.	+	0	transcript "dm_033_GS_dna_3"	
Adh	MAGPIEProm	promotor	1468812	1468851	.	-	2	transcript "dm_033_GS_dna_4"	
Adh	MAGPIEProm	promotor	1474057	1474096	.	-	1	transcript "dm_033_GS_dna_5"	
Adh	MAGPIEProm	promotor	1474397	1474436	.	+	1	transcript "dm_033_GS_dna_6"	
Adh	MAGPIEProm	promotor	1480353	1480392	.	+	2	transcript "dm_033_GS_dna_7"	
Adh	MAGPIEProm	promotor	1481400	1481439	.	+	2	transcript "dm_033_GS_dna_8"	
Adh	MAGPIEProm	promotor	1490707	1490746	.	+	0	transcript "dm_034_GS_dna_2"	
Adh	MAGPIEProm	promotor	1497344	1497383	.	-	0	transcript "dm_034_GS_dna_3"	
Adh	MAGPIEProm	promotor	1497394	1497433	.	+	0	transcript "dm_034_GS_dna_4"	
Adh	MAGPIEProm	promotor	1499389	1499428	.	-	1	transcript "dm_034_GS_dna_5"	
Adh	MAGPIEProm	promotor	1499556	1499595	.	+	2	transcript "dm_034_MP_dna_6"	
Adh	MAGPIEProm	promotor	1528714	1528753	.	-	1	transcript "dm_034_GS_dna_7"	
Adh	MAGPIEProm	promotor	1529034	1529073	.	+	2	transcript "dm_034_MP_dna_8"	
Adh	MAGPIEProm	promotor	1545110	1545149	.	-	0	transcript "dm_035_GS_dna_2"	
Adh	MAGPIEProm	promotor	1546524	1546563	.	+	2	transcript "dm_035_GS_dna_3"	
Adh	MAGPIEProm	promotor	1550435	1550474	.	-	0	transcript "dm_035_MP_dna_4"	
Adh	MAGPIEProm	promotor	1557459	1557498	.	-	2	transcript "dm_035_GS_dna_5"	
Adh	MAGPIEProm	promotor	1557916	1557955	.	+	0	transcript "dm_035_MP_dna_6"	
Adh	MAGPIEProm	promotor	1565240	1565279	.	+	1	transcript "dm_035_GS_dna_7"	
Adh	MAGPIEProm	promotor	1590997	1591036	.	-	1	transcript "dm_036_GS_dna_2"	
Adh	MAGPIEProm	promotor	1598347	1598386	.	-	1	transcript "dm_036_GS_dna_3"	
Adh	MAGPIEProm	promotor	1598695	1598734	.	+	0	transcript "dm_036_MP_dna_4"	
Adh	MAGPIEProm	promotor	1624222	1624261	.	+	0	transcript "dm_037_GS_dna_2"	
Adh	MAGPIEProm	promotor	1631142	1631181	.	-	2	transcript "dm_037_GS_dna_3"	
Adh	MAGPIEProm	promotor	1642210	1642249	.	-	1	transcript "dm_037_GS_dna_4"	
Adh	MAGPIEProm	promotor	1650073	1650112	.	-	1	transcript "dm_037_GS_dna_5"	
Adh	MAGPIEProm	promotor	1650151	1650190	.	+	0	transcript "dm_037_GS_dna_6"	
Adh	MAGPIEProm	promotor	1670821	1670860	.	-	1	transcript "dm_038_GS_dna_1"	
Adh	MAGPIEProm	promotor	1679718	1679757	.	-	2	transcript "dm_038_GS_dna_2"	
Adh	MAGPIEProm	promotor	1681051	1681090	.	+	0	transcript "dm_038_GS_dna_3"	
Adh	MAGPIEProm	promotor	1699791	1699830	.	+	2	transcript "dm_038_GS_dna_4"	
Adh	MAGPIEProm	promotor	1706383	1706422	.	-	1	transcript "dm_038_GS_dna_5"	
Adh	MAGPIEProm	promotor	1706896	1706935	.	+	0	transcript "dm_038_GS_dna_6"	
Adh	MAGPIEProm	promotor	1720414	1720453	.	-	1	transcript "dm_039_GS_dna_2"	
Adh	MAGPIEProm	promotor	1721442	1721481	.	+	2	transcript "dm_039_GS_dna_3"	
Adh	MAGPIEProm	promotor	1737612	1737651	.	-	2	transcript "dm_039_GS_dna_4"	
Adh	MAGPIEProm	promotor	1737762	1737801	.	+	2	transcript "dm_039_GS_dna_5"	
Adh	MAGPIEProm	promotor	1746136	1746175	.	-	1	transcript "dm_039_GS_dna_6"	
Adh	MAGPIEProm	promotor	1746222	1746261	.	+	2	transcript "dm_039_GS_dna_7"	
Adh	MAGPIEProm	promotor	1754705	1754744	.	-	0	transcript "dm_039_GS_dna_8"	
Adh	MAGPIEProm	promotor	1763769	1763808	.	-	2	transcript "dm_040_GS_dna_1"	
Adh	MAGPIEProm	promotor	1764537	1764576	.	-	2	transcript "dm_040_GS_dna_2"	
Adh	MAGPIEProm	promotor	1764655	1764694	.	+	0	transcript "dm_040_GS_dna_3"	
Adh	MAGPIEProm	promotor	1774619	1774658	.	+	1	transcript "dm_040_GS_dna_4"	
Adh	MAGPIEProm	promotor	1776471	1776510	.	+	2	transcript "dm_040_GS_dna_5"	
Adh	MAGPIEProm	promotor	1780104	1780143	.	-	2	transcript "dm_040_GS_dna_6"	
Adh	MAGPIEProm	promotor	1781921	1781960	.	-	0	transcript "dm_040_GS_dna_7"	
Adh	MAGPIEProm	promotor	1786523	1786562	.	-	0	transcript "dm_040_GS_dna_8"	
Adh	MAGPIEProm	promotor	1787164	1787203	.	+	0	transcript "dm_040_GS_dna_9"	
Adh	MAGPIEProm	promotor	1804395	1804434	.	-	2	transcript "dm_041_GS_dna_2"	
Adh	MAGPIEProm	promotor	1810093	1810132	.	-	1	transcript "dm_041_GS_dna_3"	
Adh	MAGPIEProm	promotor	1811655	1811694	.	-	2	transcript "dm_041_GS_dna_4"	
Adh	MAGPIEProm	promotor	1811757	1811796	.	+	2	transcript "dm_041_GS_dna_5"	
Adh	MAGPIEProm	promotor	1823482	1823521	.	+	0	transcript "dm_041_MP_dna_6"	
Adh	MAGPIEProm	promotor	1827673	1827712	.	+	0	transcript "dm_041_GS_dna_7"	
Adh	MAGPIEProm	promotor	1835019	1835058	.	-	2	transcript "dm_041_GS_dna_8"	
Adh	MAGPIEProm	promotor	1838172	1838211	.	-	2	transcript "dm_041_GS_dna_9"	
Adh	MAGPIEProm	promotor	1850225	1850264	.	-	0	transcript "dm_042_GS_dna_2"	
Adh	MAGPIEProm	promotor	1857886	1857925	.	-	1	transcript "dm_042_GS_dna_3"	
Adh	MAGPIEProm	promotor	1864385	1864424	.	-	0	transcript "dm_042_GS_dna_4"	
Adh	MAGPIEProm	promotor	1864840	1864879	.	+	0	transcript "dm_042_GS_dna_5"	
Adh	MAGPIEProm	promotor	1867779	1867818	.	+	2	transcript "dm_042_GS_dna_6"	
Adh	MAGPIEProm	promotor	1896299	1896338	.	-	0	transcript "dm_043_GS_dna_1"	
Adh	MAGPIEProm	promotor	1897044	1897083	.	+	2	transcript "dm_043_GS_dna_2"	
Adh	MAGPIEProm	promotor	1900406	1900445	.	+	1	transcript "dm_043_GS_dna_3"	
Adh	MAGPIEProm	promotor	1906830	1906869	.	+	2	transcript "dm_043_GS_dna_4"	
Adh	MAGPIEProm	promotor	1915224	1915263	.	-	2	transcript "dm_043_GS_dna_5"	
Adh	MAGPIEProm	promotor	1916161	1916200	.	+	0	transcript "dm_043_GS_dna_6"	
Adh	MAGPIEProm	promotor	1917288	1917327	.	+	2	transcript "dm_043_GS_dna_7"	
Adh	MAGPIEProm	promotor	1919828	1919867	.	-	0	transcript "dm_043_GS_dna_8"	
Adh	MAGPIEProm	promotor	1921657	1921696	.	-	1	transcript "dm_043_GS_dna_9"	
Adh	MAGPIEProm	promotor	1935849	1935888	.	+	2	transcript "dm_044_GS_dna_2"	
Adh	MAGPIEProm	promotor	1959897	1959936	.	-	2	transcript "dm_044_GS_dna_3"	
Adh	MAGPIEProm	promotor	1962428	1962467	.	+	1	transcript "dm_044_GS_dna_4"	
Adh	MAGPIEProm	promotor	1967902	1967941	.	-	1	transcript "dm_044_MP_dna_5"	
Adh	MAGPIEProm	promotor	1970375	1970414	.	+	1	transcript "dm_044_GS_dna_6"	
Adh	MAGPIEProm	promotor	1971419	1971458	.	+	1	transcript "dm_044_GS_dna_7"	
Adh	MAGPIEProm	promotor	1984370	1984409	.	+	1	transcript "dm_045_GS_dna_2"	
Adh	MAGPIEProm	promotor	1986387	1986426	.	+	2	transcript "dm_045_GS_dna_3"	
Adh	MAGPIEProm	promotor	1988342	1988381	.	+	1	transcript "dm_045_GS_dna_4"	
Adh	MAGPIEProm	promotor	1994641	1994680	.	+	0	transcript "dm_045_GS_dna_5"	
Adh	MAGPIEProm	promotor	2010379	2010418	.	-	1	transcript "dm_045_GS_dna_6"	
Adh	MAGPIEProm	promotor	2010769	2010808	.	+	0	transcript "dm_045_GS_dna_7"	
Adh	MAGPIEProm	promotor	2033560	2033599	.	+	0	transcript "dm_046_GS_dna_2"	
Adh	MAGPIEProm	promotor	2038194	2038233	.	+	2	transcript "dm_046_GS_dna_3"	
Adh	MAGPIEProm	promotor	2039648	2039687	.	+	1	transcript "dm_046_GS_dna_4"	
Adh	MAGPIEProm	promotor	2055068	2055107	.	+	1	transcript "dm_046_GS_dna_5"	
Adh	MAGPIEProm	promotor	2063954	2063993	.	-	0	transcript "dm_046_GS_dna_6"	
Adh	MAGPIEProm	promotor	2067389	2067428	.	+	1	transcript "dm_046_GS_dna_7"	
Adh	MAGPIEProm	promotor	2074561	2074600	.	+	0	transcript "dm_046_GS_dna_8"	
Adh	MAGPIEProm	promotor	2074561	2074600	.	+	0	transcript "dm_047_GS_dna_2"	
Adh	MAGPIEProm	promotor	2076107	2076146	.	+	1	transcript "dm_047_MP_dna_3"	
Adh	MAGPIEProm	promotor	2097553	2097592	.	-	1	transcript "dm_047_GS_dna_4"	
Adh	MAGPIEProm	promotor	2101612	2101651	.	-	1	transcript "dm_047_GS_dna_5"	
Adh	MAGPIEProm	promotor	2104494	2104533	.	-	2	transcript "dm_047_GS_dna_6"	
Adh	MAGPIEProm	promotor	2106289	2106328	.	-	1	transcript "dm_047_GS_dna_7"	
Adh	MAGPIEProm	promotor	2106605	2106644	.	+	1	transcript "dm_047_GS_dna_8"	
Adh	MAGPIEProm	promotor	2113224	2113263	.	-	2	transcript "dm_047_GS_dna_9"	
Adh	MAGPIEProm	promotor	2119187	2119226	.	+	1	transcript "dm_048_GS_dna_2"	
Adh	MAGPIEProm	promotor	2125416	2125455	.	+	2	transcript "dm_048_GS_dna_3"	
Adh	MAGPIEProm	promotor	2136317	2136356	.	-	0	transcript "dm_048_GS_dna_4"	
Adh	MAGPIEProm	promotor	2147018	2147057	.	-	0	transcript "dm_048_GS_dna_5"	
Adh	MAGPIEProm	promotor	2148210	2148249	.	+	2	transcript "dm_048_GS_dna_6"	
Adh	MAGPIEProm	promotor	2153180	2153219	.	-	0	transcript "dm_048_GS_dna_7"	
Adh	MAGPIEProm	promotor	2153627	2153666	.	+	1	transcript "dm_048_GS_dna_8"	
Adh	MAGPIEProm	promotor	2158180	2158219	.	+	0	transcript "dm_048_GS_dna_9"	
Adh	MAGPIEProm	promotor	2164379	2164418	.	-	0	transcript "dm_049_GS_dna_2"	
Adh	MAGPIEProm	promotor	2164506	2164545	.	+	2	transcript "dm_049_GS_dna_3"	
Adh	MAGPIEProm	promotor	2173017	2173056	.	+	2	transcript "dm_049_GS_dna_4"	
Adh	MAGPIEProm	promotor	2183307	2183346	.	-	2	transcript "dm_049_MP_dna_5"	
Adh	MAGPIEProm	promotor	2184571	2184610	.	-	1	transcript "dm_049_GS_dna_6"	
Adh	MAGPIEProm	promotor	2184707	2184746	.	+	1	transcript "dm_049_GS_dna_7"	
Adh	MAGPIEProm	promotor	2189223	2189262	.	+	2	transcript "dm_049_GS_dna_8"	
Adh	MAGPIEProm	promotor	2200681	2200720	.	-	1	transcript "dm_049_GS_dna_9"	
Adh	MAGPIEProm	promotor	2213220	2213259	.	-	2	transcript "dm_050_MP_dna_2"	
Adh	MAGPIEProm	promotor	2213266	2213305	.	+	0	transcript "dm_050_GS_dna_3"	
Adh	MAGPIEProm	promotor	2216151	2216190	.	+	2	transcript "dm_050_GS_dna_4"	
Adh	MAGPIEProm	promotor	2220392	2220431	.	-	0	transcript "dm_050_GS_dna_5"	
Adh	MAGPIEProm	promotor	2232714	2232753	.	-	2	transcript "dm_050_GS_dna_6"	
Adh	MAGPIEProm	promotor	2235147	2235186	.	+	2	transcript "dm_050_GS_dna_7"	
Adh	MAGPIEProm	promotor	2246899	2246938	.	-	1	transcript "dm_050_GS_dna_8"	
Adh	MAGPIEProm	promotor	2262245	2262284	.	-	0	transcript "dm_051_GS_dna_2"	
Adh	MAGPIEProm	promotor	2264081	2264120	.	-	0	transcript "dm_051_GS_dna_3"	
Adh	MAGPIEProm	promotor	2265832	2265871	.	+	0	transcript "dm_051_GS_dna_4"	
Adh	MAGPIEProm	promotor	2275552	2275591	.	+	0	transcript "dm_051_GS_dna_5"	
Adh	MAGPIEProm	promotor	2281175	2281214	.	+	1	transcript "dm_051_GS_dna_6"	
Adh	MAGPIEProm	promotor	2288934	2288973	.	-	2	transcript "dm_051_GS_dna_7"	
Adh	MAGPIEProm	promotor	2292529	2292568	.	+	0	transcript "dm_051_GS_dna_8"	
Adh	MAGPIEProm	promotor	2302054	2302093	.	-	1	transcript "dm_052_GS_dna_2"	
Adh	MAGPIEProm	promotor	2302430	2302469	.	+	1	transcript "dm_052_GS_dna_3"	
Adh	MAGPIEProm	promotor	2303377	2303416	.	+	0	transcript "dm_052_GS_dna_4"	
Adh	MAGPIEProm	promotor	2304800	2304839	.	+	1	transcript "dm_052_GS_dna_5"	
Adh	MAGPIEProm	promotor	2307131	2307170	.	+	1	transcript "dm_052_GS_dna_6"	
Adh	MAGPIEProm	promotor	2313856	2313895	.	+	0	transcript "dm_052_GS_dna_7"	
Adh	MAGPIEProm	promotor	2316130	2316169	.	-	1	transcript "dm_052_GS_dna_8"	
Adh	MAGPIEProm	promotor	2316718	2316757	.	+	0	transcript "dm_052_GS_dna_9"	
Adh	MAGPIEProm	promotor	2345549	2345588	.	-	0	transcript "dm_053_GS_dna_1"	
Adh	MAGPIEProm	promotor	2345662	2345701	.	+	0	transcript "dm_053_GS_dna_2"	
Adh	MAGPIEProm	promotor	2353078	2353117	.	-	1	transcript "dm_053_GS_dna_3"	
Adh	MAGPIEProm	promotor	2353190	2353229	.	+	1	transcript "dm_053_GS_dna_4"	
Adh	MAGPIEProm	promotor	2363885	2363924	.	-	0	transcript "dm_053_GS_dna_5"	
Adh	MAGPIEProm	promotor	2364053	2364092	.	+	1	transcript "dm_053_GS_dna_6"	
Adh	MAGPIEProm	promotor	2366506	2366545	.	-	1	transcript "dm_053_GS_dna_7"	
Adh	MAGPIEProm	promotor	2371243	2371282	.	-	1	transcript "dm_053_GS_dna_8"	
Adh	MAGPIEProm	promotor	2372257	2372296	.	+	0	transcript "dm_053_GS_dna_9"	
Adh	MAGPIEProm	promotor	2396443	2396482	.	+	0	transcript "dm_054_GS_dna_2"	
Adh	MAGPIEProm	promotor	2415607	2415646	.	-	1	transcript "dm_054_GS_dna_3"	
Adh	MAGPIEProm	promotor	2415661	2415700	.	+	0	transcript "dm_054_GS_dna_4"	
Adh	MAGPIEProm	promotor	2427763	2427802	.	-	1	transcript "dm_054_GS_dna_5"	
Adh	MAGPIEProm	promotor	2428068	2428107	.	+	2	transcript "dm_054_GS_dna_6"	
Adh	MAGPIEProm	promotor	2443185	2443224	.	+	2	transcript "dm_055_GS_dna_2"	
Adh	MAGPIEProm	promotor	2453050	2453089	.	+	0	transcript "dm_055_GS_dna_3"	
Adh	MAGPIEProm	promotor	2463937	2463976	.	+	0	transcript "dm_055_GS_dna_4"	
Adh	MAGPIEProm	promotor	2479920	2479959	.	-	2	transcript "dm_056_GS_dna_2"	
Adh	MAGPIEProm	promotor	2480169	2480208	.	+	2	transcript "dm_056_GS_dna_3"	
Adh	MAGPIEProm	promotor	2492812	2492851	.	-	1	transcript "dm_056_GS_dna_4"	
Adh	MAGPIEProm	promotor	2492936	2492975	.	+	1	transcript "dm_056_MP_dna_5"	
Adh	MAGPIEProm	promotor	2501295	2501334	.	+	2	transcript "dm_056_GS_dna_6"	
Adh	MAGPIEProm	promotor	2517159	2517198	.	-	2	transcript "dm_056_GS_dna_7"	
Adh	MAGPIEProm	promotor	2523516	2523555	.	-	2	transcript "dm_057_GS_dna_1"	
Adh	MAGPIEProm	promotor	2523873	2523912	.	+	2	transcript "dm_057_MP_dna_2"	
Adh	MAGPIEProm	promotor	2543278	2543317	.	-	1	transcript "dm_057_GS_dna_3"	
Adh	MAGPIEProm	promotor	2543923	2543962	.	+	0	transcript "dm_057_GS_dna_4"	
Adh	MAGPIEProm	promotor	2546181	2546220	.	+	2	transcript "dm_057_GS_dna_5"	
Adh	MAGPIEProm	promotor	2568299	2568338	.	+	1	transcript "dm_058_GS_dna_2"	
Adh	MAGPIEProm	promotor	2582426	2582465	.	-	0	transcript "dm_058_GS_dna_3"	
Adh	MAGPIEProm	promotor	2582799	2582838	.	+	2	transcript "dm_058_GS_dna_4"	
Adh	MAGPIEProm	promotor	2588161	2588200	.	-	1	transcript "dm_058_GS_dna_5"	
Adh	MAGPIEProm	promotor	2589999	2590038	.	+	2	transcript "dm_058_MP_dna_6"	
Adh	MAGPIEProm	promotor	2599885	2599924	.	-	1	transcript "dm_058_GS_dna_7"	
Adh	MAGPIEProm	promotor	2600568	2600607	.	+	2	transcript "dm_058_GS_dna_8"	
Adh	MAGPIEProm	promotor	2637609	2637648	.	+	2	transcript "dm_059_GS_dna_2"	
Adh	MAGPIEProm	promotor	2644081	2644120	.	-	1	transcript "dm_059_GS_dna_3"	
Adh	MAGPIEProm	promotor	2656802	2656841	.	+	1	transcript "dm_060_GS_dna_2"	
Adh	MAGPIEProm	promotor	2672523	2672562	.	-	2	transcript "dm_060_GS_dna_3"	
Adh	MAGPIEProm	promotor	2674769	2674808	.	-	0	transcript "dm_060_GS_dna_4"	
Adh	MAGPIEProm	promotor	2680862	2680901	.	-	0	transcript "dm_060_GS_dna_5"	
Adh	MAGPIEProm	promotor	2683213	2683252	.	+	0	transcript "dm_060_GS_dna_6"	
Adh	MAGPIEProm	promotor	2698919	2698958	.	-	0	transcript "dm_060_MP_dna_7"	
Adh	MAGPIEProm	promotor	2700066	2700105	.	+	2	transcript "dm_060_GS_dna_8"	
Adh	MAGPIEProm	promotor	2710767	2710806	.	-	2	transcript "dm_061_MP_dna_2"	
Adh	MAGPIEProm	promotor	2711302	2711341	.	+	0	transcript "dm_061_GS_dna_3"	
Adh	MAGPIEProm	promotor	2731112	2731151	.	-	0	transcript "dm_061_GS_dna_4"	
Adh	MAGPIEProm	promotor	2731174	2731213	.	+	0	transcript "dm_061_GS_dna_5"	
Adh	MAGPIEProm	promotor	2734631	2734670	.	+	1	transcript "dm_061_GS_dna_6"	
Adh	MAGPIEProm	promotor	2737256	2737295	.	+	1	transcript "dm_061_GS_dna_7"	
Adh	MAGPIEProm	promotor	2740490	2740529	.	+	1	transcript "dm_061_GS_dna_8"	
Adh	MAGPIEProm	promotor	2741971	2742010	.	-	1	transcript "dm_061_GS_dna_9"	
Adh	MAGPIEProm	promotor	2749384	2749423	.	-	1	transcript "dm_062_GS_dna_1"	
Adh	MAGPIEProm	promotor	2749548	2749587	.	+	2	transcript "dm_062_GS_dna_2"	
Adh	MAGPIEProm	promotor	2752111	2752150	.	-	1	transcript "dm_062_GS_dna_3"	
Adh	MAGPIEProm	promotor	2752403	2752442	.	+	1	transcript "dm_062_GS_dna_4"	
Adh	MAGPIEProm	promotor	2756096	2756135	.	-	0	transcript "dm_062_GS_dna_5"	
Adh	MAGPIEProm	promotor	2756207	2756246	.	+	1	transcript "dm_062_MP_dna_6"	
Adh	MAGPIEProm	promotor	2759260	2759299	.	+	0	transcript "dm_062_MP_dna_7"	
Adh	MAGPIEProm	promotor	2774767	2774806	.	-	1	transcript "dm_062_MP_dna_8"	
Adh	MAGPIEProm	promotor	2775824	2775863	.	+	1	transcript "dm_062_GS_dna_9"	
Adh	MAGPIEProm	promotor	2792871	2792910	.	-	2	transcript "dm_063_GS_dna_1"	
Adh	MAGPIEProm	promotor	2800161	2800200	.	-	2	transcript "dm_063_GS_dna_2"	
Adh	MAGPIEProm	promotor	2800514	2800553	.	+	1	transcript "dm_063_GS_dna_3"	
Adh	MAGPIEProm	promotor	2807721	2807760	.	-	2	transcript "dm_063_GS_dna_4"	
Adh	MAGPIEProm	promotor	2815129	2815168	.	+	0	transcript "dm_063_GS_dna_5"	
Adh	MAGPIEProm	promotor	2826941	2826980	.	-	0	transcript "dm_063_GS_dna_6"	
Adh	MAGPIEProm	promotor	2846179	2846218	.	-	1	transcript "dm_064_GS_dna_2"	
Adh	MAGPIEProm	promotor	2847886	2847925	.	+	0	transcript "dm_064_GS_dna_3"	
Adh	MAGPIEProm	promotor	2857146	2857185	.	-	2	transcript "dm_064_GS_dna_4"	
Adh	MAGPIEProm	promotor	2862524	2862563	.	-	0	transcript "dm_064_GS_dna_5"	
Adh	MAGPIEProm	promotor	2862840	2862879	.	+	2	transcript "dm_064_GS_dna_6"	
Adh	MAGPIEProm	promotor	2869573	2869612	.	+	0	transcript "dm_064_GS_dna_7"	
Adh	MAGPIEProm	promotor	2880210	2880249	.	+	2	transcript "dm_064_GS_dna_8"	
Adh	MAGPIEProm	promotor	2881930	2881969	.	+	0	transcript "dm_064_GS_dna_9"	
Adh	MAGPIEProm	promotor	2881930	2881969	.	+	0	transcript "dm_065_GS_dna_2"	
Adh	MAGPIEProm	promotor	2889961	2890000	.	-	1	transcript "dm_065_GS_dna_3"	
Adh	MAGPIEProm	promotor	2894049	2894088	.	-	2	transcript "dm_065_GS_dna_4"	
Adh	MAGPIEProm	promotor	2894329	2894368	.	+	0	transcript "dm_065_MP_dna_5"	
Adh	MAGPIEProm	promotor	2896265	2896304	.	+	1	transcript "dm_065_MP_dna_6"	
Adh	MAGPIEProm	promotor	2899795	2899834	.	+	0	transcript "dm_065_MP_dna_7"	
Adh	MAGPIEProm	promotor	2905800	2905839	.	+	2	transcript "dm_065_GS_dna_8"	
Adh	MAGPIEProm	promotor	2909912	2909951	.	+	1	transcript "dm_065_GS_dna_9"	
# 
# compfly: 1. replaced "LME-IMC" with "LMEIMC" Dec 14 (MR)
#          2. replaced "Adh_anc_cact.1" with "Adh" Dec 14 (MR)
#
Adh	LMEIMC	TSS	2510	2511	-0.011028	+	.
Adh	LMEIMC	TSS	3640	3641	-0.020338	+	.
Adh	LMEIMC	TSS	5470	5471	-0.019631	+	.
Adh	LMEIMC	TSS	7390	7391	-0.027064	+	.
Adh	LMEIMC	TSS	8430	8431	-0.014424	+	.
Adh	LMEIMC	TSS	11080	11081	-0.011292	+	.
Adh	LMEIMC	TSS	12660	12661	-0.009864	+	.
Adh	LMEIMC	TSS	13700	13701	-0.010333	+	.
Adh	LMEIMC	TSS	15310	15311	-0.013203	+	.
Adh	LMEIMC	TSS	15750	15751	-0.011292	+	.
Adh	LMEIMC	TSS	23950	23951	-0.012779	+	.
Adh	LMEIMC	TSS	26620	26621	-0.010393	+	.
Adh	LMEIMC	TSS	32610	32611	-0.017978	+	.
Adh	LMEIMC	TSS	34430	34431	-0.011441	+	.
Adh	LMEIMC	TSS	35600	35601	-0.010504	+	.
Adh	LMEIMC	TSS	38880	38881	-0.009481	+	.
Adh	LMEIMC	TSS	40990	40991	-0.009078	+	.
Adh	LMEIMC	TSS	41550	41551	-0.012075	+	.
Adh	LMEIMC	TSS	42480	42481	-0.013165	+	.
Adh	LMEIMC	TSS	43160	43161	-0.016890	+	.
Adh	LMEIMC	TSS	44300	44301	-0.010849	+	.
Adh	LMEIMC	TSS	45510	45511	-0.009208	+	.
Adh	LMEIMC	TSS	46950	46951	-0.010005	+	.
Adh	LMEIMC	TSS	48600	48601	-0.014570	+	.
Adh	LMEIMC	TSS	53730	53731	-0.010020	+	.
Adh	LMEIMC	TSS	54510	54511	-0.013243	+	.
Adh	LMEIMC	TSS	56850	56851	-0.010770	+	.
Adh	LMEIMC	TSS	64600	64601	-0.009535	+	.
Adh	LMEIMC	TSS	68290	68291	-0.013546	+	.
Adh	LMEIMC	TSS	72100	72101	-0.009729	+	.
Adh	LMEIMC	TSS	74470	74471	-0.009248	+	.
Adh	LMEIMC	TSS	78330	78331	-0.013090	+	.
Adh	LMEIMC	TSS	82630	82631	-0.010150	+	.
Adh	LMEIMC	TSS	83280	83281	-0.013135	+	.
Adh	LMEIMC	TSS	88710	88711	-0.011917	+	.
Adh	LMEIMC	TSS	91450	91451	-0.010722	+	.
Adh	LMEIMC	TSS	102990	102991	-0.010237	+	.
Adh	LMEIMC	TSS	104420	104421	-0.017985	+	.
Adh	LMEIMC	TSS	105490	105491	-0.013528	+	.
Adh	LMEIMC	TSS	108880	108881	-0.012357	+	.
Adh	LMEIMC	TSS	109460	109461	-0.015093	+	.
Adh	LMEIMC	TSS	110910	110911	-0.016375	+	.
Adh	LMEIMC	TSS	112070	112071	-0.013410	+	.
Adh	LMEIMC	TSS	113660	113661	-0.009210	+	.
Adh	LMEIMC	TSS	117360	117361	-0.009203	+	.
Adh	LMEIMC	TSS	119030	119031	-0.012994	+	.
Adh	LMEIMC	TSS	122980	122981	-0.010937	+	.
Adh	LMEIMC	TSS	123340	123341	-0.015556	+	.
Adh	LMEIMC	TSS	130050	130051	-0.011926	+	.
Adh	LMEIMC	TSS	130560	130561	-0.017094	+	.
Adh	LMEIMC	TSS	131160	131161	-0.022693	+	.
Adh	LMEIMC	TSS	131390	131391	-0.009468	+	.
Adh	LMEIMC	TSS	141250	141251	-0.010238	+	.
Adh	LMEIMC	TSS	141640	141641	-0.011029	+	.
Adh	LMEIMC	TSS	144090	144091	-0.010697	+	.
Adh	LMEIMC	TSS	144320	144321	-0.012554	+	.
Adh	LMEIMC	TSS	147210	147211	-0.014168	+	.
Adh	LMEIMC	TSS	149600	149601	-0.012731	+	.
Adh	LMEIMC	TSS	150300	150301	-0.010238	+	.
Adh	LMEIMC	TSS	150690	150691	-0.011029	+	.
Adh	LMEIMC	TSS	153100	153101	-0.011835	+	.
Adh	LMEIMC	TSS	153300	153301	-0.012900	+	.
Adh	LMEIMC	TSS	156190	156191	-0.016209	+	.
Adh	LMEIMC	TSS	158650	158651	-0.011278	+	.
Adh	LMEIMC	TSS	159260	159261	-0.011270	+	.
Adh	LMEIMC	TSS	161790	161791	-0.011127	+	.
Adh	LMEIMC	TSS	168550	168551	-0.013709	+	.
Adh	LMEIMC	TSS	172830	172831	-0.016322	+	.
Adh	LMEIMC	TSS	173840	173841	-0.011369	+	.
Adh	LMEIMC	TSS	175700	175701	-0.009313	+	.
Adh	LMEIMC	TSS	178380	178381	-0.015278	+	.
Adh	LMEIMC	TSS	179500	179501	-0.012948	+	.
Adh	LMEIMC	TSS	182140	182141	-0.011810	+	.
Adh	LMEIMC	TSS	185000	185001	-0.012346	+	.
Adh	LMEIMC	TSS	188720	188721	-0.015859	+	.
Adh	LMEIMC	TSS	196460	196461	-0.012177	+	.
Adh	LMEIMC	TSS	197850	197851	-0.011087	+	.
Adh	LMEIMC	TSS	201680	201681	-0.016081	+	.
Adh	LMEIMC	TSS	205750	205751	-0.012954	+	.
Adh	LMEIMC	TSS	209480	209481	-0.015692	+	.
Adh	LMEIMC	TSS	211010	211011	-0.011978	+	.
Adh	LMEIMC	TSS	212790	212791	-0.009003	+	.
Adh	LMEIMC	TSS	217850	217851	-0.015145	+	.
Adh	LMEIMC	TSS	220860	220861	-0.015501	+	.
Adh	LMEIMC	TSS	222580	222581	-0.010450	+	.
Adh	LMEIMC	TSS	224070	224071	-0.011498	+	.
Adh	LMEIMC	TSS	226420	226421	-0.015615	+	.
Adh	LMEIMC	TSS	227130	227131	-0.014856	+	.
Adh	LMEIMC	TSS	229560	229561	-0.018233	+	.
Adh	LMEIMC	TSS	230560	230561	-0.012418	+	.
Adh	LMEIMC	TSS	234450	234451	-0.013263	+	.
Adh	LMEIMC	TSS	235830	235831	-0.013753	+	.
Adh	LMEIMC	TSS	240830	240831	-0.012389	+	.
Adh	LMEIMC	TSS	242290	242291	-0.011778	+	.
Adh	LMEIMC	TSS	246690	246691	-0.012773	+	.
Adh	LMEIMC	TSS	247730	247731	-0.014266	+	.
Adh	LMEIMC	TSS	250220	250221	-0.009887	+	.
Adh	LMEIMC	TSS	250800	250801	-0.012139	+	.
Adh	LMEIMC	TSS	251980	251981	-0.011344	+	.
Adh	LMEIMC	TSS	254240	254241	-0.015034	+	.
Adh	LMEIMC	TSS	255470	255471	-0.009825	+	.
Adh	LMEIMC	TSS	256310	256311	-0.009160	+	.
Adh	LMEIMC	TSS	261310	261311	-0.014268	+	.
Adh	LMEIMC	TSS	269650	269651	-0.009041	+	.
Adh	LMEIMC	TSS	273460	273461	-0.011427	+	.
Adh	LMEIMC	TSS	273860	273861	-0.011054	+	.
Adh	LMEIMC	TSS	274620	274621	-0.012665	+	.
Adh	LMEIMC	TSS	281690	281691	-0.012683	+	.
Adh	LMEIMC	TSS	284070	284071	-0.011310	+	.
Adh	LMEIMC	TSS	284960	284961	-0.011546	+	.
Adh	LMEIMC	TSS	286890	286891	-0.010534	+	.
Adh	LMEIMC	TSS	287500	287501	-0.015165	+	.
Adh	LMEIMC	TSS	288730	288731	-0.011320	+	.
Adh	LMEIMC	TSS	293120	293121	-0.010592	+	.
Adh	LMEIMC	TSS	295630	295631	-0.011000	+	.
Adh	LMEIMC	TSS	297530	297531	-0.018996	+	.
Adh	LMEIMC	TSS	300140	300141	-0.011040	+	.
Adh	LMEIMC	TSS	300880	300881	-0.011047	+	.
Adh	LMEIMC	TSS	307750	307751	-0.018229	+	.
Adh	LMEIMC	TSS	311550	311551	-0.010829	+	.
Adh	LMEIMC	TSS	313320	313321	-0.012397	+	.
Adh	LMEIMC	TSS	314180	314181	-0.012984	+	.
Adh	LMEIMC	TSS	315110	315111	-0.010906	+	.
Adh	LMEIMC	TSS	323810	323811	-0.014272	+	.
Adh	LMEIMC	TSS	325460	325461	-0.010303	+	.
Adh	LMEIMC	TSS	326820	326821	-0.009448	+	.
Adh	LMEIMC	TSS	327250	327251	-0.013263	+	.
Adh	LMEIMC	TSS	328840	328841	-0.009399	+	.
Adh	LMEIMC	TSS	329900	329901	-0.011901	+	.
Adh	LMEIMC	TSS	334750	334751	-0.011944	+	.
Adh	LMEIMC	TSS	339140	339141	-0.010966	+	.
Adh	LMEIMC	TSS	341700	341701	-0.009966	+	.
Adh	LMEIMC	TSS	344700	344701	-0.012929	+	.
Adh	LMEIMC	TSS	345890	345891	-0.013549	+	.
Adh	LMEIMC	TSS	360170	360171	-0.010333	+	.
Adh	LMEIMC	TSS	361540	361541	-0.012757	+	.
Adh	LMEIMC	TSS	362530	362531	-0.017464	+	.
Adh	LMEIMC	TSS	364850	364851	-0.015293	+	.
Adh	LMEIMC	TSS	367440	367441	-0.011062	+	.
Adh	LMEIMC	TSS	368420	368421	-0.009711	+	.
Adh	LMEIMC	TSS	370510	370511	-0.010726	+	.
Adh	LMEIMC	TSS	371170	371171	-0.014734	+	.
Adh	LMEIMC	TSS	372680	372681	-0.017694	+	.
Adh	LMEIMC	TSS	373240	373241	-0.017972	+	.
Adh	LMEIMC	TSS	379550	379551	-0.015402	+	.
Adh	LMEIMC	TSS	384030	384031	-0.014633	+	.
Adh	LMEIMC	TSS	385700	385701	-0.015883	+	.
Adh	LMEIMC	TSS	388160	388161	-0.012807	+	.
Adh	LMEIMC	TSS	389140	389141	-0.018438	+	.
Adh	LMEIMC	TSS	392970	392971	-0.009566	+	.
Adh	LMEIMC	TSS	393570	393571	-0.013099	+	.
Adh	LMEIMC	TSS	398430	398431	-0.010486	+	.
Adh	LMEIMC	TSS	399410	399411	-0.011465	+	.
Adh	LMEIMC	TSS	401060	401061	-0.011044	+	.
Adh	LMEIMC	TSS	401450	401451	-0.015161	+	.
Adh	LMEIMC	TSS	403310	403311	-0.010212	+	.
Adh	LMEIMC	TSS	405520	405521	-0.010459	+	.
Adh	LMEIMC	TSS	407080	407081	-0.012474	+	.
Adh	LMEIMC	TSS	408600	408601	-0.009877	+	.
Adh	LMEIMC	TSS	412990	412991	-0.009982	+	.
Adh	LMEIMC	TSS	417520	417521	-0.014310	+	.
Adh	LMEIMC	TSS	420520	420521	-0.018034	+	.
Adh	LMEIMC	TSS	422010	422011	-0.009629	+	.
Adh	LMEIMC	TSS	428480	428481	-0.014801	+	.
Adh	LMEIMC	TSS	430350	430351	-0.018885	+	.
Adh	LMEIMC	TSS	432620	432621	-0.010710	+	.
Adh	LMEIMC	TSS	435110	435111	-0.014870	+	.
Adh	LMEIMC	TSS	436090	436091	-0.010329	+	.
Adh	LMEIMC	TSS	437650	437651	-0.009078	+	.
Adh	LMEIMC	TSS	438840	438841	-0.014109	+	.
Adh	LMEIMC	TSS	440610	440611	-0.017842	+	.
Adh	LMEIMC	TSS	444090	444091	-0.014205	+	.
Adh	LMEIMC	TSS	445670	445671	-0.013141	+	.
Adh	LMEIMC	TSS	447050	447051	-0.013706	+	.
Adh	LMEIMC	TSS	448250	448251	-0.018606	+	.
Adh	LMEIMC	TSS	448640	448641	-0.010881	+	.
Adh	LMEIMC	TSS	451490	451491	-0.010912	+	.
Adh	LMEIMC	TSS	453010	453011	-0.013442	+	.
Adh	LMEIMC	TSS	454720	454721	-0.010583	+	.
Adh	LMEIMC	TSS	457540	457541	-0.014624	+	.
Adh	LMEIMC	TSS	459400	459401	-0.011760	+	.
Adh	LMEIMC	TSS	459800	459801	-0.013527	+	.
Adh	LMEIMC	TSS	461440	461441	-0.012422	+	.
Adh	LMEIMC	TSS	461820	461821	-0.009761	+	.
Adh	LMEIMC	TSS	462620	462621	-0.013616	+	.
Adh	LMEIMC	TSS	463490	463491	-0.013683	+	.
Adh	LMEIMC	TSS	463900	463901	-0.009992	+	.
Adh	LMEIMC	TSS	464700	464701	-0.009761	+	.
Adh	LMEIMC	TSS	470570	470571	-0.009480	+	.
Adh	LMEIMC	TSS	472550	472551	-0.009621	+	.
Adh	LMEIMC	TSS	474260	474261	-0.009310	+	.
Adh	LMEIMC	TSS	478090	478091	-0.009369	+	.
Adh	LMEIMC	TSS	480320	480321	-0.010876	+	.
Adh	LMEIMC	TSS	482970	482971	-0.020601	+	.
Adh	LMEIMC	TSS	485080	485081	-0.010879	+	.
Adh	LMEIMC	TSS	486120	486121	-0.012792	+	.
Adh	LMEIMC	TSS	487340	487341	-0.010797	+	.
Adh	LMEIMC	TSS	488320	488321	-0.009827	+	.
Adh	LMEIMC	TSS	495050	495051	-0.030127	+	.
Adh	LMEIMC	TSS	496730	496731	-0.021862	+	.
Adh	LMEIMC	TSS	498540	498541	-0.009277	+	.
Adh	LMEIMC	TSS	499620	499621	-0.013645	+	.
Adh	LMEIMC	TSS	502900	502901	-0.014858	+	.
Adh	LMEIMC	TSS	504400	504401	-0.009363	+	.
Adh	LMEIMC	TSS	506980	506981	-0.010896	+	.
Adh	LMEIMC	TSS	507630	507631	-0.013678	+	.
Adh	LMEIMC	TSS	515740	515741	-0.015362	+	.
Adh	LMEIMC	TSS	517620	517621	-0.014089	+	.
Adh	LMEIMC	TSS	519470	519471	-0.009659	+	.
Adh	LMEIMC	TSS	522230	522231	-0.009289	+	.
Adh	LMEIMC	TSS	523980	523981	-0.013454	+	.
Adh	LMEIMC	TSS	527220	527221	-0.016541	+	.
Adh	LMEIMC	TSS	529580	529581	-0.014440	+	.
Adh	LMEIMC	TSS	530400	530401	-0.014380	+	.
Adh	LMEIMC	TSS	534130	534131	-0.016010	+	.
Adh	LMEIMC	TSS	536500	536501	-0.012261	+	.
Adh	LMEIMC	TSS	538020	538021	-0.011459	+	.
Adh	LMEIMC	TSS	539290	539291	-0.010006	+	.
Adh	LMEIMC	TSS	542630	542631	-0.012481	+	.
Adh	LMEIMC	TSS	543740	543741	-0.015061	+	.
Adh	LMEIMC	TSS	545440	545441	-0.021240	+	.
Adh	LMEIMC	TSS	548260	548261	-0.018279	+	.
Adh	LMEIMC	TSS	549040	549041	-0.010922	+	.
Adh	LMEIMC	TSS	549930	549931	-0.010791	+	.
Adh	LMEIMC	TSS	552060	552061	-0.016200	+	.
Adh	LMEIMC	TSS	552660	552661	-0.013472	+	.
Adh	LMEIMC	TSS	555860	555861	-0.014648	+	.
Adh	LMEIMC	TSS	556470	556471	-0.019189	+	.
Adh	LMEIMC	TSS	558080	558081	-0.010239	+	.
Adh	LMEIMC	TSS	561590	561591	-0.010786	+	.
Adh	LMEIMC	TSS	564450	564451	-0.016568	+	.
Adh	LMEIMC	TSS	565260	565261	-0.009296	+	.
Adh	LMEIMC	TSS	567570	567571	-0.016369	+	.
Adh	LMEIMC	TSS	568660	568661	-0.009853	+	.
Adh	LMEIMC	TSS	569680	569681	-0.012323	+	.
Adh	LMEIMC	TSS	570140	570141	-0.013898	+	.
Adh	LMEIMC	TSS	574890	574891	-0.009429	+	.
Adh	LMEIMC	TSS	581890	581891	-0.015112	+	.
Adh	LMEIMC	TSS	584420	584421	-0.010911	+	.
Adh	LMEIMC	TSS	593850	593851	-0.019370	+	.
Adh	LMEIMC	TSS	594240	594241	-0.015881	+	.
Adh	LMEIMC	TSS	594700	594701	-0.013295	+	.
Adh	LMEIMC	TSS	604650	604651	-0.009284	+	.
Adh	LMEIMC	TSS	605950	605951	-0.018008	+	.
Adh	LMEIMC	TSS	609620	609621	-0.013184	+	.
Adh	LMEIMC	TSS	610180	610181	-0.013550	+	.
Adh	LMEIMC	TSS	612250	612251	-0.011801	+	.
Adh	LMEIMC	TSS	615700	615701	-0.009518	+	.
Adh	LMEIMC	TSS	616890	616891	-0.014641	+	.
Adh	LMEIMC	TSS	622180	622181	-0.011200	+	.
Adh	LMEIMC	TSS	623830	623831	-0.013023	+	.
Adh	LMEIMC	TSS	625340	625341	-0.009789	+	.
Adh	LMEIMC	TSS	627300	627301	-0.015156	+	.
Adh	LMEIMC	TSS	628130	628131	-0.012329	+	.
Adh	LMEIMC	TSS	629540	629541	-0.010521	+	.
Adh	LMEIMC	TSS	638000	638001	-0.015633	+	.
Adh	LMEIMC	TSS	639180	639181	-0.017145	+	.
Adh	LMEIMC	TSS	639700	639701	-0.011846	+	.
Adh	LMEIMC	TSS	645040	645041	-0.013818	+	.
Adh	LMEIMC	TSS	645750	645751	-0.014538	+	.
Adh	LMEIMC	TSS	647280	647281	-0.009081	+	.
Adh	LMEIMC	TSS	648140	648141	-0.012581	+	.
Adh	LMEIMC	TSS	650690	650691	-0.013179	+	.
Adh	LMEIMC	TSS	652490	652491	-0.012446	+	.
Adh	LMEIMC	TSS	652960	652961	-0.011982	+	.
Adh	LMEIMC	TSS	655600	655601	-0.009442	+	.
Adh	LMEIMC	TSS	656900	656901	-0.010158	+	.
Adh	LMEIMC	TSS	662370	662371	-0.010019	+	.
Adh	LMEIMC	TSS	663620	663621	-0.011117	+	.
Adh	LMEIMC	TSS	668160	668161	-0.011374	+	.
Adh	LMEIMC	TSS	669860	669861	-0.010635	+	.
Adh	LMEIMC	TSS	671360	671361	-0.011316	+	.
Adh	LMEIMC	TSS	672280	672281	-0.009284	+	.
Adh	LMEIMC	TSS	674580	674581	-0.014923	+	.
Adh	LMEIMC	TSS	682030	682031	-0.011635	+	.
Adh	LMEIMC	TSS	683440	683441	-0.012063	+	.
Adh	LMEIMC	TSS	686130	686131	-0.011100	+	.
Adh	LMEIMC	TSS	687200	687201	-0.011127	+	.
Adh	LMEIMC	TSS	689560	689561	-0.013735	+	.
Adh	LMEIMC	TSS	690770	690771	-0.009585	+	.
Adh	LMEIMC	TSS	691940	691941	-0.017829	+	.
Adh	LMEIMC	TSS	693210	693211	-0.012146	+	.
Adh	LMEIMC	TSS	693890	693891	-0.009755	+	.
Adh	LMEIMC	TSS	694590	694591	-0.012083	+	.
Adh	LMEIMC	TSS	698290	698291	-0.016036	+	.
Adh	LMEIMC	TSS	700110	700111	-0.013192	+	.
Adh	LMEIMC	TSS	701040	701041	-0.011668	+	.
Adh	LMEIMC	TSS	705070	705071	-0.012125	+	.
Adh	LMEIMC	TSS	705430	705431	-0.019094	+	.
Adh	LMEIMC	TSS	707230	707231	-0.015350	+	.
Adh	LMEIMC	TSS	708590	708591	-0.013939	+	.
Adh	LMEIMC	TSS	709060	709061	-0.013909	+	.
Adh	LMEIMC	TSS	711140	711141	-0.014532	+	.
Adh	LMEIMC	TSS	717660	717661	-0.010689	+	.
Adh	LMEIMC	TSS	719840	719841	-0.009112	+	.
Adh	LMEIMC	TSS	727950	727951	-0.013690	+	.
Adh	LMEIMC	TSS	728770	728771	-0.009197	+	.
Adh	LMEIMC	TSS	732850	732851	-0.009960	+	.
Adh	LMEIMC	TSS	735300	735301	-0.011539	+	.
Adh	LMEIMC	TSS	735510	735511	-0.010368	+	.
Adh	LMEIMC	TSS	739240	739241	-0.010983	+	.
Adh	LMEIMC	TSS	744090	744091	-0.020762	+	.
Adh	LMEIMC	TSS	747980	747981	-0.013991	+	.
Adh	LMEIMC	TSS	750740	750741	-0.011278	+	.
Adh	LMEIMC	TSS	754100	754101	-0.011357	+	.
Adh	LMEIMC	TSS	756900	756901	-0.013362	+	.
Adh	LMEIMC	TSS	758030	758031	-0.013643	+	.
Adh	LMEIMC	TSS	761180	761181	-0.011354	+	.
Adh	LMEIMC	TSS	764830	764831	-0.011885	+	.
Adh	LMEIMC	TSS	773180	773181	-0.011068	+	.
Adh	LMEIMC	TSS	774620	774621	-0.009261	+	.
Adh	LMEIMC	TSS	775470	775471	-0.012575	+	.
Adh	LMEIMC	TSS	781920	781921	-0.011302	+	.
Adh	LMEIMC	TSS	784200	784201	-0.016746	+	.
Adh	LMEIMC	TSS	786770	786771	-0.016471	+	.
Adh	LMEIMC	TSS	787960	787961	-0.009587	+	.
Adh	LMEIMC	TSS	788540	788541	-0.009357	+	.
Adh	LMEIMC	TSS	791160	791161	-0.010366	+	.
Adh	LMEIMC	TSS	793290	793291	-0.012348	+	.
Adh	LMEIMC	TSS	794890	794891	-0.017716	+	.
Adh	LMEIMC	TSS	796940	796941	-0.012827	+	.
Adh	LMEIMC	TSS	799600	799601	-0.013490	+	.
Adh	LMEIMC	TSS	805900	805901	-0.010648	+	.
Adh	LMEIMC	TSS	808180	808181	-0.010162	+	.
Adh	LMEIMC	TSS	810340	810341	-0.010619	+	.
Adh	LMEIMC	TSS	810810	810811	-0.009820	+	.
Adh	LMEIMC	TSS	813380	813381	-0.010920	+	.
Adh	LMEIMC	TSS	820230	820231	-0.010759	+	.
Adh	LMEIMC	TSS	823040	823041	-0.011752	+	.
Adh	LMEIMC	TSS	825800	825801	-0.009800	+	.
Adh	LMEIMC	TSS	827190	827191	-0.013218	+	.
Adh	LMEIMC	TSS	828120	828121	-0.017159	+	.
Adh	LMEIMC	TSS	829510	829511	-0.009066	+	.
Adh	LMEIMC	TSS	832150	832151	-0.010083	+	.
Adh	LMEIMC	TSS	839210	839211	-0.009476	+	.
Adh	LMEIMC	TSS	841850	841851	-0.013724	+	.
Adh	LMEIMC	TSS	842590	842591	-0.010178	+	.
Adh	LMEIMC	TSS	850830	850831	-0.009293	+	.
Adh	LMEIMC	TSS	851940	851941	-0.010878	+	.
Adh	LMEIMC	TSS	856110	856111	-0.011578	+	.
Adh	LMEIMC	TSS	860110	860111	-0.010355	+	.
Adh	LMEIMC	TSS	860510	860511	-0.012074	+	.
Adh	LMEIMC	TSS	867880	867881	-0.011085	+	.
Adh	LMEIMC	TSS	870030	870031	-0.010750	+	.
Adh	LMEIMC	TSS	873400	873401	-0.011534	+	.
Adh	LMEIMC	TSS	875970	875971	-0.011252	+	.
Adh	LMEIMC	TSS	877960	877961	-0.009686	+	.
Adh	LMEIMC	TSS	880140	880141	-0.014250	+	.
Adh	LMEIMC	TSS	880800	880801	-0.015417	+	.
Adh	LMEIMC	TSS	881880	881881	-0.009975	+	.
Adh	LMEIMC	TSS	882830	882831	-0.019032	+	.
Adh	LMEIMC	TSS	888310	888311	-0.016057	+	.
Adh	LMEIMC	TSS	891020	891021	-0.016848	+	.
Adh	LMEIMC	TSS	891930	891931	-0.012689	+	.
Adh	LMEIMC	TSS	897440	897441	-0.014164	+	.
Adh	LMEIMC	TSS	898980	898981	-0.012585	+	.
Adh	LMEIMC	TSS	900260	900261	-0.009399	+	.
Adh	LMEIMC	TSS	902330	902331	-0.010826	+	.
Adh	LMEIMC	TSS	903620	903621	-0.014242	+	.
Adh	LMEIMC	TSS	904420	904421	-0.016158	+	.
Adh	LMEIMC	TSS	907040	907041	-0.011808	+	.
Adh	LMEIMC	TSS	907650	907651	-0.012684	+	.
Adh	LMEIMC	TSS	909400	909401	-0.011541	+	.
Adh	LMEIMC	TSS	915350	915351	-0.011015	+	.
Adh	LMEIMC	TSS	917310	917311	-0.013754	+	.
Adh	LMEIMC	TSS	920360	920361	-0.013468	+	.
Adh	LMEIMC	TSS	920980	920981	-0.014537	+	.
Adh	LMEIMC	TSS	926960	926961	-0.016530	+	.
Adh	LMEIMC	TSS	930890	930891	-0.014509	+	.
Adh	LMEIMC	TSS	934460	934461	-0.010925	+	.
Adh	LMEIMC	TSS	937510	937511	-0.015330	+	.
Adh	LMEIMC	TSS	938170	938171	-0.013443	+	.
Adh	LMEIMC	TSS	941130	941131	-0.009065	+	.
Adh	LMEIMC	TSS	943050	943051	-0.016865	+	.
Adh	LMEIMC	TSS	946750	946751	-0.013348	+	.
Adh	LMEIMC	TSS	948070	948071	-0.015401	+	.
Adh	LMEIMC	TSS	951810	951811	-0.015191	+	.
Adh	LMEIMC	TSS	952050	952051	-0.010829	+	.
Adh	LMEIMC	TSS	954930	954931	-0.014176	+	.
Adh	LMEIMC	TSS	961510	961511	-0.009769	+	.
Adh	LMEIMC	TSS	964000	964001	-0.010215	+	.
Adh	LMEIMC	TSS	964170	964171	-0.011381	+	.
Adh	LMEIMC	TSS	968700	968701	-0.012753	+	.
Adh	LMEIMC	TSS	970790	970791	-0.013076	+	.
Adh	LMEIMC	TSS	973330	973331	-0.011666	+	.
Adh	LMEIMC	TSS	978890	978891	-0.013527	+	.
Adh	LMEIMC	TSS	981820	981821	-0.012364	+	.
Adh	LMEIMC	TSS	983000	983001	-0.010393	+	.
Adh	LMEIMC	TSS	984170	984171	-0.022915	+	.
Adh	LMEIMC	TSS	984740	984741	-0.024609	+	.
Adh	LMEIMC	TSS	990230	990231	-0.009782	+	.
Adh	LMEIMC	TSS	991300	991301	-0.010526	+	.
Adh	LMEIMC	TSS	993340	993341	-0.020149	+	.
Adh	LMEIMC	TSS	997020	997021	-0.010886	+	.
Adh	LMEIMC	TSS	997740	997741	-0.014333	+	.
Adh	LMEIMC	TSS	998830	998831	-0.010724	+	.
Adh	LMEIMC	TSS	999520	999521	-0.012639	+	.
Adh	LMEIMC	TSS	1000700	1000701	-0.014474	+	.
Adh	LMEIMC	TSS	1002910	1002911	-0.018566	+	.
Adh	LMEIMC	TSS	1003660	1003661	-0.015493	+	.
Adh	LMEIMC	TSS	1004770	1004771	-0.010241	+	.
Adh	LMEIMC	TSS	1005390	1005391	-0.011405	+	.
Adh	LMEIMC	TSS	1005740	1005741	-0.012202	+	.
Adh	LMEIMC	TSS	1008450	1008451	-0.009565	+	.
Adh	LMEIMC	TSS	1010060	1010061	-0.020101	+	.
Adh	LMEIMC	TSS	1011420	1011421	-0.015168	+	.
Adh	LMEIMC	TSS	1012500	1012501	-0.010020	+	.
Adh	LMEIMC	TSS	1013850	1013851	-0.013966	+	.
Adh	LMEIMC	TSS	1014730	1014731	-0.011339	+	.
Adh	LMEIMC	TSS	1018280	1018281	-0.010851	+	.
Adh	LMEIMC	TSS	1020710	1020711	-0.013829	+	.
Adh	LMEIMC	TSS	1022780	1022781	-0.012301	+	.
Adh	LMEIMC	TSS	1025640	1025641	-0.019372	+	.
Adh	LMEIMC	TSS	1028330	1028331	-0.010169	+	.
Adh	LMEIMC	TSS	1032220	1032221	-0.009980	+	.
Adh	LMEIMC	TSS	1034270	1034271	-0.012773	+	.
Adh	LMEIMC	TSS	1034700	1034701	-0.009454	+	.
Adh	LMEIMC	TSS	1035760	1035761	-0.013239	+	.
Adh	LMEIMC	TSS	1037310	1037311	-0.009724	+	.
Adh	LMEIMC	TSS	1038060	1038061	-0.012828	+	.
Adh	LMEIMC	TSS	1041150	1041151	-0.012008	+	.
Adh	LMEIMC	TSS	1042790	1042791	-0.010339	+	.
Adh	LMEIMC	TSS	1043680	1043681	-0.009281	+	.
Adh	LMEIMC	TSS	1044700	1044701	-0.014025	+	.
Adh	LMEIMC	TSS	1045440	1045441	-0.010547	+	.
Adh	LMEIMC	TSS	1046610	1046611	-0.009519	+	.
Adh	LMEIMC	TSS	1048260	1048261	-0.015712	+	.
Adh	LMEIMC	TSS	1049880	1049881	-0.012369	+	.
Adh	LMEIMC	TSS	1051680	1051681	-0.011493	+	.
Adh	LMEIMC	TSS	1052230	1052231	-0.010346	+	.
Adh	LMEIMC	TSS	1053920	1053921	-0.011044	+	.
Adh	LMEIMC	TSS	1054640	1054641	-0.013112	+	.
Adh	LMEIMC	TSS	1056460	1056461	-0.011043	+	.
Adh	LMEIMC	TSS	1059090	1059091	-0.012199	+	.
Adh	LMEIMC	TSS	1059730	1059731	-0.012979	+	.
Adh	LMEIMC	TSS	1061270	1061271	-0.013250	+	.
Adh	LMEIMC	TSS	1062470	1062471	-0.009394	+	.
Adh	LMEIMC	TSS	1063980	1063981	-0.015987	+	.
Adh	LMEIMC	TSS	1065550	1065551	-0.015317	+	.
Adh	LMEIMC	TSS	1066340	1066341	-0.010469	+	.
Adh	LMEIMC	TSS	1067370	1067371	-0.010436	+	.
Adh	LMEIMC	TSS	1068320	1068321	-0.010141	+	.
Adh	LMEIMC	TSS	1069570	1069571	-0.009389	+	.
Adh	LMEIMC	TSS	1073150	1073151	-0.011018	+	.
Adh	LMEIMC	TSS	1075940	1075941	-0.015356	+	.
Adh	LMEIMC	TSS	1080890	1080891	-0.011474	+	.
Adh	LMEIMC	TSS	1083540	1083541	-0.012627	+	.
Adh	LMEIMC	TSS	1085180	1085181	-0.019625	+	.
Adh	LMEIMC	TSS	1086800	1086801	-0.013767	+	.
Adh	LMEIMC	TSS	1088810	1088811	-0.013904	+	.
Adh	LMEIMC	TSS	1090180	1090181	-0.015846	+	.
Adh	LMEIMC	TSS	1095950	1095951	-0.009076	+	.
Adh	LMEIMC	TSS	1096500	1096501	-0.016554	+	.
Adh	LMEIMC	TSS	1099740	1099741	-0.024317	+	.
Adh	LMEIMC	TSS	1101090	1101091	-0.017058	+	.
Adh	LMEIMC	TSS	1104180	1104181	-0.012968	+	.
Adh	LMEIMC	TSS	1105120	1105121	-0.014677	+	.
Adh	LMEIMC	TSS	1106350	1106351	-0.012970	+	.
Adh	LMEIMC	TSS	1107120	1107121	-0.010927	+	.
Adh	LMEIMC	TSS	1109930	1109931	-0.016251	+	.
Adh	LMEIMC	TSS	1111480	1111481	-0.012842	+	.
Adh	LMEIMC	TSS	1112610	1112611	-0.009347	+	.
Adh	LMEIMC	TSS	1113960	1113961	-0.011972	+	.
Adh	LMEIMC	TSS	1116410	1116411	-0.010223	+	.
Adh	LMEIMC	TSS	1116830	1116831	-0.009827	+	.
Adh	LMEIMC	TSS	1117740	1117741	-0.015371	+	.
Adh	LMEIMC	TSS	1124830	1124831	-0.013400	+	.
Adh	LMEIMC	TSS	1126310	1126311	-0.012175	+	.
Adh	LMEIMC	TSS	1127140	1127141	-0.009692	+	.
Adh	LMEIMC	TSS	1128660	1128661	-0.016869	+	.
Adh	LMEIMC	TSS	1131820	1131821	-0.015661	+	.
Adh	LMEIMC	TSS	1133050	1133051	-0.010608	+	.
Adh	LMEIMC	TSS	1134010	1134011	-0.009002	+	.
Adh	LMEIMC	TSS	1135100	1135101	-0.011246	+	.
Adh	LMEIMC	TSS	1145760	1145761	-0.011696	+	.
Adh	LMEIMC	TSS	1145980	1145981	-0.011007	+	.
Adh	LMEIMC	TSS	1147190	1147191	-0.011791	+	.
Adh	LMEIMC	TSS	1148880	1148881	-0.015241	+	.
Adh	LMEIMC	TSS	1150760	1150761	-0.009396	+	.
Adh	LMEIMC	TSS	1151620	1151621	-0.009140	+	.
Adh	LMEIMC	TSS	1153920	1153921	-0.010306	+	.
Adh	LMEIMC	TSS	1156880	1156881	-0.015271	+	.
Adh	LMEIMC	TSS	1159560	1159561	-0.013244	+	.
Adh	LMEIMC	TSS	1163750	1163751	-0.009887	+	.
Adh	LMEIMC	TSS	1167600	1167601	-0.010345	+	.
Adh	LMEIMC	TSS	1172770	1172771	-0.012930	+	.
Adh	LMEIMC	TSS	1174690	1174691	-0.014670	+	.
Adh	LMEIMC	TSS	1179210	1179211	-0.009843	+	.
Adh	LMEIMC	TSS	1182440	1182441	-0.012882	+	.
Adh	LMEIMC	TSS	1188380	1188381	-0.012104	+	.
Adh	LMEIMC	TSS	1189860	1189861	-0.013360	+	.
Adh	LMEIMC	TSS	1193660	1193661	-0.017758	+	.
Adh	LMEIMC	TSS	1196170	1196171	-0.012246	+	.
Adh	LMEIMC	TSS	1197390	1197391	-0.016913	+	.
Adh	LMEIMC	TSS	1200210	1200211	-0.010723	+	.
Adh	LMEIMC	TSS	1202120	1202121	-0.013516	+	.
Adh	LMEIMC	TSS	1204300	1204301	-0.012202	+	.
Adh	LMEIMC	TSS	1205030	1205031	-0.012221	+	.
Adh	LMEIMC	TSS	1206340	1206341	-0.012355	+	.
Adh	LMEIMC	TSS	1207520	1207521	-0.014127	+	.
Adh	LMEIMC	TSS	1209090	1209091	-0.011239	+	.
Adh	LMEIMC	TSS	1211330	1211331	-0.017153	+	.
Adh	LMEIMC	TSS	1213580	1213581	-0.012143	+	.
Adh	LMEIMC	TSS	1216210	1216211	-0.013419	+	.
Adh	LMEIMC	TSS	1219270	1219271	-0.011874	+	.
Adh	LMEIMC	TSS	1221710	1221711	-0.010484	+	.
Adh	LMEIMC	TSS	1224570	1224571	-0.016856	+	.
Adh	LMEIMC	TSS	1225290	1225291	-0.019010	+	.
Adh	LMEIMC	TSS	1228490	1228491	-0.014932	+	.
Adh	LMEIMC	TSS	1229830	1229831	-0.010063	+	.
Adh	LMEIMC	TSS	1231190	1231191	-0.013012	+	.
Adh	LMEIMC	TSS	1234350	1234351	-0.010489	+	.
Adh	LMEIMC	TSS	1244120	1244121	-0.010050	+	.
Adh	LMEIMC	TSS	1247790	1247791	-0.019224	+	.
Adh	LMEIMC	TSS	1250010	1250011	-0.012974	+	.
Adh	LMEIMC	TSS	1252140	1252141	-0.011535	+	.
Adh	LMEIMC	TSS	1254120	1254121	-0.014690	+	.
Adh	LMEIMC	TSS	1255790	1255791	-0.012179	+	.
Adh	LMEIMC	TSS	1257370	1257371	-0.009395	+	.
Adh	LMEIMC	TSS	1261050	1261051	-0.011430	+	.
Adh	LMEIMC	TSS	1265300	1265301	-0.010021	+	.
Adh	LMEIMC	TSS	1269080	1269081	-0.009764	+	.
Adh	LMEIMC	TSS	1270090	1270091	-0.012816	+	.
Adh	LMEIMC	TSS	1274300	1274301	-0.012024	+	.
Adh	LMEIMC	TSS	1275110	1275111	-0.012695	+	.
Adh	LMEIMC	TSS	1278400	1278401	-0.011579	+	.
Adh	LMEIMC	TSS	1281130	1281131	-0.014778	+	.
Adh	LMEIMC	TSS	1285590	1285591	-0.010534	+	.
Adh	LMEIMC	TSS	1286340	1286341	-0.009170	+	.
Adh	LMEIMC	TSS	1287410	1287411	-0.015072	+	.
Adh	LMEIMC	TSS	1287600	1287601	-0.019358	+	.
Adh	LMEIMC	TSS	1288760	1288761	-0.011615	+	.
Adh	LMEIMC	TSS	1289720	1289721	-0.010263	+	.
Adh	LMEIMC	TSS	1290690	1290691	-0.011584	+	.
Adh	LMEIMC	TSS	1291710	1291711	-0.011383	+	.
Adh	LMEIMC	TSS	1299400	1299401	-0.011618	+	.
Adh	LMEIMC	TSS	1301260	1301261	-0.014459	+	.
Adh	LMEIMC	TSS	1302740	1302741	-0.009518	+	.
Adh	LMEIMC	TSS	1306100	1306101	-0.011371	+	.
Adh	LMEIMC	TSS	1307330	1307331	-0.016430	+	.
Adh	LMEIMC	TSS	1307770	1307771	-0.011369	+	.
Adh	LMEIMC	TSS	1310930	1310931	-0.013799	+	.
Adh	LMEIMC	TSS	1312200	1312201	-0.013745	+	.
Adh	LMEIMC	TSS	1314330	1314331	-0.009759	+	.
Adh	LMEIMC	TSS	1316270	1316271	-0.015885	+	.
Adh	LMEIMC	TSS	1322710	1322711	-0.010094	+	.
Adh	LMEIMC	TSS	1323870	1323871	-0.015857	+	.
Adh	LMEIMC	TSS	1327360	1327361	-0.009359	+	.
Adh	LMEIMC	TSS	1333820	1333821	-0.019808	+	.
Adh	LMEIMC	TSS	1337320	1337321	-0.010000	+	.
Adh	LMEIMC	TSS	1338020	1338021	-0.009060	+	.
Adh	LMEIMC	TSS	1341470	1341471	-0.014809	+	.
Adh	LMEIMC	TSS	1344190	1344191	-0.009447	+	.
Adh	LMEIMC	TSS	1350700	1350701	-0.009343	+	.
Adh	LMEIMC	TSS	1352800	1352801	-0.009643	+	.
Adh	LMEIMC	TSS	1353490	1353491	-0.014329	+	.
Adh	LMEIMC	TSS	1354490	1354491	-0.014337	+	.
Adh	LMEIMC	TSS	1356610	1356611	-0.009995	+	.
Adh	LMEIMC	TSS	1359440	1359441	-0.010171	+	.
Adh	LMEIMC	TSS	1360350	1360351	-0.011066	+	.
Adh	LMEIMC	TSS	1361760	1361761	-0.009993	+	.
Adh	LMEIMC	TSS	1363250	1363251	-0.010203	+	.
Adh	LMEIMC	TSS	1364700	1364701	-0.010618	+	.
Adh	LMEIMC	TSS	1366610	1366611	-0.009861	+	.
Adh	LMEIMC	TSS	1370340	1370341	-0.011292	+	.
Adh	LMEIMC	TSS	1371000	1371001	-0.013739	+	.
Adh	LMEIMC	TSS	1373030	1373031	-0.014407	+	.
Adh	LMEIMC	TSS	1374880	1374881	-0.010357	+	.
Adh	LMEIMC	TSS	1376440	1376441	-0.012466	+	.
Adh	LMEIMC	TSS	1377230	1377231	-0.014142	+	.
Adh	LMEIMC	TSS	1378890	1378891	-0.016104	+	.
Adh	LMEIMC	TSS	1382500	1382501	-0.009383	+	.
Adh	LMEIMC	TSS	1385120	1385121	-0.012777	+	.
Adh	LMEIMC	TSS	1387260	1387261	-0.009866	+	.
Adh	LMEIMC	TSS	1392850	1392851	-0.010812	+	.
Adh	LMEIMC	TSS	1394160	1394161	-0.022109	+	.
Adh	LMEIMC	TSS	1396090	1396091	-0.012659	+	.
Adh	LMEIMC	TSS	1400250	1400251	-0.012867	+	.
Adh	LMEIMC	TSS	1401160	1401161	-0.009713	+	.
Adh	LMEIMC	TSS	1403170	1403171	-0.017778	+	.
Adh	LMEIMC	TSS	1406090	1406091	-0.014839	+	.
Adh	LMEIMC	TSS	1407300	1407301	-0.018613	+	.
Adh	LMEIMC	TSS	1408160	1408161	-0.019400	+	.
Adh	LMEIMC	TSS	1409680	1409681	-0.013605	+	.
Adh	LMEIMC	TSS	1411210	1411211	-0.009532	+	.
Adh	LMEIMC	TSS	1414270	1414271	-0.009031	+	.
Adh	LMEIMC	TSS	1415180	1415181	-0.010222	+	.
Adh	LMEIMC	TSS	1421680	1421681	-0.013311	+	.
Adh	LMEIMC	TSS	1430040	1430041	-0.011378	+	.
Adh	LMEIMC	TSS	1431420	1431421	-0.016829	+	.
Adh	LMEIMC	TSS	1435110	1435111	-0.013173	+	.
Adh	LMEIMC	TSS	1436750	1436751	-0.011218	+	.
Adh	LMEIMC	TSS	1438650	1438651	-0.009894	+	.
Adh	LMEIMC	TSS	1439140	1439141	-0.009151	+	.
Adh	LMEIMC	TSS	1440970	1440971	-0.013774	+	.
Adh	LMEIMC	TSS	1443300	1443301	-0.016705	+	.
Adh	LMEIMC	TSS	1445600	1445601	-0.012112	+	.
Adh	LMEIMC	TSS	1448710	1448711	-0.010469	+	.
Adh	LMEIMC	TSS	1451240	1451241	-0.010791	+	.
Adh	LMEIMC	TSS	1452850	1452851	-0.010726	+	.
Adh	LMEIMC	TSS	1453410	1453411	-0.012373	+	.
Adh	LMEIMC	TSS	1454760	1454761	-0.009404	+	.
Adh	LMEIMC	TSS	1457450	1457451	-0.011752	+	.
Adh	LMEIMC	TSS	1460780	1460781	-0.012283	+	.
Adh	LMEIMC	TSS	1461940	1461941	-0.016709	+	.
Adh	LMEIMC	TSS	1462250	1462251	-0.015271	+	.
Adh	LMEIMC	TSS	1463550	1463551	-0.012270	+	.
Adh	LMEIMC	TSS	1464560	1464561	-0.010665	+	.
Adh	LMEIMC	TSS	1469590	1469591	-0.013181	+	.
Adh	LMEIMC	TSS	1470920	1470921	-0.011592	+	.
Adh	LMEIMC	TSS	1472800	1472801	-0.011595	+	.
Adh	LMEIMC	TSS	1473460	1473461	-0.009860	+	.
Adh	LMEIMC	TSS	1474330	1474331	-0.009870	+	.
Adh	LMEIMC	TSS	1478620	1478621	-0.010741	+	.
Adh	LMEIMC	TSS	1479130	1479131	-0.010184	+	.
Adh	LMEIMC	TSS	1479850	1479851	-0.010872	+	.
Adh	LMEIMC	TSS	1481800	1481801	-0.011474	+	.
Adh	LMEIMC	TSS	1484810	1484811	-0.015993	+	.
Adh	LMEIMC	TSS	1487390	1487391	-0.013809	+	.
Adh	LMEIMC	TSS	1489060	1489061	-0.012957	+	.
Adh	LMEIMC	TSS	1490270	1490271	-0.018889	+	.
Adh	LMEIMC	TSS	1491340	1491341	-0.012998	+	.
Adh	LMEIMC	TSS	1497610	1497611	-0.017827	+	.
Adh	LMEIMC	TSS	1499760	1499761	-0.014300	+	.
Adh	LMEIMC	TSS	1501590	1501591	-0.013343	+	.
Adh	LMEIMC	TSS	1501980	1501981	-0.015244	+	.
Adh	LMEIMC	TSS	1506710	1506711	-0.009628	+	.
Adh	LMEIMC	TSS	1516560	1516561	-0.012292	+	.
Adh	LMEIMC	TSS	1519030	1519031	-0.012026	+	.
Adh	LMEIMC	TSS	1520660	1520661	-0.010286	+	.
Adh	LMEIMC	TSS	1521760	1521761	-0.012459	+	.
Adh	LMEIMC	TSS	1528250	1528251	-0.009962	+	.
Adh	LMEIMC	TSS	1529350	1529351	-0.018866	+	.
Adh	LMEIMC	TSS	1530670	1530671	-0.010639	+	.
Adh	LMEIMC	TSS	1531890	1531891	-0.009360	+	.
Adh	LMEIMC	TSS	1533430	1533431	-0.013988	+	.
Adh	LMEIMC	TSS	1540950	1540951	-0.009165	+	.
Adh	LMEIMC	TSS	1541770	1541771	-0.010004	+	.
Adh	LMEIMC	TSS	1542500	1542501	-0.011754	+	.
Adh	LMEIMC	TSS	1544230	1544231	-0.009234	+	.
Adh	LMEIMC	TSS	1546820	1546821	-0.009355	+	.
Adh	LMEIMC	TSS	1547550	1547551	-0.023320	+	.
Adh	LMEIMC	TSS	1554170	1554171	-0.010790	+	.
Adh	LMEIMC	TSS	1555620	1555621	-0.010683	+	.
Adh	LMEIMC	TSS	1559670	1559671	-0.009165	+	.
Adh	LMEIMC	TSS	1562380	1562381	-0.016140	+	.
Adh	LMEIMC	TSS	1563370	1563371	-0.009346	+	.
Adh	LMEIMC	TSS	1565330	1565331	-0.013391	+	.
Adh	LMEIMC	TSS	1568610	1568611	-0.011198	+	.
Adh	LMEIMC	TSS	1570570	1570571	-0.011323	+	.
Adh	LMEIMC	TSS	1573440	1573441	-0.011125	+	.
Adh	LMEIMC	TSS	1577180	1577181	-0.013641	+	.
Adh	LMEIMC	TSS	1580800	1580801	-0.009841	+	.
Adh	LMEIMC	TSS	1581890	1581891	-0.016131	+	.
Adh	LMEIMC	TSS	1583220	1583221	-0.010523	+	.
Adh	LMEIMC	TSS	1585090	1585091	-0.014441	+	.
Adh	LMEIMC	TSS	1590410	1590411	-0.013723	+	.
Adh	LMEIMC	TSS	1591920	1591921	-0.009494	+	.
Adh	LMEIMC	TSS	1594540	1594541	-0.009851	+	.
Adh	LMEIMC	TSS	1596950	1596951	-0.009658	+	.
Adh	LMEIMC	TSS	1599130	1599131	-0.009767	+	.
Adh	LMEIMC	TSS	1601330	1601331	-0.012617	+	.
Adh	LMEIMC	TSS	1603420	1603421	-0.012427	+	.
Adh	LMEIMC	TSS	1604070	1604071	-0.011073	+	.
Adh	LMEIMC	TSS	1606790	1606791	-0.012289	+	.
Adh	LMEIMC	TSS	1610320	1610321	-0.016007	+	.
Adh	LMEIMC	TSS	1610530	1610531	-0.015202	+	.
Adh	LMEIMC	TSS	1611570	1611571	-0.014655	+	.
Adh	LMEIMC	TSS	1615010	1615011	-0.010529	+	.
Adh	LMEIMC	TSS	1616010	1616011	-0.012112	+	.
Adh	LMEIMC	TSS	1616640	1616641	-0.013790	+	.
Adh	LMEIMC	TSS	1617770	1617771	-0.009098	+	.
Adh	LMEIMC	TSS	1620330	1620331	-0.018154	+	.
Adh	LMEIMC	TSS	1622750	1622751	-0.012478	+	.
Adh	LMEIMC	TSS	1624450	1624451	-0.014035	+	.
Adh	LMEIMC	TSS	1625050	1625051	-0.014063	+	.
Adh	LMEIMC	TSS	1629710	1629711	-0.009059	+	.
Adh	LMEIMC	TSS	1631010	1631011	-0.009711	+	.
Adh	LMEIMC	TSS	1634380	1634381	-0.010407	+	.
Adh	LMEIMC	TSS	1635760	1635761	-0.017879	+	.
Adh	LMEIMC	TSS	1637720	1637721	-0.009223	+	.
Adh	LMEIMC	TSS	1640900	1640901	-0.009336	+	.
Adh	LMEIMC	TSS	1641450	1641451	-0.009782	+	.
Adh	LMEIMC	TSS	1643890	1643891	-0.012069	+	.
Adh	LMEIMC	TSS	1645700	1645701	-0.010648	+	.
Adh	LMEIMC	TSS	1648020	1648021	-0.013533	+	.
Adh	LMEIMC	TSS	1650370	1650371	-0.009215	+	.
Adh	LMEIMC	TSS	1653270	1653271	-0.013837	+	.
Adh	LMEIMC	TSS	1657420	1657421	-0.009194	+	.
Adh	LMEIMC	TSS	1661690	1661691	-0.015811	+	.
Adh	LMEIMC	TSS	1663170	1663171	-0.009469	+	.
Adh	LMEIMC	TSS	1665510	1665511	-0.010131	+	.
Adh	LMEIMC	TSS	1668140	1668141	-0.010044	+	.
Adh	LMEIMC	TSS	1669200	1669201	-0.010990	+	.
Adh	LMEIMC	TSS	1670230	1670231	-0.010431	+	.
Adh	LMEIMC	TSS	1671060	1671061	-0.017413	+	.
Adh	LMEIMC	TSS	1671240	1671241	-0.026704	+	.
Adh	LMEIMC	TSS	1672910	1672911	-0.014701	+	.
Adh	LMEIMC	TSS	1674190	1674191	-0.012055	+	.
Adh	LMEIMC	TSS	1676570	1676571	-0.010572	+	.
Adh	LMEIMC	TSS	1679460	1679461	-0.016363	+	.
Adh	LMEIMC	TSS	1680950	1680951	-0.009744	+	.
Adh	LMEIMC	TSS	1681840	1681841	-0.009313	+	.
Adh	LMEIMC	TSS	1683270	1683271	-0.009685	+	.
Adh	LMEIMC	TSS	1686480	1686481	-0.014032	+	.
Adh	LMEIMC	TSS	1694690	1694691	-0.013910	+	.
Adh	LMEIMC	TSS	1697770	1697771	-0.009959	+	.
Adh	LMEIMC	TSS	1701340	1701341	-0.009918	+	.
Adh	LMEIMC	TSS	1701890	1701891	-0.011034	+	.
Adh	LMEIMC	TSS	1703880	1703881	-0.010930	+	.
Adh	LMEIMC	TSS	1705880	1705881	-0.013695	+	.
Adh	LMEIMC	TSS	1706860	1706861	-0.012043	+	.
Adh	LMEIMC	TSS	1709740	1709741	-0.010654	+	.
Adh	LMEIMC	TSS	1710270	1710271	-0.010001	+	.
Adh	LMEIMC	TSS	1711720	1711721	-0.012104	+	.
Adh	LMEIMC	TSS	1715910	1715911	-0.014076	+	.
Adh	LMEIMC	TSS	1717250	1717251	-0.010565	+	.
Adh	LMEIMC	TSS	1717830	1717831	-0.013875	+	.
Adh	LMEIMC	TSS	1720970	1720971	-0.013170	+	.
Adh	LMEIMC	TSS	1721460	1721461	-0.014682	+	.
Adh	LMEIMC	TSS	1723490	1723491	-0.010285	+	.
Adh	LMEIMC	TSS	1724760	1724761	-0.010651	+	.
Adh	LMEIMC	TSS	1727450	1727451	-0.012660	+	.
Adh	LMEIMC	TSS	1727690	1727691	-0.009110	+	.
Adh	LMEIMC	TSS	1729530	1729531	-0.017913	+	.
Adh	LMEIMC	TSS	1730660	1730661	-0.009481	+	.
Adh	LMEIMC	TSS	1733230	1733231	-0.009012	+	.
Adh	LMEIMC	TSS	1734560	1734561	-0.015947	+	.
Adh	LMEIMC	TSS	1735390	1735391	-0.013545	+	.
Adh	LMEIMC	TSS	1736590	1736591	-0.012630	+	.
Adh	LMEIMC	TSS	1750230	1750231	-0.010454	+	.
Adh	LMEIMC	TSS	1752160	1752161	-0.012865	+	.
Adh	LMEIMC	TSS	1757860	1757861	-0.012369	+	.
Adh	LMEIMC	TSS	1759220	1759221	-0.011895	+	.
Adh	LMEIMC	TSS	1761890	1761891	-0.013924	+	.
Adh	LMEIMC	TSS	1763750	1763751	-0.019054	+	.
Adh	LMEIMC	TSS	1766270	1766271	-0.009923	+	.
Adh	LMEIMC	TSS	1767050	1767051	-0.011556	+	.
Adh	LMEIMC	TSS	1768240	1768241	-0.011094	+	.
Adh	LMEIMC	TSS	1769520	1769521	-0.010150	+	.
Adh	LMEIMC	TSS	1770290	1770291	-0.011817	+	.
Adh	LMEIMC	TSS	1771060	1771061	-0.016409	+	.
Adh	LMEIMC	TSS	1783160	1783161	-0.016374	+	.
Adh	LMEIMC	TSS	1783410	1783411	-0.013263	+	.
Adh	LMEIMC	TSS	1784920	1784921	-0.015636	+	.
Adh	LMEIMC	TSS	1789360	1789361	-0.012210	+	.
Adh	LMEIMC	TSS	1789740	1789741	-0.017966	+	.
Adh	LMEIMC	TSS	1790400	1790401	-0.009258	+	.
Adh	LMEIMC	TSS	1790800	1790801	-0.012673	+	.
Adh	LMEIMC	TSS	1792070	1792071	-0.009756	+	.
Adh	LMEIMC	TSS	1794060	1794061	-0.011251	+	.
Adh	LMEIMC	TSS	1794510	1794511	-0.018312	+	.
Adh	LMEIMC	TSS	1794910	1794911	-0.015483	+	.
Adh	LMEIMC	TSS	1799110	1799111	-0.010915	+	.
Adh	LMEIMC	TSS	1799730	1799731	-0.017947	+	.
Adh	LMEIMC	TSS	1804540	1804541	-0.019859	+	.
Adh	LMEIMC	TSS	1805940	1805941	-0.010641	+	.
Adh	LMEIMC	TSS	1807900	1807901	-0.012904	+	.
Adh	LMEIMC	TSS	1810540	1810541	-0.011629	+	.
Adh	LMEIMC	TSS	1811560	1811561	-0.009283	+	.
Adh	LMEIMC	TSS	1814150	1814151	-0.011807	+	.
Adh	LMEIMC	TSS	1815870	1815871	-0.011848	+	.
Adh	LMEIMC	TSS	1816710	1816711	-0.011171	+	.
Adh	LMEIMC	TSS	1817660	1817661	-0.018321	+	.
Adh	LMEIMC	TSS	1819050	1819051	-0.010193	+	.
Adh	LMEIMC	TSS	1819630	1819631	-0.014218	+	.
Adh	LMEIMC	TSS	1820460	1820461	-0.010538	+	.
Adh	LMEIMC	TSS	1823400	1823401	-0.021793	+	.
Adh	LMEIMC	TSS	1825350	1825351	-0.009659	+	.
Adh	LMEIMC	TSS	1826630	1826631	-0.011598	+	.
Adh	LMEIMC	TSS	1828980	1828981	-0.009024	+	.
Adh	LMEIMC	TSS	1829540	1829541	-0.009785	+	.
Adh	LMEIMC	TSS	1836790	1836791	-0.013616	+	.
Adh	LMEIMC	TSS	1837280	1837281	-0.015446	+	.
Adh	LMEIMC	TSS	1838850	1838851	-0.009453	+	.
Adh	LMEIMC	TSS	1840540	1840541	-0.012036	+	.
Adh	LMEIMC	TSS	1843700	1843701	-0.010821	+	.
Adh	LMEIMC	TSS	1846090	1846091	-0.012256	+	.
Adh	LMEIMC	TSS	1848290	1848291	-0.013639	+	.
Adh	LMEIMC	TSS	1849730	1849731	-0.014028	+	.
Adh	LMEIMC	TSS	1852570	1852571	-0.011359	+	.
Adh	LMEIMC	TSS	1853740	1853741	-0.009793	+	.
Adh	LMEIMC	TSS	1855860	1855861	-0.012790	+	.
Adh	LMEIMC	TSS	1857730	1857731	-0.011194	+	.
Adh	LMEIMC	TSS	1860040	1860041	-0.010312	+	.
Adh	LMEIMC	TSS	1862550	1862551	-0.012021	+	.
Adh	LMEIMC	TSS	1864230	1864231	-0.012009	+	.
Adh	LMEIMC	TSS	1865350	1865351	-0.012182	+	.
Adh	LMEIMC	TSS	1866560	1866561	-0.014413	+	.
Adh	LMEIMC	TSS	1867150	1867151	-0.011067	+	.
Adh	LMEIMC	TSS	1869420	1869421	-0.013967	+	.
Adh	LMEIMC	TSS	1871000	1871001	-0.009763	+	.
Adh	LMEIMC	TSS	1872280	1872281	-0.014015	+	.
Adh	LMEIMC	TSS	1872810	1872811	-0.011363	+	.
Adh	LMEIMC	TSS	1874850	1874851	-0.016990	+	.
Adh	LMEIMC	TSS	1875190	1875191	-0.010892	+	.
Adh	LMEIMC	TSS	1876130	1876131	-0.012254	+	.
Adh	LMEIMC	TSS	1877050	1877051	-0.009487	+	.
Adh	LMEIMC	TSS	1878380	1878381	-0.010967	+	.
Adh	LMEIMC	TSS	1881980	1881981	-0.010106	+	.
Adh	LMEIMC	TSS	1887910	1887911	-0.012042	+	.
Adh	LMEIMC	TSS	1890090	1890091	-0.019117	+	.
Adh	LMEIMC	TSS	1893360	1893361	-0.010401	+	.
Adh	LMEIMC	TSS	1895490	1895491	-0.014274	+	.
Adh	LMEIMC	TSS	1897060	1897061	-0.014916	+	.
Adh	LMEIMC	TSS	1897740	1897741	-0.009939	+	.
Adh	LMEIMC	TSS	1899210	1899211	-0.016167	+	.
Adh	LMEIMC	TSS	1900600	1900601	-0.013847	+	.
Adh	LMEIMC	TSS	1901570	1901571	-0.009435	+	.
Adh	LMEIMC	TSS	1902020	1902021	-0.012808	+	.
Adh	LMEIMC	TSS	1903170	1903171	-0.014859	+	.
Adh	LMEIMC	TSS	1903730	1903731	-0.009505	+	.
Adh	LMEIMC	TSS	1904410	1904411	-0.011792	+	.
Adh	LMEIMC	TSS	1907340	1907341	-0.010707	+	.
Adh	LMEIMC	TSS	1908010	1908011	-0.009186	+	.
Adh	LMEIMC	TSS	1908620	1908621	-0.012360	+	.
Adh	LMEIMC	TSS	1910350	1910351	-0.017136	+	.
Adh	LMEIMC	TSS	1911350	1911351	-0.009822	+	.
Adh	LMEIMC	TSS	1912570	1912571	-0.014538	+	.
Adh	LMEIMC	TSS	1915670	1915671	-0.016720	+	.
Adh	LMEIMC	TSS	1918220	1918221	-0.016575	+	.
Adh	LMEIMC	TSS	1920280	1920281	-0.015458	+	.
Adh	LMEIMC	TSS	1920790	1920791	-0.013198	+	.
Adh	LMEIMC	TSS	1921970	1921971	-0.014287	+	.
Adh	LMEIMC	TSS	1926660	1926661	-0.011224	+	.
Adh	LMEIMC	TSS	1928310	1928311	-0.010604	+	.
Adh	LMEIMC	TSS	1929870	1929871	-0.016023	+	.
Adh	LMEIMC	TSS	1933860	1933861	-0.011344	+	.
Adh	LMEIMC	TSS	1934170	1934171	-0.013637	+	.
Adh	LMEIMC	TSS	1934930	1934931	-0.012344	+	.
Adh	LMEIMC	TSS	1936140	1936141	-0.013528	+	.
Adh	LMEIMC	TSS	1937130	1937131	-0.009759	+	.
Adh	LMEIMC	TSS	1938780	1938781	-0.016189	+	.
Adh	LMEIMC	TSS	1943070	1943071	-0.014093	+	.
Adh	LMEIMC	TSS	1944870	1944871	-0.014439	+	.
Adh	LMEIMC	TSS	1945460	1945461	-0.019093	+	.
Adh	LMEIMC	TSS	1948240	1948241	-0.012510	+	.
Adh	LMEIMC	TSS	1948600	1948601	-0.012650	+	.
Adh	LMEIMC	TSS	1949170	1949171	-0.014847	+	.
Adh	LMEIMC	TSS	1951310	1951311	-0.021129	+	.
Adh	LMEIMC	TSS	1955590	1955591	-0.009290	+	.
Adh	LMEIMC	TSS	1957440	1957441	-0.013344	+	.
Adh	LMEIMC	TSS	1958350	1958351	-0.009845	+	.
Adh	LMEIMC	TSS	1958960	1958961	-0.010514	+	.
Adh	LMEIMC	TSS	1959480	1959481	-0.013855	+	.
Adh	LMEIMC	TSS	1959980	1959981	-0.010554	+	.
Adh	LMEIMC	TSS	1962350	1962351	-0.013699	+	.
Adh	LMEIMC	TSS	1968020	1968021	-0.015672	+	.
Adh	LMEIMC	TSS	1970180	1970181	-0.010538	+	.
Adh	LMEIMC	TSS	1974550	1974551	-0.014937	+	.
Adh	LMEIMC	TSS	1975850	1975851	-0.009795	+	.
Adh	LMEIMC	TSS	1976310	1976311	-0.011697	+	.
Adh	LMEIMC	TSS	1976910	1976911	-0.013727	+	.
Adh	LMEIMC	TSS	1978810	1978811	-0.019818	+	.
Adh	LMEIMC	TSS	1979480	1979481	-0.010623	+	.
Adh	LMEIMC	TSS	1981780	1981781	-0.014270	+	.
Adh	LMEIMC	TSS	1983490	1983491	-0.010925	+	.
Adh	LMEIMC	TSS	1985310	1985311	-0.020841	+	.
Adh	LMEIMC	TSS	1986620	1986621	-0.013989	+	.
Adh	LMEIMC	TSS	1989270	1989271	-0.022724	+	.
Adh	LMEIMC	TSS	1997640	1997641	-0.009024	+	.
Adh	LMEIMC	TSS	1998440	1998441	-0.013759	+	.
Adh	LMEIMC	TSS	2000190	2000191	-0.012032	+	.
Adh	LMEIMC	TSS	2000930	2000931	-0.011179	+	.
Adh	LMEIMC	TSS	2001670	2001671	-0.015322	+	.
Adh	LMEIMC	TSS	2003440	2003441	-0.014909	+	.
Adh	LMEIMC	TSS	2004490	2004491	-0.012848	+	.
Adh	LMEIMC	TSS	2005800	2005801	-0.011522	+	.
Adh	LMEIMC	TSS	2006860	2006861	-0.019988	+	.
Adh	LMEIMC	TSS	2009890	2009891	-0.017521	+	.
Adh	LMEIMC	TSS	2015520	2015521	-0.012429	+	.
Adh	LMEIMC	TSS	2016790	2016791	-0.014202	+	.
Adh	LMEIMC	TSS	2018650	2018651	-0.021017	+	.
Adh	LMEIMC	TSS	2023010	2023011	-0.011342	+	.
Adh	LMEIMC	TSS	2023520	2023521	-0.013675	+	.
Adh	LMEIMC	TSS	2025160	2025161	-0.009979	+	.
Adh	LMEIMC	TSS	2027340	2027341	-0.009459	+	.
Adh	LMEIMC	TSS	2033930	2033931	-0.016216	+	.
Adh	LMEIMC	TSS	2039370	2039371	-0.010528	+	.
Adh	LMEIMC	TSS	2040050	2040051	-0.009325	+	.
Adh	LMEIMC	TSS	2041200	2041201	-0.009592	+	.
Adh	LMEIMC	TSS	2042670	2042671	-0.011807	+	.
Adh	LMEIMC	TSS	2044190	2044191	-0.010990	+	.
Adh	LMEIMC	TSS	2047870	2047871	-0.012689	+	.
Adh	LMEIMC	TSS	2050230	2050231	-0.011995	+	.
Adh	LMEIMC	TSS	2050350	2050351	-0.011374	+	.
Adh	LMEIMC	TSS	2051430	2051431	-0.011472	+	.
Adh	LMEIMC	TSS	2052980	2052981	-0.011361	+	.
Adh	LMEIMC	TSS	2055160	2055161	-0.010653	+	.
Adh	LMEIMC	TSS	2060490	2060491	-0.009102	+	.
Adh	LMEIMC	TSS	2062830	2062831	-0.009161	+	.
Adh	LMEIMC	TSS	2065800	2065801	-0.010331	+	.
Adh	LMEIMC	TSS	2070580	2070581	-0.014407	+	.
Adh	LMEIMC	TSS	2075490	2075491	-0.009846	+	.
Adh	LMEIMC	TSS	2084670	2084671	-0.012556	+	.
Adh	LMEIMC	TSS	2085130	2085131	-0.013899	+	.
Adh	LMEIMC	TSS	2086070	2086071	-0.013630	+	.
Adh	LMEIMC	TSS	2088190	2088191	-0.017105	+	.
Adh	LMEIMC	TSS	2089310	2089311	-0.011479	+	.
Adh	LMEIMC	TSS	2089890	2089891	-0.011468	+	.
Adh	LMEIMC	TSS	2091020	2091021	-0.013734	+	.
Adh	LMEIMC	TSS	2092700	2092701	-0.011254	+	.
Adh	LMEIMC	TSS	2093790	2093791	-0.011567	+	.
Adh	LMEIMC	TSS	2094340	2094341	-0.015388	+	.
Adh	LMEIMC	TSS	2094710	2094711	-0.010092	+	.
Adh	LMEIMC	TSS	2096190	2096191	-0.010652	+	.
Adh	LMEIMC	TSS	2097640	2097641	-0.011687	+	.
Adh	LMEIMC	TSS	2098530	2098531	-0.013814	+	.
Adh	LMEIMC	TSS	2100290	2100291	-0.010734	+	.
Adh	LMEIMC	TSS	2100940	2100941	-0.011214	+	.
Adh	LMEIMC	TSS	2105760	2105761	-0.014348	+	.
Adh	LMEIMC	TSS	2109480	2109481	-0.010496	+	.
Adh	LMEIMC	TSS	2111970	2111971	-0.011844	+	.
Adh	LMEIMC	TSS	2114300	2114301	-0.010194	+	.
Adh	LMEIMC	TSS	2116180	2116181	-0.010912	+	.
Adh	LMEIMC	TSS	2117290	2117291	-0.012987	+	.
Adh	LMEIMC	TSS	2118470	2118471	-0.009314	+	.
Adh	LMEIMC	TSS	2120120	2120121	-0.012362	+	.
Adh	LMEIMC	TSS	2124310	2124311	-0.009862	+	.
Adh	LMEIMC	TSS	2125050	2125051	-0.010179	+	.
Adh	LMEIMC	TSS	2125320	2125321	-0.009130	+	.
Adh	LMEIMC	TSS	2128730	2128731	-0.013779	+	.
Adh	LMEIMC	TSS	2129800	2129801	-0.010845	+	.
Adh	LMEIMC	TSS	2132080	2132081	-0.012375	+	.
Adh	LMEIMC	TSS	2133190	2133191	-0.010717	+	.
Adh	LMEIMC	TSS	2142140	2142141	-0.019707	+	.
Adh	LMEIMC	TSS	2142580	2142581	-0.010396	+	.
Adh	LMEIMC	TSS	2143490	2143491	-0.009735	+	.
Adh	LMEIMC	TSS	2146320	2146321	-0.010865	+	.
Adh	LMEIMC	TSS	2147020	2147021	-0.010530	+	.
Adh	LMEIMC	TSS	2147740	2147741	-0.009232	+	.
Adh	LMEIMC	TSS	2149020	2149021	-0.013872	+	.
Adh	LMEIMC	TSS	2154270	2154271	-0.011107	+	.
Adh	LMEIMC	TSS	2154630	2154631	-0.012291	+	.
Adh	LMEIMC	TSS	2156030	2156031	-0.013902	+	.
Adh	LMEIMC	TSS	2158810	2158811	-0.011136	+	.
Adh	LMEIMC	TSS	2162780	2162781	-0.016030	+	.
Adh	LMEIMC	TSS	2163680	2163681	-0.010793	+	.
Adh	LMEIMC	TSS	2165840	2165841	-0.021535	+	.
Adh	LMEIMC	TSS	2169640	2169641	-0.010233	+	.
Adh	LMEIMC	TSS	2171270	2171271	-0.012913	+	.
Adh	LMEIMC	TSS	2171760	2171761	-0.016584	+	.
Adh	LMEIMC	TSS	2181130	2181131	-0.009871	+	.
Adh	LMEIMC	TSS	2182750	2182751	-0.012117	+	.
Adh	LMEIMC	TSS	2187490	2187491	-0.012629	+	.
Adh	LMEIMC	TSS	2189830	2189831	-0.012587	+	.
Adh	LMEIMC	TSS	2195720	2195721	-0.011148	+	.
Adh	LMEIMC	TSS	2197590	2197591	-0.009992	+	.
Adh	LMEIMC	TSS	2198570	2198571	-0.014727	+	.
Adh	LMEIMC	TSS	2199600	2199601	-0.020550	+	.
Adh	LMEIMC	TSS	2201530	2201531	-0.015404	+	.
Adh	LMEIMC	TSS	2202930	2202931	-0.012174	+	.
Adh	LMEIMC	TSS	2204240	2204241	-0.011642	+	.
Adh	LMEIMC	TSS	2212400	2212401	-0.011621	+	.
Adh	LMEIMC	TSS	2214630	2214631	-0.018158	+	.
Adh	LMEIMC	TSS	2220230	2220231	-0.009361	+	.
Adh	LMEIMC	TSS	2233440	2233441	-0.018278	+	.
Adh	LMEIMC	TSS	2238500	2238501	-0.009592	+	.
Adh	LMEIMC	TSS	2239790	2239791	-0.011538	+	.
Adh	LMEIMC	TSS	2248460	2248461	-0.009019	+	.
Adh	LMEIMC	TSS	2252830	2252831	-0.013189	+	.
Adh	LMEIMC	TSS	2257440	2257441	-0.009453	+	.
Adh	LMEIMC	TSS	2261710	2261711	-0.011910	+	.
Adh	LMEIMC	TSS	2273850	2273851	-0.011088	+	.
Adh	LMEIMC	TSS	2276470	2276471	-0.014493	+	.
Adh	LMEIMC	TSS	2279320	2279321	-0.009430	+	.
Adh	LMEIMC	TSS	2285430	2285431	-0.012275	+	.
Adh	LMEIMC	TSS	2286970	2286971	-0.012629	+	.
Adh	LMEIMC	TSS	2288050	2288051	-0.010540	+	.
Adh	LMEIMC	TSS	2289190	2289191	-0.014275	+	.
Adh	LMEIMC	TSS	2290150	2290151	-0.011111	+	.
Adh	LMEIMC	TSS	2295570	2295571	-0.009303	+	.
Adh	LMEIMC	TSS	2302580	2302581	-0.009308	+	.
Adh	LMEIMC	TSS	2303110	2303111	-0.010399	+	.
Adh	LMEIMC	TSS	2305140	2305141	-0.009034	+	.
Adh	LMEIMC	TSS	2309610	2309611	-0.015497	+	.
Adh	LMEIMC	TSS	2311200	2311201	-0.015448	+	.
Adh	LMEIMC	TSS	2315050	2315051	-0.010492	+	.
Adh	LMEIMC	TSS	2322440	2322441	-0.010838	+	.
Adh	LMEIMC	TSS	2325920	2325921	-0.012567	+	.
Adh	LMEIMC	TSS	2327660	2327661	-0.010970	+	.
Adh	LMEIMC	TSS	2328130	2328131	-0.012828	+	.
Adh	LMEIMC	TSS	2334840	2334841	-0.017815	+	.
Adh	LMEIMC	TSS	2335420	2335421	-0.010670	+	.
Adh	LMEIMC	TSS	2335840	2335841	-0.014644	+	.
Adh	LMEIMC	TSS	2337000	2337001	-0.014141	+	.
Adh	LMEIMC	TSS	2338420	2338421	-0.010303	+	.
Adh	LMEIMC	TSS	2339370	2339371	-0.010382	+	.
Adh	LMEIMC	TSS	2340960	2340961	-0.009700	+	.
Adh	LMEIMC	TSS	2341820	2341821	-0.009673	+	.
Adh	LMEIMC	TSS	2345800	2345801	-0.010231	+	.
Adh	LMEIMC	TSS	2346480	2346481	-0.009306	+	.
Adh	LMEIMC	TSS	2347710	2347711	-0.009377	+	.
Adh	LMEIMC	TSS	2354820	2354821	-0.017983	+	.
Adh	LMEIMC	TSS	2356700	2356701	-0.009952	+	.
Adh	LMEIMC	TSS	2358410	2358411	-0.017996	+	.
Adh	LMEIMC	TSS	2358970	2358971	-0.012406	+	.
Adh	LMEIMC	TSS	2359870	2359871	-0.016015	+	.
Adh	LMEIMC	TSS	2360750	2360751	-0.017972	+	.
Adh	LMEIMC	TSS	2362170	2362171	-0.012695	+	.
Adh	LMEIMC	TSS	2362660	2362661	-0.014520	+	.
Adh	LMEIMC	TSS	2363450	2363451	-0.012839	+	.
Adh	LMEIMC	TSS	2364760	2364761	-0.015848	+	.
Adh	LMEIMC	TSS	2367000	2367001	-0.010637	+	.
Adh	LMEIMC	TSS	2370790	2370791	-0.010647	+	.
Adh	LMEIMC	TSS	2371230	2371231	-0.009909	+	.
Adh	LMEIMC	TSS	2371990	2371991	-0.014399	+	.
Adh	LMEIMC	TSS	2374020	2374021	-0.012437	+	.
Adh	LMEIMC	TSS	2377900	2377901	-0.012451	+	.
Adh	LMEIMC	TSS	2378520	2378521	-0.011040	+	.
Adh	LMEIMC	TSS	2379640	2379641	-0.009266	+	.
Adh	LMEIMC	TSS	2382070	2382071	-0.013819	+	.
Adh	LMEIMC	TSS	2388130	2388131	-0.011349	+	.
Adh	LMEIMC	TSS	2389350	2389351	-0.012753	+	.
Adh	LMEIMC	TSS	2390040	2390041	-0.015836	+	.
Adh	LMEIMC	TSS	2396180	2396181	-0.010427	+	.
Adh	LMEIMC	TSS	2397140	2397141	-0.011064	+	.
Adh	LMEIMC	TSS	2397920	2397921	-0.011627	+	.
Adh	LMEIMC	TSS	2400750	2400751	-0.013573	+	.
Adh	LMEIMC	TSS	2406180	2406181	-0.013637	+	.
Adh	LMEIMC	TSS	2407650	2407651	-0.010109	+	.
Adh	LMEIMC	TSS	2410760	2410761	-0.009587	+	.
Adh	LMEIMC	TSS	2413500	2413501	-0.011863	+	.
Adh	LMEIMC	TSS	2415140	2415141	-0.010319	+	.
Adh	LMEIMC	TSS	2416580	2416581	-0.010090	+	.
Adh	LMEIMC	TSS	2417400	2417401	-0.011822	+	.
Adh	LMEIMC	TSS	2421020	2421021	-0.011203	+	.
Adh	LMEIMC	TSS	2425550	2425551	-0.009568	+	.
Adh	LMEIMC	TSS	2428930	2428931	-0.010930	+	.
Adh	LMEIMC	TSS	2430400	2430401	-0.012059	+	.
Adh	LMEIMC	TSS	2431440	2431441	-0.015134	+	.
Adh	LMEIMC	TSS	2432460	2432461	-0.009465	+	.
Adh	LMEIMC	TSS	2435080	2435081	-0.009898	+	.
Adh	LMEIMC	TSS	2440970	2440971	-0.014117	+	.
Adh	LMEIMC	TSS	2441630	2441631	-0.009532	+	.
Adh	LMEIMC	TSS	2446790	2446791	-0.011199	+	.
Adh	LMEIMC	TSS	2450000	2450001	-0.012675	+	.
Adh	LMEIMC	TSS	2457400	2457401	-0.011203	+	.
Adh	LMEIMC	TSS	2460760	2460761	-0.013885	+	.
Adh	LMEIMC	TSS	2463950	2463951	-0.020709	+	.
Adh	LMEIMC	TSS	2468580	2468581	-0.012535	+	.
Adh	LMEIMC	TSS	2472120	2472121	-0.010927	+	.
Adh	LMEIMC	TSS	2472610	2472611	-0.009258	+	.
Adh	LMEIMC	TSS	2473990	2473991	-0.011003	+	.
Adh	LMEIMC	TSS	2475630	2475631	-0.012919	+	.
Adh	LMEIMC	TSS	2479460	2479461	-0.010764	+	.
Adh	LMEIMC	TSS	2480640	2480641	-0.010307	+	.
Adh	LMEIMC	TSS	2481670	2481671	-0.009955	+	.
Adh	LMEIMC	TSS	2483690	2483691	-0.011396	+	.
Adh	LMEIMC	TSS	2484870	2484871	-0.010016	+	.
Adh	LMEIMC	TSS	2485860	2485861	-0.014298	+	.
Adh	LMEIMC	TSS	2488980	2488981	-0.012862	+	.
Adh	LMEIMC	TSS	2491410	2491411	-0.012967	+	.
Adh	LMEIMC	TSS	2492180	2492181	-0.014724	+	.
Adh	LMEIMC	TSS	2493700	2493701	-0.015258	+	.
Adh	LMEIMC	TSS	2494220	2494221	-0.009424	+	.
Adh	LMEIMC	TSS	2497310	2497311	-0.016925	+	.
Adh	LMEIMC	TSS	2499390	2499391	-0.009513	+	.
Adh	LMEIMC	TSS	2500310	2500311	-0.015177	+	.
Adh	LMEIMC	TSS	2501040	2501041	-0.012518	+	.
Adh	LMEIMC	TSS	2501930	2501931	-0.009496	+	.
Adh	LMEIMC	TSS	2503490	2503491	-0.009054	+	.
Adh	LMEIMC	TSS	2504930	2504931	-0.010798	+	.
Adh	LMEIMC	TSS	2506730	2506731	-0.012621	+	.
Adh	LMEIMC	TSS	2508120	2508121	-0.009302	+	.
Adh	LMEIMC	TSS	2510560	2510561	-0.009994	+	.
Adh	LMEIMC	TSS	2511280	2511281	-0.012318	+	.
Adh	LMEIMC	TSS	2513740	2513741	-0.011650	+	.
Adh	LMEIMC	TSS	2514980	2514981	-0.011758	+	.
Adh	LMEIMC	TSS	2515780	2515781	-0.010576	+	.
Adh	LMEIMC	TSS	2517200	2517201	-0.009022	+	.
Adh	LMEIMC	TSS	2524580	2524581	-0.012553	+	.
Adh	LMEIMC	TSS	2525840	2525841	-0.011256	+	.
Adh	LMEIMC	TSS	2528450	2528451	-0.009495	+	.
Adh	LMEIMC	TSS	2534310	2534311	-0.015603	+	.
Adh	LMEIMC	TSS	2536390	2536391	-0.009734	+	.
Adh	LMEIMC	TSS	2539880	2539881	-0.010744	+	.
Adh	LMEIMC	TSS	2540210	2540211	-0.011603	+	.
Adh	LMEIMC	TSS	2541950	2541951	-0.012985	+	.
Adh	LMEIMC	TSS	2543620	2543621	-0.014890	+	.
Adh	LMEIMC	TSS	2547190	2547191	-0.011573	+	.
Adh	LMEIMC	TSS	2552000	2552001	-0.011264	+	.
Adh	LMEIMC	TSS	2552540	2552541	-0.014683	+	.
Adh	LMEIMC	TSS	2555150	2555151	-0.013045	+	.
Adh	LMEIMC	TSS	2557680	2557681	-0.009842	+	.
Adh	LMEIMC	TSS	2563730	2563731	-0.010324	+	.
Adh	LMEIMC	TSS	2567180	2567181	-0.011100	+	.
Adh	LMEIMC	TSS	2567690	2567691	-0.009205	+	.
Adh	LMEIMC	TSS	2568610	2568611	-0.010947	+	.
Adh	LMEIMC	TSS	2572070	2572071	-0.010621	+	.
Adh	LMEIMC	TSS	2573210	2573211	-0.009636	+	.
Adh	LMEIMC	TSS	2580810	2580811	-0.014949	+	.
Adh	LMEIMC	TSS	2584450	2584451	-0.009998	+	.
Adh	LMEIMC	TSS	2591330	2591331	-0.012141	+	.
Adh	LMEIMC	TSS	2595220	2595221	-0.011462	+	.
Adh	LMEIMC	TSS	2596690	2596691	-0.010552	+	.
Adh	LMEIMC	TSS	2602290	2602291	-0.011985	+	.
Adh	LMEIMC	TSS	2614600	2614601	-0.011536	+	.
Adh	LMEIMC	TSS	2615830	2615831	-0.012065	+	.
Adh	LMEIMC	TSS	2621800	2621801	-0.013477	+	.
Adh	LMEIMC	TSS	2632350	2632351	-0.013939	+	.
Adh	LMEIMC	TSS	2634510	2634511	-0.015167	+	.
Adh	LMEIMC	TSS	2637140	2637141	-0.012812	+	.
Adh	LMEIMC	TSS	2639680	2639681	-0.011253	+	.
Adh	LMEIMC	TSS	2640420	2640421	-0.011889	+	.
Adh	LMEIMC	TSS	2641670	2641671	-0.009348	+	.
Adh	LMEIMC	TSS	2649960	2649961	-0.010963	+	.
Adh	LMEIMC	TSS	2655910	2655911	-0.015404	+	.
Adh	LMEIMC	TSS	2659520	2659521	-0.014836	+	.
Adh	LMEIMC	TSS	2662830	2662831	-0.010044	+	.
Adh	LMEIMC	TSS	2666800	2666801	-0.012288	+	.
Adh	LMEIMC	TSS	2675860	2675861	-0.011622	+	.
Adh	LMEIMC	TSS	2677440	2677441	-0.010354	+	.
Adh	LMEIMC	TSS	2680930	2680931	-0.017184	+	.
Adh	LMEIMC	TSS	2683460	2683461	-0.020644	+	.
Adh	LMEIMC	TSS	2684370	2684371	-0.010901	+	.
Adh	LMEIMC	TSS	2685010	2685011	-0.014649	+	.
Adh	LMEIMC	TSS	2689020	2689021	-0.009133	+	.
Adh	LMEIMC	TSS	2690150	2690151	-0.009007	+	.
Adh	LMEIMC	TSS	2692710	2692711	-0.009440	+	.
Adh	LMEIMC	TSS	2693260	2693261	-0.011360	+	.
Adh	LMEIMC	TSS	2697100	2697101	-0.010466	+	.
Adh	LMEIMC	TSS	2701160	2701161	-0.009138	+	.
Adh	LMEIMC	TSS	2705190	2705191	-0.012286	+	.
Adh	LMEIMC	TSS	2717500	2717501	-0.010578	+	.
Adh	LMEIMC	TSS	2718840	2718841	-0.011209	+	.
Adh	LMEIMC	TSS	2720610	2720611	-0.009161	+	.
Adh	LMEIMC	TSS	2722210	2722211	-0.011810	+	.
Adh	LMEIMC	TSS	2723530	2723531	-0.009326	+	.
Adh	LMEIMC	TSS	2725560	2725561	-0.018035	+	.
Adh	LMEIMC	TSS	2726800	2726801	-0.010202	+	.
Adh	LMEIMC	TSS	2729510	2729511	-0.011771	+	.
Adh	LMEIMC	TSS	2732380	2732381	-0.018748	+	.
Adh	LMEIMC	TSS	2734290	2734291	-0.014720	+	.
Adh	LMEIMC	TSS	2735550	2735551	-0.019686	+	.
Adh	LMEIMC	TSS	2736160	2736161	-0.015113	+	.
Adh	LMEIMC	TSS	2737080	2737081	-0.010429	+	.
Adh	LMEIMC	TSS	2739650	2739651	-0.009836	+	.
Adh	LMEIMC	TSS	2740610	2740611	-0.012594	+	.
Adh	LMEIMC	TSS	2741200	2741201	-0.009373	+	.
Adh	LMEIMC	TSS	2743580	2743581	-0.013460	+	.
Adh	LMEIMC	TSS	2746100	2746101	-0.012348	+	.
Adh	LMEIMC	TSS	2747590	2747591	-0.010105	+	.
Adh	LMEIMC	TSS	2749790	2749791	-0.009488	+	.
Adh	LMEIMC	TSS	2751430	2751431	-0.012423	+	.
Adh	LMEIMC	TSS	2752870	2752871	-0.014447	+	.
Adh	LMEIMC	TSS	2756240	2756241	-0.014703	+	.
Adh	LMEIMC	TSS	2760430	2760431	-0.013683	+	.
Adh	LMEIMC	TSS	2762160	2762161	-0.009029	+	.
Adh	LMEIMC	TSS	2766010	2766011	-0.009196	+	.
Adh	LMEIMC	TSS	2767660	2767661	-0.015244	+	.
Adh	LMEIMC	TSS	2769200	2769201	-0.017834	+	.
Adh	LMEIMC	TSS	2775320	2775321	-0.010487	+	.
Adh	LMEIMC	TSS	2798770	2798771	-0.012598	+	.
Adh	LMEIMC	TSS	2802530	2802531	-0.009756	+	.
Adh	LMEIMC	TSS	2814030	2814031	-0.012219	+	.
Adh	LMEIMC	TSS	2815220	2815221	-0.009812	+	.
Adh	LMEIMC	TSS	2815970	2815971	-0.009277	+	.
Adh	LMEIMC	TSS	2816930	2816931	-0.009326	+	.
Adh	LMEIMC	TSS	2821770	2821771	-0.009968	+	.
Adh	LMEIMC	TSS	2822670	2822671	-0.012199	+	.
Adh	LMEIMC	TSS	2824660	2824661	-0.009621	+	.
Adh	LMEIMC	TSS	2825460	2825461	-0.014758	+	.
Adh	LMEIMC	TSS	2825890	2825891	-0.009196	+	.
Adh	LMEIMC	TSS	2826730	2826731	-0.009437	+	.
Adh	LMEIMC	TSS	2827950	2827951	-0.013754	+	.
Adh	LMEIMC	TSS	2829030	2829031	-0.011233	+	.
Adh	LMEIMC	TSS	2831960	2831961	-0.009557	+	.
Adh	LMEIMC	TSS	2834850	2834851	-0.010715	+	.
Adh	LMEIMC	TSS	2840540	2840541	-0.014143	+	.
Adh	LMEIMC	TSS	2844110	2844111	-0.009603	+	.
Adh	LMEIMC	TSS	2848950	2848951	-0.010028	+	.
Adh	LMEIMC	TSS	2851890	2851891	-0.010103	+	.
Adh	LMEIMC	TSS	2852690	2852691	-0.015911	+	.
Adh	LMEIMC	TSS	2859310	2859311	-0.010069	+	.
Adh	LMEIMC	TSS	2861190	2861191	-0.013091	+	.
Adh	LMEIMC	TSS	2864160	2864161	-0.010289	+	.
Adh	LMEIMC	TSS	2865010	2865011	-0.013989	+	.
Adh	LMEIMC	TSS	2866150	2866151	-0.010441	+	.
Adh	LMEIMC	TSS	2867200	2867201	-0.009723	+	.
Adh	LMEIMC	TSS	2872970	2872971	-0.011392	+	.
Adh	LMEIMC	TSS	2876850	2876851	-0.010396	+	.
Adh	LMEIMC	TSS	2879470	2879471	-0.011880	+	.
Adh	LMEIMC	TSS	2881000	2881001	-0.009962	+	.
Adh	LMEIMC	TSS	2881760	2881761	-0.014611	+	.
Adh	LMEIMC	TSS	2883990	2883991	-0.016284	+	.
Adh	LMEIMC	TSS	2885630	2885631	-0.014267	+	.
Adh	LMEIMC	TSS	2887250	2887251	-0.015876	+	.
Adh	LMEIMC	TSS	2887830	2887831	-0.013812	+	.
Adh	LMEIMC	TSS	2894560	2894561	-0.010228	+	.
Adh	LMEIMC	TSS	2898250	2898251	-0.016016	+	.
Adh	LMEIMC	TSS	2903230	2903231	-0.009874	+	.
Adh	LMEIMC	TSS	2906550	2906551	-0.010625	+	.
Adh	LMEIMC	TSS	2908990	2908991	-0.016772	+	.
Adh	LMEIMC	TSS	2910930	2910931	-0.009371	+	.
Adh	LMEIMC	TSS	2911770	2911771	-0.013122	+	.
Adh	LMEIMC	TSS	2913380	2913381	-0.010380	+	.
Adh	LMEIMC	TSS	2914740	2914741	-0.017608	+	.
Adh	LMEIMC	TSS	2917620	2917621	-0.009594	+	.
Adh	LMEIMC	TSS	2918401	2918402	-0.017374	-	.
Adh	LMEIMC	TSS	2917391	2917392	-0.016461	-	.
Adh	LMEIMC	TSS	2916941	2916942	-0.011231	-	.
Adh	LMEIMC	TSS	2915801	2915802	-0.015258	-	.
Adh	LMEIMC	TSS	2913131	2913132	-0.014298	-	.
Adh	LMEIMC	TSS	2907381	2907382	-0.011379	-	.
Adh	LMEIMC	TSS	2906571	2906572	-0.009326	-	.
Adh	LMEIMC	TSS	2905791	2905792	-0.009449	-	.
Adh	LMEIMC	TSS	2902661	2902662	-0.009234	-	.
Adh	LMEIMC	TSS	2900331	2900332	-0.010836	-	.
Adh	LMEIMC	TSS	2899511	2899512	-0.009675	-	.
Adh	LMEIMC	TSS	2898061	2898062	-0.010821	-	.
Adh	LMEIMC	TSS	2892041	2892042	-0.010996	-	.
Adh	LMEIMC	TSS	2890371	2890372	-0.010773	-	.
Adh	LMEIMC	TSS	2888471	2888472	-0.010528	-	.
Adh	LMEIMC	TSS	2888001	2888002	-0.012227	-	.
Adh	LMEIMC	TSS	2887561	2887562	-0.014556	-	.
Adh	LMEIMC	TSS	2886981	2886982	-0.013600	-	.
Adh	LMEIMC	TSS	2886081	2886082	-0.018492	-	.
Adh	LMEIMC	TSS	2883501	2883502	-0.012795	-	.
Adh	LMEIMC	TSS	2877471	2877472	-0.013478	-	.
Adh	LMEIMC	TSS	2873351	2873352	-0.009749	-	.
Adh	LMEIMC	TSS	2872001	2872002	-0.020387	-	.
Adh	LMEIMC	TSS	2869181	2869182	-0.010376	-	.
Adh	LMEIMC	TSS	2865091	2865092	-0.010509	-	.
Adh	LMEIMC	TSS	2861891	2861892	-0.010380	-	.
Adh	LMEIMC	TSS	2857011	2857012	-0.010746	-	.
Adh	LMEIMC	TSS	2855251	2855252	-0.009364	-	.
Adh	LMEIMC	TSS	2853551	2853552	-0.011335	-	.
Adh	LMEIMC	TSS	2852541	2852542	-0.011347	-	.
Adh	LMEIMC	TSS	2851501	2851502	-0.012630	-	.
Adh	LMEIMC	TSS	2849941	2849942	-0.012999	-	.
Adh	LMEIMC	TSS	2845011	2845012	-0.015553	-	.
Adh	LMEIMC	TSS	2844021	2844022	-0.012334	-	.
Adh	LMEIMC	TSS	2841841	2841842	-0.011615	-	.
Adh	LMEIMC	TSS	2836311	2836312	-0.009308	-	.
Adh	LMEIMC	TSS	2833911	2833912	-0.009900	-	.
Adh	LMEIMC	TSS	2831311	2831312	-0.009949	-	.
Adh	LMEIMC	TSS	2830441	2830442	-0.012565	-	.
Adh	LMEIMC	TSS	2829111	2829112	-0.012454	-	.
Adh	LMEIMC	TSS	2826731	2826732	-0.011703	-	.
Adh	LMEIMC	TSS	2825251	2825252	-0.012899	-	.
Adh	LMEIMC	TSS	2824551	2824552	-0.011281	-	.
Adh	LMEIMC	TSS	2820891	2820892	-0.018158	-	.
Adh	LMEIMC	TSS	2820041	2820042	-0.010840	-	.
Adh	LMEIMC	TSS	2813471	2813472	-0.010689	-	.
Adh	LMEIMC	TSS	2808201	2808202	-0.010076	-	.
Adh	LMEIMC	TSS	2802291	2802292	-0.018738	-	.
Adh	LMEIMC	TSS	2801491	2801492	-0.015322	-	.
Adh	LMEIMC	TSS	2800031	2800032	-0.011414	-	.
Adh	LMEIMC	TSS	2798571	2798572	-0.014647	-	.
Adh	LMEIMC	TSS	2798241	2798242	-0.011088	-	.
Adh	LMEIMC	TSS	2796061	2796062	-0.010236	-	.
Adh	LMEIMC	TSS	2793481	2793482	-0.018938	-	.
Adh	LMEIMC	TSS	2791901	2791902	-0.017332	-	.
Adh	LMEIMC	TSS	2779731	2779732	-0.014894	-	.
Adh	LMEIMC	TSS	2775351	2775352	-0.013660	-	.
Adh	LMEIMC	TSS	2774231	2774232	-0.018674	-	.
Adh	LMEIMC	TSS	2773511	2773512	-0.014711	-	.
Adh	LMEIMC	TSS	2772111	2772112	-0.009142	-	.
Adh	LMEIMC	TSS	2770511	2770512	-0.009397	-	.
Adh	LMEIMC	TSS	2768751	2768752	-0.010888	-	.
Adh	LMEIMC	TSS	2767491	2767492	-0.012631	-	.
Adh	LMEIMC	TSS	2760341	2760342	-0.014473	-	.
Adh	LMEIMC	TSS	2757331	2757332	-0.010942	-	.
Adh	LMEIMC	TSS	2751691	2751692	-0.014750	-	.
Adh	LMEIMC	TSS	2749721	2749722	-0.017200	-	.
Adh	LMEIMC	TSS	2748811	2748812	-0.024171	-	.
Adh	LMEIMC	TSS	2743411	2743412	-0.009881	-	.
Adh	LMEIMC	TSS	2741271	2741272	-0.017577	-	.
Adh	LMEIMC	TSS	2739521	2739522	-0.012369	-	.
Adh	LMEIMC	TSS	2736901	2736902	-0.017278	-	.
Adh	LMEIMC	TSS	2736411	2736412	-0.014998	-	.
Adh	LMEIMC	TSS	2734711	2734712	-0.015541	-	.
Adh	LMEIMC	TSS	2733971	2733972	-0.014431	-	.
Adh	LMEIMC	TSS	2732041	2732042	-0.013682	-	.
Adh	LMEIMC	TSS	2731541	2731542	-0.010512	-	.
Adh	LMEIMC	TSS	2728361	2728362	-0.010147	-	.
Adh	LMEIMC	TSS	2728011	2728012	-0.021239	-	.
Adh	LMEIMC	TSS	2726101	2726102	-0.011831	-	.
Adh	LMEIMC	TSS	2725431	2725432	-0.009221	-	.
Adh	LMEIMC	TSS	2722061	2722062	-0.013877	-	.
Adh	LMEIMC	TSS	2720091	2720092	-0.015819	-	.
Adh	LMEIMC	TSS	2718751	2718752	-0.018992	-	.
Adh	LMEIMC	TSS	2717351	2717352	-0.012283	-	.
Adh	LMEIMC	TSS	2714461	2714462	-0.011581	-	.
Adh	LMEIMC	TSS	2713391	2713392	-0.009276	-	.
Adh	LMEIMC	TSS	2710811	2710812	-0.011649	-	.
Adh	LMEIMC	TSS	2700861	2700862	-0.015223	-	.
Adh	LMEIMC	TSS	2699891	2699892	-0.010434	-	.
Adh	LMEIMC	TSS	2699141	2699142	-0.009690	-	.
Adh	LMEIMC	TSS	2696781	2696782	-0.012778	-	.
Adh	LMEIMC	TSS	2688801	2688802	-0.010186	-	.
Adh	LMEIMC	TSS	2684241	2684242	-0.011282	-	.
Adh	LMEIMC	TSS	2683371	2683372	-0.015374	-	.
Adh	LMEIMC	TSS	2681641	2681642	-0.010146	-	.
Adh	LMEIMC	TSS	2680941	2680942	-0.017670	-	.
Adh	LMEIMC	TSS	2678331	2678332	-0.009101	-	.
Adh	LMEIMC	TSS	2671141	2671142	-0.013062	-	.
Adh	LMEIMC	TSS	2668761	2668762	-0.009631	-	.
Adh	LMEIMC	TSS	2663891	2663892	-0.013081	-	.
Adh	LMEIMC	TSS	2657101	2657102	-0.011263	-	.
Adh	LMEIMC	TSS	2655211	2655212	-0.013291	-	.
Adh	LMEIMC	TSS	2650211	2650212	-0.013881	-	.
Adh	LMEIMC	TSS	2646821	2646822	-0.011589	-	.
Adh	LMEIMC	TSS	2642951	2642952	-0.009675	-	.
Adh	LMEIMC	TSS	2634771	2634772	-0.010096	-	.
Adh	LMEIMC	TSS	2633341	2633342	-0.012068	-	.
Adh	LMEIMC	TSS	2628021	2628022	-0.011714	-	.
Adh	LMEIMC	TSS	2624141	2624142	-0.009245	-	.
Adh	LMEIMC	TSS	2616721	2616722	-0.011045	-	.
Adh	LMEIMC	TSS	2615631	2615632	-0.009985	-	.
Adh	LMEIMC	TSS	2612121	2612122	-0.016561	-	.
Adh	LMEIMC	TSS	2610401	2610402	-0.012728	-	.
Adh	LMEIMC	TSS	2609961	2609962	-0.012366	-	.
Adh	LMEIMC	TSS	2598561	2598562	-0.010756	-	.
Adh	LMEIMC	TSS	2590461	2590462	-0.010009	-	.
Adh	LMEIMC	TSS	2583551	2583552	-0.010665	-	.
Adh	LMEIMC	TSS	2580911	2580912	-0.010932	-	.
Adh	LMEIMC	TSS	2580471	2580472	-0.011971	-	.
Adh	LMEIMC	TSS	2579611	2579612	-0.010346	-	.
Adh	LMEIMC	TSS	2576291	2576292	-0.012409	-	.
Adh	LMEIMC	TSS	2573691	2573692	-0.012933	-	.
Adh	LMEIMC	TSS	2573161	2573162	-0.014131	-	.
Adh	LMEIMC	TSS	2570671	2570672	-0.012200	-	.
Adh	LMEIMC	TSS	2566711	2566712	-0.011114	-	.
Adh	LMEIMC	TSS	2554341	2554342	-0.009973	-	.
Adh	LMEIMC	TSS	2551881	2551882	-0.011954	-	.
Adh	LMEIMC	TSS	2547351	2547352	-0.009463	-	.
Adh	LMEIMC	TSS	2545651	2545652	-0.011920	-	.
Adh	LMEIMC	TSS	2542661	2542662	-0.012520	-	.
Adh	LMEIMC	TSS	2533381	2533382	-0.010614	-	.
Adh	LMEIMC	TSS	2532261	2532262	-0.011196	-	.
Adh	LMEIMC	TSS	2527711	2527712	-0.010331	-	.
Adh	LMEIMC	TSS	2514741	2514742	-0.013699	-	.
Adh	LMEIMC	TSS	2511281	2511282	-0.010144	-	.
Adh	LMEIMC	TSS	2509491	2509492	-0.009491	-	.
Adh	LMEIMC	TSS	2506491	2506492	-0.014670	-	.
Adh	LMEIMC	TSS	2504271	2504272	-0.010445	-	.
Adh	LMEIMC	TSS	2503481	2503482	-0.012398	-	.
Adh	LMEIMC	TSS	2501771	2501772	-0.015801	-	.
Adh	LMEIMC	TSS	2500971	2500972	-0.011719	-	.
Adh	LMEIMC	TSS	2499151	2499152	-0.020090	-	.
Adh	LMEIMC	TSS	2498941	2498942	-0.011088	-	.
Adh	LMEIMC	TSS	2497191	2497192	-0.012950	-	.
Adh	LMEIMC	TSS	2491901	2491902	-0.014903	-	.
Adh	LMEIMC	TSS	2491191	2491192	-0.013069	-	.
Adh	LMEIMC	TSS	2488791	2488792	-0.010905	-	.
Adh	LMEIMC	TSS	2488351	2488352	-0.017892	-	.
Adh	LMEIMC	TSS	2487541	2487542	-0.011386	-	.
Adh	LMEIMC	TSS	2485781	2485782	-0.010465	-	.
Adh	LMEIMC	TSS	2484531	2484532	-0.010473	-	.
Adh	LMEIMC	TSS	2483351	2483352	-0.017332	-	.
Adh	LMEIMC	TSS	2481591	2481592	-0.011699	-	.
Adh	LMEIMC	TSS	2475431	2475432	-0.014554	-	.
Adh	LMEIMC	TSS	2473901	2473902	-0.011369	-	.
Adh	LMEIMC	TSS	2470461	2470462	-0.011281	-	.
Adh	LMEIMC	TSS	2467861	2467862	-0.013387	-	.
Adh	LMEIMC	TSS	2466131	2466132	-0.009940	-	.
Adh	LMEIMC	TSS	2464811	2464812	-0.010188	-	.
Adh	LMEIMC	TSS	2462831	2462832	-0.009468	-	.
Adh	LMEIMC	TSS	2455751	2455752	-0.010613	-	.
Adh	LMEIMC	TSS	2454331	2454332	-0.012870	-	.
Adh	LMEIMC	TSS	2453911	2453912	-0.014210	-	.
Adh	LMEIMC	TSS	2449721	2449722	-0.013691	-	.
Adh	LMEIMC	TSS	2449031	2449032	-0.009703	-	.
Adh	LMEIMC	TSS	2448551	2448552	-0.010083	-	.
Adh	LMEIMC	TSS	2448431	2448432	-0.009968	-	.
Adh	LMEIMC	TSS	2442201	2442202	-0.013528	-	.
Adh	LMEIMC	TSS	2437441	2437442	-0.014622	-	.
Adh	LMEIMC	TSS	2434911	2434912	-0.009564	-	.
Adh	LMEIMC	TSS	2427581	2427582	-0.009201	-	.
Adh	LMEIMC	TSS	2427071	2427072	-0.016733	-	.
Adh	LMEIMC	TSS	2425171	2425172	-0.009833	-	.
Adh	LMEIMC	TSS	2422801	2422802	-0.011178	-	.
Adh	LMEIMC	TSS	2420781	2420782	-0.009267	-	.
Adh	LMEIMC	TSS	2417641	2417642	-0.013670	-	.
Adh	LMEIMC	TSS	2415621	2415622	-0.014217	-	.
Adh	LMEIMC	TSS	2411671	2411672	-0.020409	-	.
Adh	LMEIMC	TSS	2410731	2410732	-0.010944	-	.
Adh	LMEIMC	TSS	2410091	2410092	-0.010133	-	.
Adh	LMEIMC	TSS	2407461	2407462	-0.010597	-	.
Adh	LMEIMC	TSS	2404201	2404202	-0.012210	-	.
Adh	LMEIMC	TSS	2400371	2400372	-0.012554	-	.
Adh	LMEIMC	TSS	2399341	2399342	-0.017454	-	.
Adh	LMEIMC	TSS	2396891	2396892	-0.011580	-	.
Adh	LMEIMC	TSS	2393841	2393842	-0.011361	-	.
Adh	LMEIMC	TSS	2391611	2391612	-0.012348	-	.
Adh	LMEIMC	TSS	2385041	2385042	-0.013573	-	.
Adh	LMEIMC	TSS	2379801	2379802	-0.019277	-	.
Adh	LMEIMC	TSS	2373971	2373972	-0.010004	-	.
Adh	LMEIMC	TSS	2372931	2372932	-0.013947	-	.
Adh	LMEIMC	TSS	2371431	2371432	-0.009559	-	.
Adh	LMEIMC	TSS	2370361	2370362	-0.009487	-	.
Adh	LMEIMC	TSS	2369471	2369472	-0.009566	-	.
Adh	LMEIMC	TSS	2368411	2368412	-0.009995	-	.
Adh	LMEIMC	TSS	2366751	2366752	-0.009873	-	.
Adh	LMEIMC	TSS	2365851	2365852	-0.017750	-	.
Adh	LMEIMC	TSS	2364531	2364532	-0.013937	-	.
Adh	LMEIMC	TSS	2362061	2362062	-0.009512	-	.
Adh	LMEIMC	TSS	2361351	2361352	-0.010767	-	.
Adh	LMEIMC	TSS	2360481	2360482	-0.013322	-	.
Adh	LMEIMC	TSS	2358701	2358702	-0.014754	-	.
Adh	LMEIMC	TSS	2358031	2358032	-0.018776	-	.
Adh	LMEIMC	TSS	2354651	2354652	-0.013168	-	.
Adh	LMEIMC	TSS	2354241	2354242	-0.011477	-	.
Adh	LMEIMC	TSS	2351461	2351462	-0.011590	-	.
Adh	LMEIMC	TSS	2349821	2349822	-0.009230	-	.
Adh	LMEIMC	TSS	2347881	2347882	-0.009071	-	.
Adh	LMEIMC	TSS	2343631	2343632	-0.009654	-	.
Adh	LMEIMC	TSS	2336661	2336662	-0.018700	-	.
Adh	LMEIMC	TSS	2335361	2335362	-0.010949	-	.
Adh	LMEIMC	TSS	2332551	2332552	-0.009579	-	.
Adh	LMEIMC	TSS	2331891	2331892	-0.010266	-	.
Adh	LMEIMC	TSS	2331281	2331282	-0.010592	-	.
Adh	LMEIMC	TSS	2328281	2328282	-0.010570	-	.
Adh	LMEIMC	TSS	2324781	2324782	-0.011541	-	.
Adh	LMEIMC	TSS	2313941	2313942	-0.012311	-	.
Adh	LMEIMC	TSS	2310421	2310422	-0.010461	-	.
Adh	LMEIMC	TSS	2309491	2309492	-0.016374	-	.
Adh	LMEIMC	TSS	2302521	2302522	-0.010683	-	.
Adh	LMEIMC	TSS	2299031	2299032	-0.009993	-	.
Adh	LMEIMC	TSS	2297511	2297512	-0.010290	-	.
Adh	LMEIMC	TSS	2295841	2295842	-0.018861	-	.
Adh	LMEIMC	TSS	2293541	2293542	-0.009746	-	.
Adh	LMEIMC	TSS	2291541	2291542	-0.009198	-	.
Adh	LMEIMC	TSS	2290051	2290052	-0.010778	-	.
Adh	LMEIMC	TSS	2283591	2283592	-0.015190	-	.
Adh	LMEIMC	TSS	2277521	2277522	-0.016238	-	.
Adh	LMEIMC	TSS	2276321	2276322	-0.011511	-	.
Adh	LMEIMC	TSS	2273851	2273852	-0.015114	-	.
Adh	LMEIMC	TSS	2271941	2271942	-0.010279	-	.
Adh	LMEIMC	TSS	2267231	2267232	-0.012508	-	.
Adh	LMEIMC	TSS	2263621	2263622	-0.009645	-	.
Adh	LMEIMC	TSS	2257921	2257922	-0.009650	-	.
Adh	LMEIMC	TSS	2257321	2257322	-0.013446	-	.
Adh	LMEIMC	TSS	2253481	2253482	-0.009239	-	.
Adh	LMEIMC	TSS	2252411	2252412	-0.010846	-	.
Adh	LMEIMC	TSS	2250191	2250192	-0.012810	-	.
Adh	LMEIMC	TSS	2249611	2249612	-0.018369	-	.
Adh	LMEIMC	TSS	2247981	2247982	-0.010272	-	.
Adh	LMEIMC	TSS	2244861	2244862	-0.013102	-	.
Adh	LMEIMC	TSS	2243211	2243212	-0.013319	-	.
Adh	LMEIMC	TSS	2239651	2239652	-0.010045	-	.
Adh	LMEIMC	TSS	2235631	2235632	-0.012456	-	.
Adh	LMEIMC	TSS	2234111	2234112	-0.010987	-	.
Adh	LMEIMC	TSS	2232171	2232172	-0.010462	-	.
Adh	LMEIMC	TSS	2224291	2224292	-0.009662	-	.
Adh	LMEIMC	TSS	2220511	2220512	-0.018672	-	.
Adh	LMEIMC	TSS	2216021	2216022	-0.014634	-	.
Adh	LMEIMC	TSS	2214441	2214442	-0.017790	-	.
Adh	LMEIMC	TSS	2209901	2209902	-0.010273	-	.
Adh	LMEIMC	TSS	2204081	2204082	-0.010863	-	.
Adh	LMEIMC	TSS	2202731	2202732	-0.015614	-	.
Adh	LMEIMC	TSS	2201501	2201502	-0.009294	-	.
Adh	LMEIMC	TSS	2199411	2199412	-0.018962	-	.
Adh	LMEIMC	TSS	2198341	2198342	-0.015170	-	.
Adh	LMEIMC	TSS	2197361	2197362	-0.010841	-	.
Adh	LMEIMC	TSS	2189641	2189642	-0.014870	-	.
Adh	LMEIMC	TSS	2189351	2189352	-0.011321	-	.
Adh	LMEIMC	TSS	2184801	2184802	-0.009829	-	.
Adh	LMEIMC	TSS	2183521	2183522	-0.017725	-	.
Adh	LMEIMC	TSS	2176621	2176622	-0.009182	-	.
Adh	LMEIMC	TSS	2170811	2170812	-0.022263	-	.
Adh	LMEIMC	TSS	2168951	2168952	-0.011596	-	.
Adh	LMEIMC	TSS	2168321	2168322	-0.012585	-	.
Adh	LMEIMC	TSS	2162241	2162242	-0.019425	-	.
Adh	LMEIMC	TSS	2160131	2160132	-0.011040	-	.
Adh	LMEIMC	TSS	2158631	2158632	-0.009694	-	.
Adh	LMEIMC	TSS	2157841	2157842	-0.013166	-	.
Adh	LMEIMC	TSS	2150371	2150372	-0.018426	-	.
Adh	LMEIMC	TSS	2149251	2149252	-0.009300	-	.
Adh	LMEIMC	TSS	2146551	2146552	-0.014238	-	.
Adh	LMEIMC	TSS	2145021	2145022	-0.017790	-	.
Adh	LMEIMC	TSS	2144291	2144292	-0.011662	-	.
Adh	LMEIMC	TSS	2140551	2140552	-0.012007	-	.
Adh	LMEIMC	TSS	2131041	2131042	-0.010625	-	.
Adh	LMEIMC	TSS	2129091	2129092	-0.009213	-	.
Adh	LMEIMC	TSS	2124191	2124192	-0.011503	-	.
Adh	LMEIMC	TSS	2117391	2117392	-0.013365	-	.
Adh	LMEIMC	TSS	2114511	2114512	-0.014528	-	.
Adh	LMEIMC	TSS	2114051	2114052	-0.014290	-	.
Adh	LMEIMC	TSS	2111181	2111182	-0.017104	-	.
Adh	LMEIMC	TSS	2105721	2105722	-0.012819	-	.
Adh	LMEIMC	TSS	2103241	2103242	-0.011239	-	.
Adh	LMEIMC	TSS	2098451	2098452	-0.016717	-	.
Adh	LMEIMC	TSS	2096971	2096972	-0.011951	-	.
Adh	LMEIMC	TSS	2096791	2096792	-0.012327	-	.
Adh	LMEIMC	TSS	2092901	2092902	-0.011024	-	.
Adh	LMEIMC	TSS	2087911	2087912	-0.015075	-	.
Adh	LMEIMC	TSS	2084861	2084862	-0.015857	-	.
Adh	LMEIMC	TSS	2083241	2083242	-0.010328	-	.
Adh	LMEIMC	TSS	2073901	2073902	-0.016593	-	.
Adh	LMEIMC	TSS	2067371	2067372	-0.017366	-	.
Adh	LMEIMC	TSS	2066491	2066492	-0.013579	-	.
Adh	LMEIMC	TSS	2064871	2064872	-0.013721	-	.
Adh	LMEIMC	TSS	2063291	2063292	-0.013333	-	.
Adh	LMEIMC	TSS	2057711	2057712	-0.010044	-	.
Adh	LMEIMC	TSS	2055961	2055962	-0.011986	-	.
Adh	LMEIMC	TSS	2052841	2052842	-0.014946	-	.
Adh	LMEIMC	TSS	2050201	2050202	-0.012720	-	.
Adh	LMEIMC	TSS	2049481	2049482	-0.010717	-	.
Adh	LMEIMC	TSS	2044371	2044372	-0.014469	-	.
Adh	LMEIMC	TSS	2041051	2041052	-0.009330	-	.
Adh	LMEIMC	TSS	2039851	2039852	-0.014115	-	.
Adh	LMEIMC	TSS	2039121	2039122	-0.013450	-	.
Adh	LMEIMC	TSS	2034411	2034412	-0.010606	-	.
Adh	LMEIMC	TSS	2033081	2033082	-0.009556	-	.
Adh	LMEIMC	TSS	2029691	2029692	-0.012565	-	.
Adh	LMEIMC	TSS	2028751	2028752	-0.016124	-	.
Adh	LMEIMC	TSS	2027161	2027162	-0.014225	-	.
Adh	LMEIMC	TSS	2026731	2026732	-0.009392	-	.
Adh	LMEIMC	TSS	2024011	2024012	-0.013344	-	.
Adh	LMEIMC	TSS	2022891	2022892	-0.013367	-	.
Adh	LMEIMC	TSS	2021291	2021292	-0.009067	-	.
Adh	LMEIMC	TSS	2020441	2020442	-0.015963	-	.
Adh	LMEIMC	TSS	2018301	2018302	-0.009771	-	.
Adh	LMEIMC	TSS	2016711	2016712	-0.009635	-	.
Adh	LMEIMC	TSS	2016031	2016032	-0.010863	-	.
Adh	LMEIMC	TSS	2012561	2012562	-0.013231	-	.
Adh	LMEIMC	TSS	2010811	2010812	-0.010951	-	.
Adh	LMEIMC	TSS	2009741	2009742	-0.018947	-	.
Adh	LMEIMC	TSS	2008421	2008422	-0.009864	-	.
Adh	LMEIMC	TSS	2007771	2007772	-0.009961	-	.
Adh	LMEIMC	TSS	2004221	2004222	-0.022703	-	.
Adh	LMEIMC	TSS	2002571	2002572	-0.010673	-	.
Adh	LMEIMC	TSS	2001161	2001162	-0.018768	-	.
Adh	LMEIMC	TSS	2000061	2000062	-0.011879	-	.
Adh	LMEIMC	TSS	1998641	1998642	-0.009360	-	.
Adh	LMEIMC	TSS	1996971	1996972	-0.015081	-	.
Adh	LMEIMC	TSS	1995941	1995942	-0.013840	-	.
Adh	LMEIMC	TSS	1990951	1990952	-0.014725	-	.
Adh	LMEIMC	TSS	1989981	1989982	-0.009502	-	.
Adh	LMEIMC	TSS	1988851	1988852	-0.013888	-	.
Adh	LMEIMC	TSS	1987951	1987952	-0.013475	-	.
Adh	LMEIMC	TSS	1986441	1986442	-0.015587	-	.
Adh	LMEIMC	TSS	1985241	1985242	-0.019007	-	.
Adh	LMEIMC	TSS	1983691	1983692	-0.017426	-	.
Adh	LMEIMC	TSS	1983141	1983142	-0.015221	-	.
Adh	LMEIMC	TSS	1982601	1982602	-0.009556	-	.
Adh	LMEIMC	TSS	1981601	1981602	-0.021955	-	.
Adh	LMEIMC	TSS	1980741	1980742	-0.010730	-	.
Adh	LMEIMC	TSS	1978691	1978692	-0.010118	-	.
Adh	LMEIMC	TSS	1974851	1974852	-0.011793	-	.
Adh	LMEIMC	TSS	1967911	1967912	-0.026302	-	.
Adh	LMEIMC	TSS	1963591	1963592	-0.015211	-	.
Adh	LMEIMC	TSS	1962241	1962242	-0.010591	-	.
Adh	LMEIMC	TSS	1961131	1961132	-0.009814	-	.
Adh	LMEIMC	TSS	1959791	1959792	-0.013180	-	.
Adh	LMEIMC	TSS	1958341	1958342	-0.010144	-	.
Adh	LMEIMC	TSS	1958091	1958092	-0.009273	-	.
Adh	LMEIMC	TSS	1955921	1955922	-0.022534	-	.
Adh	LMEIMC	TSS	1954411	1954412	-0.018118	-	.
Adh	LMEIMC	TSS	1952981	1952982	-0.010386	-	.
Adh	LMEIMC	TSS	1952061	1952062	-0.014821	-	.
Adh	LMEIMC	TSS	1951101	1951102	-0.011415	-	.
Adh	LMEIMC	TSS	1949171	1949172	-0.009615	-	.
Adh	LMEIMC	TSS	1948031	1948032	-0.011058	-	.
Adh	LMEIMC	TSS	1947081	1947082	-0.010622	-	.
Adh	LMEIMC	TSS	1945581	1945582	-0.014113	-	.
Adh	LMEIMC	TSS	1944671	1944672	-0.010411	-	.
Adh	LMEIMC	TSS	1942951	1942952	-0.016687	-	.
Adh	LMEIMC	TSS	1936871	1936872	-0.014024	-	.
Adh	LMEIMC	TSS	1935951	1935952	-0.015459	-	.
Adh	LMEIMC	TSS	1935131	1935132	-0.016360	-	.
Adh	LMEIMC	TSS	1933911	1933912	-0.012181	-	.
Adh	LMEIMC	TSS	1930651	1930652	-0.014353	-	.
Adh	LMEIMC	TSS	1930111	1930112	-0.012504	-	.
Adh	LMEIMC	TSS	1929591	1929592	-0.015917	-	.
Adh	LMEIMC	TSS	1928201	1928202	-0.011230	-	.
Adh	LMEIMC	TSS	1926781	1926782	-0.013001	-	.
Adh	LMEIMC	TSS	1925801	1925802	-0.010861	-	.
Adh	LMEIMC	TSS	1924151	1924152	-0.016471	-	.
Adh	LMEIMC	TSS	1921111	1921112	-0.012162	-	.
Adh	LMEIMC	TSS	1919991	1919992	-0.009650	-	.
Adh	LMEIMC	TSS	1919411	1919412	-0.013783	-	.
Adh	LMEIMC	TSS	1915571	1915572	-0.018386	-	.
Adh	LMEIMC	TSS	1912421	1912422	-0.014848	-	.
Adh	LMEIMC	TSS	1910271	1910272	-0.013739	-	.
Adh	LMEIMC	TSS	1908911	1908912	-0.012813	-	.
Adh	LMEIMC	TSS	1908431	1908432	-0.016595	-	.
Adh	LMEIMC	TSS	1907981	1907982	-0.013553	-	.
Adh	LMEIMC	TSS	1907041	1907042	-0.010141	-	.
Adh	LMEIMC	TSS	1904791	1904792	-0.010948	-	.
Adh	LMEIMC	TSS	1903311	1903312	-0.016572	-	.
Adh	LMEIMC	TSS	1901181	1901182	-0.016231	-	.
Adh	LMEIMC	TSS	1899731	1899732	-0.011230	-	.
Adh	LMEIMC	TSS	1897471	1897472	-0.011133	-	.
Adh	LMEIMC	TSS	1895881	1895882	-0.015295	-	.
Adh	LMEIMC	TSS	1895451	1895452	-0.013117	-	.
Adh	LMEIMC	TSS	1894381	1894382	-0.016058	-	.
Adh	LMEIMC	TSS	1893641	1893642	-0.011150	-	.
Adh	LMEIMC	TSS	1893341	1893342	-0.014497	-	.
Adh	LMEIMC	TSS	1891071	1891072	-0.010974	-	.
Adh	LMEIMC	TSS	1890041	1890042	-0.013629	-	.
Adh	LMEIMC	TSS	1888451	1888452	-0.016056	-	.
Adh	LMEIMC	TSS	1887671	1887672	-0.017753	-	.
Adh	LMEIMC	TSS	1885141	1885142	-0.017112	-	.
Adh	LMEIMC	TSS	1883211	1883212	-0.013928	-	.
Adh	LMEIMC	TSS	1881911	1881912	-0.021159	-	.
Adh	LMEIMC	TSS	1881511	1881512	-0.013970	-	.
Adh	LMEIMC	TSS	1880651	1880652	-0.012218	-	.
Adh	LMEIMC	TSS	1879111	1879112	-0.019514	-	.
Adh	LMEIMC	TSS	1878321	1878322	-0.009731	-	.
Adh	LMEIMC	TSS	1877461	1877462	-0.014130	-	.
Adh	LMEIMC	TSS	1875651	1875652	-0.010866	-	.
Adh	LMEIMC	TSS	1872591	1872592	-0.010337	-	.
Adh	LMEIMC	TSS	1870311	1870312	-0.013636	-	.
Adh	LMEIMC	TSS	1869461	1869462	-0.013708	-	.
Adh	LMEIMC	TSS	1866951	1866952	-0.015380	-	.
Adh	LMEIMC	TSS	1865681	1865682	-0.017863	-	.
Adh	LMEIMC	TSS	1865221	1865222	-0.011175	-	.
Adh	LMEIMC	TSS	1864091	1864092	-0.013588	-	.
Adh	LMEIMC	TSS	1862691	1862692	-0.011857	-	.
Adh	LMEIMC	TSS	1858711	1858712	-0.018570	-	.
Adh	LMEIMC	TSS	1857871	1857872	-0.019141	-	.
Adh	LMEIMC	TSS	1855641	1855642	-0.009650	-	.
Adh	LMEIMC	TSS	1853171	1853172	-0.011343	-	.
Adh	LMEIMC	TSS	1852261	1852262	-0.013225	-	.
Adh	LMEIMC	TSS	1851111	1851112	-0.018888	-	.
Adh	LMEIMC	TSS	1850171	1850172	-0.010739	-	.
Adh	LMEIMC	TSS	1848571	1848572	-0.010408	-	.
Adh	LMEIMC	TSS	1848051	1848052	-0.011695	-	.
Adh	LMEIMC	TSS	1846921	1846922	-0.014739	-	.
Adh	LMEIMC	TSS	1843301	1843302	-0.009161	-	.
Adh	LMEIMC	TSS	1843071	1843072	-0.010351	-	.
Adh	LMEIMC	TSS	1840811	1840812	-0.012172	-	.
Adh	LMEIMC	TSS	1833491	1833492	-0.009093	-	.
Adh	LMEIMC	TSS	1830691	1830692	-0.009211	-	.
Adh	LMEIMC	TSS	1829521	1829522	-0.010436	-	.
Adh	LMEIMC	TSS	1827261	1827262	-0.013602	-	.
Adh	LMEIMC	TSS	1820191	1820192	-0.012809	-	.
Adh	LMEIMC	TSS	1816521	1816522	-0.011938	-	.
Adh	LMEIMC	TSS	1815451	1815452	-0.012370	-	.
Adh	LMEIMC	TSS	1811631	1811632	-0.013258	-	.
Adh	LMEIMC	TSS	1809561	1809562	-0.011585	-	.
Adh	LMEIMC	TSS	1808741	1808742	-0.018449	-	.
Adh	LMEIMC	TSS	1805881	1805882	-0.019248	-	.
Adh	LMEIMC	TSS	1804371	1804372	-0.018333	-	.
Adh	LMEIMC	TSS	1801961	1801962	-0.014855	-	.
Adh	LMEIMC	TSS	1801131	1801132	-0.013389	-	.
Adh	LMEIMC	TSS	1795961	1795962	-0.010547	-	.
Adh	LMEIMC	TSS	1794491	1794492	-0.009626	-	.
Adh	LMEIMC	TSS	1792201	1792202	-0.014659	-	.
Adh	LMEIMC	TSS	1791231	1791232	-0.010266	-	.
Adh	LMEIMC	TSS	1790701	1790702	-0.012580	-	.
Adh	LMEIMC	TSS	1789641	1789642	-0.011437	-	.
Adh	LMEIMC	TSS	1788461	1788462	-0.009593	-	.
Adh	LMEIMC	TSS	1787961	1787962	-0.012469	-	.
Adh	LMEIMC	TSS	1787431	1787432	-0.009596	-	.
Adh	LMEIMC	TSS	1785621	1785622	-0.011081	-	.
Adh	LMEIMC	TSS	1785451	1785452	-0.010396	-	.
Adh	LMEIMC	TSS	1784921	1784922	-0.014339	-	.
Adh	LMEIMC	TSS	1783561	1783562	-0.013393	-	.
Adh	LMEIMC	TSS	1782961	1782962	-0.018239	-	.
Adh	LMEIMC	TSS	1780631	1780632	-0.010209	-	.
Adh	LMEIMC	TSS	1776841	1776842	-0.014236	-	.
Adh	LMEIMC	TSS	1773841	1773842	-0.014070	-	.
Adh	LMEIMC	TSS	1772501	1772502	-0.015074	-	.
Adh	LMEIMC	TSS	1768761	1768762	-0.010201	-	.
Adh	LMEIMC	TSS	1767631	1767632	-0.011765	-	.
Adh	LMEIMC	TSS	1766681	1766682	-0.011497	-	.
Adh	LMEIMC	TSS	1764641	1764642	-0.009073	-	.
Adh	LMEIMC	TSS	1763561	1763562	-0.018996	-	.
Adh	LMEIMC	TSS	1762761	1762762	-0.016779	-	.
Adh	LMEIMC	TSS	1761101	1761102	-0.014625	-	.
Adh	LMEIMC	TSS	1760441	1760442	-0.010096	-	.
Adh	LMEIMC	TSS	1759761	1759762	-0.012407	-	.
Adh	LMEIMC	TSS	1756111	1756112	-0.011945	-	.
Adh	LMEIMC	TSS	1755431	1755432	-0.013139	-	.
Adh	LMEIMC	TSS	1754301	1754302	-0.027542	-	.
Adh	LMEIMC	TSS	1749821	1749822	-0.012028	-	.
Adh	LMEIMC	TSS	1747321	1747322	-0.011988	-	.
Adh	LMEIMC	TSS	1746721	1746722	-0.012293	-	.
Adh	LMEIMC	TSS	1738521	1738522	-0.010764	-	.
Adh	LMEIMC	TSS	1737041	1737042	-0.014381	-	.
Adh	LMEIMC	TSS	1734701	1734702	-0.019829	-	.
Adh	LMEIMC	TSS	1732901	1732902	-0.013144	-	.
Adh	LMEIMC	TSS	1731711	1731712	-0.010183	-	.
Adh	LMEIMC	TSS	1730811	1730812	-0.011277	-	.
Adh	LMEIMC	TSS	1730461	1730462	-0.015169	-	.
Adh	LMEIMC	TSS	1729411	1729412	-0.009547	-	.
Adh	LMEIMC	TSS	1728441	1728442	-0.011887	-	.
Adh	LMEIMC	TSS	1727711	1727712	-0.012908	-	.
Adh	LMEIMC	TSS	1724951	1724952	-0.009427	-	.
Adh	LMEIMC	TSS	1722951	1722952	-0.015539	-	.
Adh	LMEIMC	TSS	1721221	1721222	-0.017667	-	.
Adh	LMEIMC	TSS	1718881	1718882	-0.013411	-	.
Adh	LMEIMC	TSS	1715621	1715622	-0.013499	-	.
Adh	LMEIMC	TSS	1714981	1714982	-0.012109	-	.
Adh	LMEIMC	TSS	1712951	1712952	-0.013659	-	.
Adh	LMEIMC	TSS	1706591	1706592	-0.009936	-	.
Adh	LMEIMC	TSS	1705241	1705242	-0.009066	-	.
Adh	LMEIMC	TSS	1704081	1704082	-0.012793	-	.
Adh	LMEIMC	TSS	1701051	1701052	-0.010644	-	.
Adh	LMEIMC	TSS	1698541	1698542	-0.010906	-	.
Adh	LMEIMC	TSS	1696831	1696832	-0.013139	-	.
Adh	LMEIMC	TSS	1694291	1694292	-0.012817	-	.
Adh	LMEIMC	TSS	1692381	1692382	-0.009553	-	.
Adh	LMEIMC	TSS	1689981	1689982	-0.012311	-	.
Adh	LMEIMC	TSS	1688351	1688352	-0.013392	-	.
Adh	LMEIMC	TSS	1684251	1684252	-0.009914	-	.
Adh	LMEIMC	TSS	1682581	1682582	-0.010197	-	.
Adh	LMEIMC	TSS	1678661	1678662	-0.009469	-	.
Adh	LMEIMC	TSS	1676061	1676062	-0.015258	-	.
Adh	LMEIMC	TSS	1672451	1672452	-0.011429	-	.
Adh	LMEIMC	TSS	1671091	1671092	-0.017475	-	.
Adh	LMEIMC	TSS	1665961	1665962	-0.010531	-	.
Adh	LMEIMC	TSS	1661051	1661052	-0.009735	-	.
Adh	LMEIMC	TSS	1658331	1658332	-0.010608	-	.
Adh	LMEIMC	TSS	1657461	1657462	-0.010284	-	.
Adh	LMEIMC	TSS	1653301	1653302	-0.011044	-	.
Adh	LMEIMC	TSS	1653081	1653082	-0.012617	-	.
Adh	LMEIMC	TSS	1650881	1650882	-0.014240	-	.
Adh	LMEIMC	TSS	1649681	1649682	-0.010572	-	.
Adh	LMEIMC	TSS	1647851	1647852	-0.009442	-	.
Adh	LMEIMC	TSS	1644991	1644992	-0.011912	-	.
Adh	LMEIMC	TSS	1642211	1642212	-0.011146	-	.
Adh	LMEIMC	TSS	1639631	1639632	-0.010238	-	.
Adh	LMEIMC	TSS	1638381	1638382	-0.016427	-	.
Adh	LMEIMC	TSS	1634581	1634582	-0.011006	-	.
Adh	LMEIMC	TSS	1633181	1633182	-0.009066	-	.
Adh	LMEIMC	TSS	1630711	1630712	-0.010167	-	.
Adh	LMEIMC	TSS	1629021	1629022	-0.009352	-	.
Adh	LMEIMC	TSS	1624471	1624472	-0.010099	-	.
Adh	LMEIMC	TSS	1622251	1622252	-0.020139	-	.
Adh	LMEIMC	TSS	1620691	1620692	-0.011772	-	.
Adh	LMEIMC	TSS	1620081	1620082	-0.012131	-	.
Adh	LMEIMC	TSS	1619061	1619062	-0.013615	-	.
Adh	LMEIMC	TSS	1618311	1618312	-0.010407	-	.
Adh	LMEIMC	TSS	1616731	1616732	-0.016524	-	.
Adh	LMEIMC	TSS	1614481	1614482	-0.011341	-	.
Adh	LMEIMC	TSS	1609751	1609752	-0.009041	-	.
Adh	LMEIMC	TSS	1605251	1605252	-0.009853	-	.
Adh	LMEIMC	TSS	1604481	1604482	-0.010264	-	.
Adh	LMEIMC	TSS	1603211	1603212	-0.012943	-	.
Adh	LMEIMC	TSS	1600031	1600032	-0.014550	-	.
Adh	LMEIMC	TSS	1595341	1595342	-0.019180	-	.
Adh	LMEIMC	TSS	1594361	1594362	-0.013613	-	.
Adh	LMEIMC	TSS	1591761	1591762	-0.016640	-	.
Adh	LMEIMC	TSS	1590371	1590372	-0.015784	-	.
Adh	LMEIMC	TSS	1588891	1588892	-0.016562	-	.
Adh	LMEIMC	TSS	1587591	1587592	-0.009491	-	.
Adh	LMEIMC	TSS	1583111	1583112	-0.011330	-	.
Adh	LMEIMC	TSS	1581701	1581702	-0.013954	-	.
Adh	LMEIMC	TSS	1576781	1576782	-0.012395	-	.
Adh	LMEIMC	TSS	1575111	1575112	-0.013433	-	.
Adh	LMEIMC	TSS	1574041	1574042	-0.009676	-	.
Adh	LMEIMC	TSS	1567111	1567112	-0.009008	-	.
Adh	LMEIMC	TSS	1564271	1564272	-0.013745	-	.
Adh	LMEIMC	TSS	1561971	1561972	-0.014495	-	.
Adh	LMEIMC	TSS	1561091	1561092	-0.012079	-	.
Adh	LMEIMC	TSS	1557191	1557192	-0.013519	-	.
Adh	LMEIMC	TSS	1555071	1555072	-0.009382	-	.
Adh	LMEIMC	TSS	1550101	1550102	-0.012461	-	.
Adh	LMEIMC	TSS	1548701	1548702	-0.012684	-	.
Adh	LMEIMC	TSS	1546811	1546812	-0.013950	-	.
Adh	LMEIMC	TSS	1541611	1541612	-0.015737	-	.
Adh	LMEIMC	TSS	1541421	1541422	-0.011603	-	.
Adh	LMEIMC	TSS	1540491	1540492	-0.009521	-	.
Adh	LMEIMC	TSS	1535461	1535462	-0.009390	-	.
Adh	LMEIMC	TSS	1533351	1533352	-0.011437	-	.
Adh	LMEIMC	TSS	1531951	1531952	-0.014210	-	.
Adh	LMEIMC	TSS	1530531	1530532	-0.017489	-	.
Adh	LMEIMC	TSS	1525091	1525092	-0.013280	-	.
Adh	LMEIMC	TSS	1521561	1521562	-0.011077	-	.
Adh	LMEIMC	TSS	1515251	1515252	-0.011455	-	.
Adh	LMEIMC	TSS	1511291	1511292	-0.014295	-	.
Adh	LMEIMC	TSS	1505851	1505852	-0.011832	-	.
Adh	LMEIMC	TSS	1504661	1504662	-0.009167	-	.
Adh	LMEIMC	TSS	1503351	1503352	-0.015128	-	.
Adh	LMEIMC	TSS	1501931	1501932	-0.011918	-	.
Adh	LMEIMC	TSS	1501451	1501452	-0.009474	-	.
Adh	LMEIMC	TSS	1500811	1500812	-0.009219	-	.
Adh	LMEIMC	TSS	1496831	1496832	-0.009904	-	.
Adh	LMEIMC	TSS	1496271	1496272	-0.010366	-	.
Adh	LMEIMC	TSS	1495311	1495312	-0.009329	-	.
Adh	LMEIMC	TSS	1492201	1492202	-0.009518	-	.
Adh	LMEIMC	TSS	1491261	1491262	-0.014483	-	.
Adh	LMEIMC	TSS	1489591	1489592	-0.017844	-	.
Adh	LMEIMC	TSS	1487311	1487312	-0.013137	-	.
Adh	LMEIMC	TSS	1485291	1485292	-0.021366	-	.
Adh	LMEIMC	TSS	1484451	1484452	-0.013297	-	.
Adh	LMEIMC	TSS	1482111	1482112	-0.009761	-	.
Adh	LMEIMC	TSS	1478461	1478462	-0.009040	-	.
Adh	LMEIMC	TSS	1474071	1474072	-0.029322	-	.
Adh	LMEIMC	TSS	1469361	1469362	-0.012730	-	.
Adh	LMEIMC	TSS	1466591	1466592	-0.012403	-	.
Adh	LMEIMC	TSS	1466101	1466102	-0.015037	-	.
Adh	LMEIMC	TSS	1464951	1464952	-0.017024	-	.
Adh	LMEIMC	TSS	1464441	1464442	-0.016917	-	.
Adh	LMEIMC	TSS	1461981	1461982	-0.011942	-	.
Adh	LMEIMC	TSS	1461091	1461092	-0.014607	-	.
Adh	LMEIMC	TSS	1456201	1456202	-0.011926	-	.
Adh	LMEIMC	TSS	1451651	1451652	-0.010270	-	.
Adh	LMEIMC	TSS	1446491	1446492	-0.014593	-	.
Adh	LMEIMC	TSS	1442651	1442652	-0.010660	-	.
Adh	LMEIMC	TSS	1439281	1439282	-0.011812	-	.
Adh	LMEIMC	TSS	1435201	1435202	-0.014461	-	.
Adh	LMEIMC	TSS	1433321	1433322	-0.010496	-	.
Adh	LMEIMC	TSS	1432061	1432062	-0.013938	-	.
Adh	LMEIMC	TSS	1431291	1431292	-0.016409	-	.
Adh	LMEIMC	TSS	1429601	1429602	-0.024752	-	.
Adh	LMEIMC	TSS	1428891	1428892	-0.012461	-	.
Adh	LMEIMC	TSS	1424731	1424732	-0.012469	-	.
Adh	LMEIMC	TSS	1423411	1423412	-0.009282	-	.
Adh	LMEIMC	TSS	1419951	1419952	-0.009225	-	.
Adh	LMEIMC	TSS	1411641	1411642	-0.014068	-	.
Adh	LMEIMC	TSS	1410971	1410972	-0.015612	-	.
Adh	LMEIMC	TSS	1409251	1409252	-0.009837	-	.
Adh	LMEIMC	TSS	1407961	1407962	-0.019933	-	.
Adh	LMEIMC	TSS	1406931	1406932	-0.014850	-	.
Adh	LMEIMC	TSS	1405791	1405792	-0.011232	-	.
Adh	LMEIMC	TSS	1399901	1399902	-0.015389	-	.
Adh	LMEIMC	TSS	1396561	1396562	-0.011848	-	.
Adh	LMEIMC	TSS	1395751	1395752	-0.016851	-	.
Adh	LMEIMC	TSS	1394061	1394062	-0.015272	-	.
Adh	LMEIMC	TSS	1393091	1393092	-0.016845	-	.
Adh	LMEIMC	TSS	1390751	1390752	-0.009711	-	.
Adh	LMEIMC	TSS	1388641	1388642	-0.013628	-	.
Adh	LMEIMC	TSS	1384961	1384962	-0.011664	-	.
Adh	LMEIMC	TSS	1384151	1384152	-0.013362	-	.
Adh	LMEIMC	TSS	1381891	1381892	-0.011964	-	.
Adh	LMEIMC	TSS	1381151	1381152	-0.012941	-	.
Adh	LMEIMC	TSS	1377031	1377032	-0.012816	-	.
Adh	LMEIMC	TSS	1376171	1376172	-0.012138	-	.
Adh	LMEIMC	TSS	1371911	1371912	-0.015237	-	.
Adh	LMEIMC	TSS	1370361	1370362	-0.012226	-	.
Adh	LMEIMC	TSS	1367881	1367882	-0.010932	-	.
Adh	LMEIMC	TSS	1366921	1366922	-0.012518	-	.
Adh	LMEIMC	TSS	1363421	1363422	-0.013146	-	.
Adh	LMEIMC	TSS	1359751	1359752	-0.009277	-	.
Adh	LMEIMC	TSS	1356111	1356112	-0.010080	-	.
Adh	LMEIMC	TSS	1351191	1351192	-0.015918	-	.
Adh	LMEIMC	TSS	1345581	1345582	-0.019509	-	.
Adh	LMEIMC	TSS	1343361	1343362	-0.012851	-	.
Adh	LMEIMC	TSS	1342481	1342482	-0.011699	-	.
Adh	LMEIMC	TSS	1341321	1341322	-0.009385	-	.
Adh	LMEIMC	TSS	1338251	1338252	-0.011534	-	.
Adh	LMEIMC	TSS	1333521	1333522	-0.016652	-	.
Adh	LMEIMC	TSS	1331721	1331722	-0.016070	-	.
Adh	LMEIMC	TSS	1330701	1330702	-0.012434	-	.
Adh	LMEIMC	TSS	1323521	1323522	-0.011855	-	.
Adh	LMEIMC	TSS	1316191	1316192	-0.009203	-	.
Adh	LMEIMC	TSS	1315531	1315532	-0.013067	-	.
Adh	LMEIMC	TSS	1314941	1314942	-0.010584	-	.
Adh	LMEIMC	TSS	1310471	1310472	-0.013322	-	.
Adh	LMEIMC	TSS	1307641	1307642	-0.009550	-	.
Adh	LMEIMC	TSS	1307081	1307082	-0.009723	-	.
Adh	LMEIMC	TSS	1305931	1305932	-0.017299	-	.
Adh	LMEIMC	TSS	1303071	1303072	-0.009143	-	.
Adh	LMEIMC	TSS	1298941	1298942	-0.009302	-	.
Adh	LMEIMC	TSS	1297891	1297892	-0.010122	-	.
Adh	LMEIMC	TSS	1294001	1294002	-0.010993	-	.
Adh	LMEIMC	TSS	1289331	1289332	-0.013834	-	.
Adh	LMEIMC	TSS	1288361	1288362	-0.010797	-	.
Adh	LMEIMC	TSS	1285111	1285112	-0.015660	-	.
Adh	LMEIMC	TSS	1283611	1283612	-0.012775	-	.
Adh	LMEIMC	TSS	1282571	1282572	-0.010360	-	.
Adh	LMEIMC	TSS	1280421	1280422	-0.012069	-	.
Adh	LMEIMC	TSS	1279711	1279712	-0.009059	-	.
Adh	LMEIMC	TSS	1278301	1278302	-0.016935	-	.
Adh	LMEIMC	TSS	1274121	1274122	-0.011562	-	.
Adh	LMEIMC	TSS	1272491	1272492	-0.009472	-	.
Adh	LMEIMC	TSS	1270931	1270932	-0.010674	-	.
Adh	LMEIMC	TSS	1269121	1269122	-0.019321	-	.
Adh	LMEIMC	TSS	1265101	1265102	-0.011469	-	.
Adh	LMEIMC	TSS	1263671	1263672	-0.009126	-	.
Adh	LMEIMC	TSS	1261591	1261592	-0.009971	-	.
Adh	LMEIMC	TSS	1255631	1255632	-0.009772	-	.
Adh	LMEIMC	TSS	1253061	1253062	-0.010096	-	.
Adh	LMEIMC	TSS	1252041	1252042	-0.011314	-	.
Adh	LMEIMC	TSS	1250551	1250552	-0.010594	-	.
Adh	LMEIMC	TSS	1247611	1247612	-0.011076	-	.
Adh	LMEIMC	TSS	1245091	1245092	-0.009836	-	.
Adh	LMEIMC	TSS	1243971	1243972	-0.015737	-	.
Adh	LMEIMC	TSS	1243181	1243182	-0.010408	-	.
Adh	LMEIMC	TSS	1241591	1241592	-0.012884	-	.
Adh	LMEIMC	TSS	1240411	1240412	-0.015320	-	.
Adh	LMEIMC	TSS	1239271	1239272	-0.009593	-	.
Adh	LMEIMC	TSS	1236751	1236752	-0.013721	-	.
Adh	LMEIMC	TSS	1234821	1234822	-0.009136	-	.
Adh	LMEIMC	TSS	1233551	1233552	-0.011308	-	.
Adh	LMEIMC	TSS	1231031	1231032	-0.013775	-	.
Adh	LMEIMC	TSS	1225831	1225832	-0.016348	-	.
Adh	LMEIMC	TSS	1223491	1223492	-0.011344	-	.
Adh	LMEIMC	TSS	1220681	1220682	-0.010696	-	.
Adh	LMEIMC	TSS	1218621	1218622	-0.013263	-	.
Adh	LMEIMC	TSS	1217121	1217122	-0.009451	-	.
Adh	LMEIMC	TSS	1215031	1215032	-0.011899	-	.
Adh	LMEIMC	TSS	1211081	1211082	-0.010816	-	.
Adh	LMEIMC	TSS	1206621	1206622	-0.021285	-	.
Adh	LMEIMC	TSS	1203061	1203062	-0.011639	-	.
Adh	LMEIMC	TSS	1198551	1198552	-0.017556	-	.
Adh	LMEIMC	TSS	1197621	1197622	-0.016168	-	.
Adh	LMEIMC	TSS	1196081	1196082	-0.013040	-	.
Adh	LMEIMC	TSS	1193451	1193452	-0.011783	-	.
Adh	LMEIMC	TSS	1191651	1191652	-0.009706	-	.
Adh	LMEIMC	TSS	1187681	1187682	-0.012459	-	.
Adh	LMEIMC	TSS	1183031	1183032	-0.014632	-	.
Adh	LMEIMC	TSS	1182321	1182322	-0.014509	-	.
Adh	LMEIMC	TSS	1179511	1179512	-0.010010	-	.
Adh	LMEIMC	TSS	1174731	1174732	-0.009492	-	.
Adh	LMEIMC	TSS	1172551	1172552	-0.013673	-	.
Adh	LMEIMC	TSS	1169361	1169362	-0.009966	-	.
Adh	LMEIMC	TSS	1163571	1163572	-0.012601	-	.
Adh	LMEIMC	TSS	1160401	1160402	-0.014886	-	.
Adh	LMEIMC	TSS	1158511	1158512	-0.011420	-	.
Adh	LMEIMC	TSS	1158351	1158352	-0.010400	-	.
Adh	LMEIMC	TSS	1156921	1156922	-0.017152	-	.
Adh	LMEIMC	TSS	1155931	1155932	-0.009325	-	.
Adh	LMEIMC	TSS	1153741	1153742	-0.009356	-	.
Adh	LMEIMC	TSS	1152851	1152852	-0.011039	-	.
Adh	LMEIMC	TSS	1152231	1152232	-0.010601	-	.
Adh	LMEIMC	TSS	1151921	1151922	-0.011338	-	.
Adh	LMEIMC	TSS	1150371	1150372	-0.015887	-	.
Adh	LMEIMC	TSS	1148391	1148392	-0.009345	-	.
Adh	LMEIMC	TSS	1146961	1146962	-0.011077	-	.
Adh	LMEIMC	TSS	1145581	1145582	-0.013421	-	.
Adh	LMEIMC	TSS	1144171	1144172	-0.017194	-	.
Adh	LMEIMC	TSS	1137261	1137262	-0.011291	-	.
Adh	LMEIMC	TSS	1136111	1136112	-0.011281	-	.
Adh	LMEIMC	TSS	1135331	1135332	-0.014075	-	.
Adh	LMEIMC	TSS	1133741	1133742	-0.010438	-	.
Adh	LMEIMC	TSS	1131951	1131952	-0.011145	-	.
Adh	LMEIMC	TSS	1128851	1128852	-0.010091	-	.
Adh	LMEIMC	TSS	1128411	1128412	-0.013802	-	.
Adh	LMEIMC	TSS	1126391	1126392	-0.010860	-	.
Adh	LMEIMC	TSS	1118881	1118882	-0.010133	-	.
Adh	LMEIMC	TSS	1117351	1117352	-0.011968	-	.
Adh	LMEIMC	TSS	1116191	1116192	-0.010132	-	.
Adh	LMEIMC	TSS	1114981	1114982	-0.014591	-	.
Adh	LMEIMC	TSS	1114461	1114462	-0.009732	-	.
Adh	LMEIMC	TSS	1106031	1106032	-0.009489	-	.
Adh	LMEIMC	TSS	1104331	1104332	-0.013932	-	.
Adh	LMEIMC	TSS	1103791	1103792	-0.010206	-	.
Adh	LMEIMC	TSS	1101111	1101112	-0.010869	-	.
Adh	LMEIMC	TSS	1100221	1100222	-0.010046	-	.
Adh	LMEIMC	TSS	1099791	1099792	-0.017417	-	.
Adh	LMEIMC	TSS	1098861	1098862	-0.010418	-	.
Adh	LMEIMC	TSS	1096141	1096142	-0.012575	-	.
Adh	LMEIMC	TSS	1092221	1092222	-0.012517	-	.
Adh	LMEIMC	TSS	1089991	1089992	-0.014669	-	.
Adh	LMEIMC	TSS	1089161	1089162	-0.010790	-	.
Adh	LMEIMC	TSS	1088191	1088192	-0.013256	-	.
Adh	LMEIMC	TSS	1086521	1086522	-0.011031	-	.
Adh	LMEIMC	TSS	1084321	1084322	-0.015893	-	.
Adh	LMEIMC	TSS	1079641	1079642	-0.010040	-	.
Adh	LMEIMC	TSS	1077501	1077502	-0.016561	-	.
Adh	LMEIMC	TSS	1076541	1076542	-0.012427	-	.
Adh	LMEIMC	TSS	1074841	1074842	-0.023706	-	.
Adh	LMEIMC	TSS	1073061	1073062	-0.011298	-	.
Adh	LMEIMC	TSS	1071961	1071962	-0.012818	-	.
Adh	LMEIMC	TSS	1071481	1071482	-0.011394	-	.
Adh	LMEIMC	TSS	1069411	1069412	-0.010968	-	.
Adh	LMEIMC	TSS	1068421	1068422	-0.013789	-	.
Adh	LMEIMC	TSS	1066461	1066462	-0.010403	-	.
Adh	LMEIMC	TSS	1065491	1065492	-0.011331	-	.
Adh	LMEIMC	TSS	1063731	1063732	-0.012502	-	.
Adh	LMEIMC	TSS	1062051	1062052	-0.011601	-	.
Adh	LMEIMC	TSS	1060991	1060992	-0.015774	-	.
Adh	LMEIMC	TSS	1060131	1060132	-0.012777	-	.
Adh	LMEIMC	TSS	1058621	1058622	-0.010625	-	.
Adh	LMEIMC	TSS	1055251	1055252	-0.009681	-	.
Adh	LMEIMC	TSS	1054471	1054472	-0.015940	-	.
Adh	LMEIMC	TSS	1053641	1053642	-0.010960	-	.
Adh	LMEIMC	TSS	1052931	1052932	-0.012465	-	.
Adh	LMEIMC	TSS	1051621	1051622	-0.017027	-	.
Adh	LMEIMC	TSS	1047531	1047532	-0.009755	-	.
Adh	LMEIMC	TSS	1044611	1044612	-0.010920	-	.
Adh	LMEIMC	TSS	1043621	1043622	-0.015025	-	.
Adh	LMEIMC	TSS	1043081	1043082	-0.011302	-	.
Adh	LMEIMC	TSS	1039791	1039792	-0.014271	-	.
Adh	LMEIMC	TSS	1038951	1038952	-0.013522	-	.
Adh	LMEIMC	TSS	1038011	1038012	-0.011414	-	.
Adh	LMEIMC	TSS	1037161	1037162	-0.011851	-	.
Adh	LMEIMC	TSS	1030681	1030682	-0.011769	-	.
Adh	LMEIMC	TSS	1029711	1029712	-0.014034	-	.
Adh	LMEIMC	TSS	1028151	1028152	-0.012771	-	.
Adh	LMEIMC	TSS	1026161	1026162	-0.011277	-	.
Adh	LMEIMC	TSS	1025151	1025152	-0.012247	-	.
Adh	LMEIMC	TSS	1021211	1021212	-0.014405	-	.
Adh	LMEIMC	TSS	1020121	1020122	-0.014615	-	.
Adh	LMEIMC	TSS	1017931	1017932	-0.015343	-	.
Adh	LMEIMC	TSS	1016201	1016202	-0.013305	-	.
Adh	LMEIMC	TSS	1014361	1014362	-0.015726	-	.
Adh	LMEIMC	TSS	1013311	1013312	-0.013810	-	.
Adh	LMEIMC	TSS	1010621	1010622	-0.009678	-	.
Adh	LMEIMC	TSS	1009771	1009772	-0.011672	-	.
Adh	LMEIMC	TSS	1008571	1008572	-0.009621	-	.
Adh	LMEIMC	TSS	1006861	1006862	-0.013038	-	.
Adh	LMEIMC	TSS	1005691	1005692	-0.015022	-	.
Adh	LMEIMC	TSS	1004681	1004682	-0.014595	-	.
Adh	LMEIMC	TSS	1004041	1004042	-0.010453	-	.
Adh	LMEIMC	TSS	1002511	1002512	-0.014991	-	.
Adh	LMEIMC	TSS	1000781	1000782	-0.011180	-	.
Adh	LMEIMC	TSS	999321	999322	-0.018004	-	.
Adh	LMEIMC	TSS	994521	994522	-0.013298	-	.
Adh	LMEIMC	TSS	993211	993212	-0.012546	-	.
Adh	LMEIMC	TSS	988691	988692	-0.010996	-	.
Adh	LMEIMC	TSS	985321	985322	-0.012969	-	.
Adh	LMEIMC	TSS	984321	984322	-0.015911	-	.
Adh	LMEIMC	TSS	981961	981962	-0.018321	-	.
Adh	LMEIMC	TSS	979601	979602	-0.014708	-	.
Adh	LMEIMC	TSS	977761	977762	-0.011760	-	.
Adh	LMEIMC	TSS	976851	976852	-0.016152	-	.
Adh	LMEIMC	TSS	975021	975022	-0.012022	-	.
Adh	LMEIMC	TSS	973851	973852	-0.009310	-	.
Adh	LMEIMC	TSS	971521	971522	-0.012395	-	.
Adh	LMEIMC	TSS	970961	970962	-0.009893	-	.
Adh	LMEIMC	TSS	970551	970552	-0.009454	-	.
Adh	LMEIMC	TSS	969161	969162	-0.009054	-	.
Adh	LMEIMC	TSS	968181	968182	-0.014344	-	.
Adh	LMEIMC	TSS	960021	960022	-0.012506	-	.
Adh	LMEIMC	TSS	956851	956852	-0.010517	-	.
Adh	LMEIMC	TSS	954301	954302	-0.011622	-	.
Adh	LMEIMC	TSS	952441	952442	-0.011105	-	.
Adh	LMEIMC	TSS	947861	947862	-0.009430	-	.
Adh	LMEIMC	TSS	947151	947152	-0.011472	-	.
Adh	LMEIMC	TSS	940541	940542	-0.019657	-	.
Adh	LMEIMC	TSS	935841	935842	-0.015268	-	.
Adh	LMEIMC	TSS	932681	932682	-0.011077	-	.
Adh	LMEIMC	TSS	932301	932302	-0.011174	-	.
Adh	LMEIMC	TSS	931071	931072	-0.013637	-	.
Adh	LMEIMC	TSS	921841	921842	-0.013553	-	.
Adh	LMEIMC	TSS	920681	920682	-0.012338	-	.
Adh	LMEIMC	TSS	916261	916262	-0.010854	-	.
Adh	LMEIMC	TSS	915141	915142	-0.013802	-	.
Adh	LMEIMC	TSS	913461	913462	-0.011310	-	.
Adh	LMEIMC	TSS	911691	911692	-0.016944	-	.
Adh	LMEIMC	TSS	911111	911112	-0.011083	-	.
Adh	LMEIMC	TSS	909231	909232	-0.011785	-	.
Adh	LMEIMC	TSS	907541	907542	-0.014547	-	.
Adh	LMEIMC	TSS	906971	906972	-0.015614	-	.
Adh	LMEIMC	TSS	903141	903142	-0.015975	-	.
Adh	LMEIMC	TSS	902361	902362	-0.016159	-	.
Adh	LMEIMC	TSS	900761	900762	-0.013158	-	.
Adh	LMEIMC	TSS	899911	899912	-0.017536	-	.
Adh	LMEIMC	TSS	898801	898802	-0.010486	-	.
Adh	LMEIMC	TSS	897251	897252	-0.010821	-	.
Adh	LMEIMC	TSS	896321	896322	-0.010000	-	.
Adh	LMEIMC	TSS	894161	894162	-0.013062	-	.
Adh	LMEIMC	TSS	893041	893042	-0.012175	-	.
Adh	LMEIMC	TSS	890671	890672	-0.010826	-	.
Adh	LMEIMC	TSS	886771	886772	-0.010177	-	.
Adh	LMEIMC	TSS	883241	883242	-0.009557	-	.
Adh	LMEIMC	TSS	881761	881762	-0.012376	-	.
Adh	LMEIMC	TSS	880211	880212	-0.015182	-	.
Adh	LMEIMC	TSS	880001	880002	-0.011286	-	.
Adh	LMEIMC	TSS	879091	879092	-0.020006	-	.
Adh	LMEIMC	TSS	875431	875432	-0.011642	-	.
Adh	LMEIMC	TSS	872781	872782	-0.010976	-	.
Adh	LMEIMC	TSS	872401	872402	-0.013577	-	.
Adh	LMEIMC	TSS	867961	867962	-0.016860	-	.
Adh	LMEIMC	TSS	862581	862582	-0.011694	-	.
Adh	LMEIMC	TSS	860681	860682	-0.012140	-	.
Adh	LMEIMC	TSS	859461	859462	-0.011434	-	.
Adh	LMEIMC	TSS	856071	856072	-0.009496	-	.
Adh	LMEIMC	TSS	851751	851752	-0.013314	-	.
Adh	LMEIMC	TSS	850611	850612	-0.012332	-	.
Adh	LMEIMC	TSS	849281	849282	-0.012623	-	.
Adh	LMEIMC	TSS	842371	842372	-0.013177	-	.
Adh	LMEIMC	TSS	840981	840982	-0.009094	-	.
Adh	LMEIMC	TSS	835361	835362	-0.009793	-	.
Adh	LMEIMC	TSS	827901	827902	-0.016127	-	.
Adh	LMEIMC	TSS	826801	826802	-0.009114	-	.
Adh	LMEIMC	TSS	820851	820852	-0.009118	-	.
Adh	LMEIMC	TSS	820041	820042	-0.010665	-	.
Adh	LMEIMC	TSS	818041	818042	-0.011457	-	.
Adh	LMEIMC	TSS	815551	815552	-0.012006	-	.
Adh	LMEIMC	TSS	812761	812762	-0.010487	-	.
Adh	LMEIMC	TSS	810291	810292	-0.014730	-	.
Adh	LMEIMC	TSS	808291	808292	-0.013299	-	.
Adh	LMEIMC	TSS	806351	806352	-0.014579	-	.
Adh	LMEIMC	TSS	805711	805712	-0.010452	-	.
Adh	LMEIMC	TSS	804221	804222	-0.010746	-	.
Adh	LMEIMC	TSS	802901	802902	-0.019578	-	.
Adh	LMEIMC	TSS	802101	802102	-0.022654	-	.
Adh	LMEIMC	TSS	800921	800922	-0.010356	-	.
Adh	LMEIMC	TSS	799551	799552	-0.010954	-	.
Adh	LMEIMC	TSS	797841	797842	-0.009971	-	.
Adh	LMEIMC	TSS	796721	796722	-0.009474	-	.
Adh	LMEIMC	TSS	794611	794612	-0.011406	-	.
Adh	LMEIMC	TSS	793481	793482	-0.016732	-	.
Adh	LMEIMC	TSS	787301	787302	-0.012949	-	.
Adh	LMEIMC	TSS	786871	786872	-0.011889	-	.
Adh	LMEIMC	TSS	785771	785772	-0.014883	-	.
Adh	LMEIMC	TSS	784381	784382	-0.009416	-	.
Adh	LMEIMC	TSS	782651	782652	-0.013955	-	.
Adh	LMEIMC	TSS	781431	781432	-0.011378	-	.
Adh	LMEIMC	TSS	779671	779672	-0.012925	-	.
Adh	LMEIMC	TSS	778981	778982	-0.012162	-	.
Adh	LMEIMC	TSS	776521	776522	-0.012691	-	.
Adh	LMEIMC	TSS	767311	767312	-0.009847	-	.
Adh	LMEIMC	TSS	764791	764792	-0.013219	-	.
Adh	LMEIMC	TSS	762591	762592	-0.010522	-	.
Adh	LMEIMC	TSS	757921	757922	-0.009749	-	.
Adh	LMEIMC	TSS	757371	757372	-0.012193	-	.
Adh	LMEIMC	TSS	756761	756762	-0.013557	-	.
Adh	LMEIMC	TSS	755071	755072	-0.012488	-	.
Adh	LMEIMC	TSS	749451	749452	-0.009989	-	.
Adh	LMEIMC	TSS	748561	748562	-0.009561	-	.
Adh	LMEIMC	TSS	747571	747572	-0.019531	-	.
Adh	LMEIMC	TSS	744641	744642	-0.012969	-	.
Adh	LMEIMC	TSS	738261	738262	-0.013708	-	.
Adh	LMEIMC	TSS	734851	734852	-0.011082	-	.
Adh	LMEIMC	TSS	732421	732422	-0.010512	-	.
Adh	LMEIMC	TSS	731571	731572	-0.013740	-	.
Adh	LMEIMC	TSS	727651	727652	-0.016940	-	.
Adh	LMEIMC	TSS	727081	727082	-0.013291	-	.
Adh	LMEIMC	TSS	718921	718922	-0.010181	-	.
Adh	LMEIMC	TSS	706831	706832	-0.012084	-	.
Adh	LMEIMC	TSS	705381	705382	-0.012468	-	.
Adh	LMEIMC	TSS	699861	699862	-0.011924	-	.
Adh	LMEIMC	TSS	696751	696752	-0.011786	-	.
Adh	LMEIMC	TSS	693171	693172	-0.012193	-	.
Adh	LMEIMC	TSS	690571	690572	-0.013737	-	.
Adh	LMEIMC	TSS	688731	688732	-0.013995	-	.
Adh	LMEIMC	TSS	686211	686212	-0.011199	-	.
Adh	LMEIMC	TSS	675861	675862	-0.009787	-	.
Adh	LMEIMC	TSS	674531	674532	-0.014982	-	.
Adh	LMEIMC	TSS	672151	672152	-0.011095	-	.
Adh	LMEIMC	TSS	671501	671502	-0.015679	-	.
Adh	LMEIMC	TSS	669351	669352	-0.013670	-	.
Adh	LMEIMC	TSS	668461	668462	-0.012792	-	.
Adh	LMEIMC	TSS	665121	665122	-0.012656	-	.
Adh	LMEIMC	TSS	662701	662702	-0.014664	-	.
Adh	LMEIMC	TSS	658321	658322	-0.010487	-	.
Adh	LMEIMC	TSS	652661	652662	-0.015886	-	.
Adh	LMEIMC	TSS	652401	652402	-0.019766	-	.
Adh	LMEIMC	TSS	648421	648422	-0.010821	-	.
Adh	LMEIMC	TSS	647101	647102	-0.014312	-	.
Adh	LMEIMC	TSS	646191	646192	-0.009576	-	.
Adh	LMEIMC	TSS	644281	644282	-0.019062	-	.
Adh	LMEIMC	TSS	640971	640972	-0.010851	-	.
Adh	LMEIMC	TSS	637901	637902	-0.009122	-	.
Adh	LMEIMC	TSS	636301	636302	-0.011681	-	.
Adh	LMEIMC	TSS	634721	634722	-0.014835	-	.
Adh	LMEIMC	TSS	633621	633622	-0.013221	-	.
Adh	LMEIMC	TSS	633041	633042	-0.009534	-	.
Adh	LMEIMC	TSS	628731	628732	-0.012699	-	.
Adh	LMEIMC	TSS	628071	628072	-0.013779	-	.
Adh	LMEIMC	TSS	627611	627612	-0.011350	-	.
Adh	LMEIMC	TSS	626741	626742	-0.015172	-	.
Adh	LMEIMC	TSS	625171	625172	-0.013539	-	.
Adh	LMEIMC	TSS	623971	623972	-0.011131	-	.
Adh	LMEIMC	TSS	623191	623192	-0.010285	-	.
Adh	LMEIMC	TSS	619391	619392	-0.017182	-	.
Adh	LMEIMC	TSS	613411	613412	-0.012119	-	.
Adh	LMEIMC	TSS	608071	608072	-0.009835	-	.
Adh	LMEIMC	TSS	605951	605952	-0.009308	-	.
Adh	LMEIMC	TSS	601181	601182	-0.012664	-	.
Adh	LMEIMC	TSS	599201	599202	-0.011133	-	.
Adh	LMEIMC	TSS	597321	597322	-0.013061	-	.
Adh	LMEIMC	TSS	594571	594572	-0.020127	-	.
Adh	LMEIMC	TSS	594061	594062	-0.016477	-	.
Adh	LMEIMC	TSS	593671	593672	-0.019431	-	.
Adh	LMEIMC	TSS	582121	582122	-0.010250	-	.
Adh	LMEIMC	TSS	574221	574222	-0.010180	-	.
Adh	LMEIMC	TSS	570751	570752	-0.013728	-	.
Adh	LMEIMC	TSS	569951	569952	-0.009981	-	.
Adh	LMEIMC	TSS	568331	568332	-0.009347	-	.
Adh	LMEIMC	TSS	565751	565752	-0.019897	-	.
Adh	LMEIMC	TSS	564451	564452	-0.013709	-	.
Adh	LMEIMC	TSS	563321	563322	-0.011307	-	.
Adh	LMEIMC	TSS	560111	560112	-0.009331	-	.
Adh	LMEIMC	TSS	558051	558052	-0.010838	-	.
Adh	LMEIMC	TSS	556161	556162	-0.019251	-	.
Adh	LMEIMC	TSS	555621	555622	-0.010927	-	.
Adh	LMEIMC	TSS	555281	555282	-0.013558	-	.
Adh	LMEIMC	TSS	552551	552552	-0.014365	-	.
Adh	LMEIMC	TSS	550451	550452	-0.011912	-	.
Adh	LMEIMC	TSS	547851	547852	-0.011671	-	.
Adh	LMEIMC	TSS	546861	546862	-0.010391	-	.
Adh	LMEIMC	TSS	546511	546512	-0.009703	-	.
Adh	LMEIMC	TSS	545821	545822	-0.010044	-	.
Adh	LMEIMC	TSS	544991	544992	-0.015074	-	.
Adh	LMEIMC	TSS	544041	544042	-0.013146	-	.
Adh	LMEIMC	TSS	537801	537802	-0.009237	-	.
Adh	LMEIMC	TSS	534841	534842	-0.010533	-	.
Adh	LMEIMC	TSS	534011	534012	-0.013604	-	.
Adh	LMEIMC	TSS	532331	532332	-0.009343	-	.
Adh	LMEIMC	TSS	529881	529882	-0.014892	-	.
Adh	LMEIMC	TSS	529311	529312	-0.018714	-	.
Adh	LMEIMC	TSS	525811	525812	-0.012662	-	.
Adh	LMEIMC	TSS	522981	522982	-0.016660	-	.
Adh	LMEIMC	TSS	518831	518832	-0.011073	-	.
Adh	LMEIMC	TSS	516101	516102	-0.009170	-	.
Adh	LMEIMC	TSS	513931	513932	-0.010444	-	.
Adh	LMEIMC	TSS	513171	513172	-0.014320	-	.
Adh	LMEIMC	TSS	507981	507982	-0.012797	-	.
Adh	LMEIMC	TSS	507461	507462	-0.010662	-	.
Adh	LMEIMC	TSS	505291	505292	-0.009920	-	.
Adh	LMEIMC	TSS	502871	502872	-0.010089	-	.
Adh	LMEIMC	TSS	499311	499312	-0.009156	-	.
Adh	LMEIMC	TSS	498391	498392	-0.010314	-	.
Adh	LMEIMC	TSS	495781	495782	-0.017954	-	.
Adh	LMEIMC	TSS	494861	494862	-0.016688	-	.
Adh	LMEIMC	TSS	493581	493582	-0.009375	-	.
Adh	LMEIMC	TSS	491101	491102	-0.012943	-	.
Adh	LMEIMC	TSS	487261	487262	-0.016779	-	.
Adh	LMEIMC	TSS	485981	485982	-0.014559	-	.
Adh	LMEIMC	TSS	482741	482742	-0.014877	-	.
Adh	LMEIMC	TSS	481401	481402	-0.015750	-	.
Adh	LMEIMC	TSS	480071	480072	-0.010196	-	.
Adh	LMEIMC	TSS	470921	470922	-0.011359	-	.
Adh	LMEIMC	TSS	470281	470282	-0.009209	-	.
Adh	LMEIMC	TSS	465361	465362	-0.015855	-	.
Adh	LMEIMC	TSS	462491	462492	-0.012471	-	.
Adh	LMEIMC	TSS	458071	458072	-0.010401	-	.
Adh	LMEIMC	TSS	457361	457362	-0.012412	-	.
Adh	LMEIMC	TSS	457151	457152	-0.011655	-	.
Adh	LMEIMC	TSS	455861	455862	-0.010460	-	.
Adh	LMEIMC	TSS	452841	452842	-0.009857	-	.
Adh	LMEIMC	TSS	449831	449832	-0.010263	-	.
Adh	LMEIMC	TSS	449141	449142	-0.012628	-	.
Adh	LMEIMC	TSS	448571	448572	-0.012084	-	.
Adh	LMEIMC	TSS	448071	448072	-0.016509	-	.
Adh	LMEIMC	TSS	444801	444802	-0.011921	-	.
Adh	LMEIMC	TSS	442611	442612	-0.010175	-	.
Adh	LMEIMC	TSS	441261	441262	-0.011193	-	.
Adh	LMEIMC	TSS	440141	440142	-0.012483	-	.
Adh	LMEIMC	TSS	436251	436252	-0.009511	-	.
Adh	LMEIMC	TSS	433131	433132	-0.009113	-	.
Adh	LMEIMC	TSS	428421	428422	-0.015060	-	.
Adh	LMEIMC	TSS	422011	422012	-0.010098	-	.
Adh	LMEIMC	TSS	420441	420442	-0.012089	-	.
Adh	LMEIMC	TSS	417481	417482	-0.012231	-	.
Adh	LMEIMC	TSS	415111	415112	-0.012221	-	.
Adh	LMEIMC	TSS	414621	414622	-0.010564	-	.
Adh	LMEIMC	TSS	412951	412952	-0.013005	-	.
Adh	LMEIMC	TSS	412121	412122	-0.013108	-	.
Adh	LMEIMC	TSS	408891	408892	-0.014019	-	.
Adh	LMEIMC	TSS	408161	408162	-0.010857	-	.
Adh	LMEIMC	TSS	403111	403112	-0.010030	-	.
Adh	LMEIMC	TSS	398961	398962	-0.010337	-	.
Adh	LMEIMC	TSS	398041	398042	-0.021994	-	.
Adh	LMEIMC	TSS	395611	395612	-0.009057	-	.
Adh	LMEIMC	TSS	393711	393712	-0.015703	-	.
Adh	LMEIMC	TSS	392791	392792	-0.010512	-	.
Adh	LMEIMC	TSS	388011	388012	-0.010306	-	.
Adh	LMEIMC	TSS	386031	386032	-0.010542	-	.
Adh	LMEIMC	TSS	382421	382422	-0.012765	-	.
Adh	LMEIMC	TSS	372461	372462	-0.018225	-	.
Adh	LMEIMC	TSS	371001	371002	-0.009983	-	.
Adh	LMEIMC	TSS	367131	367132	-0.013654	-	.
Adh	LMEIMC	TSS	363461	363462	-0.010578	-	.
Adh	LMEIMC	TSS	362221	362222	-0.017453	-	.
Adh	LMEIMC	TSS	359901	359902	-0.013364	-	.
Adh	LMEIMC	TSS	354701	354702	-0.014778	-	.
Adh	LMEIMC	TSS	347781	347782	-0.009409	-	.
Adh	LMEIMC	TSS	346241	346242	-0.013042	-	.
Adh	LMEIMC	TSS	341881	341882	-0.013981	-	.
Adh	LMEIMC	TSS	339011	339012	-0.009876	-	.
Adh	LMEIMC	TSS	334561	334562	-0.010561	-	.
Adh	LMEIMC	TSS	331341	331342	-0.013579	-	.
Adh	LMEIMC	TSS	325251	325252	-0.016065	-	.
Adh	LMEIMC	TSS	323241	323242	-0.018512	-	.
Adh	LMEIMC	TSS	321431	321432	-0.011786	-	.
Adh	LMEIMC	TSS	317391	317392	-0.010911	-	.
Adh	LMEIMC	TSS	314911	314912	-0.018446	-	.
Adh	LMEIMC	TSS	313961	313962	-0.009790	-	.
Adh	LMEIMC	TSS	310421	310422	-0.009044	-	.
Adh	LMEIMC	TSS	307631	307632	-0.023328	-	.
Adh	LMEIMC	TSS	306811	306812	-0.012822	-	.
Adh	LMEIMC	TSS	301641	301642	-0.012106	-	.
Adh	LMEIMC	TSS	298841	298842	-0.009388	-	.
Adh	LMEIMC	TSS	297291	297292	-0.020349	-	.
Adh	LMEIMC	TSS	294711	294712	-0.010287	-	.
Adh	LMEIMC	TSS	293361	293362	-0.010786	-	.
Adh	LMEIMC	TSS	288561	288562	-0.009553	-	.
Adh	LMEIMC	TSS	283711	283712	-0.009515	-	.
Adh	LMEIMC	TSS	277831	277832	-0.011508	-	.
Adh	LMEIMC	TSS	277051	277052	-0.016867	-	.
Adh	LMEIMC	TSS	276261	276262	-0.015343	-	.
Adh	LMEIMC	TSS	269571	269572	-0.009390	-	.
Adh	LMEIMC	TSS	266331	266332	-0.010903	-	.
Adh	LMEIMC	TSS	261081	261082	-0.011992	-	.
Adh	LMEIMC	TSS	255291	255292	-0.016111	-	.
Adh	LMEIMC	TSS	254391	254392	-0.017137	-	.
Adh	LMEIMC	TSS	250321	250322	-0.010063	-	.
Adh	LMEIMC	TSS	250101	250102	-0.012382	-	.
Adh	LMEIMC	TSS	248281	248282	-0.011672	-	.
Adh	LMEIMC	TSS	247311	247312	-0.014531	-	.
Adh	LMEIMC	TSS	245661	245662	-0.009383	-	.
Adh	LMEIMC	TSS	244511	244512	-0.011444	-	.
Adh	LMEIMC	TSS	243661	243662	-0.010171	-	.
Adh	LMEIMC	TSS	242581	242582	-0.013113	-	.
Adh	LMEIMC	TSS	238761	238762	-0.010538	-	.
Adh	LMEIMC	TSS	236441	236442	-0.011952	-	.
Adh	LMEIMC	TSS	234161	234162	-0.010753	-	.
Adh	LMEIMC	TSS	233421	233422	-0.011263	-	.
Adh	LMEIMC	TSS	230341	230342	-0.010995	-	.
Adh	LMEIMC	TSS	228851	228852	-0.010724	-	.
Adh	LMEIMC	TSS	227111	227112	-0.010185	-	.
Adh	LMEIMC	TSS	224561	224562	-0.013732	-	.
Adh	LMEIMC	TSS	222401	222402	-0.014323	-	.
Adh	LMEIMC	TSS	221451	221452	-0.011919	-	.
Adh	LMEIMC	TSS	217731	217732	-0.012414	-	.
Adh	LMEIMC	TSS	215561	215562	-0.009576	-	.
Adh	LMEIMC	TSS	213461	213462	-0.012586	-	.
Adh	LMEIMC	TSS	211571	211572	-0.011586	-	.
Adh	LMEIMC	TSS	211071	211072	-0.016257	-	.
Adh	LMEIMC	TSS	209831	209832	-0.012921	-	.
Adh	LMEIMC	TSS	209021	209022	-0.021642	-	.
Adh	LMEIMC	TSS	206831	206832	-0.009197	-	.
Adh	LMEIMC	TSS	205301	205302	-0.009260	-	.
Adh	LMEIMC	TSS	199851	199852	-0.009057	-	.
Adh	LMEIMC	TSS	199101	199102	-0.010327	-	.
Adh	LMEIMC	TSS	195021	195022	-0.014800	-	.
Adh	LMEIMC	TSS	193851	193852	-0.012994	-	.
Adh	LMEIMC	TSS	191521	191522	-0.009039	-	.
Adh	LMEIMC	TSS	188461	188462	-0.013764	-	.
Adh	LMEIMC	TSS	186771	186772	-0.013366	-	.
Adh	LMEIMC	TSS	184951	184952	-0.019288	-	.
Adh	LMEIMC	TSS	179271	179272	-0.010326	-	.
Adh	LMEIMC	TSS	178041	178042	-0.021778	-	.
Adh	LMEIMC	TSS	175851	175852	-0.011785	-	.
Adh	LMEIMC	TSS	173421	173422	-0.016223	-	.
Adh	LMEIMC	TSS	172651	172652	-0.013926	-	.
Adh	LMEIMC	TSS	171801	171802	-0.010690	-	.
Adh	LMEIMC	TSS	169321	169322	-0.017164	-	.
Adh	LMEIMC	TSS	169071	169072	-0.014450	-	.
Adh	LMEIMC	TSS	166041	166042	-0.011074	-	.
Adh	LMEIMC	TSS	162461	162462	-0.010323	-	.
Adh	LMEIMC	TSS	159731	159732	-0.019881	-	.
Adh	LMEIMC	TSS	157601	157602	-0.013020	-	.
Adh	LMEIMC	TSS	154421	154422	-0.011958	-	.
Adh	LMEIMC	TSS	153441	153442	-0.010024	-	.
Adh	LMEIMC	TSS	152231	152232	-0.016222	-	.
Adh	LMEIMC	TSS	148591	148592	-0.010704	-	.
Adh	LMEIMC	TSS	146721	146722	-0.009097	-	.
Adh	LMEIMC	TSS	145331	145332	-0.012581	-	.
Adh	LMEIMC	TSS	144371	144372	-0.009395	-	.
Adh	LMEIMC	TSS	143161	143162	-0.019485	-	.
Adh	LMEIMC	TSS	139501	139502	-0.012063	-	.
Adh	LMEIMC	TSS	137581	137582	-0.016498	-	.
Adh	LMEIMC	TSS	135951	135952	-0.009598	-	.
Adh	LMEIMC	TSS	131001	131002	-0.010996	-	.
Adh	LMEIMC	TSS	129751	129752	-0.011843	-	.
Adh	LMEIMC	TSS	123811	123812	-0.013355	-	.
Adh	LMEIMC	TSS	122901	122902	-0.018685	-	.
Adh	LMEIMC	TSS	119231	119232	-0.011100	-	.
Adh	LMEIMC	TSS	115911	115912	-0.010341	-	.
Adh	LMEIMC	TSS	114301	114302	-0.018562	-	.
Adh	LMEIMC	TSS	113381	113382	-0.011302	-	.
Adh	LMEIMC	TSS	111561	111562	-0.010805	-	.
Adh	LMEIMC	TSS	110781	110782	-0.015260	-	.
Adh	LMEIMC	TSS	110101	110102	-0.012966	-	.
Adh	LMEIMC	TSS	109181	109182	-0.010056	-	.
Adh	LMEIMC	TSS	108101	108102	-0.016983	-	.
Adh	LMEIMC	TSS	106941	106942	-0.010559	-	.
Adh	LMEIMC	TSS	105531	105532	-0.020931	-	.
Adh	LMEIMC	TSS	103961	103962	-0.010869	-	.
Adh	LMEIMC	TSS	102651	102652	-0.009555	-	.
Adh	LMEIMC	TSS	94101	94102	-0.010999	-	.
Adh	LMEIMC	TSS	90561	90562	-0.009112	-	.
Adh	LMEIMC	TSS	88321	88322	-0.009873	-	.
Adh	LMEIMC	TSS	87031	87032	-0.013193	-	.
Adh	LMEIMC	TSS	85351	85352	-0.020162	-	.
Adh	LMEIMC	TSS	84161	84162	-0.011020	-	.
Adh	LMEIMC	TSS	82521	82522	-0.010984	-	.
Adh	LMEIMC	TSS	72091	72092	-0.013069	-	.
Adh	LMEIMC	TSS	70071	70072	-0.012034	-	.
Adh	LMEIMC	TSS	68441	68442	-0.011350	-	.
Adh	LMEIMC	TSS	66361	66362	-0.015067	-	.
Adh	LMEIMC	TSS	61091	61092	-0.009797	-	.
Adh	LMEIMC	TSS	57051	57052	-0.013951	-	.
Adh	LMEIMC	TSS	54621	54622	-0.014751	-	.
Adh	LMEIMC	TSS	53521	53522	-0.014560	-	.
Adh	LMEIMC	TSS	49501	49502	-0.010495	-	.
Adh	LMEIMC	TSS	44531	44532	-0.013336	-	.
Adh	LMEIMC	TSS	42651	42652	-0.012475	-	.
Adh	LMEIMC	TSS	41441	41442	-0.013718	-	.
Adh	LMEIMC	TSS	40801	40802	-0.018646	-	.
Adh	LMEIMC	TSS	39531	39532	-0.014276	-	.
Adh	LMEIMC	TSS	37161	37162	-0.010869	-	.
Adh	LMEIMC	TSS	36121	36122	-0.013631	-	.
Adh	LMEIMC	TSS	33361	33362	-0.010511	-	.
Adh	LMEIMC	TSS	32271	32272	-0.013588	-	.
Adh	LMEIMC	TSS	29631	29632	-0.013194	-	.
Adh	LMEIMC	TSS	26621	26622	-0.009591	-	.
Adh	LMEIMC	TSS	19591	19592	-0.009060	-	.
Adh	LMEIMC	TSS	15571	15572	-0.013799	-	.
Adh	LMEIMC	TSS	15211	15212	-0.011834	-	.
Adh	LMEIMC	TSS	12371	12372	-0.011372	-	.
Adh	LMEIMC	TSS	11041	11042	-0.010864	-	.
Adh	LMEIMC	TSS	8051	8052	-0.021537	-	.
Adh	LMEIMC	TSS	7011	7012	-0.014475	-	.
Adh	LMEIMC	TSS	6551	6552	-0.023224	-	.
Adh	LMEIMC	TSS	4951	4952	-0.010126	-	.
Adh	LMEIMC	TSS	2741	2742	-0.012054	-	.
#
# compfly: 1. replaced "LME-IMC" with "LMEIMC" Dec 14 (MR)
#          2. replaced "Adh_anc_cact.1" with "Adh" Dec 14 (MR)
#
Adh	LMESSM	TSS	2510	2511	-0.033477	+	.
Adh	LMESSM	TSS	3350	3351	-0.056259	+	.
Adh	LMESSM	TSS	3870	3871	-0.041100	+	.
Adh	LMESSM	TSS	6700	6701	-0.042390	+	.
Adh	LMESSM	TSS	7370	7371	-0.071482	+	.
Adh	LMESSM	TSS	8200	8201	-0.046877	+	.
Adh	LMESSM	TSS	8400	8401	-0.034005	+	.
Adh	LMESSM	TSS	15260	15261	-0.038990	+	.
Adh	LMESSM	TSS	21680	21681	-0.033713	+	.
Adh	LMESSM	TSS	30630	30631	-0.033764	+	.
Adh	LMESSM	TSS	31330	31331	-0.031046	+	.
Adh	LMESSM	TSS	32520	32521	-0.031310	+	.
Adh	LMESSM	TSS	33500	33501	-0.034080	+	.
Adh	LMESSM	TSS	35540	35541	-0.033390	+	.
Adh	LMESSM	TSS	36540	36541	-0.033368	+	.
Adh	LMESSM	TSS	37920	37921	-0.035860	+	.
Adh	LMESSM	TSS	39620	39621	-0.041156	+	.
Adh	LMESSM	TSS	40860	40861	-0.036281	+	.
Adh	LMESSM	TSS	42470	42471	-0.031526	+	.
Adh	LMESSM	TSS	43060	43061	-0.038276	+	.
Adh	LMESSM	TSS	44080	44081	-0.033600	+	.
Adh	LMESSM	TSS	46880	46881	-0.046231	+	.
Adh	LMESSM	TSS	48720	48721	-0.031891	+	.
Adh	LMESSM	TSS	49700	49701	-0.034150	+	.
Adh	LMESSM	TSS	54500	54501	-0.041111	+	.
Adh	LMESSM	TSS	55170	55171	-0.033045	+	.
Adh	LMESSM	TSS	56680	56681	-0.033784	+	.
Adh	LMESSM	TSS	58440	58441	-0.036750	+	.
Adh	LMESSM	TSS	76180	76181	-0.040546	+	.
Adh	LMESSM	TSS	78090	78091	-0.043300	+	.
Adh	LMESSM	TSS	90010	90011	-0.031832	+	.
Adh	LMESSM	TSS	91660	91661	-0.037404	+	.
Adh	LMESSM	TSS	93680	93681	-0.046639	+	.
Adh	LMESSM	TSS	95980	95981	-0.033131	+	.
Adh	LMESSM	TSS	101230	101231	-0.037370	+	.
Adh	LMESSM	TSS	104150	104151	-0.031843	+	.
Adh	LMESSM	TSS	104340	104341	-0.031288	+	.
Adh	LMESSM	TSS	105490	105491	-0.032119	+	.
Adh	LMESSM	TSS	109470	109471	-0.044291	+	.
Adh	LMESSM	TSS	111990	111991	-0.039019	+	.
Adh	LMESSM	TSS	113130	113131	-0.038952	+	.
Adh	LMESSM	TSS	117480	117481	-0.042545	+	.
Adh	LMESSM	TSS	122010	122011	-0.033760	+	.
Adh	LMESSM	TSS	123970	123971	-0.037190	+	.
Adh	LMESSM	TSS	126790	126791	-0.033200	+	.
Adh	LMESSM	TSS	130290	130291	-0.047514	+	.
Adh	LMESSM	TSS	131090	131091	-0.042800	+	.
Adh	LMESSM	TSS	136170	136171	-0.038949	+	.
Adh	LMESSM	TSS	138480	138481	-0.036388	+	.
Adh	LMESSM	TSS	139520	139521	-0.032211	+	.
Adh	LMESSM	TSS	141600	141601	-0.039436	+	.
Adh	LMESSM	TSS	144160	144161	-0.034807	+	.
Adh	LMESSM	TSS	146910	146911	-0.046262	+	.
Adh	LMESSM	TSS	148790	148791	-0.044914	+	.
Adh	LMESSM	TSS	149490	149491	-0.034119	+	.
Adh	LMESSM	TSS	150650	150651	-0.039436	+	.
Adh	LMESSM	TSS	152410	152411	-0.035924	+	.
Adh	LMESSM	TSS	153090	153091	-0.034771	+	.
Adh	LMESSM	TSS	155950	155951	-0.048354	+	.
Adh	LMESSM	TSS	156630	156631	-0.032010	+	.
Adh	LMESSM	TSS	157830	157831	-0.042054	+	.
Adh	LMESSM	TSS	158600	158601	-0.032328	+	.
Adh	LMESSM	TSS	159290	159291	-0.061608	+	.
Adh	LMESSM	TSS	161460	161461	-0.033460	+	.
Adh	LMESSM	TSS	168550	168551	-0.040601	+	.
Adh	LMESSM	TSS	172840	172841	-0.041478	+	.
Adh	LMESSM	TSS	177030	177031	-0.037301	+	.
Adh	LMESSM	TSS	178360	178361	-0.046603	+	.
Adh	LMESSM	TSS	184980	184981	-0.039101	+	.
Adh	LMESSM	TSS	185620	185621	-0.031772	+	.
Adh	LMESSM	TSS	186890	186891	-0.033260	+	.
Adh	LMESSM	TSS	188380	188381	-0.034123	+	.
Adh	LMESSM	TSS	189290	189291	-0.038730	+	.
Adh	LMESSM	TSS	193030	193031	-0.033071	+	.
Adh	LMESSM	TSS	194130	194131	-0.033817	+	.
Adh	LMESSM	TSS	194770	194771	-0.031081	+	.
Adh	LMESSM	TSS	200220	200221	-0.034729	+	.
Adh	LMESSM	TSS	202200	202201	-0.031061	+	.
Adh	LMESSM	TSS	207790	207791	-0.036670	+	.
Adh	LMESSM	TSS	209150	209151	-0.037724	+	.
Adh	LMESSM	TSS	209480	209481	-0.045920	+	.
Adh	LMESSM	TSS	213660	213661	-0.035650	+	.
Adh	LMESSM	TSS	217340	217341	-0.035286	+	.
Adh	LMESSM	TSS	223490	223491	-0.040448	+	.
Adh	LMESSM	TSS	225430	225431	-0.039650	+	.
Adh	LMESSM	TSS	227110	227111	-0.033661	+	.
Adh	LMESSM	TSS	229880	229881	-0.037159	+	.
Adh	LMESSM	TSS	231100	231101	-0.031223	+	.
Adh	LMESSM	TSS	234120	234121	-0.033240	+	.
Adh	LMESSM	TSS	235870	235871	-0.034356	+	.
Adh	LMESSM	TSS	240180	240181	-0.039607	+	.
Adh	LMESSM	TSS	242320	242321	-0.037764	+	.
Adh	LMESSM	TSS	244080	244081	-0.034849	+	.
Adh	LMESSM	TSS	248380	248381	-0.031531	+	.
Adh	LMESSM	TSS	250230	250231	-0.036113	+	.
Adh	LMESSM	TSS	254140	254141	-0.035270	+	.
Adh	LMESSM	TSS	254610	254611	-0.035381	+	.
Adh	LMESSM	TSS	256180	256181	-0.033679	+	.
Adh	LMESSM	TSS	256520	256521	-0.042350	+	.
Adh	LMESSM	TSS	261170	261171	-0.033251	+	.
Adh	LMESSM	TSS	266540	266541	-0.046048	+	.
Adh	LMESSM	TSS	267200	267201	-0.037432	+	.
Adh	LMESSM	TSS	268100	268101	-0.035879	+	.
Adh	LMESSM	TSS	268770	268771	-0.031069	+	.
Adh	LMESSM	TSS	269660	269661	-0.041739	+	.
Adh	LMESSM	TSS	270200	270201	-0.031030	+	.
Adh	LMESSM	TSS	271120	271121	-0.038577	+	.
Adh	LMESSM	TSS	273420	273421	-0.037839	+	.
Adh	LMESSM	TSS	273610	273611	-0.035930	+	.
Adh	LMESSM	TSS	274730	274731	-0.047971	+	.
Adh	LMESSM	TSS	276550	276551	-0.037668	+	.
Adh	LMESSM	TSS	277140	277141	-0.035360	+	.
Adh	LMESSM	TSS	278020	278021	-0.031803	+	.
Adh	LMESSM	TSS	278910	278911	-0.033282	+	.
Adh	LMESSM	TSS	280110	280111	-0.035280	+	.
Adh	LMESSM	TSS	281680	281681	-0.052330	+	.
Adh	LMESSM	TSS	282630	282631	-0.034136	+	.
Adh	LMESSM	TSS	284080	284081	-0.034678	+	.
Adh	LMESSM	TSS	288730	288731	-0.033751	+	.
Adh	LMESSM	TSS	296100	296101	-0.033548	+	.
Adh	LMESSM	TSS	297390	297391	-0.033041	+	.
Adh	LMESSM	TSS	297520	297521	-0.046460	+	.
Adh	LMESSM	TSS	298660	298661	-0.031692	+	.
Adh	LMESSM	TSS	299200	299201	-0.036364	+	.
Adh	LMESSM	TSS	301780	301781	-0.033766	+	.
Adh	LMESSM	TSS	307840	307841	-0.057607	+	.
Adh	LMESSM	TSS	311480	311481	-0.052212	+	.
Adh	LMESSM	TSS	313280	313281	-0.044110	+	.
Adh	LMESSM	TSS	314130	314131	-0.031251	+	.
Adh	LMESSM	TSS	314360	314361	-0.031332	+	.
Adh	LMESSM	TSS	314990	314991	-0.035111	+	.
Adh	LMESSM	TSS	323310	323311	-0.032394	+	.
Adh	LMESSM	TSS	325480	325481	-0.046510	+	.
Adh	LMESSM	TSS	327190	327191	-0.039591	+	.
Adh	LMESSM	TSS	328830	328831	-0.040390	+	.
Adh	LMESSM	TSS	329860	329861	-0.045710	+	.
Adh	LMESSM	TSS	331680	331681	-0.046132	+	.
Adh	LMESSM	TSS	334710	334711	-0.033820	+	.
Adh	LMESSM	TSS	336780	336781	-0.031990	+	.
Adh	LMESSM	TSS	338220	338221	-0.032500	+	.
Adh	LMESSM	TSS	339070	339071	-0.033441	+	.
Adh	LMESSM	TSS	341670	341671	-0.036553	+	.
Adh	LMESSM	TSS	342050	342051	-0.034757	+	.
Adh	LMESSM	TSS	344600	344601	-0.045257	+	.
Adh	LMESSM	TSS	346430	346431	-0.039888	+	.
Adh	LMESSM	TSS	359710	359711	-0.031047	+	.
Adh	LMESSM	TSS	361630	361631	-0.038271	+	.
Adh	LMESSM	TSS	362770	362771	-0.050332	+	.
Adh	LMESSM	TSS	367210	367211	-0.035701	+	.
Adh	LMESSM	TSS	371070	371071	-0.038040	+	.
Adh	LMESSM	TSS	372600	372601	-0.044991	+	.
Adh	LMESSM	TSS	372890	372891	-0.040731	+	.
Adh	LMESSM	TSS	373260	373261	-0.034744	+	.
Adh	LMESSM	TSS	373630	373631	-0.047322	+	.
Adh	LMESSM	TSS	379300	379301	-0.045052	+	.
Adh	LMESSM	TSS	381350	381351	-0.038140	+	.
Adh	LMESSM	TSS	385700	385701	-0.042007	+	.
Adh	LMESSM	TSS	388030	388031	-0.038268	+	.
Adh	LMESSM	TSS	389020	389021	-0.038390	+	.
Adh	LMESSM	TSS	390770	390771	-0.042988	+	.
Adh	LMESSM	TSS	393010	393011	-0.036042	+	.
Adh	LMESSM	TSS	393650	393651	-0.045967	+	.
Adh	LMESSM	TSS	395180	395181	-0.039028	+	.
Adh	LMESSM	TSS	395930	395931	-0.033610	+	.
Adh	LMESSM	TSS	399400	399401	-0.046830	+	.
Adh	LMESSM	TSS	401440	401441	-0.037151	+	.
Adh	LMESSM	TSS	405090	405091	-0.033471	+	.
Adh	LMESSM	TSS	407060	407061	-0.035980	+	.
Adh	LMESSM	TSS	408470	408471	-0.039150	+	.
Adh	LMESSM	TSS	417620	417621	-0.041405	+	.
Adh	LMESSM	TSS	418370	418371	-0.036412	+	.
Adh	LMESSM	TSS	419080	419081	-0.035671	+	.
Adh	LMESSM	TSS	420180	420181	-0.050903	+	.
Adh	LMESSM	TSS	420350	420351	-0.032010	+	.
Adh	LMESSM	TSS	421550	421551	-0.034980	+	.
Adh	LMESSM	TSS	423550	423551	-0.032710	+	.
Adh	LMESSM	TSS	426700	426701	-0.037089	+	.
Adh	LMESSM	TSS	428490	428491	-0.053654	+	.
Adh	LMESSM	TSS	430170	430171	-0.036495	+	.
Adh	LMESSM	TSS	432730	432731	-0.035250	+	.
Adh	LMESSM	TSS	434940	434941	-0.038404	+	.
Adh	LMESSM	TSS	438920	438921	-0.035180	+	.
Adh	LMESSM	TSS	440370	440371	-0.037559	+	.
Adh	LMESSM	TSS	444020	444021	-0.037138	+	.
Adh	LMESSM	TSS	445460	445461	-0.037475	+	.
Adh	LMESSM	TSS	446420	446421	-0.032881	+	.
Adh	LMESSM	TSS	448280	448281	-0.050068	+	.
Adh	LMESSM	TSS	448640	448641	-0.035732	+	.
Adh	LMESSM	TSS	449970	449971	-0.045421	+	.
Adh	LMESSM	TSS	451510	451511	-0.032701	+	.
Adh	LMESSM	TSS	456030	456031	-0.043316	+	.
Adh	LMESSM	TSS	457350	457351	-0.033271	+	.
Adh	LMESSM	TSS	457760	457761	-0.039023	+	.
Adh	LMESSM	TSS	458990	458991	-0.032673	+	.
Adh	LMESSM	TSS	459270	459271	-0.047537	+	.
Adh	LMESSM	TSS	460410	460411	-0.032497	+	.
Adh	LMESSM	TSS	461890	461891	-0.031490	+	.
Adh	LMESSM	TSS	462690	462691	-0.036050	+	.
Adh	LMESSM	TSS	463490	463491	-0.048418	+	.
Adh	LMESSM	TSS	464980	464981	-0.039508	+	.
Adh	LMESSM	TSS	468130	468131	-0.033030	+	.
Adh	LMESSM	TSS	469150	469151	-0.032035	+	.
Adh	LMESSM	TSS	471620	471621	-0.032501	+	.
Adh	LMESSM	TSS	472150	472151	-0.035245	+	.
Adh	LMESSM	TSS	472610	472611	-0.032296	+	.
Adh	LMESSM	TSS	473870	473871	-0.032440	+	.
Adh	LMESSM	TSS	479590	479591	-0.034576	+	.
Adh	LMESSM	TSS	481270	481271	-0.033104	+	.
Adh	LMESSM	TSS	482790	482791	-0.035460	+	.
Adh	LMESSM	TSS	486000	486001	-0.038740	+	.
Adh	LMESSM	TSS	487410	487411	-0.031370	+	.
Adh	LMESSM	TSS	494460	494461	-0.034320	+	.
Adh	LMESSM	TSS	494980	494981	-0.061958	+	.
Adh	LMESSM	TSS	495870	495871	-0.038820	+	.
Adh	LMESSM	TSS	496840	496841	-0.040472	+	.
Adh	LMESSM	TSS	507640	507641	-0.044848	+	.
Adh	LMESSM	TSS	513350	513351	-0.032620	+	.
Adh	LMESSM	TSS	514110	514111	-0.033025	+	.
Adh	LMESSM	TSS	515620	515621	-0.039920	+	.
Adh	LMESSM	TSS	519750	519751	-0.037879	+	.
Adh	LMESSM	TSS	520790	520791	-0.038350	+	.
Adh	LMESSM	TSS	523970	523971	-0.032492	+	.
Adh	LMESSM	TSS	524810	524811	-0.033073	+	.
Adh	LMESSM	TSS	528590	528591	-0.035656	+	.
Adh	LMESSM	TSS	529470	529471	-0.038801	+	.
Adh	LMESSM	TSS	530260	530261	-0.037169	+	.
Adh	LMESSM	TSS	530610	530611	-0.032571	+	.
Adh	LMESSM	TSS	532800	532801	-0.036177	+	.
Adh	LMESSM	TSS	534240	534241	-0.051467	+	.
Adh	LMESSM	TSS	537570	537571	-0.037440	+	.
Adh	LMESSM	TSS	538030	538031	-0.033300	+	.
Adh	LMESSM	TSS	539250	539251	-0.033081	+	.
Adh	LMESSM	TSS	539860	539861	-0.031681	+	.
Adh	LMESSM	TSS	543690	543691	-0.055569	+	.
Adh	LMESSM	TSS	545640	545641	-0.054188	+	.
Adh	LMESSM	TSS	547180	547181	-0.037277	+	.
Adh	LMESSM	TSS	549040	549041	-0.051646	+	.
Adh	LMESSM	TSS	552770	552771	-0.043929	+	.
Adh	LMESSM	TSS	554170	554171	-0.035059	+	.
Adh	LMESSM	TSS	555430	555431	-0.041283	+	.
Adh	LMESSM	TSS	556080	556081	-0.038713	+	.
Adh	LMESSM	TSS	556410	556411	-0.036839	+	.
Adh	LMESSM	TSS	558010	558011	-0.032391	+	.
Adh	LMESSM	TSS	563660	563661	-0.038213	+	.
Adh	LMESSM	TSS	568780	568781	-0.033620	+	.
Adh	LMESSM	TSS	569610	569611	-0.042590	+	.
Adh	LMESSM	TSS	570420	570421	-0.050933	+	.
Adh	LMESSM	TSS	571010	571011	-0.038858	+	.
Adh	LMESSM	TSS	574350	574351	-0.035159	+	.
Adh	LMESSM	TSS	581940	581941	-0.043435	+	.
Adh	LMESSM	TSS	584410	584411	-0.037795	+	.
Adh	LMESSM	TSS	589850	589851	-0.031800	+	.
Adh	LMESSM	TSS	593860	593861	-0.044918	+	.
Adh	LMESSM	TSS	594200	594201	-0.047001	+	.
Adh	LMESSM	TSS	597540	597541	-0.037735	+	.
Adh	LMESSM	TSS	599370	599371	-0.041860	+	.
Adh	LMESSM	TSS	602470	602471	-0.041554	+	.
Adh	LMESSM	TSS	603110	603111	-0.043292	+	.
Adh	LMESSM	TSS	603630	603631	-0.035970	+	.
Adh	LMESSM	TSS	604570	604571	-0.038371	+	.
Adh	LMESSM	TSS	605530	605531	-0.032325	+	.
Adh	LMESSM	TSS	606030	606031	-0.037909	+	.
Adh	LMESSM	TSS	606430	606431	-0.032330	+	.
Adh	LMESSM	TSS	607520	607521	-0.031880	+	.
Adh	LMESSM	TSS	609090	609091	-0.035291	+	.
Adh	LMESSM	TSS	609820	609821	-0.039729	+	.
Adh	LMESSM	TSS	610210	610211	-0.043764	+	.
Adh	LMESSM	TSS	611340	611341	-0.043658	+	.
Adh	LMESSM	TSS	612380	612381	-0.035331	+	.
Adh	LMESSM	TSS	613020	613021	-0.032900	+	.
Adh	LMESSM	TSS	613500	613501	-0.044330	+	.
Adh	LMESSM	TSS	615450	615451	-0.039876	+	.
Adh	LMESSM	TSS	615670	615671	-0.031782	+	.
Adh	LMESSM	TSS	619500	619501	-0.045289	+	.
Adh	LMESSM	TSS	622160	622161	-0.037890	+	.
Adh	LMESSM	TSS	623110	623111	-0.032371	+	.
Adh	LMESSM	TSS	624150	624151	-0.036335	+	.
Adh	LMESSM	TSS	627270	627271	-0.044964	+	.
Adh	LMESSM	TSS	627680	627681	-0.039059	+	.
Adh	LMESSM	TSS	628200	628201	-0.048364	+	.
Adh	LMESSM	TSS	628670	628671	-0.037984	+	.
Adh	LMESSM	TSS	633440	633441	-0.036470	+	.
Adh	LMESSM	TSS	633810	633811	-0.033599	+	.
Adh	LMESSM	TSS	635820	635821	-0.030920	+	.
Adh	LMESSM	TSS	639130	639131	-0.044645	+	.
Adh	LMESSM	TSS	639640	639641	-0.032705	+	.
Adh	LMESSM	TSS	640840	640841	-0.039820	+	.
Adh	LMESSM	TSS	643050	643051	-0.040652	+	.
Adh	LMESSM	TSS	644600	644601	-0.038130	+	.
Adh	LMESSM	TSS	645070	645071	-0.047131	+	.
Adh	LMESSM	TSS	652460	652461	-0.037843	+	.
Adh	LMESSM	TSS	655440	655441	-0.031110	+	.
Adh	LMESSM	TSS	658330	658331	-0.042820	+	.
Adh	LMESSM	TSS	661980	661981	-0.037180	+	.
Adh	LMESSM	TSS	663920	663921	-0.033810	+	.
Adh	LMESSM	TSS	668160	668161	-0.038620	+	.
Adh	LMESSM	TSS	671440	671441	-0.036640	+	.
Adh	LMESSM	TSS	674570	674571	-0.042159	+	.
Adh	LMESSM	TSS	679770	679771	-0.031800	+	.
Adh	LMESSM	TSS	682100	682101	-0.034399	+	.
Adh	LMESSM	TSS	682880	682881	-0.036671	+	.
Adh	LMESSM	TSS	684040	684041	-0.035490	+	.
Adh	LMESSM	TSS	686500	686501	-0.031950	+	.
Adh	LMESSM	TSS	687170	687171	-0.033720	+	.
Adh	LMESSM	TSS	689710	689711	-0.031611	+	.
Adh	LMESSM	TSS	690790	690791	-0.032319	+	.
Adh	LMESSM	TSS	691870	691871	-0.035480	+	.
Adh	LMESSM	TSS	694620	694621	-0.033695	+	.
Adh	LMESSM	TSS	697290	697291	-0.032860	+	.
Adh	LMESSM	TSS	697940	697941	-0.031249	+	.
Adh	LMESSM	TSS	698200	698201	-0.033333	+	.
Adh	LMESSM	TSS	699600	699601	-0.034991	+	.
Adh	LMESSM	TSS	700370	700371	-0.034280	+	.
Adh	LMESSM	TSS	700800	700801	-0.042451	+	.
Adh	LMESSM	TSS	705360	705361	-0.040491	+	.
Adh	LMESSM	TSS	707130	707131	-0.031670	+	.
Adh	LMESSM	TSS	712940	712941	-0.048849	+	.
Adh	LMESSM	TSS	721580	721581	-0.041170	+	.
Adh	LMESSM	TSS	722400	722401	-0.039091	+	.
Adh	LMESSM	TSS	726720	726721	-0.040240	+	.
Adh	LMESSM	TSS	727800	727801	-0.037450	+	.
Adh	LMESSM	TSS	730490	730491	-0.034268	+	.
Adh	LMESSM	TSS	731780	731781	-0.038618	+	.
Adh	LMESSM	TSS	735310	735311	-0.036457	+	.
Adh	LMESSM	TSS	737080	737081	-0.032800	+	.
Adh	LMESSM	TSS	738020	738021	-0.036848	+	.
Adh	LMESSM	TSS	744060	744061	-0.040736	+	.
Adh	LMESSM	TSS	747900	747901	-0.037145	+	.
Adh	LMESSM	TSS	750630	750631	-0.046896	+	.
Adh	LMESSM	TSS	751790	751791	-0.034533	+	.
Adh	LMESSM	TSS	754100	754101	-0.041066	+	.
Adh	LMESSM	TSS	754810	754811	-0.042550	+	.
Adh	LMESSM	TSS	755170	755171	-0.033179	+	.
Adh	LMESSM	TSS	756720	756721	-0.035741	+	.
Adh	LMESSM	TSS	758160	758161	-0.031141	+	.
Adh	LMESSM	TSS	759230	759231	-0.036441	+	.
Adh	LMESSM	TSS	761560	761561	-0.032147	+	.
Adh	LMESSM	TSS	764050	764051	-0.031222	+	.
Adh	LMESSM	TSS	766340	766341	-0.044803	+	.
Adh	LMESSM	TSS	772060	772061	-0.033630	+	.
Adh	LMESSM	TSS	774630	774631	-0.056500	+	.
Adh	LMESSM	TSS	776840	776841	-0.035999	+	.
Adh	LMESSM	TSS	779890	779891	-0.033380	+	.
Adh	LMESSM	TSS	782860	782861	-0.033062	+	.
Adh	LMESSM	TSS	784120	784121	-0.051099	+	.
Adh	LMESSM	TSS	785750	785751	-0.035380	+	.
Adh	LMESSM	TSS	786820	786821	-0.039408	+	.
Adh	LMESSM	TSS	787680	787681	-0.036159	+	.
Adh	LMESSM	TSS	788490	788491	-0.035096	+	.
Adh	LMESSM	TSS	788700	788701	-0.037590	+	.
Adh	LMESSM	TSS	791960	791961	-0.038267	+	.
Adh	LMESSM	TSS	792100	792101	-0.031141	+	.
Adh	LMESSM	TSS	793830	793831	-0.049332	+	.
Adh	LMESSM	TSS	794880	794881	-0.052030	+	.
Adh	LMESSM	TSS	796350	796351	-0.040791	+	.
Adh	LMESSM	TSS	796940	796941	-0.039155	+	.
Adh	LMESSM	TSS	798470	798471	-0.035300	+	.
Adh	LMESSM	TSS	799500	799501	-0.035529	+	.
Adh	LMESSM	TSS	806250	806251	-0.033341	+	.
Adh	LMESSM	TSS	808800	808801	-0.031900	+	.
Adh	LMESSM	TSS	810320	810321	-0.038590	+	.
Adh	LMESSM	TSS	812010	812011	-0.039600	+	.
Adh	LMESSM	TSS	817410	817411	-0.034068	+	.
Adh	LMESSM	TSS	820240	820241	-0.052965	+	.
Adh	LMESSM	TSS	826500	826501	-0.033010	+	.
Adh	LMESSM	TSS	827310	827311	-0.056844	+	.
Adh	LMESSM	TSS	828130	828131	-0.036865	+	.
Adh	LMESSM	TSS	832110	832111	-0.040360	+	.
Adh	LMESSM	TSS	836580	836581	-0.035667	+	.
Adh	LMESSM	TSS	839300	839301	-0.033071	+	.
Adh	LMESSM	TSS	841860	841861	-0.046390	+	.
Adh	LMESSM	TSS	849000	849001	-0.052141	+	.
Adh	LMESSM	TSS	852050	852051	-0.032249	+	.
Adh	LMESSM	TSS	853170	853171	-0.038745	+	.
Adh	LMESSM	TSS	857330	857331	-0.031634	+	.
Adh	LMESSM	TSS	858540	858541	-0.036245	+	.
Adh	LMESSM	TSS	860100	860101	-0.041141	+	.
Adh	LMESSM	TSS	863500	863501	-0.031841	+	.
Adh	LMESSM	TSS	864250	864251	-0.030960	+	.
Adh	LMESSM	TSS	873250	873251	-0.035040	+	.
Adh	LMESSM	TSS	875910	875911	-0.031639	+	.
Adh	LMESSM	TSS	879200	879201	-0.053031	+	.
Adh	LMESSM	TSS	880130	880131	-0.039938	+	.
Adh	LMESSM	TSS	881010	881011	-0.042720	+	.
Adh	LMESSM	TSS	881620	881621	-0.042233	+	.
Adh	LMESSM	TSS	884960	884961	-0.033434	+	.
Adh	LMESSM	TSS	888130	888131	-0.038900	+	.
Adh	LMESSM	TSS	891950	891951	-0.038591	+	.
Adh	LMESSM	TSS	893220	893221	-0.033360	+	.
Adh	LMESSM	TSS	896310	896311	-0.037160	+	.
Adh	LMESSM	TSS	900470	900471	-0.036601	+	.
Adh	LMESSM	TSS	901390	901391	-0.033901	+	.
Adh	LMESSM	TSS	902360	902361	-0.035060	+	.
Adh	LMESSM	TSS	903400	903401	-0.040641	+	.
Adh	LMESSM	TSS	904420	904421	-0.050259	+	.
Adh	LMESSM	TSS	909600	909601	-0.041341	+	.
Adh	LMESSM	TSS	910830	910831	-0.034503	+	.
Adh	LMESSM	TSS	912940	912941	-0.031887	+	.
Adh	LMESSM	TSS	914390	914391	-0.040878	+	.
Adh	LMESSM	TSS	915160	915161	-0.044432	+	.
Adh	LMESSM	TSS	917330	917331	-0.041091	+	.
Adh	LMESSM	TSS	920160	920161	-0.034111	+	.
Adh	LMESSM	TSS	926820	926821	-0.055109	+	.
Adh	LMESSM	TSS	927090	927091	-0.032701	+	.
Adh	LMESSM	TSS	930910	930911	-0.043441	+	.
Adh	LMESSM	TSS	931420	931421	-0.034723	+	.
Adh	LMESSM	TSS	934280	934281	-0.035088	+	.
Adh	LMESSM	TSS	935890	935891	-0.034620	+	.
Adh	LMESSM	TSS	937940	937941	-0.036287	+	.
Adh	LMESSM	TSS	940060	940061	-0.032338	+	.
Adh	LMESSM	TSS	941890	941891	-0.033830	+	.
Adh	LMESSM	TSS	943050	943051	-0.069090	+	.
Adh	LMESSM	TSS	944100	944101	-0.040231	+	.
Adh	LMESSM	TSS	945830	945831	-0.033938	+	.
Adh	LMESSM	TSS	946750	946751	-0.033440	+	.
Adh	LMESSM	TSS	947080	947081	-0.043320	+	.
Adh	LMESSM	TSS	948560	948561	-0.032698	+	.
Adh	LMESSM	TSS	953350	953351	-0.035811	+	.
Adh	LMESSM	TSS	954690	954691	-0.031630	+	.
Adh	LMESSM	TSS	957130	957131	-0.040301	+	.
Adh	LMESSM	TSS	958610	958611	-0.037680	+	.
Adh	LMESSM	TSS	961850	961851	-0.036011	+	.
Adh	LMESSM	TSS	964050	964051	-0.040771	+	.
Adh	LMESSM	TSS	966620	966621	-0.035299	+	.
Adh	LMESSM	TSS	968330	968331	-0.031821	+	.
Adh	LMESSM	TSS	968690	968691	-0.052169	+	.
Adh	LMESSM	TSS	973090	973091	-0.034910	+	.
Adh	LMESSM	TSS	976840	976841	-0.034347	+	.
Adh	LMESSM	TSS	977320	977321	-0.037208	+	.
Adh	LMESSM	TSS	979020	979021	-0.037340	+	.
Adh	LMESSM	TSS	979560	979561	-0.040900	+	.
Adh	LMESSM	TSS	979850	979851	-0.031954	+	.
Adh	LMESSM	TSS	980260	980261	-0.032056	+	.
Adh	LMESSM	TSS	981890	981891	-0.032111	+	.
Adh	LMESSM	TSS	984060	984061	-0.052265	+	.
Adh	LMESSM	TSS	984710	984711	-0.063345	+	.
Adh	LMESSM	TSS	985500	985501	-0.031360	+	.
Adh	LMESSM	TSS	989430	989431	-0.034831	+	.
Adh	LMESSM	TSS	991300	991301	-0.035680	+	.
Adh	LMESSM	TSS	992670	992671	-0.031920	+	.
Adh	LMESSM	TSS	993390	993391	-0.039889	+	.
Adh	LMESSM	TSS	996910	996911	-0.049444	+	.
Adh	LMESSM	TSS	997780	997781	-0.054812	+	.
Adh	LMESSM	TSS	998780	998781	-0.035061	+	.
Adh	LMESSM	TSS	999420	999421	-0.038580	+	.
Adh	LMESSM	TSS	1000780	1000781	-0.037050	+	.
Adh	LMESSM	TSS	1002950	1002951	-0.046965	+	.
Adh	LMESSM	TSS	1003600	1003601	-0.032949	+	.
Adh	LMESSM	TSS	1004540	1004541	-0.031057	+	.
Adh	LMESSM	TSS	1005410	1005411	-0.031920	+	.
Adh	LMESSM	TSS	1005730	1005731	-0.037333	+	.
Adh	LMESSM	TSS	1006540	1006541	-0.051120	+	.
Adh	LMESSM	TSS	1007670	1007671	-0.040030	+	.
Adh	LMESSM	TSS	1009950	1009951	-0.031441	+	.
Adh	LMESSM	TSS	1011210	1011211	-0.035339	+	.
Adh	LMESSM	TSS	1012840	1012841	-0.032940	+	.
Adh	LMESSM	TSS	1013490	1013491	-0.036888	+	.
Adh	LMESSM	TSS	1014530	1014531	-0.040808	+	.
Adh	LMESSM	TSS	1017450	1017451	-0.031409	+	.
Adh	LMESSM	TSS	1017980	1017981	-0.035488	+	.
Adh	LMESSM	TSS	1018170	1018171	-0.035250	+	.
Adh	LMESSM	TSS	1022780	1022781	-0.035831	+	.
Adh	LMESSM	TSS	1023550	1023551	-0.038675	+	.
Adh	LMESSM	TSS	1025460	1025461	-0.056057	+	.
Adh	LMESSM	TSS	1029310	1029311	-0.031045	+	.
Adh	LMESSM	TSS	1034190	1034191	-0.034660	+	.
Adh	LMESSM	TSS	1035810	1035811	-0.039075	+	.
Adh	LMESSM	TSS	1036840	1036841	-0.037648	+	.
Adh	LMESSM	TSS	1041080	1041081	-0.031550	+	.
Adh	LMESSM	TSS	1043800	1043801	-0.040746	+	.
Adh	LMESSM	TSS	1044360	1044361	-0.031740	+	.
Adh	LMESSM	TSS	1044760	1044761	-0.033165	+	.
Adh	LMESSM	TSS	1046560	1046561	-0.032666	+	.
Adh	LMESSM	TSS	1047500	1047501	-0.041070	+	.
Adh	LMESSM	TSS	1048220	1048221	-0.039130	+	.
Adh	LMESSM	TSS	1048510	1048511	-0.038891	+	.
Adh	LMESSM	TSS	1049400	1049401	-0.064530	+	.
Adh	LMESSM	TSS	1051290	1051291	-0.050041	+	.
Adh	LMESSM	TSS	1053140	1053141	-0.035446	+	.
Adh	LMESSM	TSS	1054100	1054101	-0.033795	+	.
Adh	LMESSM	TSS	1054540	1054541	-0.046191	+	.
Adh	LMESSM	TSS	1055950	1055951	-0.033150	+	.
Adh	LMESSM	TSS	1056600	1056601	-0.032801	+	.
Adh	LMESSM	TSS	1059000	1059001	-0.034901	+	.
Adh	LMESSM	TSS	1059660	1059661	-0.033190	+	.
Adh	LMESSM	TSS	1061090	1061091	-0.031061	+	.
Adh	LMESSM	TSS	1062540	1062541	-0.036869	+	.
Adh	LMESSM	TSS	1063720	1063721	-0.040249	+	.
Adh	LMESSM	TSS	1065550	1065551	-0.031571	+	.
Adh	LMESSM	TSS	1066770	1066771	-0.034925	+	.
Adh	LMESSM	TSS	1067400	1067401	-0.040983	+	.
Adh	LMESSM	TSS	1068360	1068361	-0.040409	+	.
Adh	LMESSM	TSS	1070670	1070671	-0.031027	+	.
Adh	LMESSM	TSS	1071310	1071311	-0.044228	+	.
Adh	LMESSM	TSS	1071990	1071991	-0.040886	+	.
Adh	LMESSM	TSS	1074740	1074741	-0.034021	+	.
Adh	LMESSM	TSS	1077780	1077781	-0.032451	+	.
Adh	LMESSM	TSS	1078570	1078571	-0.033141	+	.
Adh	LMESSM	TSS	1079220	1079221	-0.033985	+	.
Adh	LMESSM	TSS	1080630	1080631	-0.034501	+	.
Adh	LMESSM	TSS	1081820	1081821	-0.036596	+	.
Adh	LMESSM	TSS	1083540	1083541	-0.031720	+	.
Adh	LMESSM	TSS	1084330	1084331	-0.037810	+	.
Adh	LMESSM	TSS	1085220	1085221	-0.044930	+	.
Adh	LMESSM	TSS	1086430	1086431	-0.032216	+	.
Adh	LMESSM	TSS	1088790	1088791	-0.035338	+	.
Adh	LMESSM	TSS	1090270	1090271	-0.031661	+	.
Adh	LMESSM	TSS	1094930	1094931	-0.051085	+	.
Adh	LMESSM	TSS	1095930	1095931	-0.036260	+	.
Adh	LMESSM	TSS	1096430	1096431	-0.039630	+	.
Adh	LMESSM	TSS	1099660	1099661	-0.045400	+	.
Adh	LMESSM	TSS	1101720	1101721	-0.042680	+	.
Adh	LMESSM	TSS	1102950	1102951	-0.031990	+	.
Adh	LMESSM	TSS	1103970	1103971	-0.040934	+	.
Adh	LMESSM	TSS	1104560	1104561	-0.044110	+	.
Adh	LMESSM	TSS	1106390	1106391	-0.032481	+	.
Adh	LMESSM	TSS	1109300	1109301	-0.042811	+	.
Adh	LMESSM	TSS	1110070	1110071	-0.049202	+	.
Adh	LMESSM	TSS	1112370	1112371	-0.039003	+	.
Adh	LMESSM	TSS	1115210	1115211	-0.032691	+	.
Adh	LMESSM	TSS	1116410	1116411	-0.036685	+	.
Adh	LMESSM	TSS	1117530	1117531	-0.038756	+	.
Adh	LMESSM	TSS	1118730	1118731	-0.038440	+	.
Adh	LMESSM	TSS	1121440	1121441	-0.035718	+	.
Adh	LMESSM	TSS	1125060	1125061	-0.031520	+	.
Adh	LMESSM	TSS	1125240	1125241	-0.040037	+	.
Adh	LMESSM	TSS	1127260	1127261	-0.041681	+	.
Adh	LMESSM	TSS	1133960	1133961	-0.034710	+	.
Adh	LMESSM	TSS	1135480	1135481	-0.040650	+	.
Adh	LMESSM	TSS	1145720	1145721	-0.037986	+	.
Adh	LMESSM	TSS	1146050	1146051	-0.033811	+	.
Adh	LMESSM	TSS	1147030	1147031	-0.031614	+	.
Adh	LMESSM	TSS	1148800	1148801	-0.035230	+	.
Adh	LMESSM	TSS	1150530	1150531	-0.044790	+	.
Adh	LMESSM	TSS	1151970	1151971	-0.038131	+	.
Adh	LMESSM	TSS	1153190	1153191	-0.032961	+	.
Adh	LMESSM	TSS	1153890	1153891	-0.033330	+	.
Adh	LMESSM	TSS	1156130	1156131	-0.041488	+	.
Adh	LMESSM	TSS	1156860	1156861	-0.048130	+	.
Adh	LMESSM	TSS	1159410	1159411	-0.036310	+	.
Adh	LMESSM	TSS	1159800	1159801	-0.045075	+	.
Adh	LMESSM	TSS	1162810	1162811	-0.042181	+	.
Adh	LMESSM	TSS	1170360	1170361	-0.033571	+	.
Adh	LMESSM	TSS	1173740	1173741	-0.037730	+	.
Adh	LMESSM	TSS	1174630	1174631	-0.036221	+	.
Adh	LMESSM	TSS	1175100	1175101	-0.033572	+	.
Adh	LMESSM	TSS	1182400	1182401	-0.042709	+	.
Adh	LMESSM	TSS	1187740	1187741	-0.032010	+	.
Adh	LMESSM	TSS	1189770	1189771	-0.033834	+	.
Adh	LMESSM	TSS	1196560	1196561	-0.049850	+	.
Adh	LMESSM	TSS	1198030	1198031	-0.032040	+	.
Adh	LMESSM	TSS	1199580	1199581	-0.031863	+	.
Adh	LMESSM	TSS	1205710	1205711	-0.039102	+	.
Adh	LMESSM	TSS	1206600	1206601	-0.031887	+	.
Adh	LMESSM	TSS	1207850	1207851	-0.031058	+	.
Adh	LMESSM	TSS	1209150	1209151	-0.031350	+	.
Adh	LMESSM	TSS	1211560	1211561	-0.049813	+	.
Adh	LMESSM	TSS	1216240	1216241	-0.033179	+	.
Adh	LMESSM	TSS	1219230	1219231	-0.039246	+	.
Adh	LMESSM	TSS	1220240	1220241	-0.032241	+	.
Adh	LMESSM	TSS	1221320	1221321	-0.035404	+	.
Adh	LMESSM	TSS	1221660	1221661	-0.051675	+	.
Adh	LMESSM	TSS	1222250	1222251	-0.033811	+	.
Adh	LMESSM	TSS	1227100	1227101	-0.037732	+	.
Adh	LMESSM	TSS	1228470	1228471	-0.032045	+	.
Adh	LMESSM	TSS	1229820	1229821	-0.044010	+	.
Adh	LMESSM	TSS	1234170	1234171	-0.034940	+	.
Adh	LMESSM	TSS	1237810	1237811	-0.032330	+	.
Adh	LMESSM	TSS	1238120	1238121	-0.043860	+	.
Adh	LMESSM	TSS	1240260	1240261	-0.041336	+	.
Adh	LMESSM	TSS	1241730	1241731	-0.042311	+	.
Adh	LMESSM	TSS	1247720	1247721	-0.032037	+	.
Adh	LMESSM	TSS	1249910	1249911	-0.034806	+	.
Adh	LMESSM	TSS	1250820	1250821	-0.036762	+	.
Adh	LMESSM	TSS	1252100	1252101	-0.030991	+	.
Adh	LMESSM	TSS	1252600	1252601	-0.032071	+	.
Adh	LMESSM	TSS	1254170	1254171	-0.031909	+	.
Adh	LMESSM	TSS	1255050	1255051	-0.035203	+	.
Adh	LMESSM	TSS	1255800	1255801	-0.037360	+	.
Adh	LMESSM	TSS	1256440	1256441	-0.036580	+	.
Adh	LMESSM	TSS	1264540	1264541	-0.033951	+	.
Adh	LMESSM	TSS	1272000	1272001	-0.034584	+	.
Adh	LMESSM	TSS	1273630	1273631	-0.035024	+	.
Adh	LMESSM	TSS	1274310	1274311	-0.031490	+	.
Adh	LMESSM	TSS	1275090	1275091	-0.045886	+	.
Adh	LMESSM	TSS	1275540	1275541	-0.050831	+	.
Adh	LMESSM	TSS	1278400	1278401	-0.032821	+	.
Adh	LMESSM	TSS	1278770	1278771	-0.033174	+	.
Adh	LMESSM	TSS	1282600	1282601	-0.036417	+	.
Adh	LMESSM	TSS	1287490	1287491	-0.036340	+	.
Adh	LMESSM	TSS	1290720	1290721	-0.035908	+	.
Adh	LMESSM	TSS	1291250	1291251	-0.032010	+	.
Adh	LMESSM	TSS	1294100	1294101	-0.038610	+	.
Adh	LMESSM	TSS	1298200	1298201	-0.030991	+	.
Adh	LMESSM	TSS	1301010	1301011	-0.039150	+	.
Adh	LMESSM	TSS	1307290	1307291	-0.032400	+	.
Adh	LMESSM	TSS	1307900	1307901	-0.039855	+	.
Adh	LMESSM	TSS	1309170	1309171	-0.035180	+	.
Adh	LMESSM	TSS	1312250	1312251	-0.030929	+	.
Adh	LMESSM	TSS	1312770	1312771	-0.044307	+	.
Adh	LMESSM	TSS	1316170	1316171	-0.032135	+	.
Adh	LMESSM	TSS	1316950	1316951	-0.033111	+	.
Adh	LMESSM	TSS	1324180	1324181	-0.039845	+	.
Adh	LMESSM	TSS	1324910	1324911	-0.034760	+	.
Adh	LMESSM	TSS	1327440	1327441	-0.032994	+	.
Adh	LMESSM	TSS	1328320	1328321	-0.035601	+	.
Adh	LMESSM	TSS	1333690	1333691	-0.048407	+	.
Adh	LMESSM	TSS	1334930	1334931	-0.036353	+	.
Adh	LMESSM	TSS	1335290	1335291	-0.034725	+	.
Adh	LMESSM	TSS	1337480	1337481	-0.033273	+	.
Adh	LMESSM	TSS	1338020	1338021	-0.031444	+	.
Adh	LMESSM	TSS	1341480	1341481	-0.044257	+	.
Adh	LMESSM	TSS	1342000	1342001	-0.030901	+	.
Adh	LMESSM	TSS	1351410	1351411	-0.039110	+	.
Adh	LMESSM	TSS	1354540	1354541	-0.037403	+	.
Adh	LMESSM	TSS	1356270	1356271	-0.033939	+	.
Adh	LMESSM	TSS	1361330	1361331	-0.033050	+	.
Adh	LMESSM	TSS	1363560	1363561	-0.036966	+	.
Adh	LMESSM	TSS	1364670	1364671	-0.042896	+	.
Adh	LMESSM	TSS	1366510	1366511	-0.039220	+	.
Adh	LMESSM	TSS	1368960	1368961	-0.033730	+	.
Adh	LMESSM	TSS	1369500	1369501	-0.035689	+	.
Adh	LMESSM	TSS	1370380	1370381	-0.032455	+	.
Adh	LMESSM	TSS	1370920	1370921	-0.035470	+	.
Adh	LMESSM	TSS	1371590	1371591	-0.041329	+	.
Adh	LMESSM	TSS	1372940	1372941	-0.033218	+	.
Adh	LMESSM	TSS	1377230	1377231	-0.032357	+	.
Adh	LMESSM	TSS	1382220	1382221	-0.038388	+	.
Adh	LMESSM	TSS	1382370	1382371	-0.033967	+	.
Adh	LMESSM	TSS	1383000	1383001	-0.034483	+	.
Adh	LMESSM	TSS	1388750	1388751	-0.033420	+	.
Adh	LMESSM	TSS	1394180	1394181	-0.039740	+	.
Adh	LMESSM	TSS	1394920	1394921	-0.035426	+	.
Adh	LMESSM	TSS	1396040	1396041	-0.032185	+	.
Adh	LMESSM	TSS	1400100	1400101	-0.033969	+	.
Adh	LMESSM	TSS	1402070	1402071	-0.049985	+	.
Adh	LMESSM	TSS	1403260	1403261	-0.034651	+	.
Adh	LMESSM	TSS	1404230	1404231	-0.042167	+	.
Adh	LMESSM	TSS	1405850	1405851	-0.042642	+	.
Adh	LMESSM	TSS	1405970	1405971	-0.043108	+	.
Adh	LMESSM	TSS	1407420	1407421	-0.034901	+	.
Adh	LMESSM	TSS	1408050	1408051	-0.047009	+	.
Adh	LMESSM	TSS	1409000	1409001	-0.036460	+	.
Adh	LMESSM	TSS	1409500	1409501	-0.036549	+	.
Adh	LMESSM	TSS	1410860	1410861	-0.040968	+	.
Adh	LMESSM	TSS	1411580	1411581	-0.040697	+	.
Adh	LMESSM	TSS	1414500	1414501	-0.037157	+	.
Adh	LMESSM	TSS	1415400	1415401	-0.040170	+	.
Adh	LMESSM	TSS	1416180	1416181	-0.047056	+	.
Adh	LMESSM	TSS	1420680	1420681	-0.034829	+	.
Adh	LMESSM	TSS	1426220	1426221	-0.035831	+	.
Adh	LMESSM	TSS	1429790	1429791	-0.037162	+	.
Adh	LMESSM	TSS	1431350	1431351	-0.060242	+	.
Adh	LMESSM	TSS	1437640	1437641	-0.031480	+	.
Adh	LMESSM	TSS	1439430	1439431	-0.037362	+	.
Adh	LMESSM	TSS	1440940	1440941	-0.039686	+	.
Adh	LMESSM	TSS	1448690	1448691	-0.032371	+	.
Adh	LMESSM	TSS	1452820	1452821	-0.032331	+	.
Adh	LMESSM	TSS	1453200	1453201	-0.042120	+	.
Adh	LMESSM	TSS	1460900	1460901	-0.032630	+	.
Adh	LMESSM	TSS	1461920	1461921	-0.053112	+	.
Adh	LMESSM	TSS	1462220	1462221	-0.033375	+	.
Adh	LMESSM	TSS	1472650	1472651	-0.031681	+	.
Adh	LMESSM	TSS	1473520	1473521	-0.032031	+	.
Adh	LMESSM	TSS	1474130	1474131	-0.044691	+	.
Adh	LMESSM	TSS	1477470	1477471	-0.041940	+	.
Adh	LMESSM	TSS	1479430	1479431	-0.038240	+	.
Adh	LMESSM	TSS	1479770	1479771	-0.049254	+	.
Adh	LMESSM	TSS	1481430	1481431	-0.047006	+	.
Adh	LMESSM	TSS	1481660	1481661	-0.051023	+	.
Adh	LMESSM	TSS	1485370	1485371	-0.044467	+	.
Adh	LMESSM	TSS	1487330	1487331	-0.041501	+	.
Adh	LMESSM	TSS	1488240	1488241	-0.036221	+	.
Adh	LMESSM	TSS	1488910	1488911	-0.036890	+	.
Adh	LMESSM	TSS	1495690	1495691	-0.031183	+	.
Adh	LMESSM	TSS	1496400	1496401	-0.035335	+	.
Adh	LMESSM	TSS	1496900	1496901	-0.043186	+	.
Adh	LMESSM	TSS	1498690	1498691	-0.037958	+	.
Adh	LMESSM	TSS	1499130	1499131	-0.037173	+	.
Adh	LMESSM	TSS	1499720	1499721	-0.051651	+	.
Adh	LMESSM	TSS	1501660	1501661	-0.040323	+	.
Adh	LMESSM	TSS	1503470	1503471	-0.057420	+	.
Adh	LMESSM	TSS	1506000	1506001	-0.034498	+	.
Adh	LMESSM	TSS	1506680	1506681	-0.031841	+	.
Adh	LMESSM	TSS	1507760	1507761	-0.047410	+	.
Adh	LMESSM	TSS	1512950	1512951	-0.045504	+	.
Adh	LMESSM	TSS	1516460	1516461	-0.035233	+	.
Adh	LMESSM	TSS	1517670	1517671	-0.032885	+	.
Adh	LMESSM	TSS	1518970	1518971	-0.037620	+	.
Adh	LMESSM	TSS	1520120	1520121	-0.036163	+	.
Adh	LMESSM	TSS	1525260	1525261	-0.047228	+	.
Adh	LMESSM	TSS	1527740	1527741	-0.044565	+	.
Adh	LMESSM	TSS	1529380	1529381	-0.049217	+	.
Adh	LMESSM	TSS	1533270	1533271	-0.035520	+	.
Adh	LMESSM	TSS	1534170	1534171	-0.034410	+	.
Adh	LMESSM	TSS	1535920	1535921	-0.032387	+	.
Adh	LMESSM	TSS	1536550	1536551	-0.041443	+	.
Adh	LMESSM	TSS	1536730	1536731	-0.036987	+	.
Adh	LMESSM	TSS	1537210	1537211	-0.037208	+	.
Adh	LMESSM	TSS	1540790	1540791	-0.053201	+	.
Adh	LMESSM	TSS	1541760	1541761	-0.039307	+	.
Adh	LMESSM	TSS	1543410	1543411	-0.040740	+	.
Adh	LMESSM	TSS	1544360	1544361	-0.041550	+	.
Adh	LMESSM	TSS	1545070	1545071	-0.040150	+	.
Adh	LMESSM	TSS	1545210	1545211	-0.036671	+	.
Adh	LMESSM	TSS	1546920	1546921	-0.046594	+	.
Adh	LMESSM	TSS	1547350	1547351	-0.043960	+	.
Adh	LMESSM	TSS	1549010	1549011	-0.034701	+	.
Adh	LMESSM	TSS	1550840	1550841	-0.031427	+	.
Adh	LMESSM	TSS	1555630	1555631	-0.031120	+	.
Adh	LMESSM	TSS	1556630	1556631	-0.034201	+	.
Adh	LMESSM	TSS	1557760	1557761	-0.034701	+	.
Adh	LMESSM	TSS	1559580	1559581	-0.041271	+	.
Adh	LMESSM	TSS	1560980	1560981	-0.032174	+	.
Adh	LMESSM	TSS	1562210	1562211	-0.054100	+	.
Adh	LMESSM	TSS	1563330	1563331	-0.039979	+	.
Adh	LMESSM	TSS	1565340	1565341	-0.043245	+	.
Adh	LMESSM	TSS	1566970	1566971	-0.042760	+	.
Adh	LMESSM	TSS	1575110	1575111	-0.031940	+	.
Adh	LMESSM	TSS	1577030	1577031	-0.049653	+	.
Adh	LMESSM	TSS	1581810	1581811	-0.044798	+	.
Adh	LMESSM	TSS	1583210	1583211	-0.031718	+	.
Adh	LMESSM	TSS	1584440	1584441	-0.036287	+	.
Adh	LMESSM	TSS	1585000	1585001	-0.043746	+	.
Adh	LMESSM	TSS	1587400	1587401	-0.047321	+	.
Adh	LMESSM	TSS	1590790	1590791	-0.032130	+	.
Adh	LMESSM	TSS	1591820	1591821	-0.042710	+	.
Adh	LMESSM	TSS	1598980	1598981	-0.050320	+	.
Adh	LMESSM	TSS	1601310	1601311	-0.031853	+	.
Adh	LMESSM	TSS	1603230	1603231	-0.044050	+	.
Adh	LMESSM	TSS	1604130	1604131	-0.037417	+	.
Adh	LMESSM	TSS	1606850	1606851	-0.033065	+	.
Adh	LMESSM	TSS	1611570	1611571	-0.044931	+	.
Adh	LMESSM	TSS	1615870	1615871	-0.042914	+	.
Adh	LMESSM	TSS	1616790	1616791	-0.045233	+	.
Adh	LMESSM	TSS	1617680	1617681	-0.037856	+	.
Adh	LMESSM	TSS	1622470	1622471	-0.031928	+	.
Adh	LMESSM	TSS	1624590	1624591	-0.045391	+	.
Adh	LMESSM	TSS	1628080	1628081	-0.042429	+	.
Adh	LMESSM	TSS	1629820	1629821	-0.033320	+	.
Adh	LMESSM	TSS	1630840	1630841	-0.038765	+	.
Adh	LMESSM	TSS	1631410	1631411	-0.036808	+	.
Adh	LMESSM	TSS	1632110	1632111	-0.033303	+	.
Adh	LMESSM	TSS	1635770	1635771	-0.049996	+	.
Adh	LMESSM	TSS	1637800	1637801	-0.036713	+	.
Adh	LMESSM	TSS	1639200	1639201	-0.033955	+	.
Adh	LMESSM	TSS	1639750	1639751	-0.051930	+	.
Adh	LMESSM	TSS	1644050	1644051	-0.036910	+	.
Adh	LMESSM	TSS	1644200	1644201	-0.043466	+	.
Adh	LMESSM	TSS	1645150	1645151	-0.039678	+	.
Adh	LMESSM	TSS	1645680	1645681	-0.037470	+	.
Adh	LMESSM	TSS	1649540	1649541	-0.031008	+	.
Adh	LMESSM	TSS	1650400	1650401	-0.041586	+	.
Adh	LMESSM	TSS	1651270	1651271	-0.041592	+	.
Adh	LMESSM	TSS	1653940	1653941	-0.036394	+	.
Adh	LMESSM	TSS	1655820	1655821	-0.038671	+	.
Adh	LMESSM	TSS	1657480	1657481	-0.044318	+	.
Adh	LMESSM	TSS	1661730	1661731	-0.036796	+	.
Adh	LMESSM	TSS	1664630	1664631	-0.031917	+	.
Adh	LMESSM	TSS	1665440	1665441	-0.034865	+	.
Adh	LMESSM	TSS	1669300	1669301	-0.037281	+	.
Adh	LMESSM	TSS	1671230	1671231	-0.040350	+	.
Adh	LMESSM	TSS	1672360	1672361	-0.030940	+	.
Adh	LMESSM	TSS	1672890	1672891	-0.038411	+	.
Adh	LMESSM	TSS	1674840	1674841	-0.034271	+	.
Adh	LMESSM	TSS	1677760	1677761	-0.048399	+	.
Adh	LMESSM	TSS	1682880	1682881	-0.032457	+	.
Adh	LMESSM	TSS	1683260	1683261	-0.033006	+	.
Adh	LMESSM	TSS	1685050	1685051	-0.043045	+	.
Adh	LMESSM	TSS	1690100	1690101	-0.031527	+	.
Adh	LMESSM	TSS	1694460	1694461	-0.032076	+	.
Adh	LMESSM	TSS	1699820	1699821	-0.033881	+	.
Adh	LMESSM	TSS	1700900	1700901	-0.045594	+	.
Adh	LMESSM	TSS	1702640	1702641	-0.034021	+	.
Adh	LMESSM	TSS	1703870	1703871	-0.032031	+	.
Adh	LMESSM	TSS	1705460	1705461	-0.039528	+	.
Adh	LMESSM	TSS	1714520	1714521	-0.031970	+	.
Adh	LMESSM	TSS	1718710	1718711	-0.042055	+	.
Adh	LMESSM	TSS	1721480	1721481	-0.046727	+	.
Adh	LMESSM	TSS	1724280	1724281	-0.037720	+	.
Adh	LMESSM	TSS	1727340	1727341	-0.039549	+	.
Adh	LMESSM	TSS	1727730	1727731	-0.045540	+	.
Adh	LMESSM	TSS	1728610	1728611	-0.037037	+	.
Adh	LMESSM	TSS	1729000	1729001	-0.036028	+	.
Adh	LMESSM	TSS	1730580	1730581	-0.043509	+	.
Adh	LMESSM	TSS	1732230	1732231	-0.031860	+	.
Adh	LMESSM	TSS	1734070	1734071	-0.032087	+	.
Adh	LMESSM	TSS	1734470	1734471	-0.038315	+	.
Adh	LMESSM	TSS	1735280	1735281	-0.045006	+	.
Adh	LMESSM	TSS	1736680	1736681	-0.042172	+	.
Adh	LMESSM	TSS	1738700	1738701	-0.033270	+	.
Adh	LMESSM	TSS	1742950	1742951	-0.035635	+	.
Adh	LMESSM	TSS	1745920	1745921	-0.038755	+	.
Adh	LMESSM	TSS	1748670	1748671	-0.036896	+	.
Adh	LMESSM	TSS	1750340	1750341	-0.042491	+	.
Adh	LMESSM	TSS	1751780	1751781	-0.042451	+	.
Adh	LMESSM	TSS	1752160	1752161	-0.051042	+	.
Adh	LMESSM	TSS	1753500	1753501	-0.038928	+	.
Adh	LMESSM	TSS	1754530	1754531	-0.045475	+	.
Adh	LMESSM	TSS	1756610	1756611	-0.040988	+	.
Adh	LMESSM	TSS	1759150	1759151	-0.039181	+	.
Adh	LMESSM	TSS	1759920	1759921	-0.032918	+	.
Adh	LMESSM	TSS	1761130	1761131	-0.031130	+	.
Adh	LMESSM	TSS	1763080	1763081	-0.032180	+	.
Adh	LMESSM	TSS	1763720	1763721	-0.037621	+	.
Adh	LMESSM	TSS	1768700	1768701	-0.031773	+	.
Adh	LMESSM	TSS	1769230	1769231	-0.040831	+	.
Adh	LMESSM	TSS	1769760	1769761	-0.033449	+	.
Adh	LMESSM	TSS	1773340	1773341	-0.032364	+	.
Adh	LMESSM	TSS	1779740	1779741	-0.031981	+	.
Adh	LMESSM	TSS	1781130	1781131	-0.032260	+	.
Adh	LMESSM	TSS	1782850	1782851	-0.034684	+	.
Adh	LMESSM	TSS	1783040	1783041	-0.036097	+	.
Adh	LMESSM	TSS	1784700	1784701	-0.031040	+	.
Adh	LMESSM	TSS	1787680	1787681	-0.045522	+	.
Adh	LMESSM	TSS	1789780	1789781	-0.033357	+	.
Adh	LMESSM	TSS	1790400	1790401	-0.034302	+	.
Adh	LMESSM	TSS	1790660	1790661	-0.034992	+	.
Adh	LMESSM	TSS	1791450	1791451	-0.036253	+	.
Adh	LMESSM	TSS	1792070	1792071	-0.045398	+	.
Adh	LMESSM	TSS	1793940	1793941	-0.035471	+	.
Adh	LMESSM	TSS	1794350	1794351	-0.038961	+	.
Adh	LMESSM	TSS	1795270	1795271	-0.037118	+	.
Adh	LMESSM	TSS	1796020	1796021	-0.031850	+	.
Adh	LMESSM	TSS	1800380	1800381	-0.031416	+	.
Adh	LMESSM	TSS	1801140	1801141	-0.042008	+	.
Adh	LMESSM	TSS	1802770	1802771	-0.031161	+	.
Adh	LMESSM	TSS	1803720	1803721	-0.043582	+	.
Adh	LMESSM	TSS	1804500	1804501	-0.049341	+	.
Adh	LMESSM	TSS	1805040	1805041	-0.031411	+	.
Adh	LMESSM	TSS	1805830	1805831	-0.031841	+	.
Adh	LMESSM	TSS	1807290	1807291	-0.040669	+	.
Adh	LMESSM	TSS	1808000	1808001	-0.032204	+	.
Adh	LMESSM	TSS	1809620	1809621	-0.043778	+	.
Adh	LMESSM	TSS	1811570	1811571	-0.036891	+	.
Adh	LMESSM	TSS	1820460	1820461	-0.035644	+	.
Adh	LMESSM	TSS	1822590	1822591	-0.035331	+	.
Adh	LMESSM	TSS	1823510	1823511	-0.060075	+	.
Adh	LMESSM	TSS	1826580	1826581	-0.034760	+	.
Adh	LMESSM	TSS	1826890	1826891	-0.036890	+	.
Adh	LMESSM	TSS	1827540	1827541	-0.043606	+	.
Adh	LMESSM	TSS	1829520	1829521	-0.041099	+	.
Adh	LMESSM	TSS	1830260	1830261	-0.041480	+	.
Adh	LMESSM	TSS	1833090	1833091	-0.037680	+	.
Adh	LMESSM	TSS	1833660	1833661	-0.033106	+	.
Adh	LMESSM	TSS	1836060	1836061	-0.031556	+	.
Adh	LMESSM	TSS	1837110	1837111	-0.033353	+	.
Adh	LMESSM	TSS	1837970	1837971	-0.035961	+	.
Adh	LMESSM	TSS	1840550	1840551	-0.036913	+	.
Adh	LMESSM	TSS	1843960	1843961	-0.033640	+	.
Adh	LMESSM	TSS	1844420	1844421	-0.030909	+	.
Adh	LMESSM	TSS	1846070	1846071	-0.033150	+	.
Adh	LMESSM	TSS	1847050	1847051	-0.031670	+	.
Adh	LMESSM	TSS	1848770	1848771	-0.032249	+	.
Adh	LMESSM	TSS	1849600	1849601	-0.049202	+	.
Adh	LMESSM	TSS	1850390	1850391	-0.039821	+	.
Adh	LMESSM	TSS	1852230	1852231	-0.043205	+	.
Adh	LMESSM	TSS	1852360	1852361	-0.046642	+	.
Adh	LMESSM	TSS	1854510	1854511	-0.033746	+	.
Adh	LMESSM	TSS	1857680	1857681	-0.031630	+	.
Adh	LMESSM	TSS	1858610	1858611	-0.037421	+	.
Adh	LMESSM	TSS	1860360	1860361	-0.037009	+	.
Adh	LMESSM	TSS	1861740	1861741	-0.037570	+	.
Adh	LMESSM	TSS	1862460	1862461	-0.033116	+	.
Adh	LMESSM	TSS	1865140	1865141	-0.035659	+	.
Adh	LMESSM	TSS	1866030	1866031	-0.031821	+	.
Adh	LMESSM	TSS	1866440	1866441	-0.043021	+	.
Adh	LMESSM	TSS	1869660	1869661	-0.049362	+	.
Adh	LMESSM	TSS	1872290	1872291	-0.035611	+	.
Adh	LMESSM	TSS	1873430	1873431	-0.031602	+	.
Adh	LMESSM	TSS	1874860	1874861	-0.037378	+	.
Adh	LMESSM	TSS	1875640	1875641	-0.043605	+	.
Adh	LMESSM	TSS	1877740	1877741	-0.034535	+	.
Adh	LMESSM	TSS	1879210	1879211	-0.033570	+	.
Adh	LMESSM	TSS	1880880	1880881	-0.044022	+	.
Adh	LMESSM	TSS	1882020	1882021	-0.040735	+	.
Adh	LMESSM	TSS	1885410	1885411	-0.033747	+	.
Adh	LMESSM	TSS	1887190	1887191	-0.031770	+	.
Adh	LMESSM	TSS	1887900	1887901	-0.041910	+	.
Adh	LMESSM	TSS	1888580	1888581	-0.031200	+	.
Adh	LMESSM	TSS	1890240	1890241	-0.032380	+	.
Adh	LMESSM	TSS	1895890	1895891	-0.041057	+	.
Adh	LMESSM	TSS	1896520	1896521	-0.035030	+	.
Adh	LMESSM	TSS	1897060	1897061	-0.032290	+	.
Adh	LMESSM	TSS	1900940	1900941	-0.033561	+	.
Adh	LMESSM	TSS	1901570	1901571	-0.033929	+	.
Adh	LMESSM	TSS	1902240	1902241	-0.036761	+	.
Adh	LMESSM	TSS	1903200	1903201	-0.036226	+	.
Adh	LMESSM	TSS	1904440	1904441	-0.031441	+	.
Adh	LMESSM	TSS	1904900	1904901	-0.031040	+	.
Adh	LMESSM	TSS	1905840	1905841	-0.038214	+	.
Adh	LMESSM	TSS	1908060	1908061	-0.037586	+	.
Adh	LMESSM	TSS	1908400	1908401	-0.045160	+	.
Adh	LMESSM	TSS	1908520	1908521	-0.037193	+	.
Adh	LMESSM	TSS	1908970	1908971	-0.033540	+	.
Adh	LMESSM	TSS	1909240	1909241	-0.032190	+	.
Adh	LMESSM	TSS	1910690	1910691	-0.043859	+	.
Adh	LMESSM	TSS	1912550	1912551	-0.042021	+	.
Adh	LMESSM	TSS	1914660	1914661	-0.048237	+	.
Adh	LMESSM	TSS	1915700	1915701	-0.053238	+	.
Adh	LMESSM	TSS	1918130	1918131	-0.035477	+	.
Adh	LMESSM	TSS	1919630	1919631	-0.034427	+	.
Adh	LMESSM	TSS	1920340	1920341	-0.045062	+	.
Adh	LMESSM	TSS	1921420	1921421	-0.036440	+	.
Adh	LMESSM	TSS	1922060	1922061	-0.032070	+	.
Adh	LMESSM	TSS	1925930	1925931	-0.031941	+	.
Adh	LMESSM	TSS	1926610	1926611	-0.041731	+	.
Adh	LMESSM	TSS	1928380	1928381	-0.031861	+	.
Adh	LMESSM	TSS	1929710	1929711	-0.032580	+	.
Adh	LMESSM	TSS	1930690	1930691	-0.043093	+	.
Adh	LMESSM	TSS	1933700	1933701	-0.034091	+	.
Adh	LMESSM	TSS	1934920	1934921	-0.032268	+	.
Adh	LMESSM	TSS	1935360	1935361	-0.033670	+	.
Adh	LMESSM	TSS	1936150	1936151	-0.050750	+	.
Adh	LMESSM	TSS	1936700	1936701	-0.034017	+	.
Adh	LMESSM	TSS	1943020	1943021	-0.046961	+	.
Adh	LMESSM	TSS	1945600	1945601	-0.042620	+	.
Adh	LMESSM	TSS	1949100	1949101	-0.043170	+	.
Adh	LMESSM	TSS	1950210	1950211	-0.036326	+	.
Adh	LMESSM	TSS	1951120	1951121	-0.035839	+	.
Adh	LMESSM	TSS	1952800	1952801	-0.037651	+	.
Adh	LMESSM	TSS	1953180	1953181	-0.040941	+	.
Adh	LMESSM	TSS	1953470	1953471	-0.031821	+	.
Adh	LMESSM	TSS	1954650	1954651	-0.039322	+	.
Adh	LMESSM	TSS	1956420	1956421	-0.033471	+	.
Adh	LMESSM	TSS	1957070	1957071	-0.042248	+	.
Adh	LMESSM	TSS	1958330	1958331	-0.046359	+	.
Adh	LMESSM	TSS	1958840	1958841	-0.031781	+	.
Adh	LMESSM	TSS	1958950	1958951	-0.031332	+	.
Adh	LMESSM	TSS	1959500	1959501	-0.036560	+	.
Adh	LMESSM	TSS	1960700	1960701	-0.037627	+	.
Adh	LMESSM	TSS	1961490	1961491	-0.037899	+	.
Adh	LMESSM	TSS	1962290	1962291	-0.031609	+	.
Adh	LMESSM	TSS	1963740	1963741	-0.048506	+	.
Adh	LMESSM	TSS	1964510	1964511	-0.033071	+	.
Adh	LMESSM	TSS	1966670	1966671	-0.043885	+	.
Adh	LMESSM	TSS	1968240	1968241	-0.054634	+	.
Adh	LMESSM	TSS	1969490	1969491	-0.032491	+	.
Adh	LMESSM	TSS	1973500	1973501	-0.032458	+	.
Adh	LMESSM	TSS	1975480	1975481	-0.042209	+	.
Adh	LMESSM	TSS	1978970	1978971	-0.054821	+	.
Adh	LMESSM	TSS	1979480	1979481	-0.038570	+	.
Adh	LMESSM	TSS	1980080	1980081	-0.041420	+	.
Adh	LMESSM	TSS	1980940	1980941	-0.032760	+	.
Adh	LMESSM	TSS	1981930	1981931	-0.053287	+	.
Adh	LMESSM	TSS	1983030	1983031	-0.033885	+	.
Adh	LMESSM	TSS	1983800	1983801	-0.040657	+	.
Adh	LMESSM	TSS	1985260	1985261	-0.047037	+	.
Adh	LMESSM	TSS	1986420	1986421	-0.039600	+	.
Adh	LMESSM	TSS	1989380	1989381	-0.067665	+	.
Adh	LMESSM	TSS	1990000	1990001	-0.033430	+	.
Adh	LMESSM	TSS	1996040	1996041	-0.036958	+	.
Adh	LMESSM	TSS	1998530	1998531	-0.033275	+	.
Adh	LMESSM	TSS	1998840	1998841	-0.031413	+	.
Adh	LMESSM	TSS	1999690	1999691	-0.046219	+	.
Adh	LMESSM	TSS	2000850	2000851	-0.035691	+	.
Adh	LMESSM	TSS	2001350	2001351	-0.033321	+	.
Adh	LMESSM	TSS	2003460	2003461	-0.040940	+	.
Adh	LMESSM	TSS	2004390	2004391	-0.039800	+	.
Adh	LMESSM	TSS	2006860	2006861	-0.038050	+	.
Adh	LMESSM	TSS	2009770	2009771	-0.045301	+	.
Adh	LMESSM	TSS	2013530	2013531	-0.033950	+	.
Adh	LMESSM	TSS	2014300	2014301	-0.033753	+	.
Adh	LMESSM	TSS	2015520	2015521	-0.035670	+	.
Adh	LMESSM	TSS	2016800	2016801	-0.032329	+	.
Adh	LMESSM	TSS	2017690	2017691	-0.033325	+	.
Adh	LMESSM	TSS	2018650	2018651	-0.059260	+	.
Adh	LMESSM	TSS	2019370	2019371	-0.039156	+	.
Adh	LMESSM	TSS	2019770	2019771	-0.031589	+	.
Adh	LMESSM	TSS	2025160	2025161	-0.035980	+	.
Adh	LMESSM	TSS	2025520	2025521	-0.031127	+	.
Adh	LMESSM	TSS	2027900	2027901	-0.031602	+	.
Adh	LMESSM	TSS	2028950	2028951	-0.033881	+	.
Adh	LMESSM	TSS	2034020	2034021	-0.035740	+	.
Adh	LMESSM	TSS	2035440	2035441	-0.031347	+	.
Adh	LMESSM	TSS	2037350	2037351	-0.034501	+	.
Adh	LMESSM	TSS	2037820	2037821	-0.038621	+	.
Adh	LMESSM	TSS	2038400	2038401	-0.031404	+	.
Adh	LMESSM	TSS	2039260	2039261	-0.035135	+	.
Adh	LMESSM	TSS	2040040	2040041	-0.037170	+	.
Adh	LMESSM	TSS	2040450	2040451	-0.031550	+	.
Adh	LMESSM	TSS	2044060	2044061	-0.037121	+	.
Adh	LMESSM	TSS	2044410	2044411	-0.046922	+	.
Adh	LMESSM	TSS	2045750	2045751	-0.034667	+	.
Adh	LMESSM	TSS	2048880	2048881	-0.040550	+	.
Adh	LMESSM	TSS	2049540	2049541	-0.031760	+	.
Adh	LMESSM	TSS	2050240	2050241	-0.034622	+	.
Adh	LMESSM	TSS	2057520	2057521	-0.035991	+	.
Adh	LMESSM	TSS	2064970	2064971	-0.036970	+	.
Adh	LMESSM	TSS	2065900	2065901	-0.032141	+	.
Adh	LMESSM	TSS	2066650	2066651	-0.031534	+	.
Adh	LMESSM	TSS	2067330	2067331	-0.031281	+	.
Adh	LMESSM	TSS	2068600	2068601	-0.038780	+	.
Adh	LMESSM	TSS	2071660	2071661	-0.032853	+	.
Adh	LMESSM	TSS	2074250	2074251	-0.031208	+	.
Adh	LMESSM	TSS	2084600	2084601	-0.046536	+	.
Adh	LMESSM	TSS	2085120	2085121	-0.034050	+	.
Adh	LMESSM	TSS	2088140	2088141	-0.038968	+	.
Adh	LMESSM	TSS	2090860	2090861	-0.034476	+	.
Adh	LMESSM	TSS	2093380	2093381	-0.031740	+	.
Adh	LMESSM	TSS	2094330	2094331	-0.042604	+	.
Adh	LMESSM	TSS	2096030	2096031	-0.031591	+	.
Adh	LMESSM	TSS	2098820	2098821	-0.034450	+	.
Adh	LMESSM	TSS	2100290	2100291	-0.036638	+	.
Adh	LMESSM	TSS	2100690	2100691	-0.033190	+	.
Adh	LMESSM	TSS	2100860	2100861	-0.035208	+	.
Adh	LMESSM	TSS	2102910	2102911	-0.032730	+	.
Adh	LMESSM	TSS	2103870	2103871	-0.040199	+	.
Adh	LMESSM	TSS	2105550	2105551	-0.032665	+	.
Adh	LMESSM	TSS	2105890	2105891	-0.035880	+	.
Adh	LMESSM	TSS	2107230	2107231	-0.034299	+	.
Adh	LMESSM	TSS	2108000	2108001	-0.035451	+	.
Adh	LMESSM	TSS	2108550	2108551	-0.041291	+	.
Adh	LMESSM	TSS	2111160	2111161	-0.033785	+	.
Adh	LMESSM	TSS	2111960	2111961	-0.034090	+	.
Adh	LMESSM	TSS	2113160	2113161	-0.033036	+	.
Adh	LMESSM	TSS	2114280	2114281	-0.031371	+	.
Adh	LMESSM	TSS	2117200	2117201	-0.031816	+	.
Adh	LMESSM	TSS	2118650	2118651	-0.042938	+	.
Adh	LMESSM	TSS	2119740	2119741	-0.032501	+	.
Adh	LMESSM	TSS	2120120	2120121	-0.047896	+	.
Adh	LMESSM	TSS	2124310	2124311	-0.031480	+	.
Adh	LMESSM	TSS	2125260	2125261	-0.033024	+	.
Adh	LMESSM	TSS	2127420	2127421	-0.038459	+	.
Adh	LMESSM	TSS	2129270	2129271	-0.032891	+	.
Adh	LMESSM	TSS	2129700	2129701	-0.035691	+	.
Adh	LMESSM	TSS	2138770	2138771	-0.037179	+	.
Adh	LMESSM	TSS	2140520	2140521	-0.037267	+	.
Adh	LMESSM	TSS	2142140	2142141	-0.050706	+	.
Adh	LMESSM	TSS	2145520	2145521	-0.032731	+	.
Adh	LMESSM	TSS	2146840	2146841	-0.032652	+	.
Adh	LMESSM	TSS	2151160	2151161	-0.043127	+	.
Adh	LMESSM	TSS	2154230	2154231	-0.041830	+	.
Adh	LMESSM	TSS	2159090	2159091	-0.031337	+	.
Adh	LMESSM	TSS	2160200	2160201	-0.033790	+	.
Adh	LMESSM	TSS	2162390	2162391	-0.055932	+	.
Adh	LMESSM	TSS	2165760	2165761	-0.036559	+	.
Adh	LMESSM	TSS	2166420	2166421	-0.034174	+	.
Adh	LMESSM	TSS	2171060	2171061	-0.052945	+	.
Adh	LMESSM	TSS	2171760	2171761	-0.044333	+	.
Adh	LMESSM	TSS	2181550	2181551	-0.045418	+	.
Adh	LMESSM	TSS	2183830	2183831	-0.039568	+	.
Adh	LMESSM	TSS	2186010	2186011	-0.036021	+	.
Adh	LMESSM	TSS	2187640	2187641	-0.031981	+	.
Adh	LMESSM	TSS	2192260	2192261	-0.037960	+	.
Adh	LMESSM	TSS	2194950	2194951	-0.038148	+	.
Adh	LMESSM	TSS	2195360	2195361	-0.037282	+	.
Adh	LMESSM	TSS	2195820	2195821	-0.033169	+	.
Adh	LMESSM	TSS	2196170	2196171	-0.030943	+	.
Adh	LMESSM	TSS	2197080	2197081	-0.032585	+	.
Adh	LMESSM	TSS	2197590	2197591	-0.043160	+	.
Adh	LMESSM	TSS	2198390	2198391	-0.038501	+	.
Adh	LMESSM	TSS	2199510	2199511	-0.064837	+	.
Adh	LMESSM	TSS	2200040	2200041	-0.049432	+	.
Adh	LMESSM	TSS	2201540	2201541	-0.043980	+	.
Adh	LMESSM	TSS	2203140	2203141	-0.031931	+	.
Adh	LMESSM	TSS	2210330	2210331	-0.035223	+	.
Adh	LMESSM	TSS	2212370	2212371	-0.035680	+	.
Adh	LMESSM	TSS	2214520	2214521	-0.044014	+	.
Adh	LMESSM	TSS	2215580	2215581	-0.032307	+	.
Adh	LMESSM	TSS	2216170	2216171	-0.036262	+	.
Adh	LMESSM	TSS	2217600	2217601	-0.032891	+	.
Adh	LMESSM	TSS	2219090	2219091	-0.037199	+	.
Adh	LMESSM	TSS	2220200	2220201	-0.032409	+	.
Adh	LMESSM	TSS	2222300	2222301	-0.034741	+	.
Adh	LMESSM	TSS	2224450	2224451	-0.045220	+	.
Adh	LMESSM	TSS	2231180	2231181	-0.039080	+	.
Adh	LMESSM	TSS	2236280	2236281	-0.031371	+	.
Adh	LMESSM	TSS	2242740	2242741	-0.035451	+	.
Adh	LMESSM	TSS	2255920	2255921	-0.040330	+	.
Adh	LMESSM	TSS	2259620	2259621	-0.031715	+	.
Adh	LMESSM	TSS	2260260	2260261	-0.035091	+	.
Adh	LMESSM	TSS	2263770	2263771	-0.031300	+	.
Adh	LMESSM	TSS	2264130	2264131	-0.037211	+	.
Adh	LMESSM	TSS	2264650	2264651	-0.033518	+	.
Adh	LMESSM	TSS	2276400	2276401	-0.036130	+	.
Adh	LMESSM	TSS	2279050	2279051	-0.042263	+	.
Adh	LMESSM	TSS	2281340	2281341	-0.033561	+	.
Adh	LMESSM	TSS	2285500	2285501	-0.031050	+	.
Adh	LMESSM	TSS	2289190	2289191	-0.037410	+	.
Adh	LMESSM	TSS	2290040	2290041	-0.038624	+	.
Adh	LMESSM	TSS	2294490	2294491	-0.037241	+	.
Adh	LMESSM	TSS	2301580	2301581	-0.030901	+	.
Adh	LMESSM	TSS	2302510	2302511	-0.035736	+	.
Adh	LMESSM	TSS	2309540	2309541	-0.036839	+	.
Adh	LMESSM	TSS	2310100	2310101	-0.037061	+	.
Adh	LMESSM	TSS	2311210	2311211	-0.038991	+	.
Adh	LMESSM	TSS	2316030	2316031	-0.033377	+	.
Adh	LMESSM	TSS	2324940	2324941	-0.036500	+	.
Adh	LMESSM	TSS	2328130	2328131	-0.036736	+	.
Adh	LMESSM	TSS	2332470	2332471	-0.038320	+	.
Adh	LMESSM	TSS	2334930	2334931	-0.055784	+	.
Adh	LMESSM	TSS	2335930	2335931	-0.032862	+	.
Adh	LMESSM	TSS	2336830	2336831	-0.035491	+	.
Adh	LMESSM	TSS	2339050	2339051	-0.040234	+	.
Adh	LMESSM	TSS	2340530	2340531	-0.032970	+	.
Adh	LMESSM	TSS	2345800	2345801	-0.031088	+	.
Adh	LMESSM	TSS	2348380	2348381	-0.036029	+	.
Adh	LMESSM	TSS	2349290	2349291	-0.036345	+	.
Adh	LMESSM	TSS	2355470	2355471	-0.032952	+	.
Adh	LMESSM	TSS	2356340	2356341	-0.045918	+	.
Adh	LMESSM	TSS	2356630	2356631	-0.031959	+	.
Adh	LMESSM	TSS	2357270	2357271	-0.031326	+	.
Adh	LMESSM	TSS	2358200	2358201	-0.038950	+	.
Adh	LMESSM	TSS	2358920	2358921	-0.041080	+	.
Adh	LMESSM	TSS	2359780	2359781	-0.051570	+	.
Adh	LMESSM	TSS	2360700	2360701	-0.032001	+	.
Adh	LMESSM	TSS	2362160	2362161	-0.043200	+	.
Adh	LMESSM	TSS	2362680	2362681	-0.045592	+	.
Adh	LMESSM	TSS	2363450	2363451	-0.039693	+	.
Adh	LMESSM	TSS	2364670	2364671	-0.032051	+	.
Adh	LMESSM	TSS	2365360	2365361	-0.049027	+	.
Adh	LMESSM	TSS	2368710	2368711	-0.031295	+	.
Adh	LMESSM	TSS	2370690	2370691	-0.039790	+	.
Adh	LMESSM	TSS	2371690	2371691	-0.032469	+	.
Adh	LMESSM	TSS	2374160	2374161	-0.042290	+	.
Adh	LMESSM	TSS	2377850	2377851	-0.032592	+	.
Adh	LMESSM	TSS	2378470	2378471	-0.033980	+	.
Adh	LMESSM	TSS	2381950	2381951	-0.040811	+	.
Adh	LMESSM	TSS	2387800	2387801	-0.034771	+	.
Adh	LMESSM	TSS	2392020	2392021	-0.034453	+	.
Adh	LMESSM	TSS	2394770	2394771	-0.032360	+	.
Adh	LMESSM	TSS	2395960	2395961	-0.035840	+	.
Adh	LMESSM	TSS	2396890	2396891	-0.032970	+	.
Adh	LMESSM	TSS	2400730	2400731	-0.034167	+	.
Adh	LMESSM	TSS	2401640	2401641	-0.034690	+	.
Adh	LMESSM	TSS	2405440	2405441	-0.032490	+	.
Adh	LMESSM	TSS	2407630	2407631	-0.034550	+	.
Adh	LMESSM	TSS	2410210	2410211	-0.031560	+	.
Adh	LMESSM	TSS	2415190	2415191	-0.031906	+	.
Adh	LMESSM	TSS	2415760	2415761	-0.038140	+	.
Adh	LMESSM	TSS	2417030	2417031	-0.035854	+	.
Adh	LMESSM	TSS	2418240	2418241	-0.040363	+	.
Adh	LMESSM	TSS	2420960	2420961	-0.031615	+	.
Adh	LMESSM	TSS	2431410	2431411	-0.038180	+	.
Adh	LMESSM	TSS	2437830	2437831	-0.032706	+	.
Adh	LMESSM	TSS	2444400	2444401	-0.031270	+	.
Adh	LMESSM	TSS	2446790	2446791	-0.032740	+	.
Adh	LMESSM	TSS	2447810	2447811	-0.040066	+	.
Adh	LMESSM	TSS	2448660	2448661	-0.035150	+	.
Adh	LMESSM	TSS	2449700	2449701	-0.038461	+	.
Adh	LMESSM	TSS	2449980	2449981	-0.037419	+	.
Adh	LMESSM	TSS	2450440	2450441	-0.033931	+	.
Adh	LMESSM	TSS	2453390	2453391	-0.043398	+	.
Adh	LMESSM	TSS	2453810	2453811	-0.031770	+	.
Adh	LMESSM	TSS	2456130	2456131	-0.034145	+	.
Adh	LMESSM	TSS	2463920	2463921	-0.035070	+	.
Adh	LMESSM	TSS	2468380	2468381	-0.032480	+	.
Adh	LMESSM	TSS	2472180	2472181	-0.038795	+	.
Adh	LMESSM	TSS	2474470	2474471	-0.036860	+	.
Adh	LMESSM	TSS	2482080	2482081	-0.037396	+	.
Adh	LMESSM	TSS	2483450	2483451	-0.040940	+	.
Adh	LMESSM	TSS	2488180	2488181	-0.033881	+	.
Adh	LMESSM	TSS	2488930	2488931	-0.034857	+	.
Adh	LMESSM	TSS	2492460	2492461	-0.048100	+	.
Adh	LMESSM	TSS	2493660	2493661	-0.031200	+	.
Adh	LMESSM	TSS	2494340	2494341	-0.033529	+	.
Adh	LMESSM	TSS	2495290	2495291	-0.038874	+	.
Adh	LMESSM	TSS	2497330	2497331	-0.033813	+	.
Adh	LMESSM	TSS	2499190	2499191	-0.036278	+	.
Adh	LMESSM	TSS	2500390	2500391	-0.031351	+	.
Adh	LMESSM	TSS	2501930	2501931	-0.044498	+	.
Adh	LMESSM	TSS	2504940	2504941	-0.034160	+	.
Adh	LMESSM	TSS	2508130	2508131	-0.033561	+	.
Adh	LMESSM	TSS	2522770	2522771	-0.031484	+	.
Adh	LMESSM	TSS	2526280	2526281	-0.037961	+	.
Adh	LMESSM	TSS	2527480	2527481	-0.041388	+	.
Adh	LMESSM	TSS	2529800	2529801	-0.044217	+	.
Adh	LMESSM	TSS	2541960	2541961	-0.031910	+	.
Adh	LMESSM	TSS	2543640	2543641	-0.033771	+	.
Adh	LMESSM	TSS	2544490	2544491	-0.032541	+	.
Adh	LMESSM	TSS	2548230	2548231	-0.042040	+	.
Adh	LMESSM	TSS	2552570	2552571	-0.034885	+	.
Adh	LMESSM	TSS	2555160	2555161	-0.030981	+	.
Adh	LMESSM	TSS	2555500	2555501	-0.033741	+	.
Adh	LMESSM	TSS	2562630	2562631	-0.035160	+	.
Adh	LMESSM	TSS	2567610	2567611	-0.032071	+	.
Adh	LMESSM	TSS	2571790	2571791	-0.030979	+	.
Adh	LMESSM	TSS	2573070	2573071	-0.034271	+	.
Adh	LMESSM	TSS	2573940	2573941	-0.037750	+	.
Adh	LMESSM	TSS	2578320	2578321	-0.040894	+	.
Adh	LMESSM	TSS	2579810	2579811	-0.040580	+	.
Adh	LMESSM	TSS	2581020	2581021	-0.033490	+	.
Adh	LMESSM	TSS	2581270	2581271	-0.031158	+	.
Adh	LMESSM	TSS	2587110	2587111	-0.034090	+	.
Adh	LMESSM	TSS	2591330	2591331	-0.042151	+	.
Adh	LMESSM	TSS	2598060	2598061	-0.037432	+	.
Adh	LMESSM	TSS	2598690	2598691	-0.032891	+	.
Adh	LMESSM	TSS	2599770	2599771	-0.034517	+	.
Adh	LMESSM	TSS	2615800	2615801	-0.046610	+	.
Adh	LMESSM	TSS	2618010	2618011	-0.034480	+	.
Adh	LMESSM	TSS	2619710	2619711	-0.033953	+	.
Adh	LMESSM	TSS	2621320	2621321	-0.037789	+	.
Adh	LMESSM	TSS	2628710	2628711	-0.036061	+	.
Adh	LMESSM	TSS	2632370	2632371	-0.037400	+	.
Adh	LMESSM	TSS	2632660	2632661	-0.038410	+	.
Adh	LMESSM	TSS	2633720	2633721	-0.036708	+	.
Adh	LMESSM	TSS	2634480	2634481	-0.045634	+	.
Adh	LMESSM	TSS	2637240	2637241	-0.032240	+	.
Adh	LMESSM	TSS	2640270	2640271	-0.035030	+	.
Adh	LMESSM	TSS	2651640	2651641	-0.030991	+	.
Adh	LMESSM	TSS	2652290	2652291	-0.031064	+	.
Adh	LMESSM	TSS	2659320	2659321	-0.032884	+	.
Adh	LMESSM	TSS	2660970	2660971	-0.040911	+	.
Adh	LMESSM	TSS	2661750	2661751	-0.031482	+	.
Adh	LMESSM	TSS	2666110	2666111	-0.031503	+	.
Adh	LMESSM	TSS	2674580	2674581	-0.037400	+	.
Adh	LMESSM	TSS	2675900	2675901	-0.042690	+	.
Adh	LMESSM	TSS	2676580	2676581	-0.032400	+	.
Adh	LMESSM	TSS	2680720	2680721	-0.042230	+	.
Adh	LMESSM	TSS	2683240	2683241	-0.033390	+	.
Adh	LMESSM	TSS	2683470	2683471	-0.040434	+	.
Adh	LMESSM	TSS	2687320	2687321	-0.031538	+	.
Adh	LMESSM	TSS	2693280	2693281	-0.032670	+	.
Adh	LMESSM	TSS	2698200	2698201	-0.031552	+	.
Adh	LMESSM	TSS	2699000	2699001	-0.037169	+	.
Adh	LMESSM	TSS	2701040	2701041	-0.058439	+	.
Adh	LMESSM	TSS	2705150	2705151	-0.035941	+	.
Adh	LMESSM	TSS	2706910	2706911	-0.031681	+	.
Adh	LMESSM	TSS	2709490	2709491	-0.038640	+	.
Adh	LMESSM	TSS	2712540	2712541	-0.038253	+	.
Adh	LMESSM	TSS	2714770	2714771	-0.032747	+	.
Adh	LMESSM	TSS	2717630	2717631	-0.035601	+	.
Adh	LMESSM	TSS	2718490	2718491	-0.032481	+	.
Adh	LMESSM	TSS	2719160	2719161	-0.056861	+	.
Adh	LMESSM	TSS	2720830	2720831	-0.043000	+	.
Adh	LMESSM	TSS	2722230	2722231	-0.040420	+	.
Adh	LMESSM	TSS	2723510	2723511	-0.035473	+	.
Adh	LMESSM	TSS	2725560	2725561	-0.044770	+	.
Adh	LMESSM	TSS	2727510	2727511	-0.035100	+	.
Adh	LMESSM	TSS	2729390	2729391	-0.043151	+	.
Adh	LMESSM	TSS	2730750	2730751	-0.047050	+	.
Adh	LMESSM	TSS	2732460	2732461	-0.044838	+	.
Adh	LMESSM	TSS	2734140	2734141	-0.037410	+	.
Adh	LMESSM	TSS	2734310	2734311	-0.039980	+	.
Adh	LMESSM	TSS	2735540	2735541	-0.055783	+	.
Adh	LMESSM	TSS	2736410	2736411	-0.042811	+	.
Adh	LMESSM	TSS	2736930	2736931	-0.046891	+	.
Adh	LMESSM	TSS	2737660	2737661	-0.033370	+	.
Adh	LMESSM	TSS	2739710	2739711	-0.035238	+	.
Adh	LMESSM	TSS	2740670	2740671	-0.038912	+	.
Adh	LMESSM	TSS	2741540	2741541	-0.034185	+	.
Adh	LMESSM	TSS	2743620	2743621	-0.035351	+	.
Adh	LMESSM	TSS	2748200	2748201	-0.035317	+	.
Adh	LMESSM	TSS	2749050	2749051	-0.052140	+	.
Adh	LMESSM	TSS	2749900	2749901	-0.035454	+	.
Adh	LMESSM	TSS	2751370	2751371	-0.042041	+	.
Adh	LMESSM	TSS	2754530	2754531	-0.032591	+	.
Adh	LMESSM	TSS	2756180	2756181	-0.033143	+	.
Adh	LMESSM	TSS	2760490	2760491	-0.040139	+	.
Adh	LMESSM	TSS	2761190	2761191	-0.033778	+	.
Adh	LMESSM	TSS	2763740	2763741	-0.044140	+	.
Adh	LMESSM	TSS	2767570	2767571	-0.042770	+	.
Adh	LMESSM	TSS	2769220	2769221	-0.037771	+	.
Adh	LMESSM	TSS	2772370	2772371	-0.038945	+	.
Adh	LMESSM	TSS	2775450	2775451	-0.031685	+	.
Adh	LMESSM	TSS	2779470	2779471	-0.032835	+	.
Adh	LMESSM	TSS	2786790	2786791	-0.031950	+	.
Adh	LMESSM	TSS	2794730	2794731	-0.036478	+	.
Adh	LMESSM	TSS	2795390	2795391	-0.035303	+	.
Adh	LMESSM	TSS	2796400	2796401	-0.034458	+	.
Adh	LMESSM	TSS	2797350	2797351	-0.031521	+	.
Adh	LMESSM	TSS	2797790	2797791	-0.035530	+	.
Adh	LMESSM	TSS	2798450	2798451	-0.035515	+	.
Adh	LMESSM	TSS	2801890	2801891	-0.033580	+	.
Adh	LMESSM	TSS	2802490	2802491	-0.051553	+	.
Adh	LMESSM	TSS	2804520	2804521	-0.044119	+	.
Adh	LMESSM	TSS	2806230	2806231	-0.033521	+	.
Adh	LMESSM	TSS	2815160	2815161	-0.050100	+	.
Adh	LMESSM	TSS	2820930	2820931	-0.045696	+	.
Adh	LMESSM	TSS	2824640	2824641	-0.032587	+	.
Adh	LMESSM	TSS	2827950	2827951	-0.038920	+	.
Adh	LMESSM	TSS	2831590	2831591	-0.032594	+	.
Adh	LMESSM	TSS	2836060	2836061	-0.031420	+	.
Adh	LMESSM	TSS	2837970	2837971	-0.034780	+	.
Adh	LMESSM	TSS	2840440	2840441	-0.040600	+	.
Adh	LMESSM	TSS	2840910	2840911	-0.037683	+	.
Adh	LMESSM	TSS	2844980	2844981	-0.033454	+	.
Adh	LMESSM	TSS	2851550	2851551	-0.034547	+	.
Adh	LMESSM	TSS	2854740	2854741	-0.038240	+	.
Adh	LMESSM	TSS	2855580	2855581	-0.037151	+	.
Adh	LMESSM	TSS	2861270	2861271	-0.030975	+	.
Adh	LMESSM	TSS	2863360	2863361	-0.040681	+	.
Adh	LMESSM	TSS	2863960	2863961	-0.034710	+	.
Adh	LMESSM	TSS	2864770	2864771	-0.031531	+	.
Adh	LMESSM	TSS	2866680	2866681	-0.040814	+	.
Adh	LMESSM	TSS	2869790	2869791	-0.038081	+	.
Adh	LMESSM	TSS	2872170	2872171	-0.055843	+	.
Adh	LMESSM	TSS	2879320	2879321	-0.042200	+	.
Adh	LMESSM	TSS	2880870	2880871	-0.037860	+	.
Adh	LMESSM	TSS	2882130	2882131	-0.038867	+	.
Adh	LMESSM	TSS	2887110	2887111	-0.036498	+	.
Adh	LMESSM	TSS	2887690	2887691	-0.041390	+	.
Adh	LMESSM	TSS	2888080	2888081	-0.034906	+	.
Adh	LMESSM	TSS	2893600	2893601	-0.030991	+	.
Adh	LMESSM	TSS	2894540	2894541	-0.041060	+	.
Adh	LMESSM	TSS	2896650	2896651	-0.031289	+	.
Adh	LMESSM	TSS	2897500	2897501	-0.040220	+	.
Adh	LMESSM	TSS	2898270	2898271	-0.045100	+	.
Adh	LMESSM	TSS	2900310	2900311	-0.034161	+	.
Adh	LMESSM	TSS	2905060	2905061	-0.033550	+	.
Adh	LMESSM	TSS	2906520	2906521	-0.040540	+	.
Adh	LMESSM	TSS	2907990	2907991	-0.033139	+	.
Adh	LMESSM	TSS	2911120	2911121	-0.033811	+	.
Adh	LMESSM	TSS	2912210	2912211	-0.033470	+	.
Adh	LMESSM	TSS	2914740	2914741	-0.039391	+	.
Adh	LMESSM	TSS	2915360	2915361	-0.034420	+	.
Adh	LMESSM	TSS	2916790	2916791	-0.032951	+	.
Adh	LMESSM	TSS	2918940	2918941	-0.035574	+	.
Adh	LMESSM	TSS	2918680	2918681	-0.025634	-	.
Adh	LMESSM	TSS	2918430	2918431	-0.047210	-	.
Adh	LMESSM	TSS	2917440	2917441	-0.048830	-	.
Adh	LMESSM	TSS	2915090	2915091	-0.039861	-	.
Adh	LMESSM	TSS	2912700	2912701	-0.034760	-	.
Adh	LMESSM	TSS	2910710	2910711	-0.033010	-	.
Adh	LMESSM	TSS	2906470	2906471	-0.036721	-	.
Adh	LMESSM	TSS	2902100	2902101	-0.035660	-	.
Adh	LMESSM	TSS	2900260	2900261	-0.043840	-	.
Adh	LMESSM	TSS	2899490	2899491	-0.039939	-	.
Adh	LMESSM	TSS	2898190	2898191	-0.035321	-	.
Adh	LMESSM	TSS	2896620	2896621	-0.032640	-	.
Adh	LMESSM	TSS	2895160	2895161	-0.039438	-	.
Adh	LMESSM	TSS	2892040	2892041	-0.041181	-	.
Adh	LMESSM	TSS	2887910	2887911	-0.035995	-	.
Adh	LMESSM	TSS	2887590	2887591	-0.046910	-	.
Adh	LMESSM	TSS	2886970	2886971	-0.034651	-	.
Adh	LMESSM	TSS	2872300	2872301	-0.041681	-	.
Adh	LMESSM	TSS	2871930	2871931	-0.057510	-	.
Adh	LMESSM	TSS	2866930	2866931	-0.034111	-	.
Adh	LMESSM	TSS	2863060	2863061	-0.037534	-	.
Adh	LMESSM	TSS	2862020	2862021	-0.037460	-	.
Adh	LMESSM	TSS	2861130	2861131	-0.043237	-	.
Adh	LMESSM	TSS	2851460	2851461	-0.031862	-	.
Adh	LMESSM	TSS	2845830	2845831	-0.033817	-	.
Adh	LMESSM	TSS	2845090	2845091	-0.035820	-	.
Adh	LMESSM	TSS	2840420	2840421	-0.037638	-	.
Adh	LMESSM	TSS	2833500	2833501	-0.032823	-	.
Adh	LMESSM	TSS	2830720	2830721	-0.033030	-	.
Adh	LMESSM	TSS	2829490	2829491	-0.034305	-	.
Adh	LMESSM	TSS	2824520	2824521	-0.033219	-	.
Adh	LMESSM	TSS	2820780	2820781	-0.068474	-	.
Adh	LMESSM	TSS	2813720	2813721	-0.034518	-	.
Adh	LMESSM	TSS	2802270	2802271	-0.049817	-	.
Adh	LMESSM	TSS	2801750	2801751	-0.044491	-	.
Adh	LMESSM	TSS	2801210	2801211	-0.039031	-	.
Adh	LMESSM	TSS	2799990	2799991	-0.032240	-	.
Adh	LMESSM	TSS	2798580	2798581	-0.041337	-	.
Adh	LMESSM	TSS	2797730	2797731	-0.033043	-	.
Adh	LMESSM	TSS	2796050	2796051	-0.031821	-	.
Adh	LMESSM	TSS	2793500	2793501	-0.031956	-	.
Adh	LMESSM	TSS	2792490	2792491	-0.036070	-	.
Adh	LMESSM	TSS	2791900	2791901	-0.034629	-	.
Adh	LMESSM	TSS	2787370	2787371	-0.033972	-	.
Adh	LMESSM	TSS	2786930	2786931	-0.036111	-	.
Adh	LMESSM	TSS	2786700	2786701	-0.035039	-	.
Adh	LMESSM	TSS	2780050	2780051	-0.031060	-	.
Adh	LMESSM	TSS	2779820	2779821	-0.032841	-	.
Adh	LMESSM	TSS	2778290	2778291	-0.035537	-	.
Adh	LMESSM	TSS	2777480	2777481	-0.032403	-	.
Adh	LMESSM	TSS	2776570	2776571	-0.030937	-	.
Adh	LMESSM	TSS	2775350	2775351	-0.047886	-	.
Adh	LMESSM	TSS	2774250	2774251	-0.045290	-	.
Adh	LMESSM	TSS	2772290	2772291	-0.033446	-	.
Adh	LMESSM	TSS	2772110	2772111	-0.034170	-	.
Adh	LMESSM	TSS	2767570	2767571	-0.057327	-	.
Adh	LMESSM	TSS	2764420	2764421	-0.047360	-	.
Adh	LMESSM	TSS	2763940	2763941	-0.036648	-	.
Adh	LMESSM	TSS	2760890	2760891	-0.031540	-	.
Adh	LMESSM	TSS	2760260	2760261	-0.037711	-	.
Adh	LMESSM	TSS	2759150	2759151	-0.050489	-	.
Adh	LMESSM	TSS	2757420	2757421	-0.035630	-	.
Adh	LMESSM	TSS	2756020	2756021	-0.034407	-	.
Adh	LMESSM	TSS	2755520	2755521	-0.034410	-	.
Adh	LMESSM	TSS	2751320	2751321	-0.039878	-	.
Adh	LMESSM	TSS	2749730	2749731	-0.034421	-	.
Adh	LMESSM	TSS	2748790	2748791	-0.061454	-	.
Adh	LMESSM	TSS	2745030	2745031	-0.038778	-	.
Adh	LMESSM	TSS	2744180	2744181	-0.033245	-	.
Adh	LMESSM	TSS	2739920	2739921	-0.046521	-	.
Adh	LMESSM	TSS	2739450	2739451	-0.042710	-	.
Adh	LMESSM	TSS	2736550	2736551	-0.064080	-	.
Adh	LMESSM	TSS	2735980	2735981	-0.042131	-	.
Adh	LMESSM	TSS	2733980	2733981	-0.048170	-	.
Adh	LMESSM	TSS	2732140	2732141	-0.039450	-	.
Adh	LMESSM	TSS	2731550	2731551	-0.035220	-	.
Adh	LMESSM	TSS	2730550	2730551	-0.043838	-	.
Adh	LMESSM	TSS	2729310	2729311	-0.044509	-	.
Adh	LMESSM	TSS	2728370	2728371	-0.038020	-	.
Adh	LMESSM	TSS	2728010	2728011	-0.035930	-	.
Adh	LMESSM	TSS	2727350	2727351	-0.038347	-	.
Adh	LMESSM	TSS	2723420	2723421	-0.039920	-	.
Adh	LMESSM	TSS	2722000	2722001	-0.035471	-	.
Adh	LMESSM	TSS	2720670	2720671	-0.051820	-	.
Adh	LMESSM	TSS	2718750	2718751	-0.064840	-	.
Adh	LMESSM	TSS	2717340	2717341	-0.052990	-	.
Adh	LMESSM	TSS	2711650	2711651	-0.032654	-	.
Adh	LMESSM	TSS	2706710	2706711	-0.039411	-	.
Adh	LMESSM	TSS	2703400	2703401	-0.032469	-	.
Adh	LMESSM	TSS	2703290	2703291	-0.032955	-	.
Adh	LMESSM	TSS	2700970	2700971	-0.063613	-	.
Adh	LMESSM	TSS	2698880	2698881	-0.042170	-	.
Adh	LMESSM	TSS	2688790	2688791	-0.032719	-	.
Adh	LMESSM	TSS	2688130	2688131	-0.036608	-	.
Adh	LMESSM	TSS	2686720	2686721	-0.039691	-	.
Adh	LMESSM	TSS	2685080	2685081	-0.041429	-	.
Adh	LMESSM	TSS	2684350	2684351	-0.032807	-	.
Adh	LMESSM	TSS	2683310	2683311	-0.067362	-	.
Adh	LMESSM	TSS	2680790	2680791	-0.050131	-	.
Adh	LMESSM	TSS	2678480	2678481	-0.032280	-	.
Adh	LMESSM	TSS	2674050	2674051	-0.038662	-	.
Adh	LMESSM	TSS	2672020	2672021	-0.038500	-	.
Adh	LMESSM	TSS	2665890	2665891	-0.038950	-	.
Adh	LMESSM	TSS	2663890	2663891	-0.038998	-	.
Adh	LMESSM	TSS	2661670	2661671	-0.039669	-	.
Adh	LMESSM	TSS	2658450	2658451	-0.031446	-	.
Adh	LMESSM	TSS	2655210	2655211	-0.034820	-	.
Adh	LMESSM	TSS	2654600	2654601	-0.031010	-	.
Adh	LMESSM	TSS	2641680	2641681	-0.030950	-	.
Adh	LMESSM	TSS	2638790	2638791	-0.031274	-	.
Adh	LMESSM	TSS	2634770	2634771	-0.040205	-	.
Adh	LMESSM	TSS	2634310	2634311	-0.034773	-	.
Adh	LMESSM	TSS	2633440	2633441	-0.032434	-	.
Adh	LMESSM	TSS	2624820	2624821	-0.031735	-	.
Adh	LMESSM	TSS	2624040	2624041	-0.035709	-	.
Adh	LMESSM	TSS	2619590	2619591	-0.036513	-	.
Adh	LMESSM	TSS	2616820	2616821	-0.031610	-	.
Adh	LMESSM	TSS	2616090	2616091	-0.036621	-	.
Adh	LMESSM	TSS	2612330	2612331	-0.032496	-	.
Adh	LMESSM	TSS	2598540	2598541	-0.036619	-	.
Adh	LMESSM	TSS	2595120	2595121	-0.034971	-	.
Adh	LMESSM	TSS	2586880	2586881	-0.032571	-	.
Adh	LMESSM	TSS	2583470	2583471	-0.031530	-	.
Adh	LMESSM	TSS	2582210	2582211	-0.039480	-	.
Adh	LMESSM	TSS	2580910	2580911	-0.036238	-	.
Adh	LMESSM	TSS	2579760	2579761	-0.035921	-	.
Adh	LMESSM	TSS	2573650	2573651	-0.032713	-	.
Adh	LMESSM	TSS	2570700	2570701	-0.033471	-	.
Adh	LMESSM	TSS	2569180	2569181	-0.032585	-	.
Adh	LMESSM	TSS	2566870	2566871	-0.031520	-	.
Adh	LMESSM	TSS	2564150	2564151	-0.038191	-	.
Adh	LMESSM	TSS	2555410	2555411	-0.036359	-	.
Adh	LMESSM	TSS	2554970	2554971	-0.032170	-	.
Adh	LMESSM	TSS	2551740	2551741	-0.039057	-	.
Adh	LMESSM	TSS	2548710	2548711	-0.036563	-	.
Adh	LMESSM	TSS	2547450	2547451	-0.036041	-	.
Adh	LMESSM	TSS	2546530	2546531	-0.032590	-	.
Adh	LMESSM	TSS	2545470	2545471	-0.034341	-	.
Adh	LMESSM	TSS	2542920	2542921	-0.032090	-	.
Adh	LMESSM	TSS	2540070	2540071	-0.033600	-	.
Adh	LMESSM	TSS	2538020	2538021	-0.038168	-	.
Adh	LMESSM	TSS	2531190	2531191	-0.031040	-	.
Adh	LMESSM	TSS	2528540	2528541	-0.037450	-	.
Adh	LMESSM	TSS	2527360	2527361	-0.033691	-	.
Adh	LMESSM	TSS	2524420	2524421	-0.038011	-	.
Adh	LMESSM	TSS	2513250	2513251	-0.031286	-	.
Adh	LMESSM	TSS	2512630	2512631	-0.040141	-	.
Adh	LMESSM	TSS	2506470	2506471	-0.039990	-	.
Adh	LMESSM	TSS	2501750	2501751	-0.050310	-	.
Adh	LMESSM	TSS	2495500	2495501	-0.039031	-	.
Adh	LMESSM	TSS	2494510	2494511	-0.037678	-	.
Adh	LMESSM	TSS	2493530	2493531	-0.032160	-	.
Adh	LMESSM	TSS	2491970	2491971	-0.042031	-	.
Adh	LMESSM	TSS	2491240	2491241	-0.032010	-	.
Adh	LMESSM	TSS	2488800	2488801	-0.046286	-	.
Adh	LMESSM	TSS	2488330	2488331	-0.034213	-	.
Adh	LMESSM	TSS	2487350	2487351	-0.032951	-	.
Adh	LMESSM	TSS	2483280	2483281	-0.031422	-	.
Adh	LMESSM	TSS	2482000	2482001	-0.032580	-	.
Adh	LMESSM	TSS	2479260	2479261	-0.033489	-	.
Adh	LMESSM	TSS	2475540	2475541	-0.031830	-	.
Adh	LMESSM	TSS	2474700	2474701	-0.031771	-	.
Adh	LMESSM	TSS	2473930	2473931	-0.036814	-	.
Adh	LMESSM	TSS	2472110	2472111	-0.045051	-	.
Adh	LMESSM	TSS	2468000	2468001	-0.037200	-	.
Adh	LMESSM	TSS	2467570	2467571	-0.034372	-	.
Adh	LMESSM	TSS	2460230	2460231	-0.033280	-	.
Adh	LMESSM	TSS	2449780	2449781	-0.031470	-	.
Adh	LMESSM	TSS	2448540	2448541	-0.035229	-	.
Adh	LMESSM	TSS	2447670	2447671	-0.045683	-	.
Adh	LMESSM	TSS	2446540	2446541	-0.032181	-	.
Adh	LMESSM	TSS	2436460	2436461	-0.031061	-	.
Adh	LMESSM	TSS	2434150	2434151	-0.031731	-	.
Adh	LMESSM	TSS	2433060	2433061	-0.034750	-	.
Adh	LMESSM	TSS	2432200	2432201	-0.036437	-	.
Adh	LMESSM	TSS	2425370	2425371	-0.036027	-	.
Adh	LMESSM	TSS	2425070	2425071	-0.036921	-	.
Adh	LMESSM	TSS	2420980	2420981	-0.042166	-	.
Adh	LMESSM	TSS	2420840	2420841	-0.041834	-	.
Adh	LMESSM	TSS	2417740	2417741	-0.041471	-	.
Adh	LMESSM	TSS	2417130	2417131	-0.032414	-	.
Adh	LMESSM	TSS	2415550	2415551	-0.036045	-	.
Adh	LMESSM	TSS	2411650	2411651	-0.056945	-	.
Adh	LMESSM	TSS	2405250	2405251	-0.032570	-	.
Adh	LMESSM	TSS	2400380	2400381	-0.034633	-	.
Adh	LMESSM	TSS	2396690	2396691	-0.039759	-	.
Adh	LMESSM	TSS	2394230	2394231	-0.036293	-	.
Adh	LMESSM	TSS	2391780	2391781	-0.037817	-	.
Adh	LMESSM	TSS	2380000	2380001	-0.034660	-	.
Adh	LMESSM	TSS	2378510	2378511	-0.031470	-	.
Adh	LMESSM	TSS	2373900	2373901	-0.038312	-	.
Adh	LMESSM	TSS	2371760	2371761	-0.037748	-	.
Adh	LMESSM	TSS	2370480	2370481	-0.037492	-	.
Adh	LMESSM	TSS	2367960	2367961	-0.032926	-	.
Adh	LMESSM	TSS	2367620	2367621	-0.042901	-	.
Adh	LMESSM	TSS	2365810	2365811	-0.041751	-	.
Adh	LMESSM	TSS	2363280	2363281	-0.036485	-	.
Adh	LMESSM	TSS	2362490	2362491	-0.063031	-	.
Adh	LMESSM	TSS	2361540	2361541	-0.033512	-	.
Adh	LMESSM	TSS	2360640	2360641	-0.036071	-	.
Adh	LMESSM	TSS	2356440	2356441	-0.033107	-	.
Adh	LMESSM	TSS	2355220	2355221	-0.032641	-	.
Adh	LMESSM	TSS	2352980	2352981	-0.037191	-	.
Adh	LMESSM	TSS	2351980	2351981	-0.038352	-	.
Adh	LMESSM	TSS	2346710	2346711	-0.037305	-	.
Adh	LMESSM	TSS	2345560	2345561	-0.036640	-	.
Adh	LMESSM	TSS	2343620	2343621	-0.033300	-	.
Adh	LMESSM	TSS	2340820	2340821	-0.034956	-	.
Adh	LMESSM	TSS	2338810	2338811	-0.041604	-	.
Adh	LMESSM	TSS	2334640	2334641	-0.039727	-	.
Adh	LMESSM	TSS	2332340	2332341	-0.035157	-	.
Adh	LMESSM	TSS	2331130	2331131	-0.040785	-	.
Adh	LMESSM	TSS	2330460	2330461	-0.032066	-	.
Adh	LMESSM	TSS	2329860	2329861	-0.038229	-	.
Adh	LMESSM	TSS	2324910	2324911	-0.033701	-	.
Adh	LMESSM	TSS	2313920	2313921	-0.037781	-	.
Adh	LMESSM	TSS	2309500	2309501	-0.038352	-	.
Adh	LMESSM	TSS	2306790	2306791	-0.036482	-	.
Adh	LMESSM	TSS	2306260	2306261	-0.036501	-	.
Adh	LMESSM	TSS	2305330	2305331	-0.038273	-	.
Adh	LMESSM	TSS	2304010	2304011	-0.034934	-	.
Adh	LMESSM	TSS	2303520	2303521	-0.036686	-	.
Adh	LMESSM	TSS	2302890	2302891	-0.031167	-	.
Adh	LMESSM	TSS	2289220	2289221	-0.047436	-	.
Adh	LMESSM	TSS	2286810	2286811	-0.044491	-	.
Adh	LMESSM	TSS	2278790	2278791	-0.037092	-	.
Adh	LMESSM	TSS	2277930	2277931	-0.032841	-	.
Adh	LMESSM	TSS	2276290	2276291	-0.035194	-	.
Adh	LMESSM	TSS	2273850	2273851	-0.040843	-	.
Adh	LMESSM	TSS	2268820	2268821	-0.032900	-	.
Adh	LMESSM	TSS	2263840	2263841	-0.033694	-	.
Adh	LMESSM	TSS	2260300	2260301	-0.037380	-	.
Adh	LMESSM	TSS	2257730	2257731	-0.034321	-	.
Adh	LMESSM	TSS	2250200	2250201	-0.032380	-	.
Adh	LMESSM	TSS	2248200	2248201	-0.048743	-	.
Adh	LMESSM	TSS	2243940	2243941	-0.038130	-	.
Adh	LMESSM	TSS	2237500	2237501	-0.039051	-	.
Adh	LMESSM	TSS	2236370	2236371	-0.033571	-	.
Adh	LMESSM	TSS	2235420	2235421	-0.033940	-	.
Adh	LMESSM	TSS	2233990	2233991	-0.031599	-	.
Adh	LMESSM	TSS	2224350	2224351	-0.034921	-	.
Adh	LMESSM	TSS	2220440	2220441	-0.031711	-	.
Adh	LMESSM	TSS	2219890	2219891	-0.041397	-	.
Adh	LMESSM	TSS	2217370	2217371	-0.031785	-	.
Adh	LMESSM	TSS	2216000	2216001	-0.037366	-	.
Adh	LMESSM	TSS	2214320	2214321	-0.047489	-	.
Adh	LMESSM	TSS	2209840	2209841	-0.032675	-	.
Adh	LMESSM	TSS	2207290	2207291	-0.040263	-	.
Adh	LMESSM	TSS	2204080	2204081	-0.031094	-	.
Adh	LMESSM	TSS	2202750	2202751	-0.037914	-	.
Adh	LMESSM	TSS	2201570	2201571	-0.040130	-	.
Adh	LMESSM	TSS	2199950	2199951	-0.057780	-	.
Adh	LMESSM	TSS	2199430	2199431	-0.054658	-	.
Adh	LMESSM	TSS	2198420	2198421	-0.046011	-	.
Adh	LMESSM	TSS	2197430	2197431	-0.047080	-	.
Adh	LMESSM	TSS	2195940	2195941	-0.032927	-	.
Adh	LMESSM	TSS	2194790	2194791	-0.032771	-	.
Adh	LMESSM	TSS	2192120	2192121	-0.035509	-	.
Adh	LMESSM	TSS	2189640	2189641	-0.048094	-	.
Adh	LMESSM	TSS	2187580	2187581	-0.031683	-	.
Adh	LMESSM	TSS	2183650	2183651	-0.044877	-	.
Adh	LMESSM	TSS	2182530	2182531	-0.034472	-	.
Adh	LMESSM	TSS	2181010	2181011	-0.036557	-	.
Adh	LMESSM	TSS	2171360	2171361	-0.060960	-	.
Adh	LMESSM	TSS	2171120	2171121	-0.058480	-	.
Adh	LMESSM	TSS	2168360	2168361	-0.044457	-	.
Adh	LMESSM	TSS	2165560	2165561	-0.032128	-	.
Adh	LMESSM	TSS	2162240	2162241	-0.060421	-	.
Adh	LMESSM	TSS	2156240	2156241	-0.037567	-	.
Adh	LMESSM	TSS	2150480	2150481	-0.032222	-	.
Adh	LMESSM	TSS	2147550	2147551	-0.034608	-	.
Adh	LMESSM	TSS	2146800	2146801	-0.031683	-	.
Adh	LMESSM	TSS	2145400	2145401	-0.037581	-	.
Adh	LMESSM	TSS	2144470	2144471	-0.031064	-	.
Adh	LMESSM	TSS	2138830	2138831	-0.038635	-	.
Adh	LMESSM	TSS	2138070	2138071	-0.042142	-	.
Adh	LMESSM	TSS	2129670	2129671	-0.034280	-	.
Adh	LMESSM	TSS	2127520	2127521	-0.033550	-	.
Adh	LMESSM	TSS	2126750	2126751	-0.031290	-	.
Adh	LMESSM	TSS	2124900	2124901	-0.032472	-	.
Adh	LMESSM	TSS	2124380	2124381	-0.032380	-	.
Adh	LMESSM	TSS	2121260	2121261	-0.034778	-	.
Adh	LMESSM	TSS	2117540	2117541	-0.036845	-	.
Adh	LMESSM	TSS	2114200	2114201	-0.042575	-	.
Adh	LMESSM	TSS	2113230	2113231	-0.032603	-	.
Adh	LMESSM	TSS	2111380	2111381	-0.040030	-	.
Adh	LMESSM	TSS	2107710	2107711	-0.034241	-	.
Adh	LMESSM	TSS	2107010	2107011	-0.031875	-	.
Adh	LMESSM	TSS	2105720	2105721	-0.051010	-	.
Adh	LMESSM	TSS	2102850	2102851	-0.031580	-	.
Adh	LMESSM	TSS	2102480	2102481	-0.032600	-	.
Adh	LMESSM	TSS	2101850	2101851	-0.036360	-	.
Adh	LMESSM	TSS	2100480	2100481	-0.033157	-	.
Adh	LMESSM	TSS	2100130	2100131	-0.040810	-	.
Adh	LMESSM	TSS	2098660	2098661	-0.045004	-	.
Adh	LMESSM	TSS	2094150	2094151	-0.031593	-	.
Adh	LMESSM	TSS	2090890	2090891	-0.032400	-	.
Adh	LMESSM	TSS	2087810	2087811	-0.035316	-	.
Adh	LMESSM	TSS	2084860	2084861	-0.035860	-	.
Adh	LMESSM	TSS	2074020	2074021	-0.046410	-	.
Adh	LMESSM	TSS	2072620	2072621	-0.031890	-	.
Adh	LMESSM	TSS	2064840	2064841	-0.048843	-	.
Adh	LMESSM	TSS	2055930	2055931	-0.032040	-	.
Adh	LMESSM	TSS	2054180	2054181	-0.033860	-	.
Adh	LMESSM	TSS	2053100	2053101	-0.035971	-	.
Adh	LMESSM	TSS	2048810	2048811	-0.038600	-	.
Adh	LMESSM	TSS	2045530	2045531	-0.037460	-	.
Adh	LMESSM	TSS	2042440	2042441	-0.031781	-	.
Adh	LMESSM	TSS	2041920	2041921	-0.034550	-	.
Adh	LMESSM	TSS	2041040	2041041	-0.031600	-	.
Adh	LMESSM	TSS	2039990	2039991	-0.034610	-	.
Adh	LMESSM	TSS	2039130	2039131	-0.031686	-	.
Adh	LMESSM	TSS	2037590	2037591	-0.034921	-	.
Adh	LMESSM	TSS	2035280	2035281	-0.031660	-	.
Adh	LMESSM	TSS	2033810	2033811	-0.040679	-	.
Adh	LMESSM	TSS	2033200	2033201	-0.034662	-	.
Adh	LMESSM	TSS	2029010	2029011	-0.030950	-	.
Adh	LMESSM	TSS	2028680	2028681	-0.041843	-	.
Adh	LMESSM	TSS	2027680	2027681	-0.039535	-	.
Adh	LMESSM	TSS	2019620	2019621	-0.033662	-	.
Adh	LMESSM	TSS	2018290	2018291	-0.034454	-	.
Adh	LMESSM	TSS	2016750	2016751	-0.041708	-	.
Adh	LMESSM	TSS	2016170	2016171	-0.041830	-	.
Adh	LMESSM	TSS	2012640	2012641	-0.034405	-	.
Adh	LMESSM	TSS	2010850	2010851	-0.033321	-	.
Adh	LMESSM	TSS	2009660	2009661	-0.034629	-	.
Adh	LMESSM	TSS	2008530	2008531	-0.034063	-	.
Adh	LMESSM	TSS	2006190	2006191	-0.044613	-	.
Adh	LMESSM	TSS	2005030	2005031	-0.033137	-	.
Adh	LMESSM	TSS	2004210	2004211	-0.054966	-	.
Adh	LMESSM	TSS	2002600	2002601	-0.044340	-	.
Adh	LMESSM	TSS	2000650	2000651	-0.032560	-	.
Adh	LMESSM	TSS	2000180	2000181	-0.035853	-	.
Adh	LMESSM	TSS	1995950	1995951	-0.033791	-	.
Adh	LMESSM	TSS	1993150	1993151	-0.033019	-	.
Adh	LMESSM	TSS	1992010	1992011	-0.032948	-	.
Adh	LMESSM	TSS	1989040	1989041	-0.060230	-	.
Adh	LMESSM	TSS	1988680	1988681	-0.034320	-	.
Adh	LMESSM	TSS	1987010	1987011	-0.031231	-	.
Adh	LMESSM	TSS	1985070	1985071	-0.068043	-	.
Adh	LMESSM	TSS	1983710	1983711	-0.055092	-	.
Adh	LMESSM	TSS	1981730	1981731	-0.071798	-	.
Adh	LMESSM	TSS	1981190	1981191	-0.031241	-	.
Adh	LMESSM	TSS	1978750	1978751	-0.041140	-	.
Adh	LMESSM	TSS	1975550	1975551	-0.041149	-	.
Adh	LMESSM	TSS	1973680	1973681	-0.032121	-	.
Adh	LMESSM	TSS	1970700	1970701	-0.034869	-	.
Adh	LMESSM	TSS	1969590	1969591	-0.034951	-	.
Adh	LMESSM	TSS	1969260	1969261	-0.033649	-	.
Adh	LMESSM	TSS	1968470	1968471	-0.039892	-	.
Adh	LMESSM	TSS	1967920	1967921	-0.076567	-	.
Adh	LMESSM	TSS	1964010	1964011	-0.043279	-	.
Adh	LMESSM	TSS	1963650	1963651	-0.042053	-	.
Adh	LMESSM	TSS	1961280	1961281	-0.037810	-	.
Adh	LMESSM	TSS	1960610	1960611	-0.037348	-	.
Adh	LMESSM	TSS	1959420	1959421	-0.036736	-	.
Adh	LMESSM	TSS	1958350	1958351	-0.047520	-	.
Adh	LMESSM	TSS	1955930	1955931	-0.040933	-	.
Adh	LMESSM	TSS	1954540	1954541	-0.031310	-	.
Adh	LMESSM	TSS	1952000	1952001	-0.035874	-	.
Adh	LMESSM	TSS	1951060	1951061	-0.034094	-	.
Adh	LMESSM	TSS	1950120	1950121	-0.038853	-	.
Adh	LMESSM	TSS	1949270	1949271	-0.032205	-	.
Adh	LMESSM	TSS	1946540	1946541	-0.046513	-	.
Adh	LMESSM	TSS	1945540	1945541	-0.036520	-	.
Adh	LMESSM	TSS	1942940	1942941	-0.040440	-	.
Adh	LMESSM	TSS	1936960	1936961	-0.037660	-	.
Adh	LMESSM	TSS	1936210	1936211	-0.031321	-	.
Adh	LMESSM	TSS	1935750	1935751	-0.047920	-	.
Adh	LMESSM	TSS	1935180	1935181	-0.035745	-	.
Adh	LMESSM	TSS	1934690	1934691	-0.041840	-	.
Adh	LMESSM	TSS	1934130	1934131	-0.038511	-	.
Adh	LMESSM	TSS	1930480	1930481	-0.050470	-	.
Adh	LMESSM	TSS	1929590	1929591	-0.042780	-	.
Adh	LMESSM	TSS	1928190	1928191	-0.038070	-	.
Adh	LMESSM	TSS	1927550	1927551	-0.032402	-	.
Adh	LMESSM	TSS	1926810	1926811	-0.039150	-	.
Adh	LMESSM	TSS	1924040	1924041	-0.049722	-	.
Adh	LMESSM	TSS	1921050	1921051	-0.032730	-	.
Adh	LMESSM	TSS	1917880	1917881	-0.031857	-	.
Adh	LMESSM	TSS	1916280	1916281	-0.040861	-	.
Adh	LMESSM	TSS	1915660	1915661	-0.039330	-	.
Adh	LMESSM	TSS	1912530	1912531	-0.034490	-	.
Adh	LMESSM	TSS	1912110	1912111	-0.034787	-	.
Adh	LMESSM	TSS	1911420	1911421	-0.037749	-	.
Adh	LMESSM	TSS	1910730	1910731	-0.031650	-	.
Adh	LMESSM	TSS	1908920	1908921	-0.053885	-	.
Adh	LMESSM	TSS	1908450	1908451	-0.040267	-	.
Adh	LMESSM	TSS	1907820	1907821	-0.033625	-	.
Adh	LMESSM	TSS	1907250	1907251	-0.036375	-	.
Adh	LMESSM	TSS	1904920	1904921	-0.038214	-	.
Adh	LMESSM	TSS	1903270	1903271	-0.048131	-	.
Adh	LMESSM	TSS	1903110	1903111	-0.036561	-	.
Adh	LMESSM	TSS	1901230	1901231	-0.034851	-	.
Adh	LMESSM	TSS	1899890	1899891	-0.034667	-	.
Adh	LMESSM	TSS	1897640	1897641	-0.038703	-	.
Adh	LMESSM	TSS	1896680	1896681	-0.039500	-	.
Adh	LMESSM	TSS	1895780	1895781	-0.039835	-	.
Adh	LMESSM	TSS	1895440	1895441	-0.041734	-	.
Adh	LMESSM	TSS	1894630	1894631	-0.033890	-	.
Adh	LMESSM	TSS	1894240	1894241	-0.041141	-	.
Adh	LMESSM	TSS	1893610	1893611	-0.031939	-	.
Adh	LMESSM	TSS	1892470	1892471	-0.034450	-	.
Adh	LMESSM	TSS	1891020	1891021	-0.038032	-	.
Adh	LMESSM	TSS	1889500	1889501	-0.036601	-	.
Adh	LMESSM	TSS	1888650	1888651	-0.047940	-	.
Adh	LMESSM	TSS	1887840	1887841	-0.032221	-	.
Adh	LMESSM	TSS	1887710	1887711	-0.036452	-	.
Adh	LMESSM	TSS	1886460	1886461	-0.034221	-	.
Adh	LMESSM	TSS	1885350	1885351	-0.035672	-	.
Adh	LMESSM	TSS	1885060	1885061	-0.040470	-	.
Adh	LMESSM	TSS	1884390	1884391	-0.033672	-	.
Adh	LMESSM	TSS	1881750	1881751	-0.047088	-	.
Adh	LMESSM	TSS	1880520	1880521	-0.041721	-	.
Adh	LMESSM	TSS	1879120	1879121	-0.058660	-	.
Adh	LMESSM	TSS	1878400	1878401	-0.037482	-	.
Adh	LMESSM	TSS	1876670	1876671	-0.035250	-	.
Adh	LMESSM	TSS	1874910	1874911	-0.042013	-	.
Adh	LMESSM	TSS	1873310	1873311	-0.041534	-	.
Adh	LMESSM	TSS	1872580	1872581	-0.033247	-	.
Adh	LMESSM	TSS	1870970	1870971	-0.037104	-	.
Adh	LMESSM	TSS	1870090	1870091	-0.037406	-	.
Adh	LMESSM	TSS	1869380	1869381	-0.031450	-	.
Adh	LMESSM	TSS	1865920	1865921	-0.038876	-	.
Adh	LMESSM	TSS	1865150	1865151	-0.048075	-	.
Adh	LMESSM	TSS	1864140	1864141	-0.032801	-	.
Adh	LMESSM	TSS	1862860	1862861	-0.042251	-	.
Adh	LMESSM	TSS	1862740	1862741	-0.038511	-	.
Adh	LMESSM	TSS	1861010	1861011	-0.033930	-	.
Adh	LMESSM	TSS	1860130	1860131	-0.039814	-	.
Adh	LMESSM	TSS	1858730	1858731	-0.038296	-	.
Adh	LMESSM	TSS	1857900	1857901	-0.051980	-	.
Adh	LMESSM	TSS	1852290	1852291	-0.034180	-	.
Adh	LMESSM	TSS	1851150	1851151	-0.040541	-	.
Adh	LMESSM	TSS	1850280	1850281	-0.039543	-	.
Adh	LMESSM	TSS	1847950	1847951	-0.032010	-	.
Adh	LMESSM	TSS	1844250	1844251	-0.032821	-	.
Adh	LMESSM	TSS	1842380	1842381	-0.032610	-	.
Adh	LMESSM	TSS	1840350	1840351	-0.032645	-	.
Adh	LMESSM	TSS	1838750	1838751	-0.040365	-	.
Adh	LMESSM	TSS	1837770	1837771	-0.031703	-	.
Adh	LMESSM	TSS	1834870	1834871	-0.043011	-	.
Adh	LMESSM	TSS	1834000	1834001	-0.037790	-	.
Adh	LMESSM	TSS	1830100	1830101	-0.033931	-	.
Adh	LMESSM	TSS	1829490	1829491	-0.041046	-	.
Adh	LMESSM	TSS	1826910	1826911	-0.037470	-	.
Adh	LMESSM	TSS	1826600	1826601	-0.036018	-	.
Adh	LMESSM	TSS	1825140	1825141	-0.048580	-	.
Adh	LMESSM	TSS	1823240	1823241	-0.039807	-	.
Adh	LMESSM	TSS	1817590	1817591	-0.031300	-	.
Adh	LMESSM	TSS	1816640	1816641	-0.034568	-	.
Adh	LMESSM	TSS	1815590	1815591	-0.034542	-	.
Adh	LMESSM	TSS	1811890	1811891	-0.047749	-	.
Adh	LMESSM	TSS	1810950	1810951	-0.032356	-	.
Adh	LMESSM	TSS	1809540	1809541	-0.044838	-	.
Adh	LMESSM	TSS	1807130	1807131	-0.036738	-	.
Adh	LMESSM	TSS	1805790	1805791	-0.036081	-	.
Adh	LMESSM	TSS	1804390	1804391	-0.033951	-	.
Adh	LMESSM	TSS	1803560	1803561	-0.039097	-	.
Adh	LMESSM	TSS	1801970	1801971	-0.037421	-	.
Adh	LMESSM	TSS	1801310	1801311	-0.038949	-	.
Adh	LMESSM	TSS	1800410	1800411	-0.032841	-	.
Adh	LMESSM	TSS	1795930	1795931	-0.059270	-	.
Adh	LMESSM	TSS	1794730	1794731	-0.035401	-	.
Adh	LMESSM	TSS	1792260	1792261	-0.039118	-	.
Adh	LMESSM	TSS	1791250	1791251	-0.038498	-	.
Adh	LMESSM	TSS	1790570	1790571	-0.035630	-	.
Adh	LMESSM	TSS	1789610	1789611	-0.036960	-	.
Adh	LMESSM	TSS	1788460	1788461	-0.034743	-	.
Adh	LMESSM	TSS	1788010	1788011	-0.035204	-	.
Adh	LMESSM	TSS	1787420	1787421	-0.033890	-	.
Adh	LMESSM	TSS	1785820	1785821	-0.031681	-	.
Adh	LMESSM	TSS	1784970	1784971	-0.033141	-	.
Adh	LMESSM	TSS	1782890	1782891	-0.034820	-	.
Adh	LMESSM	TSS	1777820	1777821	-0.030930	-	.
Adh	LMESSM	TSS	1776710	1776711	-0.032690	-	.
Adh	LMESSM	TSS	1775970	1775971	-0.037676	-	.
Adh	LMESSM	TSS	1774980	1774981	-0.040334	-	.
Adh	LMESSM	TSS	1773530	1773531	-0.039650	-	.
Adh	LMESSM	TSS	1767630	1767631	-0.032988	-	.
Adh	LMESSM	TSS	1763780	1763781	-0.032406	-	.
Adh	LMESSM	TSS	1763590	1763591	-0.037627	-	.
Adh	LMESSM	TSS	1762980	1762981	-0.032551	-	.
Adh	LMESSM	TSS	1761110	1761111	-0.032181	-	.
Adh	LMESSM	TSS	1759800	1759801	-0.034270	-	.
Adh	LMESSM	TSS	1758220	1758221	-0.037797	-	.
Adh	LMESSM	TSS	1756060	1756061	-0.044746	-	.
Adh	LMESSM	TSS	1754180	1754181	-0.057768	-	.
Adh	LMESSM	TSS	1753760	1753761	-0.033329	-	.
Adh	LMESSM	TSS	1752720	1752721	-0.037098	-	.
Adh	LMESSM	TSS	1752160	1752161	-0.035251	-	.
Adh	LMESSM	TSS	1751480	1751481	-0.038876	-	.
Adh	LMESSM	TSS	1750050	1750051	-0.040825	-	.
Adh	LMESSM	TSS	1748910	1748911	-0.031796	-	.
Adh	LMESSM	TSS	1748370	1748371	-0.037139	-	.
Adh	LMESSM	TSS	1747370	1747371	-0.034098	-	.
Adh	LMESSM	TSS	1747110	1747111	-0.037867	-	.
Adh	LMESSM	TSS	1745780	1745781	-0.036376	-	.
Adh	LMESSM	TSS	1742390	1742391	-0.046658	-	.
Adh	LMESSM	TSS	1740960	1740961	-0.031064	-	.
Adh	LMESSM	TSS	1740420	1740421	-0.032625	-	.
Adh	LMESSM	TSS	1738550	1738551	-0.031705	-	.
Adh	LMESSM	TSS	1737110	1737111	-0.037421	-	.
Adh	LMESSM	TSS	1735650	1735651	-0.031616	-	.
Adh	LMESSM	TSS	1734790	1734791	-0.032775	-	.
Adh	LMESSM	TSS	1734100	1734101	-0.036377	-	.
Adh	LMESSM	TSS	1731860	1731861	-0.031346	-	.
Adh	LMESSM	TSS	1730650	1730651	-0.053776	-	.
Adh	LMESSM	TSS	1730170	1730171	-0.050342	-	.
Adh	LMESSM	TSS	1729420	1729421	-0.033271	-	.
Adh	LMESSM	TSS	1728580	1728581	-0.039942	-	.
Adh	LMESSM	TSS	1727820	1727821	-0.039444	-	.
Adh	LMESSM	TSS	1727690	1727691	-0.036041	-	.
Adh	LMESSM	TSS	1724960	1724961	-0.035410	-	.
Adh	LMESSM	TSS	1723300	1723301	-0.035471	-	.
Adh	LMESSM	TSS	1721280	1721281	-0.036898	-	.
Adh	LMESSM	TSS	1718650	1718651	-0.034122	-	.
Adh	LMESSM	TSS	1718220	1718221	-0.045421	-	.
Adh	LMESSM	TSS	1715820	1715821	-0.048299	-	.
Adh	LMESSM	TSS	1712940	1712941	-0.032141	-	.
Adh	LMESSM	TSS	1710120	1710121	-0.032690	-	.
Adh	LMESSM	TSS	1704970	1704971	-0.032215	-	.
Adh	LMESSM	TSS	1703840	1703841	-0.042660	-	.
Adh	LMESSM	TSS	1701100	1701101	-0.034331	-	.
Adh	LMESSM	TSS	1697590	1697591	-0.031010	-	.
Adh	LMESSM	TSS	1694220	1694221	-0.034285	-	.
Adh	LMESSM	TSS	1693210	1693211	-0.031301	-	.
Adh	LMESSM	TSS	1689880	1689881	-0.041729	-	.
Adh	LMESSM	TSS	1676630	1676631	-0.034464	-	.
Adh	LMESSM	TSS	1673090	1673091	-0.034929	-	.
Adh	LMESSM	TSS	1672130	1672131	-0.031390	-	.
Adh	LMESSM	TSS	1671040	1671041	-0.041061	-	.
Adh	LMESSM	TSS	1667980	1667981	-0.031351	-	.
Adh	LMESSM	TSS	1665940	1665941	-0.036270	-	.
Adh	LMESSM	TSS	1665310	1665311	-0.031208	-	.
Adh	LMESSM	TSS	1664510	1664511	-0.042820	-	.
Adh	LMESSM	TSS	1662830	1662831	-0.032190	-	.
Adh	LMESSM	TSS	1661780	1661781	-0.044682	-	.
Adh	LMESSM	TSS	1660820	1660821	-0.037971	-	.
Adh	LMESSM	TSS	1657550	1657551	-0.030991	-	.
Adh	LMESSM	TSS	1656950	1656951	-0.035340	-	.
Adh	LMESSM	TSS	1655670	1655671	-0.032335	-	.
Adh	LMESSM	TSS	1653300	1653301	-0.032328	-	.
Adh	LMESSM	TSS	1650450	1650451	-0.036341	-	.
Adh	LMESSM	TSS	1648000	1648001	-0.033501	-	.
Adh	LMESSM	TSS	1646490	1646491	-0.035410	-	.
Adh	LMESSM	TSS	1641370	1641371	-0.034585	-	.
Adh	LMESSM	TSS	1639820	1639821	-0.038193	-	.
Adh	LMESSM	TSS	1638720	1638721	-0.035444	-	.
Adh	LMESSM	TSS	1637840	1637841	-0.038198	-	.
Adh	LMESSM	TSS	1636350	1636351	-0.041414	-	.
Adh	LMESSM	TSS	1636170	1636171	-0.031419	-	.
Adh	LMESSM	TSS	1635840	1635841	-0.034065	-	.
Adh	LMESSM	TSS	1634610	1634611	-0.040470	-	.
Adh	LMESSM	TSS	1631000	1631001	-0.040722	-	.
Adh	LMESSM	TSS	1630710	1630711	-0.034309	-	.
Adh	LMESSM	TSS	1624710	1624711	-0.039719	-	.
Adh	LMESSM	TSS	1624430	1624431	-0.033530	-	.
Adh	LMESSM	TSS	1620790	1620791	-0.043219	-	.
Adh	LMESSM	TSS	1619490	1619491	-0.041652	-	.
Adh	LMESSM	TSS	1617560	1617561	-0.035200	-	.
Adh	LMESSM	TSS	1616630	1616631	-0.040037	-	.
Adh	LMESSM	TSS	1614360	1614361	-0.040161	-	.
Adh	LMESSM	TSS	1611550	1611551	-0.033902	-	.
Adh	LMESSM	TSS	1610240	1610241	-0.043138	-	.
Adh	LMESSM	TSS	1609960	1609961	-0.057878	-	.
Adh	LMESSM	TSS	1608260	1608261	-0.031590	-	.
Adh	LMESSM	TSS	1606680	1606681	-0.040678	-	.
Adh	LMESSM	TSS	1604240	1604241	-0.057195	-	.
Adh	LMESSM	TSS	1600010	1600011	-0.037773	-	.
Adh	LMESSM	TSS	1598770	1598771	-0.045750	-	.
Adh	LMESSM	TSS	1595300	1595301	-0.030960	-	.
Adh	LMESSM	TSS	1591780	1591781	-0.049951	-	.
Adh	LMESSM	TSS	1590690	1590691	-0.031790	-	.
Adh	LMESSM	TSS	1588270	1588271	-0.038963	-	.
Adh	LMESSM	TSS	1585230	1585231	-0.031979	-	.
Adh	LMESSM	TSS	1584820	1584821	-0.035680	-	.
Adh	LMESSM	TSS	1583100	1583101	-0.030930	-	.
Adh	LMESSM	TSS	1581550	1581551	-0.038790	-	.
Adh	LMESSM	TSS	1577370	1577371	-0.032601	-	.
Adh	LMESSM	TSS	1576790	1576791	-0.041480	-	.
Adh	LMESSM	TSS	1573840	1573841	-0.032910	-	.
Adh	LMESSM	TSS	1573190	1573191	-0.033001	-	.
Adh	LMESSM	TSS	1568770	1568771	-0.036685	-	.
Adh	LMESSM	TSS	1567060	1567061	-0.038410	-	.
Adh	LMESSM	TSS	1566180	1566181	-0.042665	-	.
Adh	LMESSM	TSS	1565420	1565421	-0.040012	-	.
Adh	LMESSM	TSS	1562080	1562081	-0.031630	-	.
Adh	LMESSM	TSS	1561140	1561141	-0.034550	-	.
Adh	LMESSM	TSS	1560620	1560621	-0.033740	-	.
Adh	LMESSM	TSS	1559160	1559161	-0.037409	-	.
Adh	LMESSM	TSS	1558820	1558821	-0.041578	-	.
Adh	LMESSM	TSS	1557200	1557201	-0.044415	-	.
Adh	LMESSM	TSS	1550100	1550101	-0.031890	-	.
Adh	LMESSM	TSS	1548920	1548921	-0.034841	-	.
Adh	LMESSM	TSS	1546630	1546631	-0.054780	-	.
Adh	LMESSM	TSS	1543140	1543141	-0.036320	-	.
Adh	LMESSM	TSS	1542340	1542341	-0.043301	-	.
Adh	LMESSM	TSS	1541620	1541621	-0.055173	-	.
Adh	LMESSM	TSS	1533650	1533651	-0.041670	-	.
Adh	LMESSM	TSS	1532090	1532091	-0.039720	-	.
Adh	LMESSM	TSS	1530990	1530991	-0.037214	-	.
Adh	LMESSM	TSS	1530540	1530541	-0.038858	-	.
Adh	LMESSM	TSS	1529120	1529121	-0.042750	-	.
Adh	LMESSM	TSS	1528300	1528301	-0.042777	-	.
Adh	LMESSM	TSS	1522800	1522801	-0.037921	-	.
Adh	LMESSM	TSS	1517010	1517011	-0.035458	-	.
Adh	LMESSM	TSS	1515830	1515831	-0.032257	-	.
Adh	LMESSM	TSS	1515120	1515121	-0.043041	-	.
Adh	LMESSM	TSS	1511500	1511501	-0.034940	-	.
Adh	LMESSM	TSS	1511310	1511311	-0.032266	-	.
Adh	LMESSM	TSS	1510880	1510881	-0.034262	-	.
Adh	LMESSM	TSS	1505910	1505911	-0.041471	-	.
Adh	LMESSM	TSS	1503140	1503141	-0.046040	-	.
Adh	LMESSM	TSS	1501760	1501761	-0.042327	-	.
Adh	LMESSM	TSS	1499610	1499611	-0.031318	-	.
Adh	LMESSM	TSS	1498960	1498961	-0.035969	-	.
Adh	LMESSM	TSS	1498090	1498091	-0.044865	-	.
Adh	LMESSM	TSS	1496830	1496831	-0.034750	-	.
Adh	LMESSM	TSS	1496220	1496221	-0.034565	-	.
Adh	LMESSM	TSS	1489020	1489021	-0.036871	-	.
Adh	LMESSM	TSS	1487210	1487211	-0.040870	-	.
Adh	LMESSM	TSS	1485280	1485281	-0.059679	-	.
Adh	LMESSM	TSS	1482150	1482151	-0.036640	-	.
Adh	LMESSM	TSS	1481270	1481271	-0.039151	-	.
Adh	LMESSM	TSS	1480750	1480751	-0.040589	-	.
Adh	LMESSM	TSS	1479650	1479651	-0.042820	-	.
Adh	LMESSM	TSS	1478450	1478451	-0.043882	-	.
Adh	LMESSM	TSS	1477900	1477901	-0.032913	-	.
Adh	LMESSM	TSS	1476900	1476901	-0.045040	-	.
Adh	LMESSM	TSS	1475860	1475861	-0.036883	-	.
Adh	LMESSM	TSS	1474080	1474081	-0.082138	-	.
Adh	LMESSM	TSS	1466630	1466631	-0.033890	-	.
Adh	LMESSM	TSS	1461980	1461981	-0.042880	-	.
Adh	LMESSM	TSS	1461650	1461651	-0.030911	-	.
Adh	LMESSM	TSS	1454930	1454931	-0.032150	-	.
Adh	LMESSM	TSS	1446430	1446431	-0.032007	-	.
Adh	LMESSM	TSS	1445640	1445641	-0.033670	-	.
Adh	LMESSM	TSS	1438390	1438391	-0.035865	-	.
Adh	LMESSM	TSS	1437370	1437371	-0.032611	-	.
Adh	LMESSM	TSS	1434770	1434771	-0.031371	-	.
Adh	LMESSM	TSS	1432220	1432221	-0.032580	-	.
Adh	LMESSM	TSS	1431200	1431201	-0.040618	-	.
Adh	LMESSM	TSS	1430160	1430161	-0.034251	-	.
Adh	LMESSM	TSS	1429550	1429551	-0.060851	-	.
Adh	LMESSM	TSS	1425020	1425021	-0.037880	-	.
Adh	LMESSM	TSS	1424580	1424581	-0.031418	-	.
Adh	LMESSM	TSS	1423420	1423421	-0.033480	-	.
Adh	LMESSM	TSS	1419760	1419761	-0.031196	-	.
Adh	LMESSM	TSS	1418920	1418921	-0.032920	-	.
Adh	LMESSM	TSS	1418040	1418041	-0.030900	-	.
Adh	LMESSM	TSS	1417260	1417261	-0.035805	-	.
Adh	LMESSM	TSS	1416810	1416811	-0.044624	-	.
Adh	LMESSM	TSS	1415770	1415771	-0.031159	-	.
Adh	LMESSM	TSS	1413290	1413291	-0.031257	-	.
Adh	LMESSM	TSS	1411630	1411631	-0.041260	-	.
Adh	LMESSM	TSS	1409330	1409331	-0.032575	-	.
Adh	LMESSM	TSS	1408710	1408711	-0.037810	-	.
Adh	LMESSM	TSS	1408080	1408081	-0.033745	-	.
Adh	LMESSM	TSS	1407100	1407101	-0.035550	-	.
Adh	LMESSM	TSS	1406970	1406971	-0.033858	-	.
Adh	LMESSM	TSS	1402090	1402091	-0.048960	-	.
Adh	LMESSM	TSS	1399920	1399921	-0.039344	-	.
Adh	LMESSM	TSS	1398730	1398731	-0.039738	-	.
Adh	LMESSM	TSS	1395980	1395981	-0.032720	-	.
Adh	LMESSM	TSS	1395730	1395731	-0.031100	-	.
Adh	LMESSM	TSS	1394830	1394831	-0.032551	-	.
Adh	LMESSM	TSS	1393980	1393981	-0.049980	-	.
Adh	LMESSM	TSS	1392970	1392971	-0.033253	-	.
Adh	LMESSM	TSS	1388570	1388571	-0.035411	-	.
Adh	LMESSM	TSS	1388320	1388321	-0.039724	-	.
Adh	LMESSM	TSS	1384960	1384961	-0.039610	-	.
Adh	LMESSM	TSS	1383010	1383011	-0.050681	-	.
Adh	LMESSM	TSS	1381070	1381071	-0.035350	-	.
Adh	LMESSM	TSS	1374980	1374981	-0.034926	-	.
Adh	LMESSM	TSS	1374090	1374091	-0.032180	-	.
Adh	LMESSM	TSS	1372160	1372161	-0.031900	-	.
Adh	LMESSM	TSS	1371910	1371911	-0.040105	-	.
Adh	LMESSM	TSS	1371560	1371561	-0.032111	-	.
Adh	LMESSM	TSS	1368830	1368831	-0.034279	-	.
Adh	LMESSM	TSS	1367140	1367141	-0.031340	-	.
Adh	LMESSM	TSS	1361630	1361631	-0.038319	-	.
Adh	LMESSM	TSS	1348550	1348551	-0.031775	-	.
Adh	LMESSM	TSS	1346750	1346751	-0.035930	-	.
Adh	LMESSM	TSS	1345600	1345601	-0.031630	-	.
Adh	LMESSM	TSS	1344630	1344631	-0.041590	-	.
Adh	LMESSM	TSS	1338310	1338311	-0.033404	-	.
Adh	LMESSM	TSS	1336000	1336001	-0.037136	-	.
Adh	LMESSM	TSS	1335000	1335001	-0.031531	-	.
Adh	LMESSM	TSS	1334300	1334301	-0.031902	-	.
Adh	LMESSM	TSS	1333730	1333731	-0.033005	-	.
Adh	LMESSM	TSS	1332110	1332111	-0.036381	-	.
Adh	LMESSM	TSS	1327350	1327351	-0.033452	-	.
Adh	LMESSM	TSS	1325380	1325381	-0.035890	-	.
Adh	LMESSM	TSS	1324700	1324701	-0.039724	-	.
Adh	LMESSM	TSS	1324090	1324091	-0.040173	-	.
Adh	LMESSM	TSS	1321670	1321671	-0.032420	-	.
Adh	LMESSM	TSS	1316770	1316771	-0.044290	-	.
Adh	LMESSM	TSS	1315920	1315921	-0.033049	-	.
Adh	LMESSM	TSS	1314930	1314931	-0.035811	-	.
Adh	LMESSM	TSS	1312800	1312801	-0.039770	-	.
Adh	LMESSM	TSS	1311910	1311911	-0.033880	-	.
Adh	LMESSM	TSS	1307820	1307821	-0.039708	-	.
Adh	LMESSM	TSS	1306800	1306801	-0.035100	-	.
Adh	LMESSM	TSS	1304300	1304301	-0.030950	-	.
Adh	LMESSM	TSS	1303130	1303131	-0.038828	-	.
Adh	LMESSM	TSS	1301080	1301081	-0.036480	-	.
Adh	LMESSM	TSS	1297890	1297891	-0.042730	-	.
Adh	LMESSM	TSS	1289540	1289541	-0.046750	-	.
Adh	LMESSM	TSS	1287910	1287911	-0.034070	-	.
Adh	LMESSM	TSS	1287430	1287431	-0.033150	-	.
Adh	LMESSM	TSS	1282570	1282571	-0.046365	-	.
Adh	LMESSM	TSS	1278570	1278571	-0.036422	-	.
Adh	LMESSM	TSS	1278300	1278301	-0.033120	-	.
Adh	LMESSM	TSS	1277280	1277281	-0.030919	-	.
Adh	LMESSM	TSS	1274950	1274951	-0.039767	-	.
Adh	LMESSM	TSS	1274270	1274271	-0.041820	-	.
Adh	LMESSM	TSS	1272610	1272611	-0.034620	-	.
Adh	LMESSM	TSS	1271740	1271741	-0.036921	-	.
Adh	LMESSM	TSS	1270850	1270851	-0.034451	-	.
Adh	LMESSM	TSS	1269160	1269161	-0.035191	-	.
Adh	LMESSM	TSS	1263850	1263851	-0.039121	-	.
Adh	LMESSM	TSS	1253290	1253291	-0.045000	-	.
Adh	LMESSM	TSS	1249710	1249711	-0.044309	-	.
Adh	LMESSM	TSS	1243270	1243271	-0.031510	-	.
Adh	LMESSM	TSS	1241780	1241781	-0.040600	-	.
Adh	LMESSM	TSS	1240950	1240951	-0.039661	-	.
Adh	LMESSM	TSS	1237880	1237881	-0.031771	-	.
Adh	LMESSM	TSS	1233630	1233631	-0.036651	-	.
Adh	LMESSM	TSS	1233500	1233501	-0.034600	-	.
Adh	LMESSM	TSS	1231350	1231351	-0.041417	-	.
Adh	LMESSM	TSS	1228380	1228381	-0.041300	-	.
Adh	LMESSM	TSS	1225830	1225831	-0.038691	-	.
Adh	LMESSM	TSS	1225030	1225031	-0.043761	-	.
Adh	LMESSM	TSS	1223310	1223311	-0.032579	-	.
Adh	LMESSM	TSS	1220910	1220911	-0.039337	-	.
Adh	LMESSM	TSS	1219030	1219031	-0.033082	-	.
Adh	LMESSM	TSS	1214850	1214851	-0.035640	-	.
Adh	LMESSM	TSS	1213280	1213281	-0.045404	-	.
Adh	LMESSM	TSS	1211420	1211421	-0.055068	-	.
Adh	LMESSM	TSS	1211090	1211091	-0.038580	-	.
Adh	LMESSM	TSS	1209040	1209041	-0.033250	-	.
Adh	LMESSM	TSS	1208850	1208851	-0.031801	-	.
Adh	LMESSM	TSS	1206620	1206621	-0.032889	-	.
Adh	LMESSM	TSS	1205360	1205361	-0.035601	-	.
Adh	LMESSM	TSS	1197580	1197581	-0.037180	-	.
Adh	LMESSM	TSS	1193460	1193461	-0.031940	-	.
Adh	LMESSM	TSS	1187540	1187541	-0.042554	-	.
Adh	LMESSM	TSS	1182350	1182351	-0.038175	-	.
Adh	LMESSM	TSS	1179660	1179661	-0.033740	-	.
Adh	LMESSM	TSS	1178980	1178981	-0.038351	-	.
Adh	LMESSM	TSS	1177500	1177501	-0.036759	-	.
Adh	LMESSM	TSS	1177250	1177251	-0.040260	-	.
Adh	LMESSM	TSS	1173500	1173501	-0.041960	-	.
Adh	LMESSM	TSS	1169420	1169421	-0.035320	-	.
Adh	LMESSM	TSS	1166710	1166711	-0.032630	-	.
Adh	LMESSM	TSS	1159710	1159711	-0.037950	-	.
Adh	LMESSM	TSS	1159150	1159151	-0.031830	-	.
Adh	LMESSM	TSS	1158380	1158381	-0.032123	-	.
Adh	LMESSM	TSS	1157070	1157071	-0.032470	-	.
Adh	LMESSM	TSS	1155920	1155921	-0.040613	-	.
Adh	LMESSM	TSS	1155700	1155701	-0.046956	-	.
Adh	LMESSM	TSS	1152970	1152971	-0.031176	-	.
Adh	LMESSM	TSS	1151900	1151901	-0.030901	-	.
Adh	LMESSM	TSS	1150360	1150361	-0.044820	-	.
Adh	LMESSM	TSS	1145790	1145791	-0.035638	-	.
Adh	LMESSM	TSS	1145540	1145541	-0.035111	-	.
Adh	LMESSM	TSS	1144380	1144381	-0.041080	-	.
Adh	LMESSM	TSS	1140930	1140931	-0.033411	-	.
Adh	LMESSM	TSS	1136060	1136061	-0.035387	-	.
Adh	LMESSM	TSS	1135180	1135181	-0.039689	-	.
Adh	LMESSM	TSS	1133690	1133691	-0.037430	-	.
Adh	LMESSM	TSS	1130420	1130421	-0.033330	-	.
Adh	LMESSM	TSS	1128320	1128321	-0.045829	-	.
Adh	LMESSM	TSS	1126430	1126431	-0.038710	-	.
Adh	LMESSM	TSS	1125620	1125621	-0.034202	-	.
Adh	LMESSM	TSS	1123850	1123851	-0.034750	-	.
Adh	LMESSM	TSS	1122780	1122781	-0.033361	-	.
Adh	LMESSM	TSS	1121410	1121411	-0.034262	-	.
Adh	LMESSM	TSS	1121110	1121111	-0.032681	-	.
Adh	LMESSM	TSS	1117690	1117691	-0.034710	-	.
Adh	LMESSM	TSS	1117370	1117371	-0.032610	-	.
Adh	LMESSM	TSS	1115800	1115801	-0.036689	-	.
Adh	LMESSM	TSS	1115470	1115471	-0.032809	-	.
Adh	LMESSM	TSS	1115010	1115011	-0.039168	-	.
Adh	LMESSM	TSS	1112360	1112361	-0.037208	-	.
Adh	LMESSM	TSS	1111990	1111991	-0.040668	-	.
Adh	LMESSM	TSS	1110870	1110871	-0.035305	-	.
Adh	LMESSM	TSS	1104870	1104871	-0.031220	-	.
Adh	LMESSM	TSS	1103640	1103641	-0.039683	-	.
Adh	LMESSM	TSS	1102950	1102951	-0.038190	-	.
Adh	LMESSM	TSS	1101540	1101541	-0.044649	-	.
Adh	LMESSM	TSS	1100150	1100151	-0.053438	-	.
Adh	LMESSM	TSS	1099430	1099431	-0.035320	-	.
Adh	LMESSM	TSS	1098860	1098861	-0.035558	-	.
Adh	LMESSM	TSS	1096230	1096231	-0.030911	-	.
Adh	LMESSM	TSS	1094720	1094721	-0.031575	-	.
Adh	LMESSM	TSS	1092360	1092361	-0.047285	-	.
Adh	LMESSM	TSS	1091400	1091401	-0.036741	-	.
Adh	LMESSM	TSS	1089990	1089991	-0.040831	-	.
Adh	LMESSM	TSS	1089170	1089171	-0.051546	-	.
Adh	LMESSM	TSS	1088700	1088701	-0.039904	-	.
Adh	LMESSM	TSS	1086390	1086391	-0.032711	-	.
Adh	LMESSM	TSS	1085390	1085391	-0.032755	-	.
Adh	LMESSM	TSS	1083760	1083761	-0.044475	-	.
Adh	LMESSM	TSS	1081050	1081051	-0.046078	-	.
Adh	LMESSM	TSS	1080080	1080081	-0.035764	-	.
Adh	LMESSM	TSS	1079770	1079771	-0.038810	-	.
Adh	LMESSM	TSS	1077020	1077021	-0.042299	-	.
Adh	LMESSM	TSS	1076450	1076451	-0.035477	-	.
Adh	LMESSM	TSS	1075400	1075401	-0.031691	-	.
Adh	LMESSM	TSS	1074770	1074771	-0.048416	-	.
Adh	LMESSM	TSS	1073050	1073051	-0.037153	-	.
Adh	LMESSM	TSS	1072230	1072231	-0.034791	-	.
Adh	LMESSM	TSS	1071730	1071731	-0.040566	-	.
Adh	LMESSM	TSS	1071010	1071011	-0.041888	-	.
Adh	LMESSM	TSS	1069840	1069841	-0.038024	-	.
Adh	LMESSM	TSS	1068420	1068421	-0.044257	-	.
Adh	LMESSM	TSS	1066620	1066621	-0.034368	-	.
Adh	LMESSM	TSS	1065610	1065611	-0.046088	-	.
Adh	LMESSM	TSS	1063980	1063981	-0.038644	-	.
Adh	LMESSM	TSS	1062270	1062271	-0.033080	-	.
Adh	LMESSM	TSS	1061570	1061571	-0.038551	-	.
Adh	LMESSM	TSS	1061150	1061151	-0.032049	-	.
Adh	LMESSM	TSS	1060170	1060171	-0.038129	-	.
Adh	LMESSM	TSS	1056520	1056521	-0.038590	-	.
Adh	LMESSM	TSS	1055680	1055681	-0.039572	-	.
Adh	LMESSM	TSS	1054450	1054451	-0.041920	-	.
Adh	LMESSM	TSS	1052940	1052941	-0.032079	-	.
Adh	LMESSM	TSS	1051420	1051421	-0.038779	-	.
Adh	LMESSM	TSS	1050840	1050841	-0.040371	-	.
Adh	LMESSM	TSS	1049220	1049221	-0.038539	-	.
Adh	LMESSM	TSS	1048580	1048581	-0.043401	-	.
Adh	LMESSM	TSS	1047410	1047411	-0.045578	-	.
Adh	LMESSM	TSS	1046280	1046281	-0.041835	-	.
Adh	LMESSM	TSS	1044550	1044551	-0.042039	-	.
Adh	LMESSM	TSS	1043570	1043571	-0.035377	-	.
Adh	LMESSM	TSS	1041870	1041871	-0.034184	-	.
Adh	LMESSM	TSS	1041510	1041511	-0.031148	-	.
Adh	LMESSM	TSS	1040910	1040911	-0.032769	-	.
Adh	LMESSM	TSS	1039750	1039751	-0.041257	-	.
Adh	LMESSM	TSS	1038860	1038861	-0.031522	-	.
Adh	LMESSM	TSS	1038280	1038281	-0.031055	-	.
Adh	LMESSM	TSS	1036690	1036691	-0.038411	-	.
Adh	LMESSM	TSS	1035510	1035511	-0.035965	-	.
Adh	LMESSM	TSS	1033350	1033351	-0.036395	-	.
Adh	LMESSM	TSS	1029910	1029911	-0.036561	-	.
Adh	LMESSM	TSS	1027960	1027961	-0.033610	-	.
Adh	LMESSM	TSS	1027070	1027071	-0.036629	-	.
Adh	LMESSM	TSS	1026700	1026701	-0.040150	-	.
Adh	LMESSM	TSS	1025950	1025951	-0.039310	-	.
Adh	LMESSM	TSS	1025520	1025521	-0.048780	-	.
Adh	LMESSM	TSS	1023510	1023511	-0.035364	-	.
Adh	LMESSM	TSS	1022860	1022861	-0.037798	-	.
Adh	LMESSM	TSS	1022110	1022111	-0.035230	-	.
Adh	LMESSM	TSS	1021340	1021341	-0.048905	-	.
Adh	LMESSM	TSS	1020200	1020201	-0.033620	-	.
Adh	LMESSM	TSS	1018250	1018251	-0.039744	-	.
Adh	LMESSM	TSS	1018030	1018031	-0.053840	-	.
Adh	LMESSM	TSS	1016210	1016211	-0.038000	-	.
Adh	LMESSM	TSS	1014840	1014841	-0.037660	-	.
Adh	LMESSM	TSS	1014580	1014581	-0.034390	-	.
Adh	LMESSM	TSS	1010640	1010641	-0.032290	-	.
Adh	LMESSM	TSS	1009730	1009731	-0.035023	-	.
Adh	LMESSM	TSS	1007320	1007321	-0.040740	-	.
Adh	LMESSM	TSS	1005880	1005881	-0.044200	-	.
Adh	LMESSM	TSS	1003490	1003491	-0.036493	-	.
Adh	LMESSM	TSS	1002600	1002601	-0.058826	-	.
Adh	LMESSM	TSS	1000840	1000841	-0.040301	-	.
Adh	LMESSM	TSS	999240	999241	-0.039970	-	.
Adh	LMESSM	TSS	997450	997451	-0.034660	-	.
Adh	LMESSM	TSS	996760	996761	-0.035370	-	.
Adh	LMESSM	TSS	993230	993231	-0.031700	-	.
Adh	LMESSM	TSS	984300	984301	-0.070199	-	.
Adh	LMESSM	TSS	984090	984091	-0.047298	-	.
Adh	LMESSM	TSS	982220	982221	-0.039771	-	.
Adh	LMESSM	TSS	981850	981851	-0.044507	-	.
Adh	LMESSM	TSS	979630	979631	-0.049639	-	.
Adh	LMESSM	TSS	978830	978831	-0.053331	-	.
Adh	LMESSM	TSS	977920	977921	-0.038642	-	.
Adh	LMESSM	TSS	977480	977481	-0.031810	-	.
Adh	LMESSM	TSS	976840	976841	-0.042231	-	.
Adh	LMESSM	TSS	976750	976751	-0.042186	-	.
Adh	LMESSM	TSS	974680	974681	-0.038921	-	.
Adh	LMESSM	TSS	972870	972871	-0.042186	-	.
Adh	LMESSM	TSS	971500	971501	-0.031871	-	.
Adh	LMESSM	TSS	969130	969131	-0.031164	-	.
Adh	LMESSM	TSS	966540	966541	-0.032428	-	.
Adh	LMESSM	TSS	964570	964571	-0.044399	-	.
Adh	LMESSM	TSS	964160	964161	-0.033882	-	.
Adh	LMESSM	TSS	963910	963911	-0.048034	-	.
Adh	LMESSM	TSS	962250	962251	-0.033646	-	.
Adh	LMESSM	TSS	961660	961661	-0.037110	-	.
Adh	LMESSM	TSS	960100	960101	-0.032699	-	.
Adh	LMESSM	TSS	956890	956891	-0.042131	-	.
Adh	LMESSM	TSS	954390	954391	-0.038200	-	.
Adh	LMESSM	TSS	952460	952461	-0.047121	-	.
Adh	LMESSM	TSS	951690	951691	-0.037805	-	.
Adh	LMESSM	TSS	948470	948471	-0.038220	-	.
Adh	LMESSM	TSS	948230	948231	-0.037339	-	.
Adh	LMESSM	TSS	947140	947141	-0.036693	-	.
Adh	LMESSM	TSS	942830	942831	-0.038200	-	.
Adh	LMESSM	TSS	941700	941701	-0.042920	-	.
Adh	LMESSM	TSS	937550	937551	-0.038615	-	.
Adh	LMESSM	TSS	935700	935701	-0.033319	-	.
Adh	LMESSM	TSS	931230	931231	-0.038070	-	.
Adh	LMESSM	TSS	930670	930671	-0.034801	-	.
Adh	LMESSM	TSS	923820	923821	-0.032881	-	.
Adh	LMESSM	TSS	923630	923631	-0.031990	-	.
Adh	LMESSM	TSS	918690	918691	-0.039295	-	.
Adh	LMESSM	TSS	914450	914451	-0.035400	-	.
Adh	LMESSM	TSS	913460	913461	-0.031621	-	.
Adh	LMESSM	TSS	911560	911561	-0.035165	-	.
Adh	LMESSM	TSS	909220	909221	-0.038777	-	.
Adh	LMESSM	TSS	908810	908811	-0.034811	-	.
Adh	LMESSM	TSS	907770	907771	-0.034341	-	.
Adh	LMESSM	TSS	903280	903281	-0.054830	-	.
Adh	LMESSM	TSS	902160	902161	-0.038377	-	.
Adh	LMESSM	TSS	900030	900031	-0.051200	-	.
Adh	LMESSM	TSS	898900	898901	-0.034660	-	.
Adh	LMESSM	TSS	897300	897301	-0.033670	-	.
Adh	LMESSM	TSS	895690	895691	-0.044531	-	.
Adh	LMESSM	TSS	895250	895251	-0.032001	-	.
Adh	LMESSM	TSS	886760	886761	-0.032666	-	.
Adh	LMESSM	TSS	883580	883581	-0.036851	-	.
Adh	LMESSM	TSS	882570	882571	-0.032535	-	.
Adh	LMESSM	TSS	880010	880011	-0.034242	-	.
Adh	LMESSM	TSS	879030	879031	-0.059000	-	.
Adh	LMESSM	TSS	875440	875441	-0.034049	-	.
Adh	LMESSM	TSS	874550	874551	-0.038972	-	.
Adh	LMESSM	TSS	873110	873111	-0.044137	-	.
Adh	LMESSM	TSS	872660	872661	-0.037542	-	.
Adh	LMESSM	TSS	870470	870471	-0.035640	-	.
Adh	LMESSM	TSS	863540	863541	-0.034870	-	.
Adh	LMESSM	TSS	857870	857871	-0.035130	-	.
Adh	LMESSM	TSS	857190	857191	-0.036050	-	.
Adh	LMESSM	TSS	854960	854961	-0.032160	-	.
Adh	LMESSM	TSS	851700	851701	-0.038185	-	.
Adh	LMESSM	TSS	850650	850651	-0.033701	-	.
Adh	LMESSM	TSS	848730	848731	-0.043550	-	.
Adh	LMESSM	TSS	842360	842361	-0.034084	-	.
Adh	LMESSM	TSS	841150	841151	-0.031048	-	.
Adh	LMESSM	TSS	830870	830871	-0.034908	-	.
Adh	LMESSM	TSS	827950	827951	-0.034531	-	.
Adh	LMESSM	TSS	827050	827051	-0.031940	-	.
Adh	LMESSM	TSS	823540	823541	-0.036612	-	.
Adh	LMESSM	TSS	822970	822971	-0.037241	-	.
Adh	LMESSM	TSS	821440	821441	-0.037657	-	.
Adh	LMESSM	TSS	820820	820821	-0.034260	-	.
Adh	LMESSM	TSS	820100	820101	-0.049661	-	.
Adh	LMESSM	TSS	819200	819201	-0.036000	-	.
Adh	LMESSM	TSS	818000	818001	-0.040317	-	.
Adh	LMESSM	TSS	815360	815361	-0.037523	-	.
Adh	LMESSM	TSS	810270	810271	-0.033458	-	.
Adh	LMESSM	TSS	809860	809861	-0.035910	-	.
Adh	LMESSM	TSS	808290	808291	-0.040790	-	.
Adh	LMESSM	TSS	804800	804801	-0.031821	-	.
Adh	LMESSM	TSS	802850	802851	-0.031657	-	.
Adh	LMESSM	TSS	802110	802111	-0.040821	-	.
Adh	LMESSM	TSS	796720	796721	-0.041881	-	.
Adh	LMESSM	TSS	794790	794791	-0.036610	-	.
Adh	LMESSM	TSS	793770	793771	-0.032887	-	.
Adh	LMESSM	TSS	793470	793471	-0.032326	-	.
Adh	LMESSM	TSS	790690	790691	-0.033811	-	.
Adh	LMESSM	TSS	788980	788981	-0.045775	-	.
Adh	LMESSM	TSS	785630	785631	-0.031117	-	.
Adh	LMESSM	TSS	784250	784251	-0.035713	-	.
Adh	LMESSM	TSS	782660	782661	-0.049782	-	.
Adh	LMESSM	TSS	781390	781391	-0.037432	-	.
Adh	LMESSM	TSS	781090	781091	-0.031888	-	.
Adh	LMESSM	TSS	777080	777081	-0.040731	-	.
Adh	LMESSM	TSS	764780	764781	-0.033201	-	.
Adh	LMESSM	TSS	763860	763861	-0.033707	-	.
Adh	LMESSM	TSS	763430	763431	-0.033283	-	.
Adh	LMESSM	TSS	758900	758901	-0.036741	-	.
Adh	LMESSM	TSS	758730	758731	-0.032847	-	.
Adh	LMESSM	TSS	756690	756691	-0.047386	-	.
Adh	LMESSM	TSS	755050	755051	-0.033380	-	.
Adh	LMESSM	TSS	750590	750591	-0.042743	-	.
Adh	LMESSM	TSS	749630	749631	-0.034649	-	.
Adh	LMESSM	TSS	747520	747521	-0.032821	-	.
Adh	LMESSM	TSS	743000	743001	-0.035521	-	.
Adh	LMESSM	TSS	741980	741981	-0.035021	-	.
Adh	LMESSM	TSS	738280	738281	-0.035816	-	.
Adh	LMESSM	TSS	735060	735061	-0.037520	-	.
Adh	LMESSM	TSS	732400	732401	-0.033370	-	.
Adh	LMESSM	TSS	731570	731571	-0.035620	-	.
Adh	LMESSM	TSS	730510	730511	-0.036593	-	.
Adh	LMESSM	TSS	727680	727681	-0.043020	-	.
Adh	LMESSM	TSS	727160	727161	-0.034861	-	.
Adh	LMESSM	TSS	724090	724091	-0.034088	-	.
Adh	LMESSM	TSS	723880	723881	-0.031281	-	.
Adh	LMESSM	TSS	711860	711861	-0.037400	-	.
Adh	LMESSM	TSS	706990	706991	-0.031681	-	.
Adh	LMESSM	TSS	701660	701661	-0.032091	-	.
Adh	LMESSM	TSS	699970	699971	-0.032060	-	.
Adh	LMESSM	TSS	699550	699551	-0.033522	-	.
Adh	LMESSM	TSS	698020	698021	-0.031647	-	.
Adh	LMESSM	TSS	688910	688911	-0.033150	-	.
Adh	LMESSM	TSS	688510	688511	-0.039211	-	.
Adh	LMESSM	TSS	687150	687151	-0.037660	-	.
Adh	LMESSM	TSS	683100	683101	-0.036590	-	.
Adh	LMESSM	TSS	681750	681751	-0.032526	-	.
Adh	LMESSM	TSS	680770	680771	-0.034901	-	.
Adh	LMESSM	TSS	677020	677021	-0.035504	-	.
Adh	LMESSM	TSS	675870	675871	-0.033071	-	.
Adh	LMESSM	TSS	674520	674521	-0.037080	-	.
Adh	LMESSM	TSS	672210	672211	-0.034831	-	.
Adh	LMESSM	TSS	671210	671211	-0.039840	-	.
Adh	LMESSM	TSS	668620	668621	-0.031381	-	.
Adh	LMESSM	TSS	668120	668121	-0.041229	-	.
Adh	LMESSM	TSS	662180	662181	-0.031520	-	.
Adh	LMESSM	TSS	661330	661331	-0.031290	-	.
Adh	LMESSM	TSS	658480	658481	-0.032848	-	.
Adh	LMESSM	TSS	652710	652711	-0.052248	-	.
Adh	LMESSM	TSS	651310	651311	-0.033838	-	.
Adh	LMESSM	TSS	648440	648441	-0.045309	-	.
Adh	LMESSM	TSS	647920	647921	-0.040258	-	.
Adh	LMESSM	TSS	647280	647281	-0.040301	-	.
Adh	LMESSM	TSS	644530	644531	-0.040510	-	.
Adh	LMESSM	TSS	643020	643021	-0.032735	-	.
Adh	LMESSM	TSS	641200	641201	-0.039441	-	.
Adh	LMESSM	TSS	638990	638991	-0.033895	-	.
Adh	LMESSM	TSS	637750	637751	-0.031920	-	.
Adh	LMESSM	TSS	634720	634721	-0.037318	-	.
Adh	LMESSM	TSS	633620	633621	-0.053121	-	.
Adh	LMESSM	TSS	633140	633141	-0.035210	-	.
Adh	LMESSM	TSS	632730	632731	-0.037947	-	.
Adh	LMESSM	TSS	629820	629821	-0.031128	-	.
Adh	LMESSM	TSS	628100	628101	-0.038273	-	.
Adh	LMESSM	TSS	626810	626811	-0.041095	-	.
Adh	LMESSM	TSS	618740	618741	-0.039188	-	.
Adh	LMESSM	TSS	617900	617901	-0.032114	-	.
Adh	LMESSM	TSS	617370	617371	-0.032810	-	.
Adh	LMESSM	TSS	614510	614511	-0.035776	-	.
Adh	LMESSM	TSS	613310	613311	-0.037084	-	.
Adh	LMESSM	TSS	611090	611091	-0.031740	-	.
Adh	LMESSM	TSS	610070	610071	-0.043070	-	.
Adh	LMESSM	TSS	602340	602341	-0.032551	-	.
Adh	LMESSM	TSS	598970	598971	-0.040560	-	.
Adh	LMESSM	TSS	597320	597321	-0.036649	-	.
Adh	LMESSM	TSS	594550	594551	-0.046371	-	.
Adh	LMESSM	TSS	594160	594161	-0.041571	-	.
Adh	LMESSM	TSS	593610	593611	-0.032611	-	.
Adh	LMESSM	TSS	591590	591591	-0.031351	-	.
Adh	LMESSM	TSS	589750	589751	-0.035823	-	.
Adh	LMESSM	TSS	584200	584201	-0.038351	-	.
Adh	LMESSM	TSS	582290	582291	-0.035250	-	.
Adh	LMESSM	TSS	581790	581791	-0.032197	-	.
Adh	LMESSM	TSS	580660	580661	-0.037470	-	.
Adh	LMESSM	TSS	574420	574421	-0.035370	-	.
Adh	LMESSM	TSS	571200	571201	-0.042290	-	.
Adh	LMESSM	TSS	570750	570751	-0.036281	-	.
Adh	LMESSM	TSS	569540	569541	-0.032140	-	.
Adh	LMESSM	TSS	565200	565201	-0.035391	-	.
Adh	LMESSM	TSS	564520	564521	-0.036445	-	.
Adh	LMESSM	TSS	561120	561121	-0.038481	-	.
Adh	LMESSM	TSS	556160	556161	-0.043928	-	.
Adh	LMESSM	TSS	555710	555711	-0.031391	-	.
Adh	LMESSM	TSS	555280	555281	-0.042251	-	.
Adh	LMESSM	TSS	554150	554151	-0.031179	-	.
Adh	LMESSM	TSS	552270	552271	-0.031873	-	.
Adh	LMESSM	TSS	551130	551131	-0.038360	-	.
Adh	LMESSM	TSS	550830	550831	-0.035908	-	.
Adh	LMESSM	TSS	547980	547981	-0.053671	-	.
Adh	LMESSM	TSS	546880	546881	-0.031259	-	.
Adh	LMESSM	TSS	545370	545371	-0.041236	-	.
Adh	LMESSM	TSS	545050	545051	-0.034051	-	.
Adh	LMESSM	TSS	544050	544051	-0.035271	-	.
Adh	LMESSM	TSS	543500	543501	-0.037260	-	.
Adh	LMESSM	TSS	539550	539551	-0.042820	-	.
Adh	LMESSM	TSS	536320	536321	-0.035544	-	.
Adh	LMESSM	TSS	534020	534021	-0.053427	-	.
Adh	LMESSM	TSS	532370	532371	-0.032830	-	.
Adh	LMESSM	TSS	529270	529271	-0.044580	-	.
Adh	LMESSM	TSS	528280	528281	-0.041475	-	.
Adh	LMESSM	TSS	526940	526941	-0.034314	-	.
Adh	LMESSM	TSS	524630	524631	-0.039218	-	.
Adh	LMESSM	TSS	523970	523971	-0.034890	-	.
Adh	LMESSM	TSS	521750	521751	-0.038860	-	.
Adh	LMESSM	TSS	518100	518101	-0.032571	-	.
Adh	LMESSM	TSS	515390	515391	-0.036530	-	.
Adh	LMESSM	TSS	511280	511281	-0.042656	-	.
Adh	LMESSM	TSS	509440	509441	-0.031824	-	.
Adh	LMESSM	TSS	507960	507961	-0.044461	-	.
Adh	LMESSM	TSS	507450	507451	-0.051467	-	.
Adh	LMESSM	TSS	505850	505851	-0.031161	-	.
Adh	LMESSM	TSS	502810	502811	-0.038351	-	.
Adh	LMESSM	TSS	496610	496611	-0.035155	-	.
Adh	LMESSM	TSS	495810	495811	-0.037410	-	.
Adh	LMESSM	TSS	495000	495001	-0.046011	-	.
Adh	LMESSM	TSS	493270	493271	-0.033369	-	.
Adh	LMESSM	TSS	491620	491621	-0.034869	-	.
Adh	LMESSM	TSS	491020	491021	-0.031117	-	.
Adh	LMESSM	TSS	488010	488011	-0.035190	-	.
Adh	LMESSM	TSS	487270	487271	-0.043135	-	.
Adh	LMESSM	TSS	486020	486021	-0.043990	-	.
Adh	LMESSM	TSS	484700	484701	-0.034043	-	.
Adh	LMESSM	TSS	482860	482861	-0.035311	-	.
Adh	LMESSM	TSS	481350	481351	-0.039508	-	.
Adh	LMESSM	TSS	480480	480481	-0.033091	-	.
Adh	LMESSM	TSS	475190	475191	-0.032712	-	.
Adh	LMESSM	TSS	472270	472271	-0.039971	-	.
Adh	LMESSM	TSS	471550	471551	-0.035984	-	.
Adh	LMESSM	TSS	470870	470871	-0.037191	-	.
Adh	LMESSM	TSS	469470	469471	-0.031557	-	.
Adh	LMESSM	TSS	465340	465341	-0.040600	-	.
Adh	LMESSM	TSS	463690	463691	-0.034949	-	.
Adh	LMESSM	TSS	463240	463241	-0.032603	-	.
Adh	LMESSM	TSS	462490	462491	-0.035433	-	.
Adh	LMESSM	TSS	460780	460781	-0.037595	-	.
Adh	LMESSM	TSS	458590	458591	-0.034766	-	.
Adh	LMESSM	TSS	458120	458121	-0.045417	-	.
Adh	LMESSM	TSS	457310	457311	-0.053708	-	.
Adh	LMESSM	TSS	454850	454851	-0.033065	-	.
Adh	LMESSM	TSS	453990	453991	-0.036758	-	.
Adh	LMESSM	TSS	452890	452891	-0.036450	-	.
Adh	LMESSM	TSS	452120	452121	-0.032047	-	.
Adh	LMESSM	TSS	450880	450881	-0.032579	-	.
Adh	LMESSM	TSS	450030	450031	-0.032641	-	.
Adh	LMESSM	TSS	449130	449131	-0.035385	-	.
Adh	LMESSM	TSS	448540	448541	-0.032670	-	.
Adh	LMESSM	TSS	447570	447571	-0.036105	-	.
Adh	LMESSM	TSS	446860	446861	-0.043229	-	.
Adh	LMESSM	TSS	445330	445331	-0.036061	-	.
Adh	LMESSM	TSS	442510	442511	-0.037107	-	.
Adh	LMESSM	TSS	440190	440191	-0.033684	-	.
Adh	LMESSM	TSS	439710	439711	-0.034593	-	.
Adh	LMESSM	TSS	436100	436101	-0.037800	-	.
Adh	LMESSM	TSS	435000	435001	-0.039529	-	.
Adh	LMESSM	TSS	433320	433321	-0.042075	-	.
Adh	LMESSM	TSS	429900	429901	-0.032610	-	.
Adh	LMESSM	TSS	428360	428361	-0.041341	-	.
Adh	LMESSM	TSS	423520	423521	-0.032999	-	.
Adh	LMESSM	TSS	421370	421371	-0.032740	-	.
Adh	LMESSM	TSS	419800	419801	-0.036414	-	.
Adh	LMESSM	TSS	418250	418251	-0.030916	-	.
Adh	LMESSM	TSS	417190	417191	-0.047968	-	.
Adh	LMESSM	TSS	416720	416721	-0.039010	-	.
Adh	LMESSM	TSS	415060	415061	-0.032993	-	.
Adh	LMESSM	TSS	410190	410191	-0.033097	-	.
Adh	LMESSM	TSS	408970	408971	-0.041865	-	.
Adh	LMESSM	TSS	406200	406201	-0.032791	-	.
Adh	LMESSM	TSS	404990	404991	-0.032439	-	.
Adh	LMESSM	TSS	403600	403601	-0.046996	-	.
Adh	LMESSM	TSS	401690	401691	-0.036015	-	.
Adh	LMESSM	TSS	400730	400731	-0.039563	-	.
Adh	LMESSM	TSS	398890	398891	-0.039321	-	.
Adh	LMESSM	TSS	397840	397841	-0.038301	-	.
Adh	LMESSM	TSS	393770	393771	-0.038389	-	.
Adh	LMESSM	TSS	391400	391401	-0.037170	-	.
Adh	LMESSM	TSS	390490	390491	-0.038140	-	.
Adh	LMESSM	TSS	388400	388401	-0.032032	-	.
Adh	LMESSM	TSS	387990	387991	-0.035888	-	.
Adh	LMESSM	TSS	378970	378971	-0.035218	-	.
Adh	LMESSM	TSS	376510	376511	-0.031177	-	.
Adh	LMESSM	TSS	373350	373351	-0.034884	-	.
Adh	LMESSM	TSS	372680	372681	-0.044693	-	.
Adh	LMESSM	TSS	372460	372461	-0.032799	-	.
Adh	LMESSM	TSS	371730	371731	-0.031530	-	.
Adh	LMESSM	TSS	371040	371041	-0.041793	-	.
Adh	LMESSM	TSS	370160	370161	-0.031374	-	.
Adh	LMESSM	TSS	364020	364021	-0.031450	-	.
Adh	LMESSM	TSS	363420	363421	-0.038222	-	.
Adh	LMESSM	TSS	362350	362351	-0.054391	-	.
Adh	LMESSM	TSS	360830	360831	-0.042280	-	.
Adh	LMESSM	TSS	360060	360061	-0.034903	-	.
Adh	LMESSM	TSS	354900	354901	-0.039642	-	.
Adh	LMESSM	TSS	351450	351451	-0.033050	-	.
Adh	LMESSM	TSS	343290	343291	-0.043436	-	.
Adh	LMESSM	TSS	341830	341831	-0.037237	-	.
Adh	LMESSM	TSS	338020	338021	-0.033138	-	.
Adh	LMESSM	TSS	334550	334551	-0.030977	-	.
Adh	LMESSM	TSS	331740	331741	-0.032080	-	.
Adh	LMESSM	TSS	331360	331361	-0.042530	-	.
Adh	LMESSM	TSS	327070	327071	-0.035021	-	.
Adh	LMESSM	TSS	324900	324901	-0.032248	-	.
Adh	LMESSM	TSS	323360	323361	-0.049501	-	.
Adh	LMESSM	TSS	314890	314891	-0.043770	-	.
Adh	LMESSM	TSS	311310	311311	-0.038877	-	.
Adh	LMESSM	TSS	310420	310421	-0.035376	-	.
Adh	LMESSM	TSS	307630	307631	-0.048695	-	.
Adh	LMESSM	TSS	306810	306811	-0.034509	-	.
Adh	LMESSM	TSS	301820	301821	-0.032071	-	.
Adh	LMESSM	TSS	300510	300511	-0.035440	-	.
Adh	LMESSM	TSS	298910	298911	-0.041086	-	.
Adh	LMESSM	TSS	297480	297481	-0.038630	-	.
Adh	LMESSM	TSS	295960	295961	-0.033363	-	.
Adh	LMESSM	TSS	295610	295611	-0.033111	-	.
Adh	LMESSM	TSS	294320	294321	-0.035831	-	.
Adh	LMESSM	TSS	289300	289301	-0.031136	-	.
Adh	LMESSM	TSS	288670	288671	-0.035460	-	.
Adh	LMESSM	TSS	287310	287311	-0.035942	-	.
Adh	LMESSM	TSS	285270	285271	-0.031767	-	.
Adh	LMESSM	TSS	283950	283951	-0.051071	-	.
Adh	LMESSM	TSS	283000	283001	-0.037736	-	.
Adh	LMESSM	TSS	282470	282471	-0.039150	-	.
Adh	LMESSM	TSS	281510	281511	-0.035287	-	.
Adh	LMESSM	TSS	280510	280511	-0.039851	-	.
Adh	LMESSM	TSS	278610	278611	-0.039377	-	.
Adh	LMESSM	TSS	277980	277981	-0.030998	-	.
Adh	LMESSM	TSS	277050	277051	-0.039101	-	.
Adh	LMESSM	TSS	276270	276271	-0.034766	-	.
Adh	LMESSM	TSS	275800	275801	-0.051523	-	.
Adh	LMESSM	TSS	274360	274361	-0.039759	-	.
Adh	LMESSM	TSS	273640	273641	-0.038680	-	.
Adh	LMESSM	TSS	273010	273011	-0.043737	-	.
Adh	LMESSM	TSS	272780	272781	-0.041256	-	.
Adh	LMESSM	TSS	272140	272141	-0.031675	-	.
Adh	LMESSM	TSS	266190	266191	-0.031792	-	.
Adh	LMESSM	TSS	261420	261421	-0.039812	-	.
Adh	LMESSM	TSS	261030	261031	-0.032930	-	.
Adh	LMESSM	TSS	256460	256461	-0.032279	-	.
Adh	LMESSM	TSS	254570	254571	-0.041861	-	.
Adh	LMESSM	TSS	252870	252871	-0.050880	-	.
Adh	LMESSM	TSS	248280	248281	-0.034201	-	.
Adh	LMESSM	TSS	247570	247571	-0.032220	-	.
Adh	LMESSM	TSS	242470	242471	-0.049951	-	.
Adh	LMESSM	TSS	240230	240231	-0.034000	-	.
Adh	LMESSM	TSS	235800	235801	-0.035164	-	.
Adh	LMESSM	TSS	230370	230371	-0.043040	-	.
Adh	LMESSM	TSS	227940	227941	-0.032689	-	.
Adh	LMESSM	TSS	226960	226961	-0.041750	-	.
Adh	LMESSM	TSS	223340	223341	-0.031287	-	.
Adh	LMESSM	TSS	222840	222841	-0.034529	-	.
Adh	LMESSM	TSS	222570	222571	-0.036790	-	.
Adh	LMESSM	TSS	220810	220811	-0.038167	-	.
Adh	LMESSM	TSS	211070	211071	-0.046361	-	.
Adh	LMESSM	TSS	209070	209071	-0.039070	-	.
Adh	LMESSM	TSS	208130	208131	-0.043520	-	.
Adh	LMESSM	TSS	207970	207971	-0.039342	-	.
Adh	LMESSM	TSS	201320	201321	-0.034960	-	.
Adh	LMESSM	TSS	197830	197831	-0.031732	-	.
Adh	LMESSM	TSS	195340	195341	-0.032046	-	.
Adh	LMESSM	TSS	189110	189111	-0.035234	-	.
Adh	LMESSM	TSS	188410	188411	-0.035267	-	.
Adh	LMESSM	TSS	187220	187221	-0.036480	-	.
Adh	LMESSM	TSS	184470	184471	-0.033800	-	.
Adh	LMESSM	TSS	178270	178271	-0.051690	-	.
Adh	LMESSM	TSS	173590	173591	-0.048400	-	.
Adh	LMESSM	TSS	173180	173181	-0.030960	-	.
Adh	LMESSM	TSS	172720	172721	-0.034898	-	.
Adh	LMESSM	TSS	168450	168451	-0.042530	-	.
Adh	LMESSM	TSS	166060	166061	-0.037630	-	.
Adh	LMESSM	TSS	164260	164261	-0.031566	-	.
Adh	LMESSM	TSS	163040	163041	-0.040208	-	.
Adh	LMESSM	TSS	162490	162491	-0.038779	-	.
Adh	LMESSM	TSS	162020	162021	-0.037871	-	.
Adh	LMESSM	TSS	159780	159781	-0.050834	-	.
Adh	LMESSM	TSS	159150	159151	-0.049800	-	.
Adh	LMESSM	TSS	157590	157591	-0.046820	-	.
Adh	LMESSM	TSS	156690	156691	-0.036197	-	.
Adh	LMESSM	TSS	154470	154471	-0.031688	-	.
Adh	LMESSM	TSS	152770	152771	-0.037441	-	.
Adh	LMESSM	TSS	152280	152281	-0.039181	-	.
Adh	LMESSM	TSS	148540	148541	-0.044676	-	.
Adh	LMESSM	TSS	147640	147641	-0.038048	-	.
Adh	LMESSM	TSS	145420	145421	-0.033034	-	.
Adh	LMESSM	TSS	144100	144101	-0.033659	-	.
Adh	LMESSM	TSS	143720	143721	-0.040060	-	.
Adh	LMESSM	TSS	143240	143241	-0.043070	-	.
Adh	LMESSM	TSS	137520	137521	-0.031420	-	.
Adh	LMESSM	TSS	135950	135951	-0.048791	-	.
Adh	LMESSM	TSS	130280	130281	-0.032755	-	.
Adh	LMESSM	TSS	127950	127951	-0.033521	-	.
Adh	LMESSM	TSS	127260	127261	-0.051686	-	.
Adh	LMESSM	TSS	126610	126611	-0.033385	-	.
Adh	LMESSM	TSS	126050	126051	-0.034212	-	.
Adh	LMESSM	TSS	124830	124831	-0.032500	-	.
Adh	LMESSM	TSS	123110	123111	-0.031450	-	.
Adh	LMESSM	TSS	121840	121841	-0.034190	-	.
Adh	LMESSM	TSS	120690	120691	-0.033611	-	.
Adh	LMESSM	TSS	115880	115881	-0.033273	-	.
Adh	LMESSM	TSS	115310	115311	-0.034327	-	.
Adh	LMESSM	TSS	112960	112961	-0.040030	-	.
Adh	LMESSM	TSS	111730	111731	-0.038301	-	.
Adh	LMESSM	TSS	110980	110981	-0.041131	-	.
Adh	LMESSM	TSS	110770	110771	-0.032727	-	.
Adh	LMESSM	TSS	105410	105411	-0.031360	-	.
Adh	LMESSM	TSS	104040	104041	-0.035376	-	.
Adh	LMESSM	TSS	100930	100931	-0.032788	-	.
Adh	LMESSM	TSS	98020	98021	-0.031760	-	.
Adh	LMESSM	TSS	78140	78141	-0.046541	-	.
Adh	LMESSM	TSS	77740	77741	-0.037979	-	.
Adh	LMESSM	TSS	77000	77001	-0.035620	-	.
Adh	LMESSM	TSS	68410	68411	-0.035578	-	.
Adh	LMESSM	TSS	66340	66341	-0.047010	-	.
Adh	LMESSM	TSS	58500	58501	-0.038021	-	.
Adh	LMESSM	TSS	57160	57161	-0.039454	-	.
Adh	LMESSM	TSS	55550	55551	-0.039260	-	.
Adh	LMESSM	TSS	54690	54691	-0.047548	-	.
Adh	LMESSM	TSS	54330	54331	-0.038290	-	.
Adh	LMESSM	TSS	52970	52971	-0.034070	-	.
Adh	LMESSM	TSS	49320	49321	-0.049577	-	.
Adh	LMESSM	TSS	42870	42871	-0.040284	-	.
Adh	LMESSM	TSS	42640	42641	-0.037641	-	.
Adh	LMESSM	TSS	40920	40921	-0.035030	-	.
Adh	LMESSM	TSS	40800	40801	-0.045869	-	.
Adh	LMESSM	TSS	37750	37751	-0.033856	-	.
Adh	LMESSM	TSS	37170	37171	-0.042201	-	.
Adh	LMESSM	TSS	35480	35481	-0.040257	-	.
Adh	LMESSM	TSS	33390	33391	-0.035260	-	.
Adh	LMESSM	TSS	32290	32291	-0.033911	-	.
Adh	LMESSM	TSS	28330	28331	-0.034440	-	.
Adh	LMESSM	TSS	21720	21721	-0.032484	-	.
Adh	LMESSM	TSS	19070	19071	-0.031641	-	.
Adh	LMESSM	TSS	15120	15121	-0.033427	-	.
Adh	LMESSM	TSS	11000	11001	-0.035750	-	.
Adh	LMESSM	TSS	10170	10171	-0.035140	-	.
Adh	LMESSM	TSS	8000	8001	-0.046495	-	.
Adh	LMESSM	TSS	7240	7241	-0.073349	-	.
Adh	LMESSM	TSS	2750	2751	-0.039366	-	.

# 
#  
# compfly: 1. replaced "Genie" with "GenieProm" Oct 20 (MR)  
# 
Adh	GenieProm	TSS	4934	4935	34.709000	-	0	transcript "1"
Adh	GenieProm	TSS	8378	8379	68.857000	-	0	transcript "2"
Adh	GenieProm	TSS	20276	20277	15.063000	+	0	transcript "3"
Adh	GenieProm	TSS	30948	30949	51.378000	-	0	transcript "4"
Adh	GenieProm	TSS	33568	33569	24.067000	+	0	transcript "5"
Adh	GenieProm	TSS	36235	36236	-0.398790	-	0	transcript "6"
Adh	GenieProm	TSS	36461	36462	2.879000	+	0	transcript "7"
Adh	GenieProm	TSS	91966	91967	33.282000	-	0	transcript "8"
Adh	GenieProm	TSS	95186	95187	16.040000	-	0	transcript "9"
Adh	GenieProm	TSS	103570	103571	0.632230	+	0	transcript "56"
Adh	GenieProm	TSS	116955	116956	4.874800	+	0	transcript "10"
Adh	GenieProm	TSS	123803	123804	29.772000	+	0	transcript "11"
Adh	GenieProm	TSS	126750	126751	4.683800	+	0	transcript "12"
Adh	GenieProm	TSS	130476	130477	17.635000	+	0	transcript "13"
Adh	GenieProm	TSS	135638	135639	18.227000	-	0	transcript "14"
Adh	GenieProm	TSS	159418	159419	7.005300	+	0	transcript "15"
Adh	GenieProm	TSS	163956	163957	0.491410	+	0	transcript "16"
Adh	GenieProm	TSS	185294	185295	27.251000	-	0	transcript "17"
Adh	GenieProm	TSS	200787	200788	28.685000	+	0	transcript "57"
Adh	GenieProm	TSS	217997	217998	23.637000	-	0	transcript "18"
Adh	GenieProm	TSS	229430	229431	28.417000	+	0	transcript "19"
Adh	GenieProm	TSS	264827	264828	12.703000	+	0	transcript "20"
Adh	GenieProm	TSS	267384	267385	6.460000	+	0	transcript "21"
Adh	GenieProm	TSS	271653	271654	56.772000	-	0	transcript "22"
Adh	GenieProm	TSS	274579	274580	1.496100	+	0	transcript "23"
Adh	GenieProm	TSS	277204	277205	1.132200	-	0	transcript "24"
Adh	GenieProm	TSS	277285	277286	30.581000	+	0	transcript "25"
Adh	GenieProm	TSS	284550	284551	10.637000	+	0	transcript "26"
Adh	GenieProm	TSS	287471	287472	8.130200	+	0	transcript "27"
Adh	GenieProm	TSS	302353	302354	8.474100	+	0	transcript "58"
Adh	GenieProm	TSS	305240	305241	3.469600	-	0	transcript "59"
Adh	GenieProm	TSS	307566	307567	45.530000	-	0	transcript "61"
Adh	GenieProm	TSS	307724	307725	3.811800	+	0	transcript "62"
Adh	GenieProm	TSS	315048	315049	4.361500	+	0	transcript "28"
Adh	GenieProm	TSS	321915	321916	36.976000	-	0	transcript "29"
Adh	GenieProm	TSS	323656	323657	13.672000	-	0	transcript "30"
Adh	GenieProm	TSS	323738	323739	2.856800	+	0	transcript "31"
Adh	GenieProm	TSS	326876	326877	16.131000	+	0	transcript "33"
Adh	GenieProm	TSS	328903	328904	2.067500	-	0	transcript "34"
Adh	GenieProm	TSS	328952	328953	27.966000	+	0	transcript "35"
Adh	GenieProm	TSS	336528	336529	27.406000	-	0	transcript "36"
Adh	GenieProm	TSS	339321	339322	1.399700	-	0	transcript "37"
Adh	GenieProm	TSS	339344	339345	10.536000	+	0	transcript "38"
Adh	GenieProm	TSS	341649	341650	0.241470	+	0	transcript "39"
Adh	GenieProm	TSS	373168	373169	14.661000	+	0	transcript "40"
Adh	GenieProm	TSS	384184	384185	19.153000	+	0	transcript "41"
Adh	GenieProm	TSS	387901	387902	40.542000	+	0	transcript "42"
Adh	GenieProm	TSS	399188	399189	26.791000	+	0	transcript "63"
Adh	GenieProm	TSS	405645	405646	11.036000	+	0	transcript "64"
Adh	GenieProm	TSS	408512	408513	8.337900	+	0	transcript "65"
Adh	GenieProm	TSS	418496	418497	52.605000	-	0	transcript "44"
Adh	GenieProm	TSS	428914	428915	37.236000	-	0	transcript "45"
Adh	GenieProm	TSS	442176	442177	39.467000	-	0	transcript "46"
Adh	GenieProm	TSS	447706	447707	20.436000	+	0	transcript "47"
Adh	GenieProm	TSS	450150	450151	28.253000	+	0	transcript "48"
Adh	GenieProm	TSS	453924	453925	13.355000	+	0	transcript "49"
Adh	GenieProm	TSS	464025	464026	13.209000	-	0	transcript "50"
Adh	GenieProm	TSS	464185	464186	4.424600	+	0	transcript "51"
Adh	GenieProm	TSS	470124	470125	-1.155800	-	0	transcript "52"
Adh	GenieProm	TSS	470319	470320	13.445000	+	0	transcript "53"
Adh	GenieProm	TSS	481820	481821	32.102000	-	0	transcript "54"
Adh	GenieProm	TSS	488675	488676	39.983000	-	0	transcript "55"
Adh	GenieProm	TSS	508376	508377	10.343000	+	0	transcript "66"
Adh	GenieProm	TSS	515222	515223	21.566000	-	0	transcript "67"
Adh	GenieProm	TSS	520637	520638	6.709300	+	0	transcript "68"
Adh	GenieProm	TSS	541018	541019	16.110000	+	0	transcript "69"
Adh	GenieProm	TSS	555309	555310	7.966500	+	0	transcript "70"
Adh	GenieProm	TSS	569810	569811	21.777000	+	0	transcript "71"
Adh	GenieProm	TSS	580422	580423	32.816000	+	0	transcript "72"
Adh	GenieProm	TSS	597210	597211	26.663000	+	0	transcript "97"
Adh	GenieProm	TSS	604474	604475	9.807700	-	0	transcript "98"
Adh	GenieProm	TSS	649600	649601	5.313600	+	0	transcript "73"
Adh	GenieProm	TSS	663004	663005	5.762900	-	0	transcript "74"
Adh	GenieProm	TSS	682435	682436	24.510000	-	0	transcript "75"
Adh	GenieProm	TSS	692413	692414	21.588000	-	0	transcript "76"
Adh	GenieProm	TSS	753383	753384	29.223000	+	0	transcript "77"
Adh	GenieProm	TSS	757301	757302	9.493000	+	0	transcript "78"
Adh	GenieProm	TSS	770643	770644	16.432000	+	0	transcript "79"
Adh	GenieProm	TSS	778942	778943	21.525000	+	0	transcript "80"
Adh	GenieProm	TSS	801813	801814	5.888000	+	0	transcript "99"
Adh	GenieProm	TSS	811793	811794	44.293000	+	0	transcript "81"
Adh	GenieProm	TSS	821851	821852	13.995000	+	0	transcript "82"
Adh	GenieProm	TSS	832056	832057	3.893200	+	0	transcript "83"
Adh	GenieProm	TSS	834073	834074	28.422000	+	0	transcript "84"
Adh	GenieProm	TSS	845259	845260	36.959000	-	0	transcript "85"
Adh	GenieProm	TSS	850008	850009	47.931000	-	0	transcript "86"
Adh	GenieProm	TSS	850101	850102	13.968000	+	0	transcript "87"
Adh	GenieProm	TSS	852417	852418	20.411000	+	0	transcript "88"
Adh	GenieProm	TSS	855411	855412	23.993000	+	0	transcript "89"
Adh	GenieProm	TSS	872233	872234	28.351000	-	0	transcript "90"
Adh	GenieProm	TSS	876237	876238	24.371000	-	0	transcript "91"
Adh	GenieProm	TSS	889196	889197	18.289000	-	0	transcript "92"
Adh	GenieProm	TSS	912109	912110	23.797000	-	0	transcript "93"
Adh	GenieProm	TSS	920016	920017	16.941000	-	0	transcript "94"
Adh	GenieProm	TSS	945458	945459	6.911000	-	0	transcript "95"
Adh	GenieProm	TSS	983725	983726	77.908000	+	0	transcript "96"
Adh	GenieProm	TSS	1044160	1044161	20.222000	-	0	transcript "100"
Adh	GenieProm	TSS	1100411	1100412	10.262000	-	0	transcript "101"
Adh	GenieProm	TSS	1106374	1106375	23.427000	-	0	transcript "125"
Adh	GenieProm	TSS	1110056	1110057	6.592300	+	0	transcript "102"
Adh	GenieProm	TSS	1111271	1111272	3.229600	+	0	transcript "103"
Adh	GenieProm	TSS	1115278	1115279	19.706000	+	0	transcript "104"
Adh	GenieProm	TSS	1117348	1117349	6.219400	+	0	transcript "105"
Adh	GenieProm	TSS	1205938	1205939	12.237000	+	0	transcript "126"
Adh	GenieProm	TSS	1223845	1223846	3.204900	-	0	transcript "106"
Adh	GenieProm	TSS	1229366	1229367	6.174700	+	0	transcript "107"
Adh	GenieProm	TSS	1232828	1232829	1.797500	-	0	transcript "108"
Adh	GenieProm	TSS	1232969	1232970	6.944100	+	0	transcript "109"
Adh	GenieProm	TSS	1249559	1249560	25.927000	+	0	transcript "110"
Adh	GenieProm	TSS	1252307	1252308	2.999400	+	0	transcript "111"
Adh	GenieProm	TSS	1255422	1255423	7.418400	+	0	transcript "112"
Adh	GenieProm	TSS	1273724	1273725	17.133000	-	0	transcript "113"
Adh	GenieProm	TSS	1340190	1340191	11.730000	-	0	transcript "114"
Adh	GenieProm	TSS	1366994	1366995	4.410800	-	0	transcript "115"
Adh	GenieProm	TSS	1400892	1400893	50.951000	-	0	transcript "127"
Adh	GenieProm	TSS	1405199	1405200	41.931000	-	0	transcript "128"
Adh	GenieProm	TSS	1414978	1414979	-2.372200	+	0	transcript "116"
Adh	GenieProm	TSS	1427736	1427737	26.198000	-	0	transcript "117"
Adh	GenieProm	TSS	1468916	1468917	48.067000	-	0	transcript "118"
Adh	GenieProm	TSS	1475307	1475308	13.846000	+	0	transcript "119"
Adh	GenieProm	TSS	1480001	1480002	32.544000	+	0	transcript "120"
Adh	GenieProm	TSS	1494933	1494934	19.070000	+	0	transcript "121"
Adh	GenieProm	TSS	1497294	1497295	19.060000	-	0	transcript "122"
Adh	GenieProm	TSS	1497338	1497339	16.891000	+	0	transcript "123"
Adh	GenieProm	TSS	1499987	1499988	17.267000	-	0	transcript "124"
Adh	GenieProm	TSS	1513791	1513792	26.417000	+	0	transcript "130"
Adh	GenieProm	TSS	1518661	1518662	9.973700	+	0	transcript "131"
Adh	GenieProm	TSS	1524899	1524900	12.785000	+	0	transcript "132"
Adh	GenieProm	TSS	1529115	1529116	14.764000	-	0	transcript "133"
Adh	GenieProm	TSS	1529283	1529284	25.549000	+	0	transcript "134"
Adh	GenieProm	TSS	1543875	1543876	30.951000	-	0	transcript "135"
Adh	GenieProm	TSS	1551577	1551578	32.957000	-	0	transcript "136"
Adh	GenieProm	TSS	1557926	1557927	29.082000	-	0	transcript "137"
Adh	GenieProm	TSS	1557994	1557995	9.698500	+	0	transcript "138"
Adh	GenieProm	TSS	1561313	1561314	10.910000	+	0	transcript "139"
Adh	GenieProm	TSS	1564153	1564154	37.705000	+	0	transcript "140"
Adh	GenieProm	TSS	1575093	1575094	27.850000	+	0	transcript "141"
Adh	GenieProm	TSS	1579692	1579693	20.757000	+	0	transcript "142"
Adh	GenieProm	TSS	1598839	1598840	-9.071000	+	0	transcript "168"
Adh	GenieProm	TSS	1658604	1658605	31.102000	-	0	transcript "143"
Adh	GenieProm	TSS	1669416	1669417	35.764000	-	0	transcript "144"
Adh	GenieProm	TSS	1721477	1721478	61.011000	-	0	transcript "145"
Adh	GenieProm	TSS	1727763	1727764	55.901000	-	0	transcript "146"
Adh	GenieProm	TSS	1727796	1727797	26.604000	+	0	transcript "147"
Adh	GenieProm	TSS	1738227	1738228	12.880000	+	0	transcript "148"
Adh	GenieProm	TSS	1746000	1746001	3.456400	-	0	transcript "149"
Adh	GenieProm	TSS	1746014	1746015	18.025000	+	0	transcript "150"
Adh	GenieProm	TSS	1750597	1750598	37.234000	-	0	transcript "151"
Adh	GenieProm	TSS	1754914	1754915	38.525000	-	0	transcript "152"
Adh	GenieProm	TSS	1761032	1761033	27.531000	-	0	transcript "153"
Adh	GenieProm	TSS	1765971	1765972	46.652000	-	0	transcript "154"
Adh	GenieProm	TSS	1774706	1774707	3.405800	+	0	transcript "155"
Adh	GenieProm	TSS	1783275	1783276	13.272000	-	0	transcript "156"
Adh	GenieProm	TSS	1786407	1786408	32.563000	+	0	transcript "157"
Adh	GenieProm	TSS	1809911	1809912	16.804000	-	0	transcript "169"
Adh	GenieProm	TSS	1822287	1822288	28.991000	+	0	transcript "158"
Adh	GenieProm	TSS	1852701	1852702	33.704000	-	0	transcript "159"
Adh	GenieProm	TSS	1880240	1880241	14.297000	+	0	transcript "160"
Adh	GenieProm	TSS	1916481	1916482	13.844000	-	0	transcript "161"
Adh	GenieProm	TSS	1922877	1922878	16.234000	+	0	transcript "162"
Adh	GenieProm	TSS	1936035	1936036	14.682000	+	0	transcript "163"
Adh	GenieProm	TSS	1967859	1967860	1.402300	-	0	transcript "164"
Adh	GenieProm	TSS	1973044	1973045	18.634000	+	0	transcript "165"
Adh	GenieProm	TSS	1988829	1988830	3.921800	+	0	transcript "166"
Adh	GenieProm	TSS	1991221	1991222	6.493100	+	0	transcript "167"
Adh	GenieProm	TSS	2038893	2038894	27.592000	+	0	transcript "170"
Adh	GenieProm	TSS	2067394	2067395	39.677000	+	0	transcript "171"
Adh	GenieProm	TSS	2070959	2070960	5.430000	+	0	transcript "172"
Adh	GenieProm	TSS	2102833	2102834	-1.601900	-	0	transcript "188"
Adh	GenieProm	TSS	2105116	2105117	-6.924900	-	0	transcript "189"
Adh	GenieProm	TSS	2108137	2108138	8.287500	-	0	transcript "190"
Adh	GenieProm	TSS	2118310	2118311	2.209100	+	0	transcript "173"
Adh	GenieProm	TSS	2119472	2119473	7.914900	+	0	transcript "174"
Adh	GenieProm	TSS	2143955	2143956	35.952000	-	0	transcript "175"
Adh	GenieProm	TSS	2148631	2148632	16.641000	+	0	transcript "176"
Adh	GenieProm	TSS	2184025	2184026	31.672000	-	0	transcript "177"
Adh	GenieProm	TSS	2203827	2203828	28.182000	-	0	transcript "191"
Adh	GenieProm	TSS	2203986	2203987	7.153600	+	0	transcript "192"
Adh	GenieProm	TSS	2213473	2213474	17.918000	-	0	transcript "193"
Adh	GenieProm	TSS	2215219	2215220	24.898000	+	0	transcript "194"
Adh	GenieProm	TSS	2220554	2220555	21.750000	-	0	transcript "195"
Adh	GenieProm	TSS	2225632	2225633	36.067000	-	0	transcript "197"
Adh	GenieProm	TSS	2302104	2302105	45.181000	+	0	transcript "198"
Adh	GenieProm	TSS	2304887	2304888	3.546000	+	0	transcript "199"
Adh	GenieProm	TSS	2331517	2331518	10.835000	-	0	transcript "178"
Adh	GenieProm	TSS	2345125	2345126	25.283000	-	0	transcript "179"
Adh	GenieProm	TSS	2354512	2354513	47.222000	-	0	transcript "180"
Adh	GenieProm	TSS	2360612	2360613	45.370000	-	0	transcript "181"
Adh	GenieProm	TSS	2373026	2373027	22.702000	+	0	transcript "182"
Adh	GenieProm	TSS	2390741	2390742	34.346000	+	0	transcript "183"
Adh	GenieProm	TSS	2427880	2427881	44.617000	+	0	transcript "184"
Adh	GenieProm	TSS	2481660	2481661	4.812800	+	0	transcript "185"
Adh	GenieProm	TSS	2485195	2485196	17.574000	+	0	transcript "186"
Adh	GenieProm	TSS	2492395	2492396	19.231000	+	0	transcript "187"
Adh	GenieProm	TSS	2527672	2527673	24.649000	+	0	transcript "200"
Adh	GenieProm	TSS	2543870	2543871	7.974200	+	0	transcript "201"
Adh	GenieProm	TSS	2579868	2579869	43.816000	+	0	transcript "202"
Adh	GenieProm	TSS	2582556	2582557	4.219900	+	0	transcript "203"
Adh	GenieProm	TSS	2618562	2618563	22.298000	+	0	transcript "204"
Adh	GenieProm	TSS	2631271	2631272	12.459000	+	0	transcript "205"
Adh	GenieProm	TSS	2637264	2637265	9.371400	+	0	transcript "206"
Adh	GenieProm	TSS	2660345	2660346	16.884000	+	0	transcript "207"
Adh	GenieProm	TSS	2683407	2683408	10.105000	+	0	transcript "208"
Adh	GenieProm	TSS	2699088	2699089	11.138000	-	0	transcript "209"
Adh	GenieProm	TSS	2706378	2706379	32.297000	+	0	transcript "234"
Adh	GenieProm	TSS	2710989	2710990	6.868700	-	0	transcript "235"
Adh	GenieProm	TSS	2711248	2711249	11.118000	+	0	transcript "236"
Adh	GenieProm	TSS	2717994	2717995	59.204000	-	0	transcript "210"
Adh	GenieProm	TSS	2729939	2729940	33.498000	-	0	transcript "211"
Adh	GenieProm	TSS	2736361	2736362	53.231000	+	0	transcript "212"
Adh	GenieProm	TSS	2743177	2743178	23.169000	-	0	transcript "214"
Adh	GenieProm	TSS	2743504	2743505	12.660000	+	0	transcript "215"
Adh	GenieProm	TSS	2748884	2748885	8.298900	-	0	transcript "216"
Adh	GenieProm	TSS	2748892	2748893	26.486000	+	0	transcript "217"
Adh	GenieProm	TSS	2752940	2752941	30.300000	-	0	transcript "218"
Adh	GenieProm	TSS	2756294	2756295	33.594000	+	0	transcript "220"
Adh	GenieProm	TSS	2759882	2759883	0.864600	-	0	transcript "221"
Adh	GenieProm	TSS	2760043	2760044	18.408000	+	0	transcript "222"
Adh	GenieProm	TSS	2765478	2765479	56.637000	-	0	transcript "223"
Adh	GenieProm	TSS	2775768	2775769	40.918000	-	0	transcript "224"
Adh	GenieProm	TSS	2776358	2776359	9.057300	+	0	transcript "225"
Adh	GenieProm	TSS	2779211	2779212	5.559400	-	0	transcript "226"
Adh	GenieProm	TSS	2779238	2779239	3.267200	+	0	transcript "227"
Adh	GenieProm	TSS	2793600	2793601	16.669000	-	0	transcript "228"
Adh	GenieProm	TSS	2800115	2800116	45.862000	-	0	transcript "229"
Adh	GenieProm	TSS	2802067	2802068	9.186200	+	0	transcript "237"
Adh	GenieProm	TSS	2807141	2807142	16.598000	-	0	transcript "238"
Adh	GenieProm	TSS	2814637	2814638	15.431000	+	0	transcript "230"
Adh	GenieProm	TSS	2842487	2842488	25.981000	+	0	transcript "231"
Adh	GenieProm	TSS	2855861	2855862	27.574000	-	0	transcript "232"
Adh	GenieProm	TSS	2894419	2894420	6.197600	+	0	transcript "239"
Adh	GenieProm	TSS	2897728	2897729	28.830000	+	0	transcript "240"
Adh	GenieProm	TSS	2900078	2900079	10.214000	+	0	transcript "241"
Adh	GenieProm	TSS	2918934	2918935	1.581000	-	0	transcript "233"
